Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
9-32384734-G-GAACACGTGGCCATCAGTAATCATGAGCAACCCATTCGCACACCTTGC c.-23+1_-23+2insAACACGTGGCCATCAGTAATCATGAGCAACCCATTCGCACACCTTGC splice_donor ACO1 2 9296 2.15146E-4 4648 1 NA
9-32405475-C-G c.-22-8C>G splice_region ACO1 1 82524 1.21177E-5 41262 0 4.02434E-6
9-32405514-C-CCATT p.Ala6fs frameshift ACO1 1 82868 1.20674E-5 41434 0 NA
9-32405519-C-T c.-283C>T 5_prime_UTR_premature_start_codon_gain ACO1 1 82872 1.20668E-5 41436 0 2.48418E-5
9-32405519-C-A p.Phe5Leu missense ACO1 1 82872 1.20668E-5 41436 0 NA
9-32405520-G-A p.Ala6Thr missense ACO1 4 82846 4.82824E-5 41423 0 0.00100806
9-32405523-C-A p.His7Asn missense ACO1 2 82874 2.4133E-5 41437 0 2.48431E-5
9-32405529-G-A p.Ala9Thr missense ACO1 1 82874 1.20665E-5 41437 0 NA
9-32405538-T-C c.-264T>C 5_prime_UTR_premature_start_codon_gain ACO1 1 82866 1.20677E-5 41433 0 1.65678E-5
9-32405542-A-G p.Asp13Gly missense ACO1 1 82856 1.20691E-5 41428 0 NA
9-32405556-G-A p.Gly18Arg missense ACO1 2 82756 2.41674E-5 41378 0 NA
9-32405561-G-T p.Lys19Asn missense ACO1 1 82714 1.20899E-5 41357 0 1.91058E-4
9-32405565-T-G p.Phe21Val missense ACO1 1 82666 1.20969E-5 41333 0 NA
9-32405567-C-G p.Phe21Leu missense ACO1 1 82634 1.21016E-5 41317 0 NA
9-32405568-T-C p.Phe22Leu missense ACO1 1 82634 1.21016E-5 41317 0 NA
9-32405586-GA-G p.Glu28fs frameshift ACO1 2 82272 2.43096E-5 41136 0 NA
9-32405589-G-T p.Asp29Tyr missense ACO1 118 82140 0.00143657 41070 0 0.00352467
9-32405602-G-GGCGCTTACCATTTTCGATCAGAGTTCTTCTGGAAGCAGCCAT c.97+1_97+2insGCGCTTACCATTTTCGATCAGAGTTCTTCTGGAAGCAGCCAT splice_donor ACO1 2 81848 2.44355E-5 40924 1 NA
9-32405602-G-GGCGCTTACCATTTTCGATCAGAGTTCTTCTGGAAGCAGCCATTCGGAAT c.97+1_97+2insGCGCTTACCATTTTCGATCAGAGTTCTTCTGGAAGCAGCCATTCGGAAT splice_donor ACO1 2 81848 2.44355E-5 40924 1 NA
9-32405602-G-GGCGCT c.97+1_97+2insGCGCT splice_donor ACO1 2 81848 2.44355E-5 40924 1 NA
9-32405607-T-A c.97+6T>A splice_region ACO1 1 81656 1.22465E-5 40828 0 NA
9-32407252-C-T c.98-7C>T splice_region ACO1 1 83262 1.20103E-5 41631 0 NA
9-32407259-G-A p.Gly33Glu missense+splice_region ACO1 2 83300 2.40096E-5 41650 0 2.48127E-5
9-32407261-C-T p.Arg34Cys missense+splice_region ACO1 7 83292 8.40417E-5 41646 0 3.30753E-5
9-32407262-G-A p.Arg34His missense ACO1 3 83302 3.60135E-5 41651 0 5.03525E-4
9-32407264-T-C p.Leu35Leu synonymous ACO1 2 83316 2.4005E-5 41658 0 NA
9-32407272-T-G p.Phe37Leu missense ACO1 1 83328 1.20008E-5 41664 0 NA
9-32407274-C-T p.Ser38Leu missense ACO1 2 83330 2.4001E-5 41665 0 1.03442E-4
9-32407275-G-T p.Ser38Ser synonymous ACO1 2 83338 2.39987E-5 41669 0 NA
9-32407293-A-G p.Glu44Glu synonymous ACO1 2 83348 2.39958E-5 41674 0 3.977E-6
9-32407312-G-C p.Asp51His missense ACO1 1 83352 1.19973E-5 41676 0 3.18512E-5
9-32407324-G-A p.Val55Met missense ACO1 8 83344 9.59877E-5 41672 0 6.25E-4
9-32407330-A-G p.Lys57Glu missense ACO1 1 83350 1.19976E-5 41675 0 NA
9-32407334-A-G p.Gln58Arg missense ACO1 1 83340 1.1999E-5 41670 0 3.18451E-5
9-32407335-G-T p.Gln58His missense ACO1 3 83336 3.59988E-5 41668 0 8.23859E-6
9-32407342-GA-G p.Asn62fs frameshift ACO1 1 83332 1.20002E-5 41666 0 NA
9-32407352-T-G p.Leu64Arg missense ACO1 1 83294 1.20057E-5 41647 0 NA
9-32407353-A-G c.-106A>G 5_prime_UTR_premature_start_codon_gain ACO1 1 83288 1.20065E-5 41644 0 NA
9-32407367-C-T p.Thr69Met missense ACO1 21 83226 2.52325E-4 41613 1 0.0020141
9-32407368-G-A p.Thr69Thr synonymous ACO1 8 83222 9.61284E-5 41611 0 3.29625E-5
9-32407374-C-A p.His71Gln missense ACO1 1 83216 1.20169E-5 41608 0 1.64837E-5
9-32407385-A-G p.Glu75Gly missense ACO1 1 83152 1.20262E-5 41576 0 NA
9-32407398-G-T p.Lys79Asn missense ACO1 17 83090 2.04597E-4 41545 0 3.18552E-5
9-32407406-G-A p.Arg82His missense ACO1 6 83018 7.22735E-5 41509 0 6.36862E-5
9-32407427-C-T p.Thr89Met missense+splice_region ACO1 3 82772 3.62441E-5 41386 0 9.55597E-5
9-32407427-C-CGG c.266_266+1insGG splice_donor ACO1 3 82774 3.62433E-5 41387 1 NA
9-32407428-G-C c.266+1G>C splice_donor ACO1 1 82740 1.20861E-5 41370 0 7.9906E-6
9-32408513-G-A p.Gly90Ser missense+splice_region ACO1 1 83344 1.19985E-5 41672 0 NA
9-32408521-C-T c.-22C>T 5_prime_UTR_premature_start_codon_gain ACO1 31 83350 3.71926E-4 41675 1 9.06693E-4
9-32408522-G-A p.Ala93Thr missense ACO1 2 83358 2.39929E-5 41679 0 2.38785E-5
9-32408527-G-C p.Val94Val synonymous ACO1 1 83358 1.19964E-5 41679 0 NA
9-32408542-A-G p.Ala99Ala synonymous ACO1 2 83350 2.39952E-5 41675 0 8.23832E-6
9-32408543-A-G p.Met1? start_lost ACO1 2 83354 2.3994E-5 41677 0 3.9776E-6
9-32408546-C-T p.Arg101Cys missense ACO1 1 83348 1.19979E-5 41674 0 1.64772E-5
9-32408547-G-A p.Arg101His missense ACO1 2 83348 2.39958E-5 41674 0 7.95551E-6
9-32408547-G-GT p.Asp102fs frameshift ACO1 1 83348 1.19979E-5 41674 0 NA
9-32408573-G-T p.Asp110Tyr missense ACO1 3 83360 3.59885E-5 41680 0 5.03525E-4
9-32408577-C-CCTTCT p.Glu112fs frameshift ACO1 1 83366 1.19953E-5 41683 0 NA
9-32408591-C-G p.Pro116Ala missense ACO1 1 83354 1.1997E-5 41677 0 2.47141E-5
9-32408599-C-A p.Cys118* stop_gained ACO1 1 83348 1.19979E-5 41674 0 NA
9-32408609-C-T p.Leu122Phe missense ACO1 1 83338 1.19993E-5 41669 0 7.95444E-6
9-32408609-C-G p.Leu122Val missense ACO1 2 83338 2.39987E-5 41669 0 4.77266E-5
9-32408612-G-A p.Val123Ile missense ACO1 141 83336 0.00169195 41668 0 0.00151057
9-32408641-C-A p.Phe132Leu missense ACO1 1 83278 1.2008E-5 41639 0 NA
9-32408644-CAGA-C p.Asp131del conservative_inframe_deletion ACO1 1 83274 1.20085E-5 41637 0 8.24389E-6
9-32408649-G-GGGCAGACA c.404_404+1insGGCAGACA splice_donor ACO1 1 83254 1.20114E-5 41627 0 NA
9-32408650-G-GGCAGACAGT c.404+1_404+2insGCAGACAGT splice_donor ACO1 1 83250 1.2012E-5 41625 0 NA
9-32408654-G-A c.404+5G>A splice_region ACO1 1 83230 1.20149E-5 41615 0 8.24824E-6
9-32418126-G-A p.Arg135Arg splice_region+synonymous ACO1 1 83270 1.20091E-5 41635 0 3.98337E-6
9-32418139-C-A p.Gln140Lys missense ACO1 1 83304 1.20042E-5 41652 0 3.98149E-6
9-32418178-C-T p.Arg153* stop_gained ACO1 1 83340 1.1999E-5 41670 0 3.18552E-5
9-32418179-G-A p.Arg153Gln missense ACO1 2 83344 2.39969E-5 41672 0 1.19447E-5
9-32418186-A-AT p.Leu157fs frameshift ACO1 1 83352 1.19973E-5 41676 0 NA
9-32418193-AAGGTATGGGCAGGGTCTGGTTCCATTGTTTGGTTTTCTTTGTAGGCAGGGTACGAGGGAGAGATGCCAAGGAGATGGGCTGAGTAGAAGTACTTCACGCGTTCATAGTGTTCTTTCCATTTGTCAATCCC-A p.Lys158fs frameshift ACO1 5 83362 5.99794E-5 41681 0 NA
9-32418350-A-G p.Met167Val missense ACO1 2 83384 2.39854E-5 41692 0 NA
9-32418353-C-T p.Arg168Trp missense ACO1 61 83392 7.31485E-4 41696 0 8.91947E-4
9-32418354-G-A p.Arg168Gln missense ACO1 2 83394 2.39825E-5 41697 0 3.18451E-5
9-32418360-T-C p.Ile170Thr missense ACO1 3 83402 3.59704E-5 41701 0 6.36821E-5
9-32418369-G-A p.Gly173Asp missense ACO1 7 83394 8.39389E-5 41697 0 2.38641E-5
9-32418382-C-G p.Ile177Met missense ACO1 1 83404 1.19898E-5 41702 0 3.9769E-6
9-32418386-C-T p.Gln179* stop_gained ACO1 2 83394 2.39825E-5 41697 0 4.37449E-5
9-32418388-G-A p.Gln179Gln synonymous ACO1 3 83394 3.59738E-5 41697 0 3.1835E-5
9-32418389-G-C p.Val180Leu missense ACO1 2 83396 2.3982E-5 41698 0 2.47141E-5
9-32418391-G-A p.Val180Val synonymous ACO1 1 83402 1.19901E-5 41701 0 NA
9-32418408-C-T p.Ala186Val missense ACO1 1 83396 1.1991E-5 41698 0 NA
9-32418415-G-A p.Val188Val synonymous ACO1 1 83404 1.19898E-5 41702 0 8.23669E-6
9-32418416-G-T p.Val189Leu missense ACO1 1 83400 1.19904E-5 41700 0 8.23669E-6
9-32418437-T-C p.Tyr196His missense ACO1 1 83392 1.19916E-5 41696 0 NA
9-32418444-C-T p.Pro198Leu missense ACO1 1 83388 1.19921E-5 41694 0 1.59085E-5
9-32418454-C-T p.Leu201Leu synonymous ACO1 2 83380 2.39866E-5 41690 0 4.94299E-5
9-32418455-G-A p.Val202Met missense ACO1 3 83366 3.59859E-5 41683 0 2.78432E-5
9-32418460-C-T p.Gly203Gly synonymous ACO1 2 83364 2.39912E-5 41682 0 NA
9-32418466-C-T p.Asp205Asp synonymous ACO1 2 83356 2.39935E-5 41678 0 NA
9-32418469-G-A p.Ser206Ser synonymous ACO1 2 83354 2.3994E-5 41677 0 3.18532E-5
9-32418471-AC-A p.His207fs frameshift ACO1 1 83354 1.1997E-5 41677 0 8.24865E-6
9-32418472-C-T p.His207His synonymous ACO1 1 83354 1.1997E-5 41677 0 8.25042E-6
9-32418473-A-G p.Thr208Ala missense ACO1 93 83352 0.00111575 41676 0 0.00219745
9-32418512-G-GTCGGTGGTATTGAAGC c.658+3_658+4insTCGGTGGTATTGAAGC splice_region ACO1 1 83072 1.20378E-5 41536 0 NA
9-32418512-G-GTCGGTGGTATTGA c.658+3_658+4insTCGGTGGTATTGA splice_region ACO1 1 83072 1.20378E-5 41536 0 NA
9-32419040-C-T p.Val221Val synonymous ACO1 9 82820 1.08669E-4 41410 0 0.00375
9-32419043-T-C p.Gly222Gly synonymous ACO1 52 82922 6.27095E-4 41461 0 2.8407E-4
9-32419046-T-C p.Gly223Gly synonymous ACO1 1 82970 1.20525E-5 41485 0 4.09651E-6
9-32419049-T-C p.Ile224Ile synonymous ACO1 1 82970 1.20525E-5 41485 0 NA
9-32419052-A-T p.Glu225Asp missense ACO1 1 83052 1.20406E-5 41526 0 NA
9-32419081-T-A p.Ile235Asn missense ACO1 1 83040 1.20424E-5 41520 0 8.30303E-6
9-32419095-C-T p.Pro240Ser missense ACO1 1 83108 1.20325E-5 41554 0 3.31455E-5
9-32419096-C-T p.Pro240Leu missense ACO1 1 83112 1.2032E-5 41556 0 NA
9-32419100-G-C p.Gln241His missense ACO1 2 83102 2.40668E-5 41551 0 8.28542E-6
9-32419105-T-C p.Ile243Thr missense ACO1 2 83080 2.40732E-5 41540 0 1.65733E-5
9-32419124-G-A p.Gly249Gly synonymous ACO1 2 82968 2.41057E-5 41484 0 8.30344E-6
9-32419133-C-T p.His252His synonymous ACO1 88 82900 0.00106152 41450 0 0.00200714
9-32419135-C-T p.Pro253Leu missense ACO1 1 82926 1.20589E-5 41463 0 NA
9-32419144-C-T p.Thr256Ile missense ACO1 1 82732 1.20872E-5 41366 0 NA
9-32419157-C-T p.Ile260Ile synonymous ACO1 2 82476 2.42495E-5 41238 0 2.1127E-5
9-32419157-C-G p.Ile260Met missense ACO1 1 82476 1.21247E-5 41238 0 3.18573E-5
9-32419167-A-G p.Ile264Val missense ACO1 2 82056 2.43736E-5 41028 0 3.18532E-5
9-32419171-C-T p.Thr265Ile missense ACO1 1 81924 1.22064E-5 40962 0 NA
9-32419175-G-GCACCTCCGCCAGGTTGGGGTAGTGGGCAAATTTGTCGAGTTCTTC c.798_798+1insCACCTCCGCCAGGTTGGGGTAGTGGGCAAATTTGTCGAGTTCTTC splice_donor ACO1 1 81672 1.22441E-5 40836 0 NA
9-32419180-C-T c.798+5C>T splice_region ACO1 36 81630 4.41014E-4 40815 0 8.9189E-4
9-32419183-T-C c.798+8T>C splice_region ACO1 1 81484 1.22723E-5 40742 0 NA
9-32420851-T-C c.799-3T>C splice_region ACO1 2 83078 2.40738E-5 41539 0 3.1837E-5
9-32420861-G-A p.Arg269His missense ACO1 1 83186 1.20213E-5 41593 0 3.1839E-5
9-32420866-G-T p.Val271Phe missense ACO1 1 83222 1.20161E-5 41611 0 NA
9-32420872-G-T p.Val273Leu missense ACO1 1 83236 1.2014E-5 41618 0 8.24131E-6
9-32420873-T-C p.Val273Ala missense ACO1 1 83242 1.20132E-5 41621 0 NA
9-32420884-T-C p.Phe277Leu missense ACO1 1 83284 1.20071E-5 41642 0 NA
9-32420889-C-T p.Val278Val synonymous ACO1 1 83290 1.20062E-5 41645 0 NA
9-32420890-G-A p.Glu279Lys missense ACO1 4 83290 4.8025E-5 41645 0 3.98111E-5
9-32420893-T-C p.Phe280Leu missense ACO1 3 83292 3.60179E-5 41646 0 3.29506E-5
9-32420898-C-T p.Phe281Phe synonymous ACO1 2 83300 2.40096E-5 41650 0 1.592E-5
9-32420899-G-A p.Gly282Arg missense ACO1 2 83304 2.40085E-5 41652 0 1.59186E-5
9-32420905-G-A p.Gly284Arg missense ACO1 1 83314 1.20028E-5 41657 0 8.23683E-6
9-32420912-C-T p.Ala286Val missense ACO1 4 83316 4.801E-5 41658 0 3.18492E-5
9-32420917-T-C p.Leu288Leu synonymous ACO1 1 83324 1.20013E-5 41662 0 NA
9-32420919-G-T p.Leu288Phe missense ACO1 14 83324 1.68019E-4 41662 0 0.00202634
9-32420933-G-A p.Arg293Gln missense ACO1 4 83336 4.79985E-5 41668 0 9.55475E-5
9-32420940-G-A p.Thr295Thr synonymous ACO1 1 83350 1.19976E-5 41675 0 5.06586E-4
9-32420949-CAT-C p.Met299fs frameshift ACO1 1 83364 1.19956E-5 41682 0 3.97668E-6
9-32420960-A-G p.Glu302Gly missense ACO1 1 83370 1.19947E-5 41685 0 NA
9-32420964-C-T p.Tyr303Tyr synonymous ACO1 1 83370 1.19947E-5 41685 0 3.1841E-5
9-32420965-G-A p.Gly304Arg missense ACO1 1 83376 1.19939E-5 41688 0 3.18451E-5
9-32420982-T-C p.Phe309Phe synonymous ACO1 1 83360 1.19962E-5 41680 0 3.97674E-6
9-32420989-G-C p.Val312Leu missense ACO1 1 83334 1.19999E-5 41667 0 NA
9-32420995-G-A p.Glu314Lys missense ACO1 1 83336 1.19996E-5 41668 0 0.00125
9-32420998-G-A p.Val315Ile missense ACO1 2 83324 2.40027E-5 41662 0 2.30688E-4
9-32421000-T-G p.Val315Val synonymous ACO1 3 83326 3.60032E-5 41663 0 6.59174E-5
9-32421008-C-T p.Thr318Met missense ACO1 7 83286 8.40477E-5 41643 0 5.03525E-4
9-32421009-G-A p.Thr318Thr synonymous ACO1 9 83276 1.08074E-4 41638 0 8.2428E-5
9-32421009-G-C p.Thr318Thr synonymous ACO1 4 83276 4.8033E-5 41638 0 0.00100705
9-32421011-A-G p.Tyr319Cys missense ACO1 1 83252 1.20117E-5 41626 0 NA
9-32421017-T-C p.Val321Ala missense ACO1 1 83204 1.20187E-5 41602 0 3.98356E-6
9-32421027-T-TCGTGATGAAGAAAAATTAAAGTATATTAAAAAATATCTTC c.970+2_970+3insCGTGATGAAGAAAAATTAAAGTATATTAAAAAATATCTTC splice_region ACO1 1 83130 1.20294E-5 41565 0 NA
9-32421027-T-TCGTGATGAAGAAAAATTAAAGTATATTAA c.970+2_970+3insCGTGATGAAGAAAAATTAAAGTATATTAA splice_region ACO1 1 83130 1.20294E-5 41565 0 NA
9-32423317-G-A p.Gly324Asp missense+splice_region ACO1 1 82476 1.21247E-5 41238 0 NA
9-32423319-C-T p.Arg325Cys missense+splice_region ACO1 3 82530 3.63504E-5 41265 0 7.56671E-5
9-32423320-G-A p.Arg325His missense ACO1 4 82590 4.8432E-5 41295 0 6.29723E-4
9-32423328-G-A p.Glu328Lys missense ACO1 2 82884 2.41301E-5 41442 0 1.91156E-4
9-32423342-T-C p.Tyr332Tyr synonymous ACO1 5 83102 6.0167E-5 41551 0 3.18552E-5
9-32423345-T-TA p.Tyr336fs frameshift ACO1 1 83118 1.20311E-5 41559 0 NA
9-32423358-C-T p.Gln338* stop_gained ACO1 1 83236 1.2014E-5 41618 0 4.30356E-6
9-32423370-A-G p.Met342Val missense ACO1 8 83232 9.61169E-5 41616 0 0.00125
9-32423377-G-A p.Arg344Gln missense ACO1 1 83196 1.20198E-5 41598 0 1.64742E-5
9-32423381-T-A p.Asp345Glu missense ACO1 1 83228 1.20152E-5 41614 0 4.18547E-6
9-32423384-C-T p.Phe346Phe synonymous ACO1 1 83244 1.20129E-5 41622 0 4.94226E-5
9-32423386-A-G p.Asn347Ser missense ACO1 8 83252 9.60938E-5 41626 0 2.54777E-4
9-32423390-C-T p.Asp348Asp synonymous ACO1 2 83242 2.40263E-5 41621 0 3.18532E-5
9-32423391-C-T p.Pro349Ser missense ACO1 3 83254 3.60343E-5 41627 0 8.33382E-5
9-32423402-C-T p.Asp352Asp synonymous ACO1 1 83234 1.20143E-5 41617 0 NA
9-32423402-C-A p.Asp352Glu missense ACO1 1 83234 1.20143E-5 41617 0 4.1708E-6
9-32423421-T-G c.1071+4T>G splice_region ACO1 1 83112 1.2032E-5 41556 0 1.64737E-5
9-32423421-TGA-T c.1071+5_1071+6delGA splice_region ACO1 1 83112 1.2032E-5 41556 0 4.23499E-6
9-32424548-T-C p.Val358Ala missense+splice_region ACO1 1 83326 1.20011E-5 41663 0 NA
9-32424552-G-T p.Val359Val synonymous ACO1 1 83334 1.19999E-5 41667 0 4.00753E-6
9-32424583-T-A p.Cys370Ser missense ACO1 2 83392 2.39831E-5 41696 0 6.76315E-5
9-32424592-C-G p.Pro373Ala missense ACO1 4 83384 4.79708E-5 41692 0 3.97829E-6
9-32424595-A-C p.Lys374Gln missense ACO1 1 83388 1.19921E-5 41694 0 NA
9-32424595-A-G p.Lys374Glu missense ACO1 2 83388 2.39843E-5 41694 0 6.59044E-5
9-32424624-C-T p.Ser383Ser synonymous ACO1 14 83376 1.67914E-4 41688 0 1.56533E-4
9-32424628-A-G p.Met385Val missense ACO1 1 83358 1.19964E-5 41679 0 3.18613E-5
9-32424630-G-GA p.Asp388fs frameshift ACO1 2 83356 2.39935E-5 41678 1 NA
9-32424633-A-G p.Lys386Lys synonymous ACO1 2 83348 2.39958E-5 41674 0 8.23954E-6
9-32424642-T-C p.Phe389Phe synonymous ACO1 1 83326 1.20011E-5 41663 0 NA
9-32424659-C-A p.Ala395Asp missense ACO1 102 83210 0.00122581 41605 4 0.00436023
9-32424665-T-A c.1188+2T>A splice_donor ACO1 3 83134 3.60863E-5 41567 0 3.18695E-5
9-32425838-A-G p.Gln397Gln splice_region+synonymous ACO1 1 82858 1.20688E-5 41429 0 NA
9-32425854-C-G p.Gln403Glu missense ACO1 1 82932 1.20581E-5 41466 0 NA
9-32425863-C-T p.Pro406Ser missense ACO1 1 82928 1.20587E-5 41464 0 NA
9-32425873-A-G p.His409Arg missense ACO1 2 82934 2.41156E-5 41467 0 NA
9-32425875-A-G p.Asn410Asp missense ACO1 1 82924 1.20592E-5 41462 0 NA
9-32425881-C-T p.His412Tyr missense ACO1 1 82946 1.2056E-5 41473 0 NA
9-32425898-T-C p.Tyr417Tyr synonymous ACO1 1824 82892 0.0220045 41446 79 0.0385571
9-32425908-G-A p.Glu421Lys missense ACO1 13 82876 1.56861E-4 41438 0 9.8974E-5
9-32425910-A-G p.Glu421Glu synonymous ACO1 27596 82190 0.335759 41095 4691 0.346049
9-32425913-C-T p.Phe422Phe synonymous ACO1 1 82840 1.20715E-5 41420 0 8.24212E-6
9-32425916-C-T p.Thr423Thr synonymous ACO1 1 82838 1.20718E-5 41419 0 7.96572E-6
9-32425922-T-C p.Ala425Ala synonymous ACO1 1 82844 1.20709E-5 41422 0 NA
9-32425931-T-C p.Ser428Ser synonymous ACO1 1 82790 1.20788E-5 41395 0 1.56559E-4
9-32425947-A-G p.Ile434Val missense ACO1 2 82706 2.4182E-5 41353 0 8.24117E-6
9-32425958-C-T p.Cys437Cys synonymous ACO1 2 82644 2.42002E-5 41322 0 3.18512E-5
9-32425965-AC-A p.Ser441fs frameshift ACO1 1 82564 1.21118E-5 41282 0 NA
9-32425975-C-G p.Pro443Arg missense ACO1 1 82510 1.21197E-5 41255 0 NA
9-32425976-G-A p.Pro443Pro synonymous ACO1 94 82488 0.00113956 41244 1 0.00654582
9-32425978-C-T p.Ser444Phe missense ACO1 1 82488 1.2123E-5 41244 0 NA
9-32425987-T-C p.Leu447Ser missense ACO1 3 82400 3.64078E-5 41200 0 NA
9-32425988-A-G p.Leu447Leu synonymous ACO1 3 82390 3.64122E-5 41195 0 NA
9-32425995-G-A p.Gly450Arg missense+splice_region ACO1 1 82284 1.2153E-5 41142 0 8.25409E-6
9-32425996-G-GATTGT c.1348+1_1348+2insATTGT splice_donor ACO1 1 82252 1.21578E-5 41126 0 NA
9-32427291-T-C c.1349-8T>C splice_region ACO1 1 83040 1.20424E-5 41520 0 6.37227E-5
9-32427292-T-C c.1349-7T>C splice_region ACO1 1 83042 1.20421E-5 41521 0 3.98279E-6
9-32427296-C-T c.1349-3C>T splice_region ACO1 1 83082 1.20363E-5 41541 0 6.25E-4
9-32427337-G-A p.Val463Met missense ACO1 16 83304 1.92068E-4 41652 0 4.69809E-4
9-32427356-C-G p.Thr469Ser missense ACO1 1 83340 1.1999E-5 41670 0 NA
9-32427357-T-C p.Thr469Thr synonymous ACO1 1 83348 1.19979E-5 41674 0 NA
9-32427375-T-C p.Ser475Ser synonymous ACO1 1 83366 1.19953E-5 41683 0 1.64737E-5
9-32427378-C-T p.Gly476Gly synonymous ACO1 2 83372 2.39889E-5 41686 0 1.98864E-5
9-32427386-C-T p.Thr479Ile missense ACO1 1 83382 1.1993E-5 41691 0 3.1841E-5
9-32427389-A-C p.Tyr480Ser missense ACO1 2 83378 2.39871E-5 41689 0 6.36862E-5
9-32427392-A-G p.Tyr481Cys missense ACO1 10 83374 1.19941E-4 41687 0 8.35143E-5
9-32427393-C-T p.Tyr481Tyr synonymous ACO1 1 83378 1.19936E-5 41689 0 4.11834E-5
9-32427396-A-G p.Leu482Leu synonymous ACO1 2179 83366 0.0261378 41683 97 0.0450666
9-32427396-A-T p.Leu482Leu synonymous ACO1 1 83384 1.19927E-5 41692 0 NA
9-32427402-A-G p.Glu484Glu synonymous ACO1 1 83382 1.1993E-5 41691 0 3.29478E-5
9-32427406-G-A p.Gly486Arg missense ACO1 883 83372 0.0105911 41686 32 0.0247771
9-32427418-T-C p.Tyr490His missense ACO1 1 83386 1.19924E-5 41693 0 NA
9-32427420-T-C p.Tyr490Tyr synonymous ACO1 1 83390 1.19918E-5 41695 0 4.11862E-5
9-32427435-G-GTT c.1484+1_1484+2insTT splice_donor ACO1 6 83370 7.19683E-5 41685 1 NA
9-32429423-C-T p.Asp497Asp synonymous ACO1 4 83210 4.80711E-5 41605 0 8.24022E-6
9-32429424-G-C p.Val498Leu missense ACO1 1 83212 1.20175E-5 41606 0 3.18471E-5
9-32429424-G-A p.Val498Met missense ACO1 1 83212 1.20175E-5 41606 0 9.88794E-5
9-32429429-G-A p.Val499Val synonymous ACO1 1 83244 1.20129E-5 41622 0 0.00100908
9-32429435-T-C p.Tyr501Tyr synonymous ACO1 5 83274 6.00428E-5 41637 0 3.18431E-5
9-32429441-C-T p.Cys503Cys synonymous ACO1 2 83292 2.40119E-5 41646 0 NA
9-32429467-C-A p.Pro512His missense ACO1 1 83314 1.20028E-5 41657 0 3.18451E-5
9-32429468-T-C p.Pro512Pro synonymous ACO1 2 83314 2.40056E-5 41657 0 7.95627E-6
9-32429469-T-C p.Leu513Leu synonymous ACO1 2 83310 2.40067E-5 41655 0 7.95558E-6
9-32429476-A-T p.Glu515Val missense ACO1 1 83308 1.20036E-5 41654 0 3.9782E-6
9-32429489-A-C p.Glu519Asp missense ACO1 20 83278 2.40159E-4 41639 0 2.31019E-4
9-32429502-G-GGAGACCTTGTAGCTGTTGGAGTACTATC c.1569+1_1569+2insGAGACCTTGTAGCTGTTGGAGTACTATC splice_donor ACO1 1 83254 1.20114E-5 41627 0 NA
9-32429502-G-GGAGACC c.1569+1_1569+2insGAGACC splice_donor ACO1 1 83254 1.20114E-5 41627 0 NA
9-32430409-T-C c.1570-7T>C splice_region ACO1 3 83092 3.61046E-5 41546 0 1.68376E-5
9-32430410-A-T c.1570-6A>T splice_region ACO1 1 83088 1.20354E-5 41544 0 NA
9-32430419-G-A p.Asp525Asn missense ACO1 1 83122 1.20305E-5 41561 0 NA
9-32430425-G-A p.Val527Ile missense ACO1 1 83204 1.20187E-5 41602 0 4.04717E-6
9-32430474-A-T p.His543Leu missense ACO1 1 83260 1.20106E-5 41630 0 4.02804E-6
9-32430481-C-T p.Asn545Asn synonymous ACO1 1 83312 1.20031E-5 41656 0 3.18573E-5
9-32430484-C-T p.Thr546Thr synonymous ACO1 1 83298 1.20051E-5 41649 0 NA
9-32430485-C-G p.Arg547Gly missense ACO1 1 83290 1.20062E-5 41645 0 8.24579E-6
9-32430485-C-T p.Arg547Trp missense ACO1 2 83290 2.40125E-5 41645 0 0.00100705
9-32430486-G-A p.Arg547Gln missense ACO1 1 83280 1.20077E-5 41640 0 5.77177E-5
9-32430487-G-A p.Arg547Arg synonymous ACO1 1 83290 1.20062E-5 41645 0 4.01326E-6
9-32430509-C-A p.Pro555Thr missense ACO1 2 83240 2.40269E-5 41620 0 1.61302E-5
9-32430509-C-G p.Pro555Ala missense ACO1 1 83240 1.20135E-5 41620 0 8.0651E-6
9-32430510-C-G p.Pro555Arg missense ACO1 10 83228 1.20152E-4 41614 0 9.67906E-5
9-32430510-C-A p.Pro555His missense ACO1 3 83228 3.60456E-5 41614 0 0.00245223
9-32430510-C-T p.Pro555Leu missense ACO1 1 83228 1.20152E-5 41614 0 8.06588E-6
9-32430512-T-G p.Leu556Val missense ACO1 1 83228 1.20152E-5 41614 0 8.24525E-6
9-32430522-C-T p.Ala559Val missense ACO1 1 83212 1.20175E-5 41606 0 8.24756E-6
9-32430525-A-G p.Tyr560Cys missense ACO1 2 83192 2.40408E-5 41596 0 NA
9-32430532-T-A p.Ile562Ile synonymous ACO1 5 83136 6.01424E-5 41568 0 2.54777E-4
9-32430532-T-C p.Ile562Ile synonymous ACO1 3 83134 3.60863E-5 41567 0 NA
9-32430541-C-T p.Thr565Thr synonymous ACO1 1 83122 1.20305E-5 41561 0 8.25928E-6
9-32430550-C-A p.Ile568Ile synonymous ACO1 1 83066 1.20386E-5 41533 0 NA
9-32430551-G-A p.Asp569Asn missense ACO1 1 83058 1.20398E-5 41529 0 1.65697E-5
9-32430553-C-T p.Asp569Asp synonymous ACO1 92 83076 0.00110742 41538 0 0.00210231
9-32430554-T-G p.Phe570Val missense ACO1 2 83074 2.40749E-5 41537 0 8.28864E-6
9-32430555-T-C p.Phe570Ser missense ACO1 3 83062 3.61176E-5 41531 0 5.3878E-5
9-32430559-G-T p.Glu571Asp missense ACO1 1 83040 1.20424E-5 41520 0 3.18492E-5
9-32430562-A-G p.Lys572Lys synonymous ACO1 1 83008 1.2047E-5 41504 0 4.16233E-6
9-32430563-G-A p.Glu573Lys missense ACO1 3 82984 3.61515E-5 41492 0 4.16646E-5
9-32430574-T-C c.1726+2T>C splice_donor ACO1 1 82940 1.20569E-5 41470 0 8.37633E-6
9-32431710-TC-T c.1727-6delC splice_region ACO1 1 83188 1.2021E-5 41594 0 NA
9-32431714-C-T c.1727-3C>T splice_region ACO1 2 83210 2.40356E-5 41605 0 3.9896E-6
9-32431728-A-C p.Lys580Gln missense ACO1 172 83250 0.00206607 41625 0 0.0035687
9-32431738-A-G p.Gln583Arg missense ACO1 2 83248 2.40246E-5 41624 0 3.18532E-5
9-32431745-T-C p.Phe585Phe synonymous ACO1 46 83244 5.52592E-4 41622 0 3.22247E-4
9-32431762-C-T p.Pro591Leu missense ACO1 2 83262 2.40206E-5 41631 0 1.2751E-4
9-32431765-C-T p.Thr592Ile missense ACO1 2 83264 2.402E-5 41632 0 NA
9-32431767-A-G p.Arg593Gly missense ACO1 1 83286 1.20068E-5 41643 0 NA
9-32431769-A-G p.Arg593Arg synonymous ACO1 1 83282 1.20074E-5 41641 0 NA
9-32431791-C-T p.Arg601Cys missense ACO1 3 83226 3.60464E-5 41613 0 1.27592E-4
9-32431808-G-A p.Pro606Pro synonymous ACO1 2 83196 2.40396E-5 41598 0 4.12072E-5
9-32431809-G-C p.Gly607Arg missense ACO1 1 83196 1.20198E-5 41598 0 3.18817E-5
9-32431828-A-G p.Tyr613Cys missense ACO1 1 83178 1.20224E-5 41589 0 NA
9-32433716-CTTTTT-C c.1852-9_1852-5delTTTTT splice_region ACO1 6 82788 7.24743E-5 41394 0 9.75316E-5
9-32433733-A-G p.Asn620Ser missense ACO1 1 82996 1.20488E-5 41498 0 NA
9-32433745-A-G p.Asn624Ser missense ACO1 3 83088 3.61063E-5 41544 0 1.65623E-5
9-32433758-C-T p.Thr628Thr synonymous ACO1 2 83138 2.40564E-5 41569 0 NA
9-32433770-G-A p.Lys632Lys synonymous ACO1 4 83166 4.80966E-5 41583 0 7.99118E-6
9-32433796-C-G p.Thr641Arg missense ACO1 1 83174 1.2023E-5 41587 0 NA
9-32433796-C-T p.Thr641Met missense ACO1 2 83176 2.40454E-5 41588 0 NA
9-32433799-A-G p.Tyr642Cys missense ACO1 2 83176 2.40454E-5 41588 0 4.95933E-5
9-32433803-C-A p.Ile643Ile synonymous ACO1 109 83180 0.00131041 41590 0 0.00302115
9-32433804-A-G p.Lys644Glu missense ACO1 3 83182 3.60655E-5 41591 0 NA
9-32433816-T-C p.Phe648Leu missense ACO1 1 83146 1.2027E-5 41573 0 1.65697E-5
9-32433834-T-C c.1956+4T>C splice_region ACO1 2 83072 2.40755E-5 41536 0 6.37186E-5
9-32433837-C-CT c.1956+7_1956+8insT splice_region ACO1 2 83034 2.40865E-5 41517 0 NA
9-32434558-C-T p.Thr653Ile missense+splice_region ACO1 1 83356 1.19967E-5 41678 0 NA
9-32434579-A-C p.Lys660Thr missense ACO1 1 83366 1.19953E-5 41683 0 NA
9-32434592-T-C p.Asp664Asp synonymous ACO1 6 83376 7.19632E-5 41688 0 1.15345E-4
9-32434594-C-T p.Ala665Val missense ACO1 3 83378 3.59807E-5 41689 0 1.27397E-4
9-32434623-G-A p.Val675Ile missense ACO1 2 83374 2.39883E-5 41687 0 3.97716E-6
9-32434625-A-C p.Val675Val synonymous ACO1 2 83370 2.39894E-5 41685 0 1.19314E-5
9-32434634-C-T p.Asp678Asp synonymous ACO1 1 83366 1.19953E-5 41683 0 3.97744E-6
9-32434635-C-G p.His679Asp missense ACO1 1 83364 1.19956E-5 41682 0 NA
9-32434659-G-A p.Ala687Thr missense ACO1 1 83348 1.19979E-5 41674 0 NA
9-32434668-A-G p.Ser690Gly missense ACO1 9 83334 1.07999E-4 41667 0 3.18248E-5
9-32434680-C-T p.Arg694Cys missense ACO1 1 83316 1.20025E-5 41658 0 8.24606E-6
9-32434681-G-A p.Arg694His missense ACO1 1 83310 1.20034E-5 41655 0 3.18492E-5
9-32434693-A-T p.Asn698Ile missense ACO1 3 83290 3.60187E-5 41645 0 7.96026E-6
9-32434699-G-GCCTAACTCCAC c.2099_2099+1insCCTAACTCCAC splice_donor ACO1 1 83254 1.20114E-5 41627 0 NA
9-32434701-T-C c.2099+2T>C splice_donor ACO1 2 83232 2.40292E-5 41616 0 NA
9-32434703-A-G c.2099+4A>G splice_region ACO1 2 83218 2.40333E-5 41609 0 NA
9-32436253-C-T p.Thr702Ile missense ACO1 4 83234 4.80573E-5 41617 0 1.64775E-5
9-32436258-C-T p.Arg704* stop_gained ACO1 2 83220 2.40327E-5 41610 0 2.47162E-5
9-32436259-G-A p.Arg704Gln missense ACO1 1 83206 1.20184E-5 41603 0 3.98105E-6
9-32436268-A-T p.Asn707Ile missense ACO1 2 83214 2.40344E-5 41607 0 1.59201E-5
9-32436274-A-G p.Tyr709Cys missense ACO1 1 83214 1.20172E-5 41607 0 NA
9-32436281-C-A p.Ser711Ser synonymous ACO1 1 83214 1.20172E-5 41607 0 NA
9-32436282-C-T p.Arg712Cys missense ACO1 1 83202 1.20189E-5 41601 0 3.58269E-5
9-32436283-G-A p.Arg712His missense ACO1 4 83192 4.80815E-5 41596 0 3.18451E-5
9-32436285-C-G p.Arg713Gly missense ACO1 2 83194 2.40402E-5 41597 0 NA
9-32436285-C-T p.Arg713* stop_gained ACO1 1 83194 1.20201E-5 41597 0 8.23859E-6
9-32436286-G-A p.Arg713Gln missense ACO1 1 83188 1.2021E-5 41594 0 3.18433E-5
9-32436287-A-C p.Arg713Arg synonymous ACO1 3 83178 3.60672E-5 41589 0 NA
9-32436289-G-A p.Gly714Asp missense ACO1 1 83192 1.20204E-5 41596 0 NA
9-32436293-T-C p.Asn715Asn synonymous ACO1 1 83188 1.2021E-5 41594 0 NA
9-32436296-C-T p.Asp716Asp synonymous ACO1 1 83174 1.2023E-5 41587 0 6.36821E-5
9-32436297-G-A p.Ala717Thr missense ACO1 10 83166 1.20241E-4 41583 0 2.78594E-5
9-32436297-G-T p.Ala717Ser missense ACO1 1 83166 1.20241E-5 41583 0 3.97991E-6
9-32436299-C-T p.Ala717Ala synonymous ACO1 1 83174 1.2023E-5 41587 0 3.1841E-5
9-32436300-G-A p.Val718Ile missense ACO1 5 83188 6.01048E-5 41594 0 5.17322E-5
9-32436303-A-G p.Met719Val missense ACO1 13 83198 1.56254E-4 41599 0 5.96863E-5
9-32436309-C-T p.Arg721Trp missense ACO1 2 83196 2.40396E-5 41598 0 5.03525E-4
9-32436331-G-A p.Arg728His missense ACO1 1 83178 1.20224E-5 41589 0 0.00100705
9-32436358-A-G p.Gln737Arg missense ACO1 1 83162 1.20247E-5 41581 0 8.23723E-6
9-32436377-T-C p.His743His synonymous ACO1 1 83124 1.20302E-5 41562 0 NA
9-32436383-T-C p.Pro745Pro synonymous ACO1 1 83110 1.20322E-5 41555 0 NA
9-32436384-T-A p.Ser746Thr missense ACO1 1 83098 1.2034E-5 41549 0 NA
9-32436388-G-C p.Gly747Ala missense ACO1 1 83078 1.20369E-5 41539 0 3.18532E-5
9-32436389-G-A p.Gly747Gly synonymous ACO1 1 83068 1.20383E-5 41534 0 2.4719E-5
9-32436395-C-CCTTGATGTGTTTGATGCTGCTGAGCG c.2247_2247+1insCTTGATGTGTTTGATGCTGCTGAGCG splice_donor ACO1 1 83036 1.2043E-5 41518 0 NA
9-32436395-C-T p.Ile749Ile splice_region+synonymous ACO1 2 83038 2.40854E-5 41519 0 6.36983E-5
9-32436396-G-T c.2247+1G>T splice_donor ACO1 1 83022 1.2045E-5 41511 0 NA
9-32436403-T-G c.2247+8T>G splice_region ACO1 4 82982 4.82032E-5 41491 0 3.98518E-5
9-32440457-C-T c.2248-6C>T splice_region ACO1 1 82814 1.20753E-5 41407 0 NA
9-32440462-G-A c.2248-1G>A splice_acceptor ACO1 9 82904 1.08559E-4 41452 0 5.78675E-5
9-32440485-A-AGC p.Tyr759fs frameshift ACO1 2 83104 2.40662E-5 41552 0 2.22739E-4
9-32440488-G-A p.Arg758Gln missense ACO1 32 83136 3.84911E-4 41568 1 5.03525E-4
9-32440499-G-C p.Ala762Pro missense ACO1 1 83180 1.20221E-5 41590 0 NA
9-32440517-G-A p.Val768Ile missense ACO1 1 83220 1.20163E-5 41610 0 5.03525E-4
9-32440522-G-A p.Leu769Leu synonymous ACO1 1 83226 1.20155E-5 41613 0 3.18796E-5
9-32440525-T-C p.Ala770Ala synonymous ACO1 2 83232 2.40292E-5 41616 0 8.24606E-6
9-32440536-A-T p.Tyr774Phe missense ACO1 1 83232 1.20146E-5 41616 0 NA
9-32440537-C-T p.Tyr774Tyr synonymous ACO1 4 83214 4.80688E-5 41607 0 3.13531E-4
9-32440538-G-A p.Gly775Ser missense ACO1 2 83214 2.40344E-5 41607 0 3.97893E-6
9-32440553-C-T p.Arg780* stop_gained ACO1 1 83212 1.20175E-5 41606 0 1.59212E-5
9-32440554-G-A p.Arg780Gln missense ACO1 1 83210 1.20178E-5 41605 0 NA
9-32440560-G-A p.Trp782* stop_gained ACO1 2 83198 2.4039E-5 41599 0 NA
9-32440562-G-A p.Ala783Thr missense ACO1 1 83188 1.2021E-5 41594 0 7.96254E-6
9-32440569-A-G p.Lys785Arg missense ACO1 1 83178 1.20224E-5 41589 0 3.18613E-5
9-32440586-G-GGAA c.2370+1_2370+2insGAA splice_donor ACO1 1 83084 1.2036E-5 41542 0 NA
9-32440590-G-C c.2370+5G>C splice_region ACO1 1 83062 1.20392E-5 41531 0 NA
9-32448888-C-G c.2371-6C>G splice_region ACO1 1 83320 1.20019E-5 41660 0 NA
9-32448905-C-T p.Ala794Ala synonymous ACO1 1165 83318 0.0139826 41659 30 0.0342397
9-32448906-G-A p.Val795Ile missense ACO1 1 83352 1.19973E-5 41676 0 5.76578E-5
9-32448914-C-T p.Ala797Ala synonymous ACO1 3 83364 3.59868E-5 41682 0 NA
9-32448915-G-A p.Glu798Lys missense ACO1 6 83368 7.19701E-5 41684 0 6.25E-4
9-32448923-C-T p.Tyr800Tyr synonymous ACO1 1 83376 1.19939E-5 41688 0 1.9882E-5
9-32448924-G-A p.Glu801Lys missense ACO1 1 83374 1.19941E-5 41687 0 6.25E-4
9-32448927-C-T p.Arg802Cys missense ACO1 16 83372 1.91911E-4 41686 0 1.27245E-4
9-32448928-G-A p.Arg802His missense ACO1 1 83372 1.19944E-5 41686 0 1.64739E-5
9-32448936-C-T p.Arg805Cys missense ACO1 15 83378 1.79904E-4 41689 0 9.06081E-5
9-32448937-G-A p.Arg805His missense ACO1 2 83380 2.39866E-5 41690 0 0.00151057
9-32448938-C-T p.Arg805Arg synonymous ACO1 3 83380 3.59799E-5 41690 0 3.1841E-5
9-32448939-A-G p.Ser806Gly missense ACO1 3 83390 3.59755E-5 41695 0 8.23696E-6
9-32448947-G-A p.Leu808Leu synonymous ACO1 1 83392 1.19916E-5 41696 0 NA
9-32448959-T-G p.Gly812Gly synonymous ACO1 1878 83366 0.0225272 41683 96 0.0422086
9-32448961-T-G p.Val813Gly missense ACO1 2 83390 2.39837E-5 41695 0 3.97652E-6
9-32448969-C-G p.Leu816Val missense ACO1 1 83382 1.1993E-5 41691 0 NA
9-32448971-TGAATATCTCCCTGGTGA-T p.Tyr818fs frameshift ACO1 5 83380 5.99664E-5 41690 0 1.98842E-5
9-32448991-A-C p.Asn823Thr missense ACO1 1 83372 1.19944E-5 41686 0 3.97722E-6
9-32448996-G-C p.Asp825His missense ACO1 4 83368 4.798E-5 41684 0 0.00125
9-32448998-T-C p.Asp825Asp synonymous ACO1 1 83368 1.1995E-5 41684 0 NA
9-32449000-C-T p.Ala826Val missense ACO1 2 83364 2.39912E-5 41682 0 3.18674E-5
9-32449012-C-G p.Thr830Arg missense ACO1 1 83360 1.19962E-5 41680 0 NA
9-32449014-G-C p.Gly831Arg missense ACO1 3 83356 3.59902E-5 41678 0 3.18634E-5
9-32449018-A-G p.Gln832Arg missense ACO1 4 83348 4.79916E-5 41674 0 4.95188E-5
9-32449023-C-T p.Arg834* stop_gained ACO1 6 83342 7.19925E-5 41671 0 1.59336E-5
9-32449032-A-G p.Ile837Val missense ACO1 3 83336 3.59988E-5 41668 0 NA
9-32449038-A-G p.Ile839Val missense ACO1 2 83316 2.4005E-5 41658 0 1.99815E-5
9-32449050-C-T p.Leu843Phe missense ACO1 1 83300 1.20048E-5 41650 0 NA
9-32449061-A-G p.Gln846Gln synonymous ACO1 1 83266 1.20097E-5 41633 0 8.50297E-6
9-32449072-A-G p.Gln850Arg missense ACO1 1 83206 1.20184E-5 41603 0 NA
9-32449078-A-AGCTGGATACT p.Leu843fs frameshift ACO1 1 83180 1.20221E-5 41590 0 NA
9-32449079-G-GCTGGATACTGGCAAGACCTTCCAGGCTGTCATGAGGTTTGACACTGAT c.2556_2556+1insCTGGATACTGGCAAGACCTTCCAGGCTGTCATGAGGTTTGACACTGAT splice_donor ACO1 1 83180 1.20221E-5 41590 0 NA
9-32449999-G-T p.Asp854Tyr missense ACO1 1 82842 1.20712E-5 41421 0 NA
9-32450010-G-A p.Lys857Lys synonymous ACO1 20 83108 2.40651E-4 41554 0 5.04541E-4
9-32450018-A-G p.Gln860Arg missense ACO1 1 83236 1.2014E-5 41618 0 NA
9-32450025-C-T p.Val862Val synonymous ACO1 1 83270 1.20091E-5 41635 0 NA
9-32450041-G-A p.Asp868Asn missense ACO1 5 83346 5.99909E-5 41673 0 4.11896E-5
9-32450041-G-T p.Asp868Tyr missense ACO1 1 83346 1.19982E-5 41673 0 3.97665E-6
9-32450043-T-C p.Asp868Asp synonymous ACO1 1800 83326 0.0216019 41663 92 0.0397784
9-32450049-G-C p.Glu870Asp missense ACO1 1 83354 1.1997E-5 41677 0 NA
9-32450054-C-T p.Thr872Ile missense ACO1 1 83352 1.19973E-5 41676 0 NA
9-32450061-CCT-GCA p.PheLeu874LeuHis missense ACO1 1 83352 1.19973E-5 41676 0 NA
9-32450066-A-C p.Asn876Thr missense ACO1 1 83350 1.19976E-5 41675 0 NA
9-32450067-C-T p.Asn876Asn synonymous ACO1 2 83350 2.39952E-5 41675 0 9.88549E-5
9-32450067-CG-C p.Gly878fs frameshift ACO1 1 83350 1.19976E-5 41675 0 3.97646E-6
9-32450073-C-A p.Gly878Gly synonymous ACO1 1 83346 1.19982E-5 41673 0 1.64764E-5
9-32450087-T-G p.Met883Arg missense ACO1 1 83324 1.20013E-5 41662 0 3.18654E-5
9-32450089-A-G p.Ile884Val missense ACO1 3 83324 3.6004E-5 41662 0 2.78352E-5
9-32450092-C-T p.Arg885Cys missense ACO1 10 83316 1.20025E-4 41658 0 6.25E-4
9-32450093-G-A p.Arg885His missense ACO1 5 83314 6.00139E-5 41657 0 2.47223E-5
9-32450107-T-C p.Ter890Glnext*? stop_lost ACO1 1 83262 1.20103E-5 41631 0 3.18857E-5