Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
17-73937587-AT-A c.*5241delA splice_region ACOX1 2 1902 0.00105152 951 0 NA
17-73938957-C-T p.Asp142Asn missense ACOX1 1414 3806 0.371519 1903 281 0.576087
17-73939297-C-CA c.*42-4dupT splice_region ACOX1 2 112 0.0178571 56 0 0.0863979
17-73939297-C-CAA c.*42-5_*42-4dupTT splice_region ACOX1 3 112 0.0267857 56 0 0.192067
17-73939297-C-CAAA c.*42-6_*42-4dupTTT splice_region ACOX1 1 112 0.00892857 56 0 0.00235738
17-73939297-C-CAAAAAAAA c.*42-11_*42-4dupTTTTTTTT splice_region ACOX1 2 112 0.0178571 56 1 NA
17-73939484-G-T n.166+8C>A splice_region ACOX1 1 2906 3.44116E-4 1453 0 0.00111607
17-73942787-C-T c.*41+1G>A splice_donor ACOX1 1 83040 1.20424E-5 41520 0 8.36946E-6
17-73942844-C-T p.Leu656Leu synonymous ACOX1 1 83362 1.19959E-5 41681 0 1.19334E-5
17-73942845-A-G p.Leu656Pro missense ACOX1 1 83364 1.19956E-5 41682 0 NA
17-73942850-C-G p.Lys654Asn missense ACOX1 2 83368 2.399E-5 41684 0 NA
17-73942876-C-T p.Val646Ile missense+splice_region ACOX1 1 83370 1.19947E-5 41685 0 NA
17-73942884-G-A c.1936-8C>T splice_region ACOX1 2 83346 2.39964E-5 41673 0 8.36806E-6
17-73944323-GATTTTT-G c.1935+3_1935+8delAAAAAT splice_region ACOX1 2 83060 2.4079E-5 41530 0 NA
17-73944342-T-C p.Asn642Ser missense ACOX1 1 83236 1.2014E-5 41618 0 NA
17-73944359-A-G p.Ala636Ala synonymous ACOX1 2 83318 2.40044E-5 41659 0 NA
17-73944362-CCACTCAAA-C p.Phe633fs frameshift ACOX1 1 83320 1.20019E-5 41660 0 NA
17-73944392-A-G p.Asp625Asp synonymous ACOX1 4 83354 4.79881E-5 41677 0 3.18613E-5
17-73944399-C-T p.Arg623His missense ACOX1 2 83358 2.39929E-5 41679 0 1.64734E-5
17-73944401-G-A p.Gly622Gly synonymous ACOX1 1 83360 1.19962E-5 41680 0 NA
17-73944409-C-A p.Val620Leu missense ACOX1 4 83370 4.79789E-5 41685 0 3.18492E-5
17-73944429-T-C p.Gln613Arg missense ACOX1 1 83376 1.19939E-5 41688 0 NA
17-73944446-A-G p.Val607Val synonymous ACOX1 1 83372 1.19944E-5 41686 0 8.23642E-6
17-73944458-A-G p.Ala603Ala synonymous ACOX1 1 83374 1.19941E-5 41687 0 NA
17-73944458-A-T p.Ala603Ala synonymous ACOX1 2 83374 2.39883E-5 41687 0 1.64731E-5
17-73944468-C-T p.Arg600His missense ACOX1 1 83370 1.19947E-5 41685 0 3.18695E-5
17-73944469-G-A p.Arg600Cys missense ACOX1 2 83366 2.39906E-5 41683 0 3.18695E-5
17-73944473-C-A p.Leu598Leu synonymous ACOX1 263 83356 0.00315514 41678 3 0.00487603
17-73944477-G-A p.Thr597Ile missense ACOX1 13 83354 1.55961E-4 41677 0 5.76559E-5
17-73944495-C-T p.Arg591His missense ACOX1 2 83336 2.39992E-5 41668 0 4.94201E-5
17-73944496-G-A p.Arg591Cys missense ACOX1 480 83320 0.00576092 41660 7 0.0151515
17-73944511-T-C p.Thr586Ala missense ACOX1 6 83294 7.2034E-5 41647 0 1.81213E-4
17-73944515-C-A p.Gln584His missense ACOX1 2 83276 2.40165E-5 41638 0 8.2371E-6
17-73944535-T-G p.Ser578Arg missense ACOX1 2 83188 2.40419E-5 41594 0 1.19355E-5
17-73945292-A-C c.1728+6T>G splice_region ACOX1 1 83300 1.20048E-5 41650 0 8.28967E-6
17-73945313-C-T p.Ala571Ala synonymous ACOX1 4 83364 4.79823E-5 41682 0 9.55231E-5
17-73945314-G-A p.Ala571Val missense ACOX1 1 83360 1.19962E-5 41680 0 6.25E-4
17-73945315-C-T p.Ala571Thr missense ACOX1 6 83360 7.1977E-5 41680 0 1.19305E-5
17-73945315-C-A p.Ala571Ser missense ACOX1 7 83360 8.39731E-5 41680 0 9.55171E-5
17-73945330-C-T p.Gly566Arg missense ACOX1 1 83370 1.19947E-5 41685 0 NA
17-73945331-A-G p.Tyr565Tyr synonymous ACOX1 2 83372 2.39889E-5 41686 0 3.1835E-4
17-73945340-A-G p.Tyr562Tyr synonymous ACOX1 1 83382 1.1993E-5 41691 0 NA
17-73945348-G-T p.Leu560Met missense ACOX1 1 83386 1.19924E-5 41693 0 NA
17-73945357-T-A p.Ser557Cys missense ACOX1 1 83386 1.19924E-5 41693 0 NA
17-73945358-C-G p.Arg556Ser missense ACOX1 5 83382 5.9965E-5 41691 0 3.18117E-5
17-73945366-C-G p.Val554Leu missense ACOX1 1 83380 1.19933E-5 41690 0 NA
17-73945369-C-T p.Ala553Thr missense ACOX1 3 83378 3.59807E-5 41689 0 9.5511E-5
17-73945394-G-A p.Leu544Leu synonymous ACOX1 1 83378 1.19936E-5 41689 0 3.97735E-6
17-73945407-GAA-G p.Ser540fs frameshift ACOX1 1 83368 1.1995E-5 41684 0 NA
17-73945423-C-T p.Val535Ile missense ACOX1 8 83360 9.59693E-5 41680 0 8.24402E-5
17-73945426-C-T p.Val534Met missense ACOX1 1 83356 1.19967E-5 41678 0 NA
17-73945428-T-G p.Tyr533Ser missense ACOX1 1 83360 1.19962E-5 41680 0 NA
17-73945431-T-C p.His532Arg missense ACOX1 1 83356 1.19967E-5 41678 0 8.24443E-6
17-73945586-C-T p.Arg525Gln missense ACOX1 2 83416 2.39762E-5 41708 0 8.2371E-6
17-73945595-T-C p.Asp522Gly missense ACOX1 2 83416 2.39762E-5 41708 0 5.96497E-5
17-73945604-G-T p.Thr519Asn missense ACOX1 1 83414 1.19884E-5 41707 0 NA
17-73945628-C-A p.Ser511Ile missense ACOX1 9 83424 1.07883E-4 41712 0 1.31789E-4
17-73945633-T-TCTCA p.Arg509fs frameshift ACOX1 1 83416 1.19881E-5 41708 0 3.97659E-6
17-73945640-A-G p.Ile507Thr missense ACOX1 241 83408 0.00288941 41704 3 0.00653199
17-73945681-TCTGTTAAGACATAGATTGGAGGTCTGAGGAAATGATCAACAGTACTCATGCCTTCTTGCCATCTGTCAGGGCCCCAGCCCCACTGCTGCGTATTCTAGCTCTTGAGGGAGAGCTCAC-T c.1478+1_1479-1del splice_acceptor ACOX1 10 83384 1.19927E-4 41692 5 NA
17-73945688-A-G c.1479-7T>C splice_region ACOX1 1 83366 1.19953E-5 41683 0 3.1835E-5
17-73945794-C-A c.1478+5G>T splice_region ACOX1 5 83294 6.00283E-5 41647 0 3.97671E-6
17-73945808-C-T p.Arg490His missense ACOX1 5 83314 6.00139E-5 41657 0 5.03525E-4
17-73945809-G-C p.Arg490Gly missense ACOX1 11 83320 1.32021E-4 41660 0 2.22973E-4
17-73945819-T-C p.Ala486Ala synonymous ACOX1 2 83338 2.39987E-5 41669 0 5.09619E-4
17-73945824-C-T p.Glu485Lys missense ACOX1 1 83346 1.19982E-5 41673 0 2.38591E-5
17-73945825-G-A p.Thr484Thr synonymous ACOX1 4 83348 4.79916E-5 41674 0 5.03525E-4
17-73945836-C-T p.Glu481Lys missense ACOX1 1 83346 1.19982E-5 41673 0 3.18715E-5
17-73945839-G-A p.Pro480Ser missense ACOX1 1 83352 1.19973E-5 41676 0 NA
17-73945840-G-A p.Ser479Ser synonymous ACOX1 2 83356 2.39935E-5 41678 0 3.18654E-5
17-73945857-T-C p.Met474Val missense ACOX1 1 83338 1.19993E-5 41669 0 1.64731E-5
17-73945859-G-A p.Thr473Ile missense ACOX1 38 83338 4.55974E-4 41669 0 1.67017E-4
17-73945867-G-T p.Val470Val synonymous ACOX1 1 83334 1.19999E-5 41667 0 NA
17-73945875-C-T p.Val468Ile missense ACOX1 1 83320 1.20019E-5 41660 0 NA
17-73945882-T-C p.Pro465Pro synonymous ACOX1 2 83312 2.40061E-5 41656 0 3.18492E-5
17-73945892-C-T p.Arg462His missense ACOX1 13 83292 1.56077E-4 41646 0 1.15329E-4
17-73945893-G-A p.Arg462Cys missense ACOX1 3 83300 3.60144E-5 41650 0 5.76644E-5
17-73945906-G-C p.Asp457Glu missense ACOX1 1 83296 1.20054E-5 41648 0 NA
17-73945908-C-G p.Asp457His missense ACOX1 1 83284 1.20071E-5 41642 0 8.2375E-6
17-73945909-G-A p.Asn456Asn synonymous ACOX1 91 83270 0.00109283 41635 1 0.00305674
17-73945921-C-T p.Val452Val synonymous ACOX1 1 83272 1.20088E-5 41636 0 8.23818E-6
17-73945925-A-G p.Met451Thr missense ACOX1 1 83262 1.20103E-5 41631 0 3.97728E-6
17-73945933-C-T p.Val448Val synonymous ACOX1 47 83272 5.64415E-4 41636 2 6.25E-4
17-73945942-T-A p.Gly445Gly synonymous ACOX1 2 83256 2.40223E-5 41628 0 1.64796E-5
17-73945943-C-T p.Gly445Glu missense ACOX1 1 83256 1.20111E-5 41628 0 NA
17-73945946-G-A p.Ser444Leu missense ACOX1 2 83250 2.4024E-5 41625 0 3.97738E-6
17-73945957-A-G p.Asp440Asp synonymous ACOX1 2833 82988 0.0341375 41494 155 0.0629342
17-73945962-A-G p.Tyr439His missense ACOX1 2 83182 2.40437E-5 41591 0 8.24429E-6
17-73945964-CT-C p.Ser438fs frameshift ACOX1 3 83168 3.60716E-5 41584 0 0.00100705
17-73945966-T-G p.Lys437Asn missense ACOX1 1 83154 1.20259E-5 41577 0 NA
17-73945972-C-T p.Leu435Leu synonymous ACOX1 1 83112 1.2032E-5 41556 0 NA
17-73945975-G-A p.Phe434Phe synonymous ACOX1 128 83060 0.00154105 41530 0 0.0037273
17-73945985-G-C c.1299-7C>G splice_region ACOX1 1 82902 1.20624E-5 41451 0 3.18552E-5
17-73946848-C-T c.1298+7G>A splice_region ACOX1 1 83248 1.20123E-5 41624 0 NA
17-73946856-TA-T p.Arg433fs frameshift ACOX1 1 83262 1.20103E-5 41631 0 NA
17-73946861-G-A p.Thr431Met missense ACOX1 3 83232 3.60438E-5 41616 0 1.59256E-4
17-73946866-G-T p.Leu429Leu synonymous ACOX1 6 83240 7.20807E-5 41620 0 4.13986E-4
17-73946866-G-A p.Leu429Leu synonymous ACOX1 1 83240 1.20135E-5 41620 0 NA
17-73946875-G-A p.Val426Val synonymous ACOX1 3 83258 3.60326E-5 41629 0 1.03392E-4
17-73946883-T-C p.Asn424Asp missense ACOX1 2 83284 2.40142E-5 41642 0 1.64742E-5
17-73946915-T-C p.Asn413Ser missense ACOX1 4 83342 4.7995E-5 41671 0 6.25E-4
17-73946940-T-A p.Ser405Cys missense ACOX1 1 83332 1.20002E-5 41666 0 NA
17-73946944-A-T p.His403Gln missense ACOX1 1 83324 1.20013E-5 41662 0 NA
17-73946951-T-C p.Tyr401Cys missense ACOX1 1 83318 1.20022E-5 41659 0 NA
17-73946953-G-A p.Gly400Gly synonymous ACOX1 1 83318 1.20022E-5 41659 0 NA
17-73946958-G-A p.His399Tyr missense ACOX1 1 83316 1.20025E-5 41658 0 3.18552E-5
17-73946967-A-T p.Cys396Ser missense ACOX1 2 83322 2.40033E-5 41661 0 NA
17-73946975-C-T p.Arg393Gln missense ACOX1 2 83314 2.40056E-5 41657 0 8.24212E-6
17-73946977-A-G p.Cys392Cys synonymous ACOX1 1 83312 1.20031E-5 41656 0 NA
17-73946992-A-G p.Thr387Thr synonymous ACOX1 2 83276 2.40165E-5 41638 0 6.25E-4
17-73947008-G-C p.Ser382Cys missense ACOX1 1 83206 1.20184E-5 41603 0 NA
17-73947025-TC-T p.Gly376fs frameshift ACOX1 1 83070 1.2038E-5 41535 0 NA
17-73947030-C-T p.Ala375Thr missense ACOX1 1 82958 1.20543E-5 41479 0 6.37024E-5
17-73947031-G-A p.Thr374Thr synonymous ACOX1 1 82948 1.20557E-5 41474 0 1.19508E-5
17-73947032-G-C p.Thr374Ser missense ACOX1 1 82934 1.20578E-5 41467 0 3.18552E-5
17-73947033-T-C p.Thr374Ala missense ACOX1 1 82912 1.2061E-5 41456 0 1.70748E-5
17-73947050-G-T c.1108-5C>A splice_region ACOX1 1 82560 1.21124E-5 41280 0 NA
17-73947053-G-C c.1108-8C>G splice_region ACOX1 1 82466 1.21262E-5 41233 0 8.9886E-6
17-73947053-G-A c.1108-8C>T splice_region ACOX1 2 82466 2.42524E-5 41233 0 3.18492E-5
17-73947504-G-A p.Leu367Leu synonymous ACOX1 2 83360 2.39923E-5 41680 0 NA
17-73947525-C-T p.Gly360Ser missense ACOX1 1 83386 1.19924E-5 41693 0 8.23696E-6
17-73947535-G-A p.Asn356Asn synonymous ACOX1 1 83388 1.19921E-5 41694 0 0.00125
17-73947544-G-A p.His353His synonymous ACOX1 1 83386 1.19924E-5 41693 0 1.64734E-5
17-73947553-C-G p.Glu350Asp missense ACOX1 1 83382 1.1993E-5 41691 0 3.97649E-6
17-73947570-C-T p.Gly345Ser missense ACOX1 1 83386 1.19924E-5 41693 0 8.23655E-6
17-73947575-A-G p.Phe343Ser missense ACOX1 1 83384 1.19927E-5 41692 0 NA
17-73947587-T-C p.Tyr339Cys missense ACOX1 1 83364 1.19956E-5 41682 0 8.23696E-6
17-73947594-T-C p.Thr337Ala missense ACOX1 1 83362 1.19959E-5 41681 0 3.97649E-6
17-73947598-C-T p.Leu335Leu synonymous ACOX1 1 83368 1.1995E-5 41684 0 NA
17-73947617-T-C p.Tyr329Cys missense ACOX1 1 83320 1.20019E-5 41660 0 8.24008E-6
17-73947618-A-C p.Tyr329Asp missense ACOX1 3 83312 3.60092E-5 41656 0 6.36821E-5
17-73947625-G-A p.Thr326Thr synonymous ACOX1 1 83300 1.20048E-5 41650 0 3.97744E-6
17-73947634-A-AGAAGTATGTAT p.Asp323fs frameshift ACOX1 1 83218 1.20166E-5 41609 0 NA
17-73947649-T-C p.Glu318Glu synonymous ACOX1 133 83062 0.00160121 41531 0 0.00372588
17-73947658-A-AC c.945-1_945insG splice_acceptor ACOX1 1 82880 1.20656E-5 41440 0 NA
17-73947661-A-G c.945-3T>C splice_region ACOX1 2 82840 2.41429E-5 41420 0 3.18492E-5
17-73947662-C-A c.945-4G>T splice_region ACOX1 2 82806 2.41528E-5 41403 0 8.29105E-6
17-73947663-G-A c.945-5C>T splice_region ACOX1 1 82766 1.20823E-5 41383 0 6.63603E-5
17-73949525-T-C c.944+7A>G splice_region ACOX1 3 83174 3.6069E-5 41587 0 3.29554E-5
17-73949538-T-G p.Lys313Thr missense ACOX1 1 83234 1.20143E-5 41617 0 NA
17-73949540-G-C p.Ile312Met missense ACOX1 46511 80708 0.576287 40354 14021 0.652792
17-73949555-C-T p.Arg307Arg synonymous ACOX1 668 83300 0.00801921 41650 3 0.00862837
17-73949558-C-T p.Val306Val synonymous ACOX1 1 83332 1.20002E-5 41666 0 NA
17-73949563-C-T p.Ala305Thr missense ACOX1 1 83340 1.1999E-5 41670 0 3.1837E-5
17-73949564-G-A p.Ser304Ser synonymous ACOX1 4 83348 4.79916E-5 41674 0 9.55475E-5
17-73949573-G-A p.Ile301Ile synonymous ACOX1 1 83372 1.19944E-5 41686 0 7.95431E-6
17-73949588-C-T p.Ala296Ala synonymous ACOX1 1 83388 1.19921E-5 41694 0 7.9545E-6
17-73949589-G-A p.Ala296Val missense ACOX1 5 83384 5.99635E-5 41692 0 3.29473E-5
17-73949599-G-A p.Leu293Leu synonymous ACOX1 2 83400 2.39808E-5 41700 0 1.59205E-4
17-73949604-C-T p.Arg291Gln missense ACOX1 3 83400 3.59712E-5 41700 0 8.23683E-6
17-73949608-C-T p.Ala290Thr missense ACOX1 1 83406 1.19895E-5 41703 0 NA
17-73949609-A-G p.Ala289Ala synonymous ACOX1 31 83406 3.71676E-4 41703 1 0.00261931
17-73949620-C-T p.Val286Met missense ACOX1 1 83418 1.19878E-5 41709 0 9.55231E-5
17-73949636-A-G p.Phe280Phe synonymous ACOX1 5 83412 5.99434E-5 41706 0 1.64736E-4
17-73949651-G-GT p.Tyr275fs frameshift ACOX1 1 83406 1.19895E-5 41703 0 NA
17-73949651-G-A p.Tyr275Tyr synonymous ACOX1 1 83406 1.19895E-5 41703 0 3.1839E-5
17-73949672-C-T p.Pro268Pro synonymous ACOX1 57 83394 6.83502E-4 41697 0 0.00159226
17-73949680-C-T p.Val266Met missense ACOX1 1 83386 1.19924E-5 41693 0 1.59205E-4
17-73949685-G-A p.Thr264Ile missense ACOX1 3 83382 3.5979E-5 41691 0 NA
17-73949688-C-G p.Gly263Ala missense ACOX1 7 83378 8.3955E-5 41689 0 8.35076E-5
17-73951650-G-C p.Ala257Ala synonymous ACOX1 2 83268 2.40188E-5 41634 0 3.97829E-6
17-73951681-A-C p.Ile247Ser missense ACOX1 1 83328 1.20008E-5 41664 0 NA
17-73951699-T-C p.Lys241Arg missense ACOX1 27 83354 3.2392E-4 41677 0 0.00352823
17-73951701-G-A p.Leu240Leu synonymous ACOX1 1 83350 1.19976E-5 41675 0 2.47158E-5
17-73951712-T-C p.Asn237Asp missense ACOX1 1 83344 1.19985E-5 41672 0 3.97652E-6
17-73951718-T-C p.Ile235Val missense ACOX1 16 83346 1.91971E-4 41673 0 6.3678E-5
17-73951754-C-T p.Val223Ile missense ACOX1 18 83350 2.15957E-4 41675 0 5.03525E-4
17-73951766-C-T c.659-4G>A splice_region ACOX1 1 83340 1.1999E-5 41670 0 3.18451E-5
17-73951905-T-C c.658+4A>G splice_region ACOX1 1 83288 1.20065E-5 41644 0 NA
17-73951913-C-T p.Leu218Leu synonymous ACOX1 1 83296 1.20054E-5 41648 0 3.97671E-6
17-73951916-A-T p.Pro217Pro synonymous ACOX1 2 83308 2.40073E-5 41654 0 NA
17-73951931-G-A p.Ile212Ile synonymous ACOX1 3 83310 3.60101E-5 41655 0 3.18431E-5
17-73951938-C-T p.Arg210His missense ACOX1 1 83306 1.20039E-5 41653 0 8.23655E-6
17-73951939-G-A p.Arg210Cys missense ACOX1 16 83304 1.92068E-4 41652 0 5.76559E-5
17-73951948-C-T p.Val207Ile missense ACOX1 1 83304 1.20042E-5 41652 0 1.19304E-5
17-73951949-G-A p.Ile206Ile synonymous ACOX1 9 83306 1.08035E-4 41653 0 1.98842E-5
17-73951951-T-C p.Ile206Val missense ACOX1 4 83314 4.80111E-5 41657 0 4.94193E-5
17-73951976-C-T p.Gly197Gly synonymous ACOX1 831 83312 0.00997455 41656 18 0.0171975
17-73951990-G-C p.Leu193Val missense ACOX1 1 83310 1.20034E-5 41655 0 NA
17-73951993-G-T p.Gln192Lys missense ACOX1 45 83310 5.40151E-4 41655 0 2.74404E-4
17-73952005-T-C p.Ile188Val missense ACOX1 1 83300 1.20048E-5 41650 0 NA
17-73952016-G-A p.Ser184Leu missense ACOX1 2 83254 2.40229E-5 41627 0 8.23696E-6
17-73952031-G-C c.539-3C>G splice_region ACOX1 1 83202 1.20189E-5 41601 0 NA
17-73953494-T-C n.594+8A>G splice_region ACOX1 1 83124 1.20302E-5 41562 0 NA
17-73953540-G-A p.Leu180Phe missense+splice_region ACOX1 1 83348 1.19979E-5 41674 0 NA
17-73953549-G-C p.Pro177Ala missense ACOX1 2 83368 2.399E-5 41684 0 1.64745E-5
17-73953581-T-C p.Asn166Ser missense ACOX1 49 83374 5.87713E-4 41687 0 0.00133758
17-73953589-G-T p.Ser217* stop_gained ACOX1 1 83374 1.19941E-5 41687 0 8.23737E-6
17-73953607-G-A p.Thr211Ile missense ACOX1 1 83360 1.19962E-5 41680 0 3.9764E-6
17-73953613-C-T p.Arg209His missense ACOX1 8 83362 9.5967E-5 41681 0 2.22944E-4
17-73953614-G-A p.Thr155Met missense ACOX1 1 83360 1.19962E-5 41680 0 1.64794E-5
17-73953620-G-A p.Gln207* stop_gained ACOX1 21 83348 2.51956E-4 41674 0 5.03525E-4
17-73953648-C-CGTGGCCCATTTCCGTCTGGGCGTAGGTGCCAA c.431-2_431-1insTTGGCACCTACGCCCAGACGGAAATGGGCCAC splice_acceptor ACOX1 1 83300 1.20048E-5 41650 0 NA
17-73956297-A-G p.Met197Thr missense+splice_region ACOX1 1 82580 1.21095E-5 41290 0 NA
17-73956321-A-G p.Leu189Pro missense ACOX1 8 83010 9.63739E-5 41505 0 6.37105E-5
17-73956361-C-T p.Arg122His missense ACOX1 2 83202 2.40379E-5 41601 0 3.18471E-5
17-73956362-G-A p.Arg122Cys missense ACOX1 5 83198 6.00976E-5 41599 0 9.55597E-5
17-73956363-C-T p.Ser175Asn missense ACOX1 1 83194 1.20201E-5 41597 0 1.65022E-5
17-73956365-C-T p.Glu121Lys missense ACOX1 1 83186 1.20213E-5 41593 0 8.25042E-6
17-73956372-C-T p.Ser172Asn missense ACOX1 1 83142 1.20276E-5 41571 0 7.42783E-5
17-73956375-C-T p.Arg171Gln missense ACOX1 2 83152 2.40523E-5 41576 0 3.30196E-5
17-73956377-C-T p.Ala117Thr missense ACOX1 1 83150 1.20265E-5 41575 0 3.97833E-6
17-73956382-G-C p.Ala115Gly missense ACOX1 1 83152 1.20262E-5 41576 0 NA
17-73956387-G-A p.Thr167Ile missense ACOX1 8 83158 9.62024E-5 41579 0 2.86588E-4
17-73956397-G-A p.Thr110Ile missense ACOX1 1 83148 1.20267E-5 41574 0 NA
17-73956399-G-T p.Pro163Gln missense ACOX1 1 83150 1.20265E-5 41575 0 NA
17-73956432-C-T p.Ser152Asn missense ACOX1 1 83170 1.20236E-5 41585 0 NA
17-73956434-C-G p.Glu98Gln missense ACOX1 1 83184 1.20215E-5 41592 0 NA
17-73956439-C-T p.Arg96Gln missense ACOX1 3 83178 3.60672E-5 41589 0 6.37024E-5
17-73956440-G-A p.Arg96Trp missense ACOX1 1 83164 1.20244E-5 41582 0 5.08268E-5
17-73956445-C-T p.Arg94Gln missense ACOX1 1 83166 1.20241E-5 41583 0 5.04541E-4
17-73956460-C-T c.270-4G>A splice_region ACOX1 3 83118 3.60933E-5 41559 0 6.07301E-5
17-73956461-G-A c.270-5C>T splice_region ACOX1 5 83110 6.01612E-5 41555 0 9.55475E-5
17-73969390-G-A c.*311C>T splice_region ACOX1 1 51856 1.92842E-5 25928 0 6.37024E-5
17-73969706-C-T p.Gly144Arg missense+splice_region ACOX1 4 83334 4.79996E-5 41667 0 6.37146E-5
17-73969720-G-T p.Thr139Lys missense ACOX1 3 83372 3.59833E-5 41686 0 3.1837E-5
17-73969720-G-A p.Thr139Met missense ACOX1 1 83372 1.19944E-5 41686 0 5.76625E-5
17-73969728-G-A p.Tyr136Tyr synonymous ACOX1 3 83382 3.5979E-5 41691 0 4.9425E-5
17-73969757-A-G p.Ser127Pro missense ACOX1 4 83404 4.79593E-5 41702 0 NA
17-73969767-C-G p.Trp123Cys missense ACOX1 1 83398 1.19907E-5 41699 0 3.9763E-6
17-73969785-A-G p.Thr117Thr synonymous ACOX1 1 83388 1.19921E-5 41694 0 3.97633E-6
17-73969800-C-T p.Leu112Leu synonymous ACOX1 1 83394 1.19913E-5 41697 0 NA
17-73969828-T-C p.Asn103Ser missense ACOX1 6 83378 7.19614E-5 41689 0 3.18112E-5
17-73969829-T-A p.Asn103Tyr missense ACOX1 2 83380 2.39866E-5 41690 0 1.64788E-5
17-73969832-G-T p.Leu102Ile missense ACOX1 3 83372 3.59833E-5 41686 0 7.95292E-6
17-73969834-C-G p.Gly101Ala missense ACOX1 1 83372 1.19944E-5 41686 0 NA
17-73969835-C-T p.Gly101Ser missense ACOX1 4515 83280 0.0542147 41640 146 0.071875
17-73969838-C-T p.Val100Met missense ACOX1 1 83370 1.19947E-5 41685 0 3.97636E-6
17-73969841-G-C p.Pro99Ala missense ACOX1 1 83370 1.19947E-5 41685 0 1.98828E-5
17-73969866-T-TTTTTTAAACCACATAATTTCATCAGGGTCAGCGATGCCAAACTCC c.270-1_270insGGAGTTTGGCATCGCTGACCCTGATGAAATTATGTGGTTTAAAAA splice_acceptor ACOX1 1 83350 1.19976E-5 41675 0 NA
17-73969867-C-T c.270-1G>A splice_acceptor ACOX1 1 83340 1.1999E-5 41670 0 NA
17-73969870-C-T c.270-4G>A splice_region ACOX1 2 83322 2.40033E-5 41661 0 8.27815E-6
17-73969873-GAGAGA-G c.270-12_270-8delTCTCT splice_region ACOX1 9 83312 1.08028E-4 41656 0 4.37595E-5
17-73974611-C-T c.269+4G>A splice_region ACOX1 1 83362 1.19959E-5 41681 0 NA
17-73974614-C-A c.269+1G>T splice_donor ACOX1 1 83356 1.19967E-5 41678 0 NA
17-73974618-T-G p.Lys89Thr missense ACOX1 1 83362 1.19959E-5 41681 0 8.23683E-6
17-73974638-A-C p.Pro82Pro synonymous ACOX1 1 83394 1.19913E-5 41697 0 NA
17-73974662-C-G p.Met74Ile missense ACOX1 1 83398 1.19907E-5 41699 0 3.97624E-6
17-73974718-G-A p.Arg56Cys missense ACOX1 1 83404 1.19898E-5 41702 0 NA
17-73974729-T-A p.Asn52Ile missense ACOX1 1 83400 1.19904E-5 41700 0 NA
17-73974743-C-G p.Gln47His missense ACOX1 3 83400 3.59712E-5 41700 0 3.1841E-5
17-73974754-G-C p.Pro44Ala missense ACOX1 1 83382 1.1993E-5 41691 0 8.23696E-6
17-73974762-A-G p.Leu41Pro missense ACOX1 2 83354 2.3994E-5 41677 0 1.43146E-4
17-73974774-TCTGAAAGGGGGTTAAAGGGCATTAAAAGGCAGACAGACACTCGGGCCTCCGTTCCACCCTCCCTGAATCACAATAGGCTTCAGAGTCGCGGACACAC-T c.110-97_110-1delGTGTGTCCGCGACTCTGAAGCCTATTGTGATTCAGGGAGGGTGGAACGGAGGCCCGAGTGTCTGTCTGCCTTTTAATGCCCTTTAACCCCCTTTCAG splice_acceptor ACOX1 2 83290 2.40125E-5 41645 0 NA
17-73974775-CT-C c.110-2delA splice_acceptor ACOX1 1 83280 1.20077E-5 41640 0 NA
17-73974777-G-A c.110-3C>T splice_region ACOX1 1 83234 1.20143E-5 41617 0 3.97659E-6
17-73974869-C-CA c.-6+2_-6+3insT splice_donor ACOX1 1 81532 1.22651E-5 40766 0 NA
17-73974886-T-C c.-20A>G 5_prime_UTR_premature_start_codon_gain ACOX1 4848 81212 0.0596956 40606 165 0.0765766
17-73974942-A-C p.Arg71Arg synonymous ACOX1 1 81928 1.22058E-5 40964 0 3.18613E-5
17-73974946-T-C p.Gln70Arg missense ACOX1 1419 81986 0.0173078 40993 27 0.0257862
17-73974957-G-A p.Gly66Gly synonymous ACOX1 3 82256 3.64715E-5 41128 0 NA
17-73974969-C-T c.-103G>A 5_prime_UTR_premature_start_codon_gain ACOX1 6 82488 7.27379E-5 41244 0 3.69177E-4
17-73974969-C-A c.-103G>T 5_prime_UTR_premature_start_codon_gain ACOX1 1 82488 1.2123E-5 41244 0 NA
17-73974985-G-A p.Ala57Val missense ACOX1 1 82718 1.20893E-5 41359 0 NA
17-73974985-G-C p.Ala57Gly missense ACOX1 1 82718 1.20893E-5 41359 0 NA
17-73974987-A-ATTTTC p.Asp56fs frameshift ACOX1 1 82752 1.20843E-5 41376 0 NA
17-73974990-G-GGGAAATTTCCGACTCGGGAAAAGTCGGAA p.Asp56fs frameshift ACOX1 1 82772 1.20814E-5 41386 0 NA
17-73974990-G-A c.-124C>T 5_prime_UTR_premature_start_codon_gain ACOX1 1 82774 1.20811E-5 41387 0 NA
17-73975001-C-T p.Gly52Arg missense ACOX1 12 82864 1.44816E-4 41432 0 1.7078E-5
17-73975002-A-C p.Ala51Ala synonymous ACOX1 1 82858 1.20688E-5 41429 0 NA
17-73975004-C-T p.Ala51Thr missense ACOX1 2 82864 2.41359E-5 41432 0 6.3743E-5
17-73975011-C-A p.Pro48Pro synonymous ACOX1 4 82786 4.83173E-5 41393 0 6.37714E-5
17-73975029-T-TA p.Asp43fs frameshift ACOX1 4 82540 4.84614E-5 41270 0 2.84121E-5
17-73975054-C-T p.Arg34Gln missense ACOX1 1 82046 1.21883E-5 41023 0 NA
17-73975058-G-A p.Arg33Cys missense ACOX1 1 81914 1.22079E-5 40957 0 NA
17-73975063-C-T p.Arg31Gln missense ACOX1 2 81894 2.44218E-5 40947 0 NA
17-73975075-G-A p.Pro27Leu missense ACOX1 520 81994 0.00634193 40997 4 0.0191532
17-73975076-G-A p.Pro27Ser missense ACOX1 3 81956 3.6605E-5 40978 0 6.37918E-5
17-73975083-G-A c.-217C>T 5_prime_UTR_premature_start_codon_gain ACOX1 9 82066 1.09668E-4 41033 0 3.82482E-4
17-73975122-G-T p.Ser11Ser synonymous ACOX1 2 82846 2.41412E-5 41423 0 NA
17-73975139-G-A p.Arg6Cys missense ACOX1 14 82824 1.69033E-4 41412 0 5.03525E-4
17-73975139-G-T p.Arg6Ser missense ACOX1 2 82826 2.4147E-5 41413 0 4.00099E-5
17-73975145-C-T p.Asp4Asn missense ACOX1 1 82836 1.2072E-5 41418 0 1.20042E-5
17-73975147-G-A p.Pro3Leu missense ACOX1 4 82824 4.82952E-5 41412 0 3.18512E-5
17-73975150-T-C p.Asn2Ser missense ACOX1 1 82792 1.20785E-5 41396 0 1.20139E-5
17-73975161-G-A c.-7C>T 5_prime_UTR_premature_start_codon_gain ACOX1 1 82692 1.20931E-5 41346 0 1.20457E-5
17-73975185-C-T c.-31G>A 5_prime_UTR_premature_start_codon_gain ACOX1 1 82378 1.21392E-5 41189 0 NA
17-73975186-C-A c.-32G>T 5_prime_UTR_premature_start_codon_gain ACOX1 2 82332 2.42919E-5 41166 0 8.43668E-6
17-73975191-G-C c.-37C>G 5_prime_UTR_premature_start_codon_gain ACOX1 1 82158 1.21717E-5 41079 0 8.46167E-6
17-73975230-G-A c.-76C>T 5_prime_UTR_premature_start_codon_gain ACOX1 1 79000 1.26582E-5 39500 0 NA
17-73975271-C-A c.-117G>T 5_prime_UTR_premature_start_codon_gain ACOX1 1 74070 1.35007E-5 37035 0 3.18695E-5
17-73975436-G-A c.-282C>T 5_prime_UTR_premature_start_codon_gain ACOX1 1 24570 4.07E-5 12285 0 NA