Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
14-23528357-C-T p.Ter1342Ter stop_retained ACIN1 1 82910 1.20613E-5 41455 0 NA
14-23528359-A-C p.Ter1342Gluext*? stop_lost ACIN1 1 82954 1.20549E-5 41477 0 NA
14-23528380-G-A p.Arg1335Trp missense ACIN1 1 83062 1.20392E-5 41531 0 NA
14-23528383-C-G p.Val1334Leu missense ACIN1 1 83134 1.20288E-5 41567 0 NA
14-23528386-G-C p.Pro1333Ala missense ACIN1 2 83150 2.40529E-5 41575 0 NA
14-23528393-C-G p.Arg1330Arg synonymous ACIN1 1 83156 1.20256E-5 41578 0 NA
14-23528394-C-T p.Arg1330Gln missense ACIN1 2 83156 2.40512E-5 41578 0 8.2394E-6
14-23528401-G-C p.Arg1328Gly missense ACIN1 1 83174 1.2023E-5 41587 0 NA
14-23528402-G-A p.Ser1327Ser synonymous ACIN1 2 83184 2.40431E-5 41592 0 3.97678E-6
14-23528415-C-T p.Arg1323His missense ACIN1 3 83206 3.60551E-5 41603 0 1.19304E-5
14-23528421-G-A p.Thr1321Ile missense ACIN1 14 83218 1.68233E-4 41609 0 6.25E-4
14-23528423-G-A p.Asp1320Asp synonymous ACIN1 1 83226 1.20155E-5 41613 0 NA
14-23528425-C-T p.Asp1320Asn missense ACIN1 1 83226 1.20155E-5 41613 0 NA
14-23528430-C-T p.Arg1318His missense ACIN1 1 83216 1.20169E-5 41608 0 3.29495E-5
14-23528432-ATCCCTTTCCCTGCCTCGTTCTCGG-A p.Arg1310_Asp1317del disruptive_inframe_deletion ACIN1 3 83208 3.60542E-5 41604 0 4.94242E-5
14-23528434-C-T p.Asp1317Asn missense ACIN1 1 83226 1.20155E-5 41613 0 NA
14-23528435-C-T p.Arg1316Arg synonymous ACIN1 1 83226 1.20155E-5 41613 0 3.97674E-6
14-23528447-TCGTTCTCGGTCCCTTTCCCTATCC-T p.Asp1305_Arg1312del disruptive_inframe_deletion ACIN1 1 83174 1.2023E-5 41587 0 NA
14-23528465-C-T p.Arg1306Arg synonymous ACIN1 1 83072 1.20378E-5 41536 0 8.23723E-6
14-23528466-C-T p.Arg1306Lys missense ACIN1 1 83042 1.20421E-5 41521 0 3.9801E-6
14-23528470-C-A p.Asp1305Tyr missense ACIN1 3 82968 3.61585E-5 41484 0 NA
14-23528472-C-T p.Arg1304Gln missense ACIN1 2 82938 2.41144E-5 41469 0 3.18939E-5
14-23528482-C-A p.Asp1301Tyr missense ACIN1 1 82814 1.20753E-5 41407 0 3.1902E-5
14-23528493-C-G p.Arg1297Pro missense ACIN1 1 82714 1.20899E-5 41357 0 NA
14-23528500-T-C p.Arg1295Gly missense ACIN1 2 82682 2.41891E-5 41341 0 NA
14-23528501-TTC-T p.Glu1294fs frameshift ACIN1 11 81140 1.35568E-4 40570 0 0.0569685
14-23528501-T-C p.Glu1294Glu synonymous ACIN1 2 82644 2.42002E-5 41322 0 3.22851E-5
14-23528517-C-T p.Arg1289Lys missense ACIN1 6 82830 7.24375E-5 41415 0 2.79676E-5
14-23528524-T-TCTCCCGACTGTG p.Glu1286_Arg1287insHisSerArgGlu conservative_inframe_insertion ACIN1 2 82678 2.41902E-5 41339 0 NA
14-23528529-C-G p.Arg1285Pro missense ACIN1 3 82848 3.62109E-5 41424 0 NA
14-23528546-T-C p.Lys1279Lys synonymous ACIN1 2 82930 2.41167E-5 41465 0 4.00718E-6
14-23528557-C-T p.Glu1276Lys missense ACIN1 1 82918 1.20601E-5 41459 0 NA
14-23528577-C-T p.Arg1269Gln missense ACIN1 4 82926 4.82358E-5 41463 0 8.29091E-6
14-23528582-G-A p.Ala1267Ala synonymous ACIN1 5 82908 6.03078E-5 41454 0 8.41751E-5
14-23528582-G-C p.Ala1267Ala synonymous ACIN1 2 82908 2.41231E-5 41454 0 NA
14-23528594-C-T p.Arg1263Arg synonymous ACIN1 1 82952 1.20552E-5 41476 0 4.00532E-6
14-23528595-C-T p.Arg1263Gln missense ACIN1 1 82930 1.20584E-5 41465 0 5.03525E-4
14-23528606-CTCT-C p.Glu1259del disruptive_inframe_deletion ACIN1 5 82924 6.02962E-5 41462 0 1.73697E-4
14-23528609-T-C p.Glu1258Glu synonymous ACIN1 1 82950 1.20555E-5 41475 0 8.26665E-6
14-23528641-G-A p.Arg1248Trp missense ACIN1 1 82548 1.21142E-5 41274 0 NA
14-23528642-C-T p.Glu1247Glu synonymous ACIN1 1 82544 1.21148E-5 41272 0 NA
14-23528662-G-T p.Arg1241Arg synonymous ACIN1 1 82198 1.21657E-5 41099 0 8.23995E-6
14-23528668-C-A p.Ala1239Ser missense ACIN1 1 82116 1.21779E-5 41058 0 NA
14-23528680-C-T p.Val1235Ile missense ACIN1 1 81804 1.22243E-5 40902 0 4.00731E-6
14-23528681-G-A p.Ile1234Ile splice_region+synonymous ACIN1 3 81732 3.67053E-5 40866 0 5.77272E-5
14-23528687-T-C c.3700-4A>G splice_region ACIN1 1 81516 1.22675E-5 40758 0 NA
14-23530292-C-T c.3699+1G>A splice_donor ACIN1 1 82914 1.20607E-5 41457 0 NA
14-23530293-C-T p.Gln1233Gln splice_region+synonymous ACIN1 25 82952 3.01379E-4 41476 0 0.00149191
14-23530296-G-A p.Ser1232Ser synonymous ACIN1 3 82996 3.61463E-5 41498 0 1.65063E-5
14-23530301-C-CA p.Asp1231fs frameshift ACIN1 1 83090 1.20351E-5 41545 0 NA
14-23530308-T-C p.Pro1228Pro synonymous ACIN1 2 83168 2.40477E-5 41584 0 1.19329E-5
14-23530334-C-T p.Ala1220Thr missense ACIN1 1 83314 1.20028E-5 41657 0 NA
14-23530345-C-T p.Arg1216Gln missense ACIN1 3 83332 3.60006E-5 41666 0 1.19295E-5
14-23530393-TCTGAGGTGGAAAAAAGTGAACCAGATATGATGCATCTGACCCTCTGTCCCATCCCATCTGGGTCCCTTTCCCACCTACTAGTGGGTATGCGTACCCCATAGCTAAGTACCTAC-T c.3598+1_3599-1del splice_acceptor ACIN1 8 83346 9.59854E-5 41673 4 NA
14-23530398-G-A c.3599-5C>T splice_region ACIN1 507 83320 0.00608497 41660 13 0.0115766
14-23530538-C-T p.Ala1189Ala synonymous ACIN1 1 82732 1.20872E-5 41366 0 3.18613E-5
14-23530542-C-A p.Arg1188Leu missense ACIN1 33 82752 3.98782E-4 41376 0 1.81485E-4
14-23530542-C-T p.Arg1188His missense ACIN1 6 82752 7.25058E-5 41376 0 NA
14-23530543-G-A p.Arg1188Cys missense ACIN1 1 82742 1.20858E-5 41371 0 1.19435E-5
14-23530551-C-T p.Arg1185His missense ACIN1 1 82542 1.2115E-5 41271 0 5.03525E-4
14-23530552-G-A p.Arg1185Cys missense ACIN1 1 82536 1.21159E-5 41268 0 3.98137E-6
14-23530554-C-T p.Arg1184His missense ACIN1 1 82482 1.21239E-5 41241 0 3.98232E-6
14-23530555-G-A p.Arg1184Cys missense ACIN1 4 82492 4.84895E-5 41246 0 3.29815E-5
14-23530557-C-T p.Arg1183His missense ACIN1 4 82460 4.85084E-5 41230 0 1.99127E-5
14-23530558-G-A p.Arg1183Cys missense ACIN1 10 82488 1.2123E-4 41244 0 1.27445E-4
14-23530562-A-T p.Arg1181Arg synonymous ACIN1 1 82436 1.21306E-5 41218 0 NA
14-23530563-C-T p.Arg1181His missense ACIN1 2 82452 2.42565E-5 41226 0 3.18613E-5
14-23530571-T-C p.Ser1178Ser synonymous ACIN1 2 82442 2.42595E-5 41221 0 8.24158E-6
14-23530574-T-G p.Arg1177Arg synonymous ACIN1 2 82308 2.4299E-5 41154 0 NA
14-23530575-C-T p.Arg1177Gln missense ACIN1 3 82312 3.64467E-5 41156 0 NA
14-23530584-G-C p.Pro1174Arg missense ACIN1 1 82280 1.21536E-5 41140 0 NA
14-23530591-C-G p.Glu1172Gln missense ACIN1 1 82172 1.21696E-5 41086 0 3.98134E-6
14-23530603-C-A p.Asp1168Tyr missense ACIN1 1 81966 1.22002E-5 40983 0 NA
14-23530622-T-C p.Ser1161Ser synonymous ACIN1 18606 81022 0.229641 40511 2192 0.297583
14-23530622-TG-CA p.Ser1161Leu missense ACIN1 1 81456 1.22766E-5 40728 0 NA
14-23530642-G-A p.Arg1155Trp missense ACIN1 2 82712 2.41803E-5 41356 0 3.97877E-6
14-23530677-C-T p.Arg1143Gln missense ACIN1 2 82214 2.43268E-5 41107 0 8.256E-6
14-23530678-G-A p.Arg1143Trp missense ACIN1 1 82126 1.21764E-5 41063 0 3.22977E-5
14-23530698-C-T p.Arg1136Gln missense ACIN1 3 80696 3.71766E-5 40348 0 3.26328E-5
14-23530708-C-T p.Ala1133Thr missense ACIN1 2 79072 2.52934E-5 39536 0 6.25E-4
14-23530710-C-T p.Arg1132Gln missense ACIN1 1 78438 1.27489E-5 39219 0 4.43991E-6
14-23530711-G-A p.Arg1132Trp missense ACIN1 2 78552 2.54608E-5 39276 0 5.66678E-5
14-23530715-G-T p.His1130Gln missense ACIN1 1 77498 1.29036E-5 38749 0 4.06138E-6
14-23530725-G-A p.Pro1127Leu missense ACIN1 1 74914 1.33486E-5 37457 0 4.14525E-6
14-23530733-C-T p.Pro1124Pro synonymous ACIN1 41 69494 5.89979E-4 34747 1 0.00349539
14-23530733-C-G p.Pro1124Pro synonymous ACIN1 2 69442 2.8801E-5 34721 0 5.17091E-4
14-23530733-C-A p.Pro1124Pro synonymous ACIN1 11 69506 1.5826E-4 34753 0 6.32911E-4
14-23530734-G-A p.Pro1124Leu missense ACIN1 2 75924 2.63421E-5 37962 0 3.20842E-5
14-23530735-G-T p.Pro1124Thr missense ACIN1 1 75884 1.3178E-5 37942 0 7.58298E-5
14-23530738-G-A p.Pro1123Ser missense ACIN1 75 74654 0.00100463 37327 3 0.00163104
14-23530739-T-G p.Pro1122Pro synonymous ACIN1 37 73208 5.05409E-4 36604 0 0.0222146
14-23530740-G-C p.Pro1122Arg missense ACIN1 1 75248 1.32894E-5 37624 0 8.98053E-6
14-23530745-T-G p.Pro1120Pro synonymous ACIN1 94 70600 0.00133144 35300 0 0.129089
14-23530746-G-T p.Pro1120Gln missense ACIN1 2 74356 2.68976E-5 37178 0 4.89515E-6
14-23530748-G-C p.Pro1119Pro synonymous ACIN1 5 74172 6.74109E-5 37086 1 1.68288E-5
14-23530757-G-C p.Pro1116Pro synonymous ACIN1 2 73368 2.72598E-5 36684 0 5.06837E-6
14-23530763-T-C p.Pro1114Pro synonymous ACIN1 1 73346 1.3634E-5 36673 0 NA
14-23530773-T-C p.Gln1111Arg missense ACIN1 1 72702 1.37548E-5 36351 0 5.59466E-6
14-23530775-C-A p.Glu1110Asp missense ACIN1 2 72296 2.7664E-5 36148 0 6.38407E-5
14-23530788-G-A p.Thr1106Ile missense ACIN1 1 70618 1.41607E-5 35309 0 1.22551E-5
14-23530800-C-T p.Arg1102His missense ACIN1 2 66816 2.99329E-5 33408 0 6.44496E-5
14-23530801-G-A p.Arg1102Cys missense ACIN1 27 66578 4.05539E-4 33289 0 0.00156904
14-23530815-C-T p.Gly1097Asp missense ACIN1 1 62578 1.59801E-5 31289 0 NA
14-23530832-C-CTCATCT c.3274-2_3274-1insAGATGA splice_acceptor ACIN1 1 56672 1.76454E-5 28336 0 NA
14-23531382-C-T p.Asp1090Asn missense ACIN1 1 83348 1.19979E-5 41674 0 NA
14-23531388-C-T p.Glu1088Lys missense ACIN1 2 83360 2.39923E-5 41680 0 4.12025E-5
14-23531389-G-A p.Ala1087Ala synonymous ACIN1 5 83356 5.99837E-5 41678 0 6.59163E-5
14-23531399-G-A p.Ala1084Val missense ACIN1 1 83382 1.1993E-5 41691 0 NA
14-23531422-C-A p.Gln1076His missense ACIN1 1 83402 1.19901E-5 41701 0 NA
14-23531423-T-A p.Gln1076Leu missense ACIN1 1 83402 1.19901E-5 41701 0 NA
14-23531425-G-C p.Pro1075Pro synonymous ACIN1 8 83410 9.59118E-5 41705 0 5.03525E-4
14-23531434-G-A p.Val1072Val synonymous ACIN1 3 83416 3.59643E-5 41708 0 1.59388E-4
14-23531439-C-T p.Gly1071Arg missense ACIN1 11 83406 1.31885E-4 41703 0 2.23172E-4
14-23531440-G-A p.His1070His synonymous ACIN1 1 83408 1.19893E-5 41704 0 6.37349E-5
14-23531458-G-A p.Ala1064Ala synonymous ACIN1 1 83402 1.19901E-5 41701 0 2.78474E-5
14-23531459-G-A p.Ala1064Val missense ACIN1 1 83402 1.19901E-5 41701 0 NA
14-23531470-C-T p.Glu1060Glu synonymous ACIN1 1 83390 1.19918E-5 41695 0 NA
14-23531474-A-G p.Val1059Ala missense ACIN1 1 83390 1.19918E-5 41695 0 2.47097E-5
14-23531487-G-A c.3166-3C>T splice_region ACIN1 3 83380 3.59799E-5 41690 0 1.99029E-5
14-23531618-C-T c.3165+7G>A splice_region ACIN1 1 83390 1.19918E-5 41695 0 1.19291E-5
14-23531626-G-A p.Thr1055Met missense+splice_region ACIN1 3 83406 3.59686E-5 41703 0 9.06066E-5
14-23531627-T-A p.Thr1055Ser missense+splice_region ACIN1 3 83404 3.59695E-5 41702 0 NA
14-23531632-A-T p.Phe1053Tyr missense ACIN1 1 83410 1.1989E-5 41705 0 8.23669E-6
14-23531638-T-C p.His1051Arg missense ACIN1 1 83412 1.19887E-5 41706 0 NA
14-23531643-T-C n.887A>G splice_region ACIN1 1 83410 1.1989E-5 41705 0 NA
14-23531689-C-T p.Arg1034His missense ACIN1 1 83418 1.19878E-5 41709 0 3.18451E-5
14-23531690-G-A p.Arg1034Cys missense ACIN1 1 83414 1.19884E-5 41707 0 NA
14-23531691-C-T p.Gly1033Gly synonymous ACIN1 1 83412 1.19887E-5 41706 0 0.00100705
14-23531696-A-G p.Leu1032Leu synonymous ACIN1 1 83412 1.19887E-5 41706 0 6.36943E-5
14-23532153-G-A p.Val1014Val synonymous ACIN1 2 83338 2.39987E-5 41669 0 NA
14-23532167-T-C p.Ile1010Val missense ACIN1 1 83358 1.19964E-5 41679 0 2.42315E-5
14-23532173-C-T p.Gly1008Ser missense ACIN1 1 83356 1.19967E-5 41678 0 1.65662E-5
14-23532175-C-T p.Arg1007Gln missense ACIN1 1 83352 1.19973E-5 41676 0 8.27609E-6
14-23532186-G-A p.Pro1003Pro synonymous ACIN1 6 83366 7.19718E-5 41683 0 1.59246E-4
14-23532193-T-C p.Gln1001Arg missense ACIN1 280 83368 0.0033586 41684 1 0.00269092
14-23532210-G-A p.Asp995Asp synonymous ACIN1 2 83364 2.39912E-5 41682 0 NA
14-23532230-C-T p.Val989Ile missense ACIN1 1 83362 1.19959E-5 41681 0 NA
14-23532233-C-T p.Gly988Arg missense ACIN1 1 83362 1.19959E-5 41681 0 3.58494E-5
14-23532234-G-C p.Ser987Ser synonymous ACIN1 3 83364 3.59868E-5 41682 0 3.18431E-5
14-23532234-G-A p.Ser987Ser synonymous ACIN1 1 83364 1.19956E-5 41682 0 8.25491E-6
14-23532247-C-T p.Ser983Asn missense ACIN1 1 83370 1.19947E-5 41685 0 NA
14-23532251-T-C p.Ile982Val missense ACIN1 87 83368 0.00104357 41684 2 5.46492E-4
14-23532262-G-A p.Thr978Ile missense ACIN1 2 83360 2.39923E-5 41680 0 NA
14-23532277-A-G p.Leu973Ser missense ACIN1 1 83346 1.19982E-5 41673 0 NA
14-23532640-C-T c.2911+5G>A splice_region ACIN1 7 83344 8.39893E-5 41672 0 4.77616E-4
14-23532646-T-C p.Lys970Lys splice_region+synonymous ACIN1 2 83352 2.39946E-5 41676 0 3.98737E-6
14-23532710-G-A p.Pro949Leu missense ACIN1 1 83376 1.19939E-5 41688 0 NA
14-23532711-G-A p.Pro949Ser missense ACIN1 1 83376 1.19939E-5 41688 0 8.23791E-6
14-23532713-G-A p.Pro948Leu missense ACIN1 1 83368 1.1995E-5 41684 0 8.23791E-6
14-23532725-G-C p.Pro944Arg missense ACIN1 1 83376 1.19939E-5 41688 0 NA
14-23532727-T-C p.Glu943Glu synonymous ACIN1 3 83370 3.59842E-5 41685 0 6.59098E-5
14-23532730-C-A p.Lys942Asn missense ACIN1 1 83368 1.1995E-5 41684 0 NA
14-23532732-TCTCTTCTTC-T p.Glu939_Glu941del conservative_inframe_deletion ACIN1 1 83372 1.19944E-5 41686 0 1.15315E-4
14-23532743-T-C p.Glu938Gly missense ACIN1 12 83366 1.43944E-4 41683 0 0.00100705
14-23532757-C-T p.Gly933Gly synonymous ACIN1 1 83312 1.20031E-5 41656 0 NA
14-23532777-C-G p.Ala927Pro missense ACIN1 1 83244 1.20129E-5 41622 0 NA
14-23533311-T-C c.2769+3A>G splice_region ACIN1 1 83126 1.20299E-5 41563 0 3.9807E-6
14-23533318-G-A p.Thr922Ile missense ACIN1 1 83182 1.20218E-5 41591 0 NA
14-23533343-C-G p.Gly914Arg missense ACIN1 3 83272 3.60265E-5 41636 0 8.2394E-6
14-23533364-C-T p.Asp907Asn missense ACIN1 2 83304 2.40085E-5 41652 0 3.18471E-5
14-23533372-C-T p.Arg904His missense ACIN1 2 83302 2.4009E-5 41651 0 0.00125
14-23533373-G-A p.Arg904Cys missense ACIN1 1 83306 1.20039E-5 41653 0 3.18471E-5
14-23533396-C-T p.Arg896His missense ACIN1 1 83304 1.20042E-5 41652 0 6.25E-4
14-23533450-A-C p.Ile878Ser missense ACIN1 1 83304 1.20042E-5 41652 0 NA
14-23533454-C-T p.Asp877Asn missense ACIN1 4 83308 4.80146E-5 41654 0 1.98969E-5
14-23533455-G-A p.Pro876Pro synonymous ACIN1 1 83312 1.20031E-5 41656 0 1.64761E-5
14-23533466-TCTGGGACACAGATACCCCCCACCCCGTTACACTGGGCCCATGTCTACTCCCACCTTAACAGGTCTCATCCTCCCTTCCCTGGCTCCTCCCACCTCAC-T c.2616+1_2617-1delGTGAGGTGGGAGGAGCCAGGGAAGGGAGGATGAGACCTGTTAAGGTGGGAGTAGACATGGGCCCAGTGTAACGGGGTGGGGGGTATCTGTGTCCCAG splice_acceptor ACIN1 8 83312 9.60246E-5 41656 0 NA
14-23533569-G-A p.Leu871Leu synonymous ACIN1 1 83390 1.19918E-5 41695 0 NA
14-23533652-C-G p.Gly843Ala missense ACIN1 2 83350 2.39952E-5 41675 0 3.18451E-5
14-23533656-C-A p.Gly842Trp missense ACIN1 1 83344 1.19985E-5 41672 0 6.36699E-5
14-23533656-C-G p.Gly842Arg missense ACIN1 1 83344 1.19985E-5 41672 0 6.59076E-5
14-23533657-C-G p.Glu841Asp missense ACIN1 1 83346 1.19982E-5 41673 0 3.1837E-5
14-23533691-G-A p.Thr830Ile missense ACIN1 1 83322 1.20016E-5 41661 0 NA
14-23535176-G-T p.Val827Val splice_region+synonymous ACIN1 1 83162 1.20247E-5 41581 0 NA
14-23535178-C-T p.Val827Ile missense ACIN1 1 83152 1.20262E-5 41576 0 8.23927E-6
14-23535181-C-T p.Val826Ile missense ACIN1 1 83132 1.20291E-5 41566 0 3.1902E-5
14-23535212-C-T p.Ser815Ser synonymous ACIN1 1 83124 1.20302E-5 41562 0 1.59243E-5
14-23535213-G-A p.Ser815Leu missense ACIN1 1 83126 1.20299E-5 41563 0 3.29979E-5
14-23535223-TGAA-T c.2440-9_2440-7delTTC splice_region ACIN1 1 83018 1.20456E-5 41509 0 3.2041E-5
14-23537674-CT-C n.569-2delA splice_acceptor ACIN1 2 66884 2.99025E-5 33442 0 NA
14-23537679-G-A n.569-6C>T splice_region ACIN1 1 66924 1.49423E-5 33462 0 NA
14-23537692-G-C n.577C>G splice_region ACIN1 4 66972 5.97265E-5 33486 0 6.36902E-5
14-23538693-TCTC-T p.Glu810del conservative_inframe_deletion ACIN1 2 83210 2.40356E-5 41605 0 6.36983E-5
14-23538699-C-T p.Glu809Lys missense ACIN1 2 83244 2.40258E-5 41622 0 NA
14-23538699-C-G p.Glu809Gln missense ACIN1 1 83244 1.20129E-5 41622 0 NA
14-23538700-A-G p.Asp808Asp synonymous ACIN1 1 83242 1.20132E-5 41621 0 NA
14-23538714-C-T p.Gly804Ser missense ACIN1 3 83292 3.60179E-5 41646 0 5.03525E-4
14-23538717-C-G p.Glu803Gln missense ACIN1 2 83298 2.40102E-5 41649 0 NA
14-23538718-C-G p.Pro802Pro synonymous ACIN1 5 83296 6.00269E-5 41648 0 9.55231E-5
14-23538719-G-C p.Pro802Arg missense ACIN1 1 83290 1.20062E-5 41645 0 NA
14-23538720-G-T p.Pro802Thr missense ACIN1 1 83294 1.20057E-5 41647 0 8.24674E-6
14-23538722-C-T p.Arg801His missense ACIN1 6 83294 7.2034E-5 41647 0 3.18492E-5
14-23538729-C-A p.Asp799Tyr missense ACIN1 2 83300 2.40096E-5 41650 0 NA
14-23538741-G-C p.Gln795Glu missense ACIN1 1 83294 1.20057E-5 41647 0 NA
14-23538750-T-C p.Ile792Val missense ACIN1 4 83300 4.80192E-5 41650 0 6.37349E-5
14-23538777-T-C p.Asn783Asp missense ACIN1 1 83228 1.20152E-5 41614 0 NA
14-23538779-T-C p.Glu782Gly missense ACIN1 1 83222 1.20161E-5 41611 0 2.47696E-5
14-23538788-T-C p.Asn779Ser missense ACIN1 3 83172 3.60698E-5 41586 0 8.39362E-5
14-23538789-T-C p.Asn779Asp missense ACIN1 1 83170 1.20236E-5 41585 0 NA
14-23538794-C-T p.Ser777Asn missense ACIN1 1 83082 1.20363E-5 41541 0 1.2036E-5
14-23538798-T-C p.Thr776Ala missense ACIN1 8 83016 9.6367E-5 41508 0 9.65103E-5
14-23538803-A-G p.Met774Thr missense ACIN1 2 82910 2.41225E-5 41455 0 NA
14-23538814-C-T p.Glu770Glu synonymous ACIN1 1 82516 1.21189E-5 41258 0 NA
14-23538818-T-G p.Lys769Thr missense ACIN1 1 82264 1.2156E-5 41132 0 NA
14-23538819-TCTC-T p.Glu768del conservative_inframe_deletion ACIN1 1 82104 1.21797E-5 41052 0 1.24137E-5
14-23538819-T-C p.Lys769Glu missense ACIN1 1 82104 1.21797E-5 41052 0 1.68418E-5
14-23538826-A-AGGCAAACCCCGAGTTCGG c.2298-1_2298insCCGAACTCGGGGTTTGCC splice_acceptor ACIN1 1 81254 1.23071E-5 40627 0 NA
14-23538828-T-TG c.2298-3_2298-2insC splice_region ACIN1 1 80894 1.23619E-5 40447 0 NA
14-23538831-C-A c.2298-5G>T splice_region ACIN1 5 80370 6.22123E-5 40185 0 4.47403E-6
14-23538831-C-T c.2298-5G>A splice_region ACIN1 1 80380 1.24409E-5 40190 0 8.94807E-6
14-23538832-A-G c.2298-6T>C splice_region ACIN1 3 80112 3.74476E-5 40056 0 9.36146E-6
14-23538832-A-T c.2298-6T>A splice_region ACIN1 1 80150 1.24766E-5 40075 0 NA
14-23540344-T-C p.Ser5Gly missense ACIN1 1 82670 1.20963E-5 41335 0 6.35017E-6
14-23540347-C-T p.Glu4Lys missense ACIN1 3 82668 3.62897E-5 41334 0 1.91388E-4
14-23540355-A-G p.Met1? start_lost ACIN1 1 82658 1.2098E-5 41329 0 1.27099E-5
14-23540393-T-C c.-37A>G splice_region ACIN1 1 82594 1.21074E-5 41297 0 NA
14-23540421-C-A c.-65G>T 5_prime_UTR_premature_start_codon_gain ACIN1 1 82434 1.21309E-5 41217 0 NA
14-23540426-A-C c.-70T>G 5_prime_UTR_premature_start_codon_gain ACIN1 1 82390 1.21374E-5 41195 0 NA
14-23540437-T-A c.-81A>T 5_prime_UTR_premature_start_codon_gain ACIN1 1 82294 1.21516E-5 41147 0 NA
14-23540478-A-G c.-122T>C 5_prime_UTR_premature_start_codon_gain ACIN1 1 81430 1.22805E-5 40715 0 NA
14-23540489-C-T c.-133G>A 5_prime_UTR_premature_start_codon_gain ACIN1 2 81090 2.4664E-5 40545 0 1.27453E-4
14-23540507-G-A c.-151C>T 5_prime_UTR_premature_start_codon_gain ACIN1 6 80922 7.41455E-5 40461 0 NA
14-23540539-C-A c.-183G>T 5_prime_UTR_premature_start_codon_gain ACIN1 7 81454 8.59381E-5 40727 0 0.0018797
14-23540540-G-A c.-184C>T 5_prime_UTR_premature_start_codon_gain ACIN1 4 81492 4.90846E-5 40746 0 3.18735E-5
14-23540549-A-C c.-193T>G 5_prime_UTR_premature_start_codon_gain ACIN1 2 81684 2.44846E-5 40842 0 NA
14-23540585-G-A c.-229C>T 5_prime_UTR_premature_start_codon_gain ACIN1 4 81894 4.88436E-5 40947 0 9.55779E-5
14-23540623-G-A c.-267C>T 5_prime_UTR_premature_start_codon_gain ACIN1 10 81850 1.22175E-4 40925 0 2.22973E-4
14-23540635-C-T c.116+1G>A splice_donor ACIN1 1 81782 1.22276E-5 40891 0 1.94333E-5
14-23540638-C-T p.Leu38Leu splice_region+synonymous ACIN1 1 81766 1.223E-5 40883 0 1.29505E-5
14-23540645-C-T p.Arg36Gln missense ACIN1 3 81736 3.67035E-5 40868 0 5.04898E-5
14-23540646-G-A p.Arg36Trp missense ACIN1 3 81734 3.67044E-5 40867 0 5.04643E-5
14-23540651-C-T p.Arg34Gln missense ACIN1 4 81710 4.89536E-5 40855 0 3.18695E-5
14-23540652-G-A p.Arg34* stop_gained ACIN1 42 81700 5.14076E-4 40850 0 0.00106383
14-23540656-G-A p.Ser32Ser synonymous ACIN1 1 81686 1.2242E-5 40843 0 1.00806E-4
14-23540663-T-G p.Asp30Ala missense ACIN1 2 81648 2.44954E-5 40824 0 6.46948E-6
14-23540667-T-TC p.Arg29fs frameshift ACIN1 1 81656 1.22465E-5 40828 0 NA
14-23540671-GAGA-G p.Leu27del disruptive_inframe_deletion ACIN1 2 81658 2.44924E-5 40829 0 3.18532E-5
14-23540674-A-G p.Leu26Leu synonymous ACIN1 301 81652 0.00368638 40826 3 0.00783989
14-23540675-A-C p.Leu26Arg missense ACIN1 1 81658 1.22462E-5 40829 0 3.18492E-5
14-23540676-G-A p.Leu26Phe missense ACIN1 5 81662 6.1228E-5 40831 0 5.17163E-5
14-23540679-G-A p.Leu25Phe missense ACIN1 2 81676 2.4487E-5 40838 0 NA
14-23540687-G-A p.Ala22Val missense ACIN1 2 81642 2.44972E-5 40821 0 1.27429E-4
14-23540695-G-A p.Ser19Ser synonymous ACIN1 1 81568 1.22597E-5 40784 0 6.36983E-5
14-23540700-T-C p.Thr18Ala missense ACIN1 1 81558 1.22612E-5 40779 0 NA
14-23540704-G-A p.Ala16Ala synonymous ACIN1 2 81564 2.45206E-5 40782 0 2.50175E-4
14-23540710-C-T p.Glu14Glu synonymous ACIN1 3 81552 3.67863E-5 40776 0 1.29087E-5
14-23540715-T-C p.Ile13Val missense ACIN1 1 81566 1.226E-5 40783 0 NA
14-23540724-C-T p.Ala10Thr missense ACIN1 17 81532 2.08507E-4 40766 0 0.00109616
14-23540725-G-A c.-129C>T 5_prime_UTR_premature_start_codon_gain ACIN1 7 81528 8.58601E-5 40764 0 9.94728E-5
14-23540728-G-C p.Arg8Arg synonymous ACIN1 1 81500 1.22699E-5 40750 0 6.44504E-6
14-23540729-C-T p.Arg8His missense ACIN1 4 81488 4.9087E-5 40744 0 3.22664E-5
14-23540730-G-A p.Arg8Cys missense ACIN1 17 81510 2.08563E-4 40755 0 0.00207039
14-23540734-G-A c.-138C>T 5_prime_UTR_premature_start_codon_gain ACIN1 1 81486 1.2272E-5 40743 0 NA
14-23540736-G-A p.Arg6Cys missense ACIN1 18 81508 2.20837E-4 40754 0 6.26566E-4
14-23540744-G-A p.Pro3Leu missense ACIN1 10 81506 1.2269E-4 40753 0 1.50015E-4
14-23540795-G-A c.-199C>T 5_prime_UTR_premature_start_codon_gain ACIN1 5 80762 6.19103E-5 40381 0 0.00129032
14-23547371-A-T p.Ile762Ile synonymous ACIN1 242 83322 0.0029044 41661 2 0.0060423
14-23547375-C-A p.Arg761Ile missense ACIN1 1 83318 1.20022E-5 41659 0 3.97712E-6
14-23547378-T-A p.Glu760Val missense ACIN1 2 83336 2.39992E-5 41668 0 NA
14-23547380-T-G p.Ser759Ser synonymous ACIN1 1 83338 1.19993E-5 41669 0 NA
14-23547380-T-C p.Ser759Ser synonymous ACIN1 1 83338 1.19993E-5 41669 0 NA
14-23547387-G-C p.Pro757Arg missense ACIN1 1 83354 1.1997E-5 41677 0 5.03525E-4
14-23547391-G-C p.Leu756Val missense ACIN1 1 83362 1.19959E-5 41681 0 NA
14-23547413-G-A p.Thr748Thr synonymous ACIN1 2 83372 2.39889E-5 41686 0 NA
14-23547415-T-C p.Thr748Ala missense ACIN1 2 83370 2.39894E-5 41685 0 8.23669E-6
14-23547416-T-C p.Gln747Gln synonymous ACIN1 101 83364 0.00121155 41682 2 0.011875
14-23547419-G-A p.Pro746Pro synonymous ACIN1 1 83364 1.19956E-5 41682 0 3.18471E-5
14-23547434-T-C p.Pro741Pro synonymous ACIN1 4 83356 4.79869E-5 41678 0 1.9885E-5
14-23547438-G-A p.Pro740Leu missense ACIN1 1 83354 1.1997E-5 41677 0 NA
14-23547442-C-G p.Glu739Gln missense ACIN1 7 83354 8.39792E-5 41677 0 1.6475E-5
14-23547444-G-A p.Ala738Val missense ACIN1 1 83346 1.19982E-5 41673 0 NA
14-23547475-C-CCCGCTCAGG c.2182-1_2182insCCTGAGCGG splice_acceptor ACIN1 4 83266 4.80388E-5 41633 2 NA
14-23547478-G-GCAGTTGTGGCACTGGTGGAGTTGCAACC c.2182-4_2182-3insGGTTGCAACTCCACCAGTGCCACAACTG splice_region ACIN1 1 83238 1.20137E-5 41619 0 NA
14-23547483-G-C c.2182-8C>G splice_region ACIN1 1 83184 1.20215E-5 41592 0 2.47345E-5
14-23548021-T-C c.2181+8A>G splice_region ACIN1 1 81636 1.22495E-5 40818 0 4.25423E-5
14-23548025-C-T c.2181+4G>A splice_region ACIN1 1 81750 1.22324E-5 40875 0 3.99799E-6
14-23548030-C-A p.Arg727Leu missense+splice_region ACIN1 2 81822 2.44433E-5 40911 0 3.18512E-5
14-23548031-G-A p.Arg727Trp missense+splice_region ACIN1 3 81830 3.66614E-5 40915 0 0.00125786
14-23548036-G-A p.Pro725Leu missense ACIN1 1 81988 1.21969E-5 40994 0 NA
14-23548059-C-G p.Lys717Asn missense ACIN1 2 82726 2.41762E-5 41363 0 3.18613E-5
14-23548073-C-T p.Glu713Lys missense ACIN1 2 82982 2.41016E-5 41491 0 NA
14-23548075-G-A p.Pro712Leu missense ACIN1 8 83022 9.636E-5 41511 0 4.37598E-5
14-23548081-C-T p.Ser710Asn missense ACIN1 5 83108 6.01627E-5 41554 0 1.59297E-4
14-23548087-C-T p.Arg708His missense ACIN1 3 83162 3.60742E-5 41581 0 3.29968E-5
14-23548098-G-A p.Val704Val synonymous ACIN1 2 83232 2.40292E-5 41616 0 NA
14-23548107-T-C p.Ser701Ser synonymous ACIN1 2 83276 2.40165E-5 41638 0 NA
14-23548112-A-T p.Ser700Thr missense ACIN1 1 83278 1.2008E-5 41639 0 NA
14-23548138-C-G p.Cys691Ser missense ACIN1 2 83306 2.40079E-5 41653 0 1.19318E-5
14-23548138-C-A p.Cys691Phe missense ACIN1 2 83306 2.40079E-5 41653 0 7.95456E-6
14-23548149-T-C p.Gln687Gln synonymous ACIN1 1 83320 1.20019E-5 41660 0 8.25151E-6
14-23548162-G-A p.Pro683Leu missense ACIN1 2 83322 2.40033E-5 41661 0 NA
14-23548202-C-T p.Glu670Lys missense ACIN1 1 83288 1.20065E-5 41644 0 NA
14-23548214-T-C p.Thr666Ala missense ACIN1 1 83256 1.20111E-5 41628 0 NA
14-23548219-C-G p.Ser664Thr missense ACIN1 4 83222 4.80642E-5 41611 0 1.76964E-4
14-23548246-G-A p.Ser655Phe missense+splice_region ACIN1 1 82922 1.20595E-5 41461 0 NA
14-23548247-A-ATTTT c.1963-1_1963insAAAA splice_acceptor ACIN1 2 82900 2.41255E-5 41450 1 NA
14-23548252-A-C c.1963-5T>G splice_region ACIN1 4 82752 4.83372E-5 41376 0 3.22178E-4
14-23548254-C-G c.1963-7G>C splice_region ACIN1 1 82690 1.20934E-5 41345 0 3.18674E-5
14-23548763-C-A p.Ser652Ile missense ACIN1 4 83354 4.79881E-5 41677 0 1.99709E-5
14-23548777-T-TGAATGA p.Ser647_Ala648insHisSer disruptive_inframe_insertion ACIN1 3 83366 3.59859E-5 41683 0 9.32679E-6
14-23548781-C-CAA p.Arg646fs frameshift ACIN1 1 83364 1.19956E-5 41682 0 NA
14-23548782-G-A p.Arg646Cys missense ACIN1 1 83368 1.1995E-5 41684 0 1.68073E-5
14-23548783-A-AGAACGT p.Ser645_Arg646insArgSer disruptive_inframe_insertion ACIN1 25936 82878 0.312942 41439 4473 0.343804
14-23548783-A-AGAACGTGAACGT p.Ser645_Arg646insArgSerArgSer disruptive_inframe_insertion ACIN1 451 83344 0.00541131 41672 6 0.0097394
14-23548783-A-AGAACAT p.Ser645_Arg646insCysSer disruptive_inframe_insertion ACIN1 3 83372 3.59833E-5 41686 0 7.47508E-5
14-23548783-A-T p.Ser645Ser synonymous ACIN1 11 83372 1.31939E-4 41686 0 0.0801411
14-23548783-A-AGAACGAGAACGT p.Ser645_Arg646insArgSerArgSer disruptive_inframe_insertion ACIN1 6 83370 7.19683E-5 41685 0 NA
14-23548783-A-AACGT p.Ala648fs frameshift ACIN1 1 83372 1.19944E-5 41686 0 NA
14-23548787-C-CGTGAAT p.Ser643_Arg644insHisSer conservative_inframe_insertion ACIN1 11394 83122 0.137076 41561 834 0.143303
14-23548793-C-CGTGAAT p.Ser641_Arg642insHisSer conservative_inframe_insertion ACIN1 4 83376 4.79754E-5 41688 0 4.12548E-5
14-23548794-G-A p.Arg642Cys missense ACIN1 2 83378 2.39871E-5 41689 0 1.40047E-4
14-23548801-T-A p.Ser639Ser synonymous ACIN1 2 83366 2.39906E-5 41683 0 NA
14-23548812-C-G p.Glu636Gln missense ACIN1 5 83382 5.9965E-5 41691 0 0.00100705
14-23548816-T-A p.Thr634Thr synonymous ACIN1 2 83386 2.39848E-5 41693 0 NA
14-23548825-G-A p.Ser631Ser synonymous ACIN1 1 83382 1.1993E-5 41691 0 1.19318E-5
14-23548847-C-T p.Arg624His missense ACIN1 12 83380 1.43919E-4 41690 0 9.94202E-5
14-23548848-G-A p.Arg624Cys missense ACIN1 2 83384 2.39854E-5 41692 0 7.41278E-5
14-23548850-G-C p.Pro623Arg missense ACIN1 1 83384 1.19927E-5 41692 0 NA
14-23548853-T-C p.Asn622Ser missense ACIN1 3 83378 3.59807E-5 41689 0 3.18451E-5
14-23548865-C-T p.Arg618His missense ACIN1 2 83382 2.3986E-5 41691 0 4.11828E-5
14-23548866-G-A p.Arg618Cys missense ACIN1 1 83382 1.1993E-5 41691 0 NA
14-23548872-G-C p.Gln616Glu missense ACIN1 1 83376 1.19939E-5 41688 0 NA
14-23548874-G-A p.Ala615Val missense ACIN1 2 83378 2.39871E-5 41689 0 3.18132E-5
14-23548882-T-A p.Arg612Ser missense ACIN1 2 83388 2.39843E-5 41694 0 1.98828E-5
14-23548886-T-C p.Gln611Arg missense ACIN1 1 83390 1.19918E-5 41695 0 3.18492E-5
14-23548900-C-T p.Pro606Pro synonymous ACIN1 5 83384 5.99635E-5 41692 0 3.18674E-5
14-23548904-G-A p.Ser605Leu missense ACIN1 1 83386 1.19924E-5 41693 0 NA
14-23548927-G-A p.Asp597Asp synonymous ACIN1 332 83366 0.00398244 41683 0 0.00563547
14-23548928-T-C p.Asp597Gly missense ACIN1 2 83362 2.39917E-5 41681 0 3.18878E-5
14-23548929-C-A p.Asp597Tyr missense ACIN1 2 83360 2.39923E-5 41680 0 2.47145E-5
14-23548929-C-T p.Asp597Asn missense ACIN1 4 83362 4.79835E-5 41681 0 8.35196E-5
14-23548936-G-A p.Arg594Arg synonymous ACIN1 1 83360 1.19962E-5 41680 0 NA
14-23548937-C-T p.Arg594His missense ACIN1 4 83354 4.79881E-5 41677 0 0.00100705
14-23548938-G-A p.Arg594Cys missense ACIN1 3 83358 3.59893E-5 41679 0 5.76578E-5
14-23548939-A-G p.Ser593Ser synonymous ACIN1 30 83356 3.59902E-4 41678 0 3.78888E-4
14-23548973-G-C p.Ser582Cys missense ACIN1 1 83342 1.19988E-5 41671 0 NA
14-23548979-C-T p.Arg580Gln missense ACIN1 4 83332 4.80008E-5 41666 0 3.29468E-5
14-23548980-G-A p.Arg580Trp missense ACIN1 15 83332 1.80003E-4 41666 0 6.25E-4
14-23548998-C-A p.Ala574Ser missense ACIN1 2 83330 2.4001E-5 41665 0 NA
14-23549003-T-C p.Gln572Arg missense ACIN1 1 83336 1.19996E-5 41668 0 3.18552E-5
14-23549022-G-A p.Pro566Ser missense ACIN1 6 83346 7.19891E-5 41673 0 1.91192E-4
14-23549034-GAGA-G p.Ser561del conservative_inframe_deletion ACIN1 2 83334 2.39998E-5 41667 0 3.18613E-5
14-23549038-A-G p.Ala560Ala synonymous ACIN1 2 83326 2.40021E-5 41663 0 2.78401E-5
14-23549038-A-C p.Ala560Ala synonymous ACIN1 1 83326 1.20011E-5 41663 0 NA
14-23549039-G-A p.Ala560Val missense ACIN1 28 83328 3.36022E-4 41664 0 0.00302115
14-23549057-T-G p.Gln554Pro missense ACIN1 3 83332 3.60006E-5 41666 0 3.97668E-6
14-23549071-C-T p.Gln549Gln synonymous ACIN1 1 83318 1.20022E-5 41659 0 NA
14-23549081-C-T p.Cys546Tyr missense ACIN1 2 83302 2.4009E-5 41651 0 3.97706E-6
14-23549087-T-G p.Glu544Ala missense ACIN1 2 83292 2.40119E-5 41646 0 NA
14-23549090-G-A p.Thr543Ile missense ACIN1 3 83290 3.60187E-5 41645 0 NA
14-23549094-T-C p.Ile542Val missense ACIN1 2 83276 2.40165E-5 41638 0 3.18471E-5
14-23549104-C-T p.Leu538Leu synonymous ACIN1 1 83210 1.20178E-5 41605 0 3.29614E-5
14-23549120-A-G p.Ile533Thr missense ACIN1 1 83166 1.20241E-5 41583 0 NA
14-23549129-G-A p.Pro530Leu missense ACIN1 11 83132 1.3232E-4 41566 0 5.17335E-5
14-23549136-G-A p.Pro528Ser missense ACIN1 3 83060 3.61185E-5 41530 0 0.00125
14-23549139-G-C p.Gln527Glu missense ACIN1 2 83056 2.40801E-5 41528 0 NA
14-23549142-C-G p.Ala526Pro missense ACIN1 1 83050 1.20409E-5 41525 0 NA
14-23549147-C-A p.Arg524Ile missense ACIN1 1 83046 1.20415E-5 41523 0 NA
14-23549149-G-A p.Asp523Asp synonymous ACIN1 2 83024 2.40894E-5 41512 0 1.64957E-5
14-23549165-A-T p.Leu518His missense ACIN1 21 83008 2.52988E-4 41504 0 7.64818E-4
14-23549179-T-C p.Ser513Ser synonymous ACIN1 19 82960 2.29026E-4 41480 1 8.16291E-4
14-23549183-T-C p.Tyr512Cys missense ACIN1 1 82942 1.20566E-5 41471 0 3.98134E-6
14-23549184-A-G p.Tyr512His missense ACIN1 1 82928 1.20587E-5 41464 0 1.64995E-5
14-23549209-C-A p.Leu503Leu synonymous ACIN1 1 82836 1.2072E-5 41418 0 NA
14-23549211-G-C p.Leu503Val missense ACIN1 44 82850 5.3108E-4 41425 0 6.25E-4
14-23549225-TCC-CCT p.GluGlu497GluGly missense ACIN1 1 82794 1.20782E-5 41397 0 NA
14-23549227-C-T p.Glu497Glu synonymous ACIN1 4 82802 4.8308E-5 41401 0 5.03525E-4
14-23549230-T-C p.Pro496Pro synonymous ACIN1 2 82800 2.41546E-5 41400 0 8.24865E-6
14-23549231-G-A p.Pro496Leu missense ACIN1 2 82778 2.4161E-5 41389 0 NA
14-23549233-C-T p.Val495Val synonymous ACIN1 1 82788 1.2079E-5 41394 0 8.2481E-6
14-23549237-T-A p.Lys494Ile missense ACIN1 1 82830 1.20729E-5 41415 0 NA
14-23549240-T-A p.Glu493Val missense ACIN1 1 82842 1.20712E-5 41421 0 NA
14-23549243-G-C p.Ala492Gly missense ACIN1 1 82838 1.20718E-5 41419 0 NA
14-23549256-C-T p.Ala488Thr missense ACIN1 3 82912 3.61829E-5 41456 0 1.59219E-5
14-23549278-C-G p.Leu480Phe missense ACIN1 13 83020 1.56589E-4 41510 0 1.31933E-4
14-23549285-G-A p.Ser478Phe missense ACIN1 4331 82918 0.0522323 41459 123 0.06875
14-23549285-G-C p.Ser478Cys missense ACIN1 1 83032 1.20435E-5 41516 0 3.97905E-6
14-23549293-T-C p.Gly475Gly synonymous ACIN1 2 83054 2.40807E-5 41527 0 NA
14-23549296-T-C p.Val474Val synonymous ACIN1 1 83062 1.20392E-5 41531 0 NA
14-23549301-A-T p.Leu473Met missense ACIN1 2 83082 2.40726E-5 41541 0 NA
14-23549303-TGGA-T p.Val471_Gln472delinsGlu disruptive_inframe_deletion ACIN1 2 83090 2.40703E-5 41545 0 NA
14-23549310-T-C p.Thr470Ala missense ACIN1 1 83092 1.20349E-5 41546 0 3.97807E-6
14-23549312-T-C p.His469Arg missense ACIN1 1 83096 1.20343E-5 41548 0 NA
14-23549319-A-G p.Ser467Pro missense ACIN1 35520 82776 0.42911 41388 7730 0.523125
14-23549346-C-T p.Asp458Asn missense ACIN1 2 83144 2.40547E-5 41572 0 3.18654E-5
14-23549352-TAGG-T p.Pro455del conservative_inframe_deletion ACIN1 2 83132 2.40581E-5 41566 0 7.16053E-5
14-23549360-G-A p.Ser453Phe missense ACIN1 1 83130 1.20294E-5 41565 0 NA
14-23549377-A-AG p.Val448fs frameshift ACIN1 1 83096 1.20343E-5 41548 0 3.29875E-5
14-23549377-AGC-A p.Ala447fs frameshift ACIN1 2 83104 2.40662E-5 41552 0 NA
14-23549378-G-C p.Ala447Gly missense ACIN1 2 83094 2.40691E-5 41547 0 1.64921E-5
14-23549379-C-G p.Ala447Pro missense ACIN1 81355 82670 0.984093 41335 40576 0.999375
14-23549379-CG-GA p.ProAla446ProPro missense ACIN1 1073 83078 0.0129156 41539 521 NA
14-23549379-C-T p.Ala447Thr missense ACIN1 1 83082 1.20363E-5 41541 0 3.18634E-5
14-23549379-C-A p.Ala447Ser missense ACIN1 1 83082 1.20363E-5 41541 0 2.38715E-5
14-23549380-G-A p.Pro446Pro synonymous ACIN1 10608 82942 0.127897 41471 349 0.1975
14-23549380-G-C p.Pro446Pro synonymous ACIN1 18 83080 2.16659E-4 41540 0 2.55151E-4
14-23549381-G-GAT p.Pro446fs frameshift ACIN1 2 83092 2.40697E-5 41546 0 NA
14-23549383-G-T p.Ala445Ala synonymous ACIN1 4339 82974 0.0522935 41487 123 0.06875
14-23549383-G-A p.Ala445Ala synonymous ACIN1 4 83082 4.81452E-5 41541 0 1.40188E-4
14-23549383-G-C p.Ala445Ala synonymous ACIN1 1 83082 1.20363E-5 41541 0 3.18796E-5
14-23549390-C-A p.Gly443Val missense ACIN1 1 83074 1.20375E-5 41537 0 NA
14-23549394-C-T p.Glu442Lys missense ACIN1 6 83072 7.22265E-5 41536 0 4.77745E-5
14-23549405-A-C p.Ile438Arg missense ACIN1 5 83054 6.02018E-5 41527 0 1.91461E-4
14-23549415-C-T p.Glu435Lys missense ACIN1 1 83000 1.20482E-5 41500 0 5.77624E-5
14-23549416-G-C p.Ser434Arg missense ACIN1 6 82986 7.23014E-5 41493 0 5.03284E-4
14-23549416-G-A p.Ser434Ser synonymous ACIN1 2 82986 2.41005E-5 41493 0 5.17656E-5
14-23549418-T-C p.Ser434Gly missense ACIN1 1 82982 1.20508E-5 41491 0 2.78729E-5
14-23549428-T-C p.Pro430Pro synonymous ACIN1 1 82996 1.20488E-5 41498 0 0.001875
14-23549435-G-A p.Pro428Leu missense ACIN1 1 83002 1.20479E-5 41501 0 NA
14-23549440-TGGA-T p.Pro426del disruptive_inframe_deletion ACIN1 2 82990 2.40993E-5 41495 0 3.58172E-5
14-23549443-A-T p.Ser425Ser synonymous ACIN1 3 82988 3.61498E-5 41494 0 6.37349E-5
14-23549444-G-A p.Ser425Phe missense ACIN1 60 83004 7.22857E-4 41502 0 4.04017E-4
14-23549463-G-C p.Leu419Val missense ACIN1 1 83100 1.20337E-5 41550 0 3.18573E-5
14-23549469-G-A p.Pro417Ser missense ACIN1 1 83118 1.20311E-5 41559 0 NA
14-23549477-G-A p.Thr414Ile missense ACIN1 1 83156 1.20256E-5 41578 0 1.6478E-5
14-23549487-C-T p.Glu411Lys missense ACIN1 6 83218 7.20998E-5 41609 0 3.18735E-5
14-23549507-A-T p.Leu404Gln missense ACIN1 1 83286 1.20068E-5 41643 0 6.37186E-5
14-23549510-G-A p.Ala403Val missense ACIN1 18 83292 2.16107E-4 41646 0 3.22193E-4
14-23549523-CCTT-C p.Lys398del conservative_inframe_deletion ACIN1 1 83310 1.20034E-5 41655 0 NA
14-23549532-G-C p.Arg396Gly missense ACIN1 1 83320 1.20019E-5 41660 0 NA
14-23549552-G-A p.Pro389Leu missense ACIN1 4 83334 4.79996E-5 41667 0 1.64807E-5
14-23549561-G-C p.Ser386Cys missense ACIN1 1 83328 1.20008E-5 41664 0 3.97814E-5
14-23549566-C-T p.Ser384Ser synonymous ACIN1 1 83316 1.20025E-5 41658 0 7.95672E-6
14-23549567-G-C p.Ser384Trp missense ACIN1 1 83304 1.20042E-5 41652 0 NA
14-23549583-C-T p.Gly379Ser missense ACIN1 1 83294 1.20057E-5 41647 0 8.24185E-6
14-23549584-T-C p.Gln378Gln synonymous ACIN1 25 83294 3.00142E-4 41647 0 9.56389E-5
14-23549601-C-T p.Glu373Lys missense ACIN1 1 83304 1.20042E-5 41652 0 1.64848E-5
14-23549606-T-C p.Glu371Gly missense ACIN1 1 83306 1.20039E-5 41653 0 1.64834E-5
14-23549612-T-A p.Glu369Val missense ACIN1 1 83306 1.20039E-5 41653 0 8.24239E-6
14-23549624-G-A p.Ser365Phe missense ACIN1 1 83306 1.20039E-5 41653 0 NA
14-23549625-ATGT-A p.Thr364del conservative_inframe_deletion ACIN1 2 83304 2.40085E-5 41652 0 8.24185E-6
14-23549626-T-C p.Thr364Thr synonymous ACIN1 178 83312 0.00213655 41656 0 0.00436639
14-23549627-G-A p.Thr364Ile missense ACIN1 2 83314 2.40056E-5 41657 0 5.03525E-4
14-23549628-T-G p.Thr364Pro missense ACIN1 1 83316 1.20025E-5 41658 0 NA
14-23549636-A-G p.Met361Thr missense ACIN1 2 83298 2.40102E-5 41649 0 NA
14-23549648-T-G p.Gln357Pro missense ACIN1 1 83314 1.20028E-5 41657 0 NA
14-23549674-T-C p.Arg348Arg synonymous ACIN1 1 83328 1.20008E-5 41664 0 NA
14-23549694-T-C p.Arg342Gly missense ACIN1 1 83346 1.19982E-5 41673 0 7.41449E-5
14-23549699-A-C p.Phe340Cys missense ACIN1 1 83340 1.1999E-5 41670 0 NA
14-23549715-C-T p.Glu335Lys missense ACIN1 1 83348 1.19979E-5 41674 0 NA
14-23549726-T-C p.Gln331Arg missense ACIN1 1 83350 1.19976E-5 41675 0 6.25E-4
14-23549737-T-A p.Arg327Ser missense ACIN1 8 83358 9.59716E-5 41679 0 1.94862E-4
14-23549739-T-C p.Arg327Gly missense ACIN1 2 83356 2.39935E-5 41678 0 NA
14-23549744-T-G p.Lys325Thr missense ACIN1 1 83352 1.19973E-5 41676 0 NA
14-23549745-T-G p.Lys325Gln missense ACIN1 1 83350 1.19976E-5 41675 0 3.97687E-6
14-23549747-G-A p.Pro324Leu missense ACIN1 23 83340 2.75978E-4 41670 0 3.954E-4
14-23549762-A-G p.Met319Thr missense ACIN1 1 83344 1.19985E-5 41672 0 3.29489E-5
14-23549770-T-C p.Pro316Pro synonymous ACIN1 5 83336 5.99981E-5 41668 0 8.2371E-6
14-23549785-T-C p.Ile311Met missense ACIN1 37072 82530 0.449194 41265 8456 0.530625
14-23549787-T-C p.Ile311Val missense ACIN1 1 83336 1.19996E-5 41668 0 3.9769E-6
14-23549789-T-G p.Glu310Ala missense ACIN1 2 83330 2.4001E-5 41665 0 1.98851E-5
14-23549790-C-T p.Glu310Lys missense ACIN1 1 83330 1.20005E-5 41665 0 8.23696E-6
14-23549796-C-T p.Gly308Arg missense ACIN1 12 83326 1.44013E-4 41663 0 3.82287E-4
14-23549797-T-A p.Glu307Asp missense ACIN1 13 83324 1.56017E-4 41662 0 5.03525E-4
14-23549798-T-A p.Glu307Val missense ACIN1 2 83324 2.40027E-5 41662 0 1.98864E-5
14-23549822-G-A p.Pro299Leu missense ACIN1 11 83304 1.32046E-4 41652 0 6.37836E-5
14-23549824-T-G p.Ala298Ala synonymous ACIN1 1 83308 1.20036E-5 41654 0 NA
14-23549833-A-C p.Ser295Ser synonymous ACIN1 6 83302 7.20271E-5 41651 0 7.96527E-5
14-23549845-C-T p.Glu291Glu synonymous ACIN1 2 83286 2.40136E-5 41643 0 5.58307E-5
14-23549850-C-A p.Asp290Tyr missense ACIN1 54 83286 6.48368E-4 41643 0 0.00111785
14-23549857-T-C p.Glu287Glu synonymous ACIN1 1 83270 1.20091E-5 41635 0 NA
14-23549860-CTCT-C p.Glu286del disruptive_inframe_deletion ACIN1 13 83266 1.56126E-4 41633 1 3.19939E-4
14-23549863-T-C p.Glu285Glu synonymous ACIN1 6 83264 7.206E-5 41632 0 3.70908E-4
14-23549864-TC-T p.Glu285fs frameshift ACIN1 1 83262 1.20103E-5 41631 0 NA
14-23549866-TTCA-T p.Asp283del disruptive_inframe_deletion ACIN1 10 83262 1.20103E-4 41631 0 1.28254E-4
14-23549866-TTC-T p.Glu284fs frameshift ACIN1 1 83262 1.20103E-5 41631 0 NA
14-23549866-T-A p.Glu284Asp missense ACIN1 1 83262 1.20103E-5 41631 0 4.00224E-6
14-23549869-A-T p.Asp283Glu missense ACIN1 2 83258 2.40217E-5 41629 0 NA
14-23549872-A-T p.Asp282Glu missense ACIN1 3 83256 3.60334E-5 41628 0 3.29848E-5
14-23549875-T-A p.Glu281Asp missense ACIN1 5 83250 6.00601E-5 41625 0 2.00494E-5
14-23549878-TTCC-T p.Glu280del disruptive_inframe_deletion ACIN1 6006 83128 0.07225 41564 261 0.0844363
14-23549878-T-TTCC p.Glu279dup conservative_inframe_insertion ACIN1 14 83248 1.68172E-4 41624 0 2.3084E-4
14-23549878-TTCCTCC-T p.Glu279_Glu280del disruptive_inframe_deletion ACIN1 8 83248 9.60984E-5 41624 0 1.31909E-4
14-23549878-T-C p.Glu280Glu synonymous ACIN1 5 83248 6.00615E-5 41624 0 5.03525E-4
14-23549881-C-T p.Glu279Glu synonymous ACIN1 2 83110 2.40645E-5 41555 0 6.40041E-5
14-23549884-C-T p.Glu278Glu synonymous ACIN1 1 83222 1.20161E-5 41611 0 3.30077E-5
14-23549887-C-T p.Glu277Glu synonymous ACIN1 1 83206 1.20184E-5 41603 0 8.02749E-6
14-23549893-C-T p.Glu275Glu synonymous ACIN1 1 83206 1.20184E-5 41603 0 5.03525E-4
14-23549895-C-T p.Glu275Lys missense ACIN1 1 83202 1.20189E-5 41601 0 8.23913E-6
14-23549896-C-G p.Glu274Asp missense ACIN1 1 83202 1.20189E-5 41601 0 NA
14-23549901-C-T p.Glu273Lys missense ACIN1 1 83200 1.20192E-5 41600 0 NA
14-23549902-TTCC-T p.Glu272del disruptive_inframe_deletion ACIN1 3 83196 3.60594E-5 41598 0 4.01748E-6
14-23549925-G-C p.Arg265Gly missense ACIN1 3 83128 3.60889E-5 41564 0 1.20541E-5
14-23549930-G-T p.Ala263Glu missense ACIN1 1 83104 1.20331E-5 41552 0 NA
14-23549944-G-A p.Asn258Asn synonymous ACIN1 2 82944 2.41127E-5 41472 0 NA
14-23549948-C-T p.Arg257Lys missense ACIN1 885 82826 0.0106851 41413 34 0.0226534
14-23549950-G-A p.Ser256Ser synonymous ACIN1 1 82790 1.20788E-5 41395 0 1.20556E-5
14-23549964-G-C p.Gln252Glu missense ACIN1 2 82322 2.42948E-5 41161 0 4.02204E-6
14-23549974-C-T p.Glu248Glu synonymous ACIN1 7 81806 8.55683E-5 40903 0 1.27372E-4
14-23549975-T-C p.Glu248Gly missense ACIN1 2 81742 2.44672E-5 40871 0 1.67695E-5
14-23549985-G-C p.Pro245Ala missense ACIN1 1 81348 1.22929E-5 40674 0 NA
14-23549995-C-T p.Glu241Glu synonymous ACIN1 2 81018 2.46859E-5 40509 0 NA
14-23549997-C-G p.Glu241Gln missense ACIN1 1 80960 1.23518E-5 40480 0 3.42472E-5
14-23549998-A-G p.Ser240Ser synonymous ACIN1 2 80922 2.47152E-5 40461 0 NA
14-23550015-T-C p.Arg235Gly missense ACIN1 1 80210 1.24673E-5 40105 0 NA
14-23550021-G-GTCTGACCCTAGATGATCGTCTTTCTCCTTTCCTTGGTTTCTCATCATC c.700-4_700-3insGATGATGAGAAACCAAGGAAAGGAGAAAGACGATCATCTAGGGTCAGA splice_region ACIN1 2 79764 2.5074E-5 39882 1 NA
14-23550950-G-A c.699+7C>T splice_region ACIN1 1 82848 1.20703E-5 41424 0 NA
14-23550955-A-G c.699+2T>C splice_donor ACIN1 2 82902 2.41249E-5 41451 0 NA
14-23550969-A-G p.Ser229Ser synonymous ACIN1 1 82968 1.20528E-5 41484 0 3.1841E-5
14-23550980-T-C p.Arg226Gly missense ACIN1 1 83008 1.2047E-5 41504 0 1.59236E-4
14-23550983-C-T p.Glu225Lys missense ACIN1 1 83008 1.2047E-5 41504 0 NA
14-23550985-C-T p.Gly224Glu missense ACIN1 1 83006 1.20473E-5 41503 0 8.2394E-6
14-23551000-T-A p.Glu219Val missense ACIN1 1 83030 1.20438E-5 41515 0 NA
14-23551020-C-T p.Glu212Glu synonymous ACIN1 3 82958 3.61629E-5 41479 0 3.18492E-5
14-23551022-C-T p.Glu212Lys missense ACIN1 2 82962 2.41074E-5 41481 0 NA
14-23551031-T-G p.Ile209Leu missense ACIN1 1 82856 1.20691E-5 41428 0 NA
14-23551031-T-C p.Ile209Val missense ACIN1 1 82856 1.20691E-5 41428 0 NA
14-23559185-A-T c.610+6T>A splice_region ACIN1 2 82574 2.42207E-5 41287 0 3.18634E-5
14-23559186-C-T c.610+5G>A splice_region ACIN1 6 82576 7.26603E-5 41288 0 3.18634E-5
14-23559186-C-G c.610+5G>C splice_region ACIN1 1 82576 1.21101E-5 41288 0 NA
14-23559187-G-A c.610+4C>T splice_region ACIN1 3 82660 3.62932E-5 41330 0 9.5584E-5
14-23559196-G-C p.Ser202Trp missense ACIN1 6 82850 7.242E-5 41425 0 8.54133E-5
14-23559200-G-C p.His201Asp missense ACIN1 1 82888 1.20645E-5 41444 0 NA
14-23559215-G-C p.Leu196Val missense ACIN1 1 82876 1.20662E-5 41438 0 NA
14-23559223-C-T p.Arg193Lys missense ACIN1 1 82870 1.20671E-5 41435 0 2.40381E-5
14-23559225-C-G p.Glu192Asp missense ACIN1 1 82872 1.20668E-5 41436 0 NA
14-23559231-G-C p.Ser190Arg missense ACIN1 6 82856 7.24148E-5 41428 0 NA
14-23559234-G-A p.Ser189Ser synonymous ACIN1 1 82852 1.20697E-5 41426 0 8.94855E-6
14-23559246-AG-TT p.Pro185Gln missense ACIN1 1 82802 1.2077E-5 41401 0 NA
14-23559257-G-A p.Leu182Leu synonymous ACIN1 1 82846 1.20706E-5 41423 0 1.75571E-5
14-23559260-A-T p.Ser181Thr missense ACIN1 2 82978 2.41028E-5 41489 0 8.67619E-6
14-23559265-A-T p.Val179Glu missense ACIN1 2 82986 2.41005E-5 41493 0 5.58891E-5
14-23559288-G-A p.Asp171Asp synonymous ACIN1 2 82978 2.41028E-5 41489 0 3.58915E-5
14-23559289-T-A p.Asp171Val missense ACIN1 1 82954 1.20549E-5 41477 0 NA
14-23559294-C-T p.Ser169Ser synonymous ACIN1 2 82934 2.41156E-5 41467 0 1.59574E-5
14-23559295-G-A p.Ser169Leu missense ACIN1 3 82932 3.61742E-5 41466 0 6.37146E-5
14-23559295-G-C p.Ser169Trp missense ACIN1 1 82932 1.20581E-5 41466 0 NA
14-23559314-C-T c.491-4G>A splice_region ACIN1 2 82814 2.41505E-5 41407 0 2.79562E-5
14-23559738-T-C p.Glu161Glu synonymous ACIN1 1 82472 1.21253E-5 41236 0 1.65815E-5
14-23559752-G-C p.Arg157Gly missense ACIN1 1 82774 1.20811E-5 41387 0 NA
14-23559759-A-G p.Arg154Arg synonymous ACIN1 1 82864 1.2068E-5 41432 0 NA
14-23559765-C-T p.Leu152Leu synonymous ACIN1 3 82932 3.61742E-5 41466 0 8.24892E-6
14-23559768-A-T p.Arg151Arg synonymous ACIN1 1 82974 1.2052E-5 41487 0 3.97997E-6
14-23559786-C-T p.Gln145Gln synonymous ACIN1 2 83140 2.40558E-5 41570 0 5.07099E-4
14-23559816-A-G p.Ser135Ser synonymous ACIN1 1 83126 1.20299E-5 41563 0 NA
14-23562690-G-C p.Gln126Glu missense+splice_region ACIN1 1 83250 1.2012E-5 41625 0 NA
14-23562706-T-C p.Ala120Ala synonymous ACIN1 2 83256 2.40223E-5 41628 0 NA
14-23562711-C-G p.Ala119Pro missense ACIN1 2 83274 2.40171E-5 41637 0 3.29468E-5
14-23562714-G-A p.His118Tyr missense ACIN1 1 83274 1.20085E-5 41637 0 NA
14-23562716-G-T p.Pro117His missense ACIN1 1 83284 1.20071E-5 41642 0 NA
14-23562718-T-C p.Thr116Thr synonymous ACIN1 2 83282 2.40148E-5 41641 0 NA
14-23562733-T-C p.Leu111Leu synonymous ACIN1 237 83268 0.00284623 41634 2 0.00553877
14-23562735-A-G p.Leu111Leu synonymous ACIN1 64 83262 7.68658E-4 41631 2 0.00247739
14-23562754-C-CCCTTTGAGCCGCTTGACCAGGGCACTCTTCTGCCCGCTCT c.313-2_313-1insAGAGCGGGCAGAAGAGTGCCCTGGTCAAGCGGCTCAAAGG splice_acceptor ACIN1 1 83170 1.20236E-5 41585 0 NA
14-23562757-G-T c.313-4C>A splice_region ACIN1 3 83142 3.60828E-5 41571 0 6.37674E-5
14-23562760-T-G c.313-7A>C splice_region ACIN1 1 83116 1.20314E-5 41558 0 NA
14-23564193-C-A p.Arg101Arg synonymous ACIN1 1 82668 1.20966E-5 41334 0 8.78025E-6
14-23564197-T-C p.Lys100Arg missense ACIN1 2 82728 2.41756E-5 41364 0 NA
14-23564228-C-G p.Ala90Pro missense ACIN1 1 83036 1.2043E-5 41518 0 1.67642E-5
14-23564237-G-T p.Arg87Arg synonymous ACIN1 1 83048 1.20412E-5 41524 0 NA
14-23564241-C-T p.Glu85Glu synonymous ACIN1 2 83058 2.40796E-5 41529 0 3.18471E-5
14-23564259-G-A p.Asp79Asp synonymous ACIN1 1 83124 1.20302E-5 41562 0 NA
14-23564283-A-C p.Pro71Pro synonymous ACIN1 10 83168 1.20239E-4 41584 0 2.23044E-4
14-23564298-A-G p.Thr66Thr synonymous ACIN1 3 83198 3.60586E-5 41599 0 9.91441E-5
14-23564304-C-T p.Glu64Glu synonymous ACIN1 1 83222 1.20161E-5 41611 0 NA
14-23564313-C-T p.Glu61Glu synonymous ACIN1 9 83218 1.0815E-4 41609 0 2.47647E-5
14-23564313-C-G p.Glu61Asp missense ACIN1 1 83224 1.20158E-5 41612 0 NA
14-23564338-G-A p.Pro53Leu missense ACIN1 1 83318 1.20022E-5 41659 0 8.24865E-6
14-23564342-C-G p.Asp52His missense ACIN1 2 83320 2.40038E-5 41660 0 NA
14-23564343-C-T p.Thr51Thr synonymous ACIN1 1 83328 1.20008E-5 41664 0 NA
14-23564344-G-C p.Thr51Arg missense ACIN1 1 83332 1.20002E-5 41666 0 1.19329E-5
14-23564344-G-A p.Thr51Met missense ACIN1 1 83332 1.20002E-5 41666 0 NA
14-23564345-T-C p.Thr51Ala missense ACIN1 1 83326 1.20011E-5 41663 0 NA
14-23564345-T-G p.Thr51Pro missense ACIN1 2 83326 2.40021E-5 41663 0 8.24674E-6
14-23564346-C-T p.Gly50Gly synonymous ACIN1 2 83340 2.39981E-5 41670 0 8.75016E-5
14-23564352-G-A c.-31C>T 5_prime_UTR_premature_start_codon_gain ACIN1 1 83324 1.20013E-5 41662 0 1.64976E-5
14-23564353-G-A p.Ala48Val missense ACIN1 37 83322 4.4406E-4 41661 0 3.71171E-4
14-23564354-C-T p.Ala48Thr missense ACIN1 2 83328 2.40015E-5 41664 0 3.18492E-5
14-23564361-C-A p.Met45Ile missense ACIN1 1 83248 1.20123E-5 41624 0 3.97763E-6
14-23564362-A-G p.Met45Thr missense ACIN1 2 83254 2.40229E-5 41627 0 NA
14-23564386-C-T p.Gly37Glu missense ACIN1 1 83314 1.20028E-5 41657 0 8.24212E-6
14-23564388-T-G p.Glu36Asp missense ACIN1 2 83316 2.4005E-5 41658 0 NA
14-23564393-A-G p.Phe35Leu missense ACIN1 1 83306 1.20039E-5 41653 0 1.19296E-5
14-23564393-A-T p.Phe35Ile missense ACIN1 1 83306 1.20039E-5 41653 0 NA
14-23564395-G-A p.Thr34Met missense ACIN1 1 83312 1.20031E-5 41656 0 3.97655E-6
14-23564396-T-C p.Thr34Ala missense ACIN1 1 83308 1.20036E-5 41654 0 3.97659E-6
14-23564398-C-G p.Gly33Ala missense ACIN1 1 83322 1.20016E-5 41661 0 NA
14-23564399-C-T p.Gly33Ser missense ACIN1 1 83320 1.20019E-5 41660 0 3.97655E-6
14-23564409-C-T p.Arg29Arg synonymous ACIN1 1 83318 1.20022E-5 41659 0 NA
14-23564421-A-T p.Tyr25* stop_gained ACIN1 2 83354 2.3994E-5 41677 0 6.37471E-5
14-23564421-A-G p.Tyr25Tyr synonymous ACIN1 2 83354 2.3994E-5 41677 0 3.18735E-5
14-23564430-C-T p.Gly22Gly synonymous ACIN1 5 83360 5.99808E-5 41680 0 4.12548E-5
14-23564437-T-C p.Asn20Ser missense ACIN1 1386 83316 0.0166355 41658 25 0.023125
14-23564443-C-G p.Ser18Thr missense ACIN1 3 83336 3.59988E-5 41668 0 5.03525E-4
14-23564445-C-G p.Leu17Leu synonymous ACIN1 1 83332 1.20002E-5 41666 0 7.96204E-6
14-23564447-G-T p.Leu17Met missense ACIN1 11 83334 1.31999E-4 41667 0 7.16572E-5
14-23564447-G-C p.Leu17Val missense ACIN1 1 83334 1.19999E-5 41667 0 NA
14-23564449-A-T p.Val16Asp missense ACIN1 1 83332 1.20002E-5 41666 0 3.98165E-6
14-23564452-C-G p.Gly15Ala missense ACIN1 2 83316 2.4005E-5 41658 0 2.48488E-5
14-23564452-C-A p.Gly15Val missense ACIN1 2 83316 2.4005E-5 41658 0 NA
14-23564455-CG-C p.Arg14fs frameshift ACIN1 2 83314 2.40056E-5 41657 0 1.49435E-4
14-23564458-G-T p.Thr13Asn missense ACIN1 2 83310 2.40067E-5 41655 0 7.96902E-6
14-23564470-G-A p.Thr9Ile missense ACIN1 5 83260 6.00528E-5 41630 0 8.36974E-6
14-23564472-C-T p.Arg8Arg synonymous ACIN1 1 83242 1.20132E-5 41621 0 NA
14-23564475-CG-C p.Pro7fs frameshift ACIN1 2 83222 2.40321E-5 41611 0 8.40393E-6
14-23564480-G-A p.His6Tyr missense ACIN1 1 83180 1.20221E-5 41590 0 4.00253E-6
14-23564490-C-A p.Trp2Cys missense ACIN1 3 83068 3.6115E-5 41534 0 1.27348E-4
14-23564491-C-T p.Trp2* stop_gained ACIN1 1 83060 1.20395E-5 41530 0 3.1837E-5
14-23564504-A-G c.-9T>C 5_prime_UTR_premature_start_codon_gain ACIN1 1 82872 1.20668E-5 41436 0 3.18857E-5
14-23564529-G-T c.-34C>A 5_prime_UTR_premature_start_codon_gain ACIN1 2 82336 2.42907E-5 41168 0 1.2738E-4
14-23564547-T-A c.-52A>T 5_prime_UTR_premature_start_codon_gain ACIN1 1 81900 1.221E-5 40950 0 NA
14-23564714-G-A c.-219C>T 5_prime_UTR_premature_start_codon_gain ACIN1 2 39558 5.05587E-5 19779 0 NA
14-23564724-G-A c.-229C>T 5_prime_UTR_premature_start_codon_gain ACIN1 4 35972 1.11198E-4 17986 0 1.59246E-4
14-23564735-G-A c.-240C>T 5_prime_UTR_premature_start_codon_gain ACIN1 1 31714 3.15318E-5 15857 0 NA
14-23564814-G-C c.-319C>G 5_prime_UTR_premature_start_codon_gain ACIN1 3 9878 3.03705E-4 4939 0 NA