Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
16-67691436-G-A c.*73C>T splice_region ACD 1 82406 1.2135E-5 41203 0 NA
16-67691438-C-T n.2524G>A splice_region ACD 11 82422 1.3346E-4 41211 1 6.37064E-5
16-67691465-CAAAG-C n.1855_1858delCTTT splice_region ACD 6 82876 7.23973E-5 41438 0 4.97323E-5
16-67691513-A-G p.Met541Thr missense ACD 1 83174 1.2023E-5 41587 0 3.97839E-6
16-67691515-C-A p.Pro540Pro synonymous ACD 3364 83118 0.0404726 41559 98 0.0356035
16-67691516-G-A p.Pro540Leu missense ACD 2 83168 2.40477E-5 41584 0 5.77548E-5
16-67691518-AGTTG-A p.Pro538fs frameshift ACD 6 83184 7.21293E-5 41592 0 1.65016E-5
16-67691542-A-G p.Asp531Asp synonymous ACD 1 83148 1.20267E-5 41574 0 NA
16-67691544-C-T p.Asp531Asn missense ACD 2 83154 2.40518E-5 41577 0 NA
16-67691550-G-A p.Leu529Leu synonymous ACD 79 83140 9.50204E-4 41570 0 0.0017192
16-67691552-A-G p.Phe528Ser missense ACD 4 83144 4.81093E-5 41572 0 1.59256E-4
16-67691569-C-T p.Trp175* stop_gained ACD 1 83104 1.20331E-5 41552 0 NA
16-67691570-A-G p.Met522Thr missense ACD 1 83102 1.20334E-5 41551 0 5.41194E-4
16-67691580-G-T p.Pro519Thr missense ACD 1 83066 1.20386E-5 41533 0 3.98137E-6
16-67691586-GCCTGGAAAGAAACCACCGCTGCAGGTCAATGGAGCCTGGGACTAGTGACCAAGAGTTGGGGCAGACCCAGGCACTCA-G p.Arg516fs frameshift ACD 4 83084 4.8144E-5 41542 0 NA
16-67691591-GAAAGAAACCACCGCTGCAGGTCAATGGAGCCTGGGACTAGTGACCAAGAGTTGGGGCAGACCCAGGCACTCACCTGA-G p.Val515fs frameshift ACD 7 83082 8.42541E-5 41541 0 NA
16-67691668-A-G p.Val515Ala missense ACD 45787 82478 0.555142 41239 13403 0.624874
16-67691679-C-A p.Gly164Val missense ACD 1 83048 1.20412E-5 41524 0 NA
16-67691680-C-T p.Arg511Gln missense ACD 2 83052 2.40813E-5 41526 0 3.97855E-6
16-67691694-C-T p.Arg159His missense ACD 1 83024 1.20447E-5 41512 0 3.58027E-5
16-67691701-G-A p.Pro504Leu missense ACD 1 83036 1.2043E-5 41518 0 3.97776E-6
16-67691705-GCTCATA-G p.Met154_Ser155del disruptive_inframe_deletion ACD 1 83018 1.20456E-5 41509 0 3.18573E-5
16-67691726-C-A p.Ala496Ser missense ACD 1 82950 1.20555E-5 41475 0 3.30022E-5
16-67691726-C-T p.Ala496Thr missense ACD 1 82950 1.20555E-5 41475 0 NA
16-67691737-C-T p.Arg492His missense ACD 2 82840 2.41429E-5 41420 0 4.37616E-5
16-67691738-G-A p.Arg492Cys missense ACD 1 82816 1.2075E-5 41408 0 1.65074E-5
16-67691739-A-G p.Ile144Thr missense ACD 2 82814 2.41505E-5 41407 0 7.95646E-6
16-67691750-G-T p.Pro488Thr missense ACD 3 82712 3.62704E-5 41356 0 8.25614E-5
16-67691752-G-T p.Pro487His missense ACD 7 82678 8.46658E-5 41339 0 2.86624E-4
16-67691764-G-A c.1456-8C>T splice_region ACD 1 82550 1.21139E-5 41275 0 1.19392E-5
16-67691882-T-G c.1455+7A>C splice_region ACD 2 82744 2.41709E-5 41372 0 NA
16-67691890-C-T p.Trp485* stop_gained ACD 2 82804 2.41534E-5 41402 0 5.03525E-4
16-67691899-C-A p.Cys482Phe missense ACD 1 82836 1.2072E-5 41418 0 NA
16-67691901-G-A p.Pro134Leu missense ACD 1 82840 1.20715E-5 41420 0 NA
16-67691902-G-A p.Pro481Leu missense ACD 1 82842 1.20712E-5 41421 0 3.18695E-5
16-67691910-G-A p.Pro131Leu missense ACD 1 82866 1.20677E-5 41433 0 NA
16-67691911-G-A p.Ala478Val missense ACD 5 82868 6.03369E-5 41434 0 1.81716E-5
16-67691917-C-T p.Arg476Lys missense ACD 1 82886 1.20648E-5 41443 0 1.2738E-4
16-67691928-G-A p.Pro125Leu missense ACD 3 82904 3.61864E-5 41452 0 2.72712E-5
16-67691932-C-T c.371-1G>A splice_acceptor ACD 1 82918 1.20601E-5 41459 0 1.81782E-5
16-67691943-C-T p.Pro467Pro synonymous ACD 10 82916 1.20604E-4 41458 0 1.59286E-4
16-67691944-G-A p.Pro467Leu missense ACD 2 82910 2.41225E-5 41455 0 3.18451E-5
16-67691947-C-T p.Arg466Gln missense ACD 4 82906 4.82474E-5 41453 0 1.54307E-4
16-67691954-T-C p.Lys464Glu missense ACD 1 82948 1.20557E-5 41474 0 NA
16-67691961-C-A p.Leu461Phe missense ACD 1 82906 1.20619E-5 41453 0 9.0652E-6
16-67691976-C-T p.Lys456Lys synonymous ACD 1 82892 1.20639E-5 41446 0 1.93915E-5
16-67691977-T-C p.Lys456Arg missense ACD 1 82884 1.20651E-5 41442 0 4.84177E-6
16-67691987-G-A p.Leu453Leu synonymous ACD 2 82836 2.41441E-5 41418 0 9.01843E-6
16-67691992-G-A p.Pro451Leu missense ACD 1 82776 1.20808E-5 41388 0 4.67054E-6
16-67691993-G-A p.Pro451Ser missense ACD 1 82782 1.20799E-5 41391 0 9.00285E-6
16-67692004-C-G p.Arg447Thr missense ACD 2 82728 2.41756E-5 41364 0 NA
16-67692006-G-A p.Thr446Thr synonymous ACD 1 82704 1.20913E-5 41352 0 NA
16-67692018-C-G p.Gln442His missense ACD 5 82604 6.05298E-5 41302 0 9.56267E-5
16-67692032-G-A p.Pro438Ser missense ACD 6 82442 7.27784E-5 41221 0 0.0020141
16-67692038-G-A p.His436Tyr missense ACD 1 82372 1.214E-5 41186 0 NA
16-67692042-A-G p.Arg434Arg synonymous ACD 1 82226 1.21616E-5 41113 0 NA
16-67692043-C-T p.Arg434His missense ACD 1 82120 1.21773E-5 41060 0 2.64588E-5
16-67692044-G-A p.Arg434Cys missense ACD 4 82158 4.86867E-5 41079 0 6.37592E-5
16-67692058-G-C p.Pro429Arg missense ACD 1 81804 1.22243E-5 40902 0 NA
16-67692063-G-A p.Cys427Cys synonymous ACD 2 81700 2.44798E-5 40850 0 5.72841E-5
16-67692078-G-A p.Ser422Ser synonymous ACD 1 81178 1.23186E-5 40589 0 2.02623E-5
16-67692082-C-G p.Ser421Thr missense ACD 1 80922 1.23576E-5 40461 0 NA
16-67692091-C-T p.Arg418His missense ACD 2 80534 2.48342E-5 40267 0 0.00151057
16-67692092-G-A p.Arg418Cys missense ACD 1 80656 1.23983E-5 40328 0 8.45809E-6
16-67692093-G-A p.Ser417Ser synonymous ACD 1 80550 1.24146E-5 40275 0 1.20871E-5
16-67692098-C-T p.Ala416Thr missense ACD 10 80100 1.24844E-4 40050 0 4.15044E-4
16-67692098-C-A p.Ala416Ser missense ACD 1 80100 1.24844E-5 40050 0 NA
16-67692099-G-A p.His415His synonymous ACD 3 80290 3.73646E-5 40145 0 3.1904E-5
16-67692104-G-A p.Pro414Ser missense ACD 1 80344 1.24465E-5 40172 0 8.36596E-6
16-67692108-C-T p.Arg412Arg synonymous ACD 1 80076 1.24881E-5 40038 0 8.35799E-6
16-67692109-C-A p.Arg412Met missense ACD 1 80104 1.24838E-5 40052 0 NA
16-67692114-G-A p.Thr410Thr synonymous ACD 3 80156 3.7427E-5 40078 1 1.60443E-5
16-67692121-G-T p.Thr408Asn missense ACD 1 80110 1.24828E-5 40055 0 6.38121E-5
16-67692121-G-A p.Thr408Ile missense ACD 2 80112 2.4965E-5 40056 0 3.19061E-5
16-67692133-G-A p.Ser404Leu missense ACD 14 80100 1.74782E-4 40050 0 9.57549E-5
16-67692136-C-G p.Cys403Ser missense ACD 2 80038 2.49881E-5 40019 0 8.30165E-6
16-67692145-G-T p.Pro400Gln missense ACD 2 79984 2.5005E-5 39992 0 NA
16-67692151-G-A p.Pro398Leu missense ACD 1 79950 1.25078E-5 39975 0 NA
16-67692156-G-A p.Ser396Ser synonymous ACD 1 79888 1.25175E-5 39944 0 NA
16-67692162-G-T p.Ser394Arg missense ACD 1 79694 1.2548E-5 39847 0 NA
16-67692163-C-G p.Ser394Thr missense ACD 3 79724 3.76298E-5 39862 0 NA
16-67692172-C-T p.Gly391Glu missense ACD 216 79580 0.00271425 39790 2 0.00644092
16-67692204-C-G p.Leu380Leu synonymous ACD 2 78442 2.54965E-5 39221 0 NA
16-67692216-G-A p.Ser376Ser synonymous ACD 5 78060 6.40533E-5 39030 0 9.56328E-5
16-67692218-T-C p.Ser376Gly missense ACD 2 78002 2.56404E-5 39001 0 NA
16-67692225-A-C p.Ser373Arg missense ACD 2 77634 2.57619E-5 38817 0 NA
16-67692233-C-T p.Glu371Lys missense ACD 2 77294 2.58752E-5 38647 0 2.79727E-5
16-67692234-G-A p.Ser370Ser synonymous ACD 4 77310 5.17397E-5 38655 0 6.25E-4
16-67692242-T-C p.Met368Val missense ACD 6 77144 7.77766E-5 38572 0 3.19852E-5
16-67692249-G-A p.Pro365Pro synonymous ACD 5 76844 6.50669E-5 38422 0 5.03525E-4
16-67692251-G-T p.Pro365Thr missense ACD 1 76822 1.30171E-5 38411 0 NA
16-67692251-G-A p.Pro365Ser missense ACD 1 76822 1.30171E-5 38411 0 8.31338E-6
16-67692256-G-C p.Ala363Gly missense ACD 2 76588 2.61138E-5 38294 0 3.603E-5
16-67692258-C-T p.Pro362Pro synonymous ACD 18 76428 2.35516E-4 38214 0 1.27502E-4
16-67692259-G-A p.Pro362Leu missense ACD 1 76476 1.3076E-5 38238 0 NA
16-67692458-CTGAGGAACTGGG-C p.Pro356_Ser359del conservative_inframe_deletion ACD 6 82268 7.29324E-5 41134 0 9.95295E-5
16-67692462-G-A p.Ser358Ser synonymous ACD 1 82354 1.21427E-5 41177 0 9.41407E-6
16-67692467-T-C p.Ser357Gly missense ACD 3 82404 3.6406E-5 41202 0 NA
16-67692468-G-A p.Pro356Pro synonymous ACD 95 82442 0.00115233 41221 0 0.00188198
16-67692476-AAGG-A p.Pro353del conservative_inframe_deletion ACD 3 82564 3.63354E-5 41282 0 6.3857E-5
16-67692486-G-A p.Ala350Ala synonymous ACD 240 82668 0.00290318 41334 4 0.0052645
16-67692488-C-A p.Ala350Ser missense ACD 2 82644 2.42002E-5 41322 0 9.01681E-5
16-67692490-A-G p.Ile349Thr missense ACD 1 82682 1.20945E-5 41341 0 9.01372E-6
16-67692494-G-C p.Leu348Val missense ACD 1 82710 1.20904E-5 41355 0 1.18684E-4
16-67692496-G-A p.Thr347Ile missense ACD 2 82726 2.41762E-5 41363 0 NA
16-67692506-G-C p.Leu344Val missense ACD 6 82738 7.25181E-5 41369 0 4.49794E-5
16-67692506-G-A p.Leu344Leu synonymous ACD 6 82738 7.25181E-5 41369 0 NA
16-67692520-G-A p.Pro339Leu missense ACD 3 82826 3.62205E-5 41413 0 3.19122E-5
16-67692522-G-A p.Asp338Asp synonymous ACD 1 82820 1.20744E-5 41410 0 9.03326E-6
16-67692529-G-A p.Pro336Leu missense ACD 3 82816 3.62249E-5 41408 0 NA
16-67692534-C-A p.Leu334Leu synonymous ACD 1 82766 1.20823E-5 41383 0 NA
16-67692538-T-C p.Glu333Gly missense ACD 2 82812 2.41511E-5 41406 0 NA
16-67692543-GCCTGGGGGGTTCAGGAAGTCTTATCAGCACTGTGGACCTGGGCCCCAGGTATCCCCCCAACCTCTCCAGTCCCCCTTA-G p.Gly331fs frameshift ACD 7 82806 8.45349E-5 41403 0 NA
16-67692543-G-T p.Gly331Gly splice_region+synonymous ACD 2 82808 2.41523E-5 41404 0 NA
16-67692544-C-T p.Gly331Asp missense+splice_region ACD 1 82788 1.2079E-5 41394 0 NA
16-67692548-G-T c.992-4C>A splice_region ACD 5 82818 6.03733E-5 41409 0 4.44156E-6
16-67692549-G-A c.992-5C>T splice_region ACD 1 82822 1.20741E-5 41411 0 NA
16-67692551-G-T c.992-7C>A splice_region ACD 1 82808 1.20761E-5 41404 0 6.25782E-4
16-67692615-C-T c.991+8G>A splice_region ACD 1 82918 1.20601E-5 41459 0 NA
16-67692618-CT-C c.991+4delA splice_region ACD 1 82920 1.20598E-5 41460 0 8.072E-6
16-67692619-T-C c.991+4A>G splice_region ACD 1 82910 1.20613E-5 41455 0 8.06231E-6
16-67692624-C-G p.Gln330His missense+splice_region ACD 2 82950 2.41109E-5 41475 0 3.18959E-5
16-67692632-T-C p.Arg328Gly missense ACD 5 82968 6.02642E-5 41484 0 4.00122E-6
16-67692655-A-G p.Leu320Pro missense ACD 1 82952 1.20552E-5 41476 0 NA
16-67692659-T-A p.Ile319Phe missense ACD 2 82932 2.41161E-5 41466 0 8.32598E-6
16-67692669-A-G p.Asn315Asn synonymous ACD 2 82910 2.41225E-5 41455 1 1.66295E-5
16-67692679-A-C p.Ile312Ser missense ACD 1 82872 1.20668E-5 41436 0 NA
16-67692687-C-A p.Met309Ile missense ACD 1 82854 1.20694E-5 41427 0 NA
16-67692690-T-G p.Ser308Ser synonymous ACD 3 82816 3.62249E-5 41408 0 8.31559E-6
16-67692702-A-T p.Thr304Thr synonymous ACD 1 82708 1.20907E-5 41354 0 8.33014E-6
16-67692703-G-C p.Thr304Ser missense ACD 1 82692 1.20931E-5 41346 0 3.18756E-5
16-67692708-C-T p.Val302Val synonymous ACD 1 82660 1.20978E-5 41330 0 NA
16-67692718-CCCTGTGGGACATGAACTCTGTAGGACAGGCCCGTTTACTCTCATGTCCTGTGGGATATGACCCTTGCCCAACTCCTCACCCTGACATCTCCCAAGCAAATCCCCAGACTGA-C p.Gly299fs frameshift ACD 2 82530 2.42336E-5 41265 0 NA
16-67692724-G-A c.895-5C>T splice_region ACD 3 82442 3.63892E-5 41221 0 8.3524E-6
16-67692726-G-A c.895-7C>T splice_region ACD 4 82430 4.8526E-5 41215 0 NA
16-67692727-A-T c.895-8T>A splice_region ACD 1 82404 1.21353E-5 41202 0 NA
16-67692824-G-C c.894+7C>G splice_region ACD 1 80904 1.23603E-5 40452 0 NA
16-67692825-A-C c.894+6T>G splice_region ACD 2 80868 2.47317E-5 40434 0 NA
16-67692831-C-T p.Thr298Thr splice_region+synonymous ACD 6 80910 7.41565E-5 40455 0 0.00100705
16-67692832-G-A p.Thr298Met missense+splice_region ACD 3 80844 3.71085E-5 40422 0 5.03525E-4
16-67692834-G-A p.Ala297Ala synonymous ACD 3 80992 3.70407E-5 40496 0 3.18857E-5
16-67692844-C-T p.Arg294Gln missense ACD 1 81060 1.23365E-5 40530 0 2.79281E-5
16-67692859-T-G p.His289Pro missense ACD 13 81300 1.59902E-4 40650 0 0.0020141
16-67692863-T-C p.Thr288Ala missense ACD 109 81310 0.00134055 40655 0 0.00375
16-67692866-CAG-C p.Pro286fs frameshift ACD 4 81406 4.91364E-5 40703 0 3.18758E-5
16-67692866-CA-C p.Val287fs frameshift ACD 1 81406 1.22841E-5 40703 0 NA
16-67692867-A-G p.Pro286Pro synonymous ACD 1 81440 1.2279E-5 40720 0 2.47897E-5
16-67692874-G-A p.Ala284Val missense ACD 1 81484 1.22723E-5 40742 0 3.18593E-5
16-67692877-G-A p.Thr283Ile missense ACD 3 81558 3.67836E-5 40779 0 1.59317E-5
16-67692883-G-C p.Pro281Arg missense ACD 1 81616 1.22525E-5 40808 0 NA
16-67692885-G-A p.Gly280Gly synonymous ACD 2 81592 2.45122E-5 40796 0 1.81713E-4
16-67692886-C-A p.Gly280Val missense ACD 1 81658 1.22462E-5 40829 0 8.25859E-6
16-67692895-G-A p.Thr277Ile missense ACD 3 81848 3.66533E-5 40924 0 3.18654E-5
16-67692899-G-A p.Leu276Leu synonymous ACD 2 81862 2.44314E-5 40931 0 1.65164E-5
16-67692909-A-G p.Ala272Ala synonymous ACD 1 81936 1.22046E-5 40968 0 1.65117E-5
16-67692920-C-G p.Val269Leu missense ACD 1 81926 1.22061E-5 40963 0 3.98048E-6
16-67692921-G-A p.Leu268Leu synonymous ACD 1 81940 1.22041E-5 40970 0 3.98073E-6
16-67692930-CT-C p.Gln265fs frameshift ACD 2 82020 2.43843E-5 41010 0 8.25641E-6
16-67692940-T-C p.Gln262Arg missense ACD 3 82064 3.65568E-5 41032 0 8.25641E-6
16-67692949-C-A p.Arg259Leu missense ACD 4 82064 4.87424E-5 41032 0 4.37874E-5
16-67692949-C-T p.Arg259Gln missense ACD 6 82064 7.31137E-5 41032 0 9.5645E-5
16-67692950-G-A p.Arg259Trp missense ACD 2 82030 2.43813E-5 41015 0 8.25777E-6
16-67692963-A-C p.Leu254Leu synonymous ACD 3 82104 3.6539E-5 41052 0 6.25E-4
16-67692980-G-A p.Leu249Leu splice_region+synonymous ACD 1 82076 1.21838E-5 41038 0 3.18634E-5
16-67692986-G-C c.743-4C>G splice_region ACD 2 82062 2.43718E-5 41031 0 8.2646E-6
16-67693124-T-C c.742+8A>G splice_region ACD 1 83116 1.20314E-5 41558 0 NA
16-67693125-A-G c.742+7T>C splice_region ACD 14 83114 1.68443E-4 41557 0 1.31817E-4
16-67693126-C-T c.742+6G>A splice_region ACD 3 83114 3.6095E-5 41557 0 6.25E-4
16-67693137-T-C p.Asn246Ser missense ACD 11 83120 1.32339E-4 41560 0 9.06185E-5
16-67693139-G-A p.Ser245Ser synonymous ACD 5 83124 6.01511E-5 41562 0 8.23805E-6
16-67693142-C-T p.Ser244Ser synonymous ACD 2 83116 2.40628E-5 41558 0 6.25E-4
16-67693143-G-A p.Ser244Leu missense ACD 13 83128 1.56385E-4 41564 0 1.8124E-4
16-67693167-C-T c.708-1G>A splice_acceptor ACD 1 83144 1.20273E-5 41572 0 NA
16-67693170-C-T c.708-4G>A splice_region ACD 1 83142 1.20276E-5 41571 0 NA
16-67693171-A-G c.708-5T>C splice_region ACD 1 83138 1.20282E-5 41569 0 3.18817E-5
16-67693278-T-C p.Glu236Gly missense+splice_region ACD 1 83066 1.20386E-5 41533 0 NA
16-67693283-G-T p.Cys234* stop_gained ACD 1 83044 1.20418E-5 41522 0 NA
16-67693284-C-A p.Cys234Phe missense ACD 1 83054 1.20404E-5 41527 0 NA
16-67693286-G-A p.Asp233Asp synonymous ACD 1 83072 1.20378E-5 41536 0 NA
16-67693287-T-G p.Asp233Ala missense ACD 1 83060 1.20395E-5 41530 0 NA
16-67693288-C-T p.Asp233Asn missense ACD 1 83068 1.20383E-5 41534 0 1.19393E-5
16-67693292-G-A p.Leu231Leu synonymous ACD 18 83072 2.1668E-4 41536 0 9.55779E-4
16-67693292-G-C p.Leu231Leu synonymous ACD 1 83072 1.20378E-5 41536 0 8.25314E-6
16-67693306-C-T p.Val227Ile missense ACD 1 83072 1.20378E-5 41536 0 3.97953E-6
16-67693316-T-C p.Gln223Gln synonymous ACD 1 83082 1.20363E-5 41541 0 NA
16-67693319-G-A p.Asn222Asn synonymous ACD 1 83070 1.2038E-5 41535 0 NA
16-67693327-G-T c.663-5C>A splice_region ACD 2 83090 2.40703E-5 41545 0 3.19407E-5
16-67693437-T-C c.662+3A>G splice_region ACD 4710 82552 0.0570549 41276 656 0.113213
16-67693452-C-T p.Arg217Gln missense ACD 1 82640 1.21007E-5 41320 0 8.39053E-6
16-67693453-G-GCTT p.Leu216_Arg217insLys conservative_inframe_insertion ACD 2 82634 2.42031E-5 41317 0 6.37267E-5
16-67693463-C-T p.Gln213Gln synonymous ACD 2 82614 2.4209E-5 41307 0 NA
16-67693468-C-A p.Glu212* stop_gained ACD 1 82572 1.21106E-5 41286 0 1.20113E-5
16-67693475-C-A p.Leu209Leu synonymous ACD 2 82606 2.42113E-5 41303 0 NA
16-67693480-G-A p.Leu208Leu synonymous ACD 2 82622 2.42066E-5 41311 0 NA
16-67693487-G-A p.Arg205Arg synonymous ACD 2 82586 2.42172E-5 41293 0 NA
16-67693494-A-T p.Val203Glu missense ACD 1 82544 1.21148E-5 41272 0 NA
16-67693513-C-A p.Ala197Ser missense ACD 1 82446 1.21292E-5 41223 0 8.41793E-6
16-67693514-G-C p.Pro196Pro splice_region+synonymous ACD 1 82476 1.21247E-5 41238 0 NA
16-67693516-GCTGGAGGAGTTCGGGGGGAAGGGGGGGTCTCAGAATCGTCACGAAGAGTCATGCCCGGTAACCCGCCCAAGGCAGTCTCACCACTCAC-G c.585+1_586-1delGTGAGTGGTGAGACTGCCTTGGGCGGGTTACCGGGCATGACTCTTCGTGACGATTCTGAGACCCCCCCTTCCCCCCGAACTCCTCCAG splice_acceptor ACD 8 82454 9.70238E-5 41227 0 NA
16-67693523-G-A c.586-7C>T splice_region ACD 1 82424 1.21324E-5 41212 0 4.01648E-6
16-67693551-A-G n.543T>C splice_region ACD 3 82286 3.64582E-5 41143 0 3.19346E-5
16-67693598-C-T c.585+7G>A splice_region ACD 1 82512 1.21194E-5 41256 0 NA
16-67693612-C-T p.Gly193Asp missense ACD 1 82622 1.21033E-5 41311 0 7.98601E-6
16-67693618-G-A p.Ala191Val missense ACD 1 82646 1.20998E-5 41323 0 8.33278E-6
16-67693625-G-A p.Gln189* stop_gained ACD 2 82688 2.41873E-5 41344 0 NA
16-67693633-A-G p.Val186Ala missense ACD 2 82608 2.42107E-5 41304 0 NA
16-67693638-G-A p.Cys184Cys synonymous ACD 1 82656 1.20983E-5 41328 0 NA
16-67693641-G-A p.Asp183Asp synonymous ACD 1 82666 1.20969E-5 41333 0 3.9962E-6
16-67693675-C-A p.Arg172Leu missense ACD 2 82594 2.42148E-5 41297 0 1.60471E-5
16-67693680-G-T p.Gly170Gly synonymous ACD 1 82598 1.21068E-5 41299 0 6.7792E-5
16-67693686-C-T p.Glu168Glu synonymous ACD 3 82558 3.63381E-5 41279 0 6.37064E-5
16-67693697-CCCTGCAACAAGCAGGATCCTCACTGCCGGGCCCACCTGAACACAAGGCCCGCCCACCTCGCGCTCTCCTGCCGGACTCCGACCTCCAGAGCCGCGCGGGGCCTCTCA-C p.Glu165fs frameshift ACD 1 82456 1.21277E-5 41228 0 NA
16-67693700-T-A c.492-2A>T splice_acceptor ACD 3 82372 3.64201E-5 41186 0 NA
16-67693704-A-G c.492-6T>C splice_region ACD 2 82306 2.42996E-5 41153 0 NA
16-67693774-T-C n.395+6A>G splice_region ACD 2 81172 2.4639E-5 40586 0 3.55167E-5
16-67693777-G-A n.395+3C>T splice_region ACD 4 81146 4.92939E-5 40573 0 4.44879E-6
16-67693785-G-A p.Leu22Leu synonymous ACD 1 81100 1.23305E-5 40550 0 NA
16-67693792-G-GC p.Ala20fs frameshift ACD 2 80774 2.47604E-5 40387 0 9.46271E-6
16-67693798-C-T p.Gly18Asp missense ACD 2 80848 2.47378E-5 40424 0 8.74401E-6
16-67693799-C-T p.Gly18Ser missense ACD 2 80942 2.47091E-5 40471 0 3.18654E-5
16-67693800-T-C c.491+6A>G splice_region ACD 1 80942 1.23545E-5 40471 0 3.18939E-5
16-67693805-C-G c.491+1G>C splice_donor ACD 2 80960 2.47036E-5 40480 0 NA
16-67693850-A-G p.Cys1Arg missense ACD 2 79668 2.51042E-5 39834 0 NA
16-67693854-T-C p.His148Arg missense ACD 1 79538 1.25726E-5 39769 0 9.17111E-6
16-67693860-C-A p.Gly146Val missense ACD 2 79124 2.52768E-5 39562 0 NA
16-67693862-G-A p.Asp145Asp synonymous ACD 1 78952 1.26659E-5 39476 0 4.16344E-6
16-67693867-A-T p.Ser144Thr missense ACD 1 78650 1.27146E-5 39325 0 NA
16-67693888-C-A p.Val137Phe missense ACD 1 76094 1.31416E-5 38047 0 4.19442E-6
16-67693889-G-A p.Asp136Asp synonymous ACD 1 75956 1.31655E-5 37978 0 3.68067E-5
16-67693895-CG-C p.Thr134fs frameshift ACD 2 74988 2.66709E-5 37494 0 9.2154E-6
16-67693897-T-C p.Thr134Ala missense ACD 1 74934 1.33451E-5 37467 0 3.18654E-5
16-67693898-A-G p.Asp133Asp synonymous ACD 1 74936 1.33447E-5 37468 0 4.20511E-6
16-67693904-G-C p.Ala131Ala synonymous ACD 1 74186 1.34796E-5 37093 0 NA
16-67693909-G-C p.His130Asp missense ACD 1 73592 1.35884E-5 36796 0 4.23926E-6
16-67693911-G-A p.Ser129Phe missense ACD 2 73480 2.72183E-5 36740 0 8.50015E-6
16-67693916-G-A p.Gly127Gly synonymous ACD 235 72210 0.0032544 36105 0 0.00857719
16-67693925-C-G p.Ala124Ala synonymous ACD 1 71370 1.40115E-5 35685 0 3.18512E-5
16-67693934-G-C p.Ala121Ala synonymous ACD 1 70498 1.41848E-5 35249 0 0.005
16-67693939-C-T p.Asp120Asn missense+splice_region ACD 20 70388 2.84139E-4 35194 0 4.77768E-4
16-67693941-T-C c.358-2A>G splice_acceptor ACD 2 70364 2.84236E-5 35182 0 9.55475E-5
16-67693946-TACCTGACGGCGGCGAGCGGCGTCAATCCCACCACCCCGGGCCTCCGCCTCGGTCTCCGGGCCCTGAATGGGGGCTC-T p.Val120fs frameshift ACD 7 69862 1.00198E-4 34931 0 NA
16-67693954-G-C c.358-6C>G splice_region ACD 1 68656 1.45654E-5 34328 0 NA
16-67693955-G-C c.358-7C>G splice_region ACD 2 68488 2.92022E-5 34244 0 3.18512E-5
16-67694020-C-T c.357+5G>A splice_region ACD 1 64256 1.55627E-5 32128 0 NA
16-67694028-A-G p.Leu118Leu synonymous ACD 1 64270 1.55594E-5 32135 0 NA
16-67694039-C-G p.Gly115Arg missense ACD 1 63444 1.57619E-5 31722 0 1.24432E-5
16-67694044-C-T p.Arg113Gln missense ACD 145 63064 0.00229925 31532 0 0.003125
16-67694056-G-A p.Pro109Leu missense ACD 1 62688 1.5952E-5 31344 0 NA
16-67694057-G-T p.Pro109Thr missense ACD 1 62484 1.60041E-5 31242 0 4.13483E-6
16-67694061-C-T p.Glu107Glu synonymous ACD 1 62514 1.59964E-5 31257 0 NA
16-67694064-T-A p.Ser106Ser synonymous ACD 1 62496 1.6001E-5 31248 0 NA
16-67694066-A-G p.Ser106Pro missense ACD 1 62306 1.60498E-5 31153 0 NA
16-67694073-A-G p.Ile103Ile synonymous ACD 2 62690 3.1903E-5 31345 0 NA
16-67694078-G-T p.Leu102Met missense ACD 11 62768 1.75249E-4 31384 0 3.18695E-4
16-67694078-G-C p.Leu102Val missense ACD 2 62768 3.18634E-5 31384 0 8.65112E-6
16-67694081-C-A p.Glu101* stop_gained ACD 1 63322 1.57923E-5 31661 0 NA
16-67694084-G-T p.Arg100Arg synonymous ACD 1 63296 1.57988E-5 31648 0 3.18817E-5
16-67694102-C-T p.Val94Ile missense ACD 154 65490 0.0023515 32745 3 0.0221551
16-67694106-C-A p.Arg92Ser missense ACD 3 65914 4.55139E-5 32957 0 9.56023E-5
16-67694130-G-C p.Ala84Ala synonymous ACD 1 68906 1.45125E-5 34453 0 3.18837E-5
16-67694132-C-A p.Ala84Ser missense ACD 1 69314 1.44271E-5 34657 0 3.18573E-5
16-67694132-C-G p.Ala84Pro missense ACD 2 69314 2.88542E-5 34657 0 1.23678E-5
16-67694147-G-A p.His79Tyr missense ACD 4 71134 5.62319E-5 35567 0 8.25437E-5
16-67694148-C-T p.Leu78Leu synonymous ACD 1 71236 1.40378E-5 35618 0 NA
16-67694152-G-C p.Pro77Arg missense ACD 4 71248 5.61419E-5 35624 0 8.26597E-5
16-67694154-G-T p.Gly76Gly synonymous ACD 1 71584 1.39696E-5 35792 0 5.37186E-5
16-67694155-C-T p.Gly76Asp missense ACD 1 71596 1.39673E-5 35798 0 8.77239E-6
16-67694160-G-A p.Asn74Asn synonymous ACD 4 72626 5.50767E-5 36313 0 2.63384E-5
16-67694167-G-T p.Ala72Glu missense ACD 1 72846 1.37276E-5 36423 0 8.28281E-6
16-67694167-G-A p.Ala72Val missense ACD 1 72846 1.37276E-5 36423 0 NA
16-67694168-C-T p.Ala72Thr missense ACD 1 73044 1.36904E-5 36522 0 NA
16-67694172-C-T p.Ala70Ala synonymous ACD 1 73086 1.36825E-5 36543 0 NA
16-67694183-C-T p.Gly67Arg missense ACD 2 75124 2.66227E-5 37562 0 NA
16-67694200-G-A p.Pro61Leu missense ACD 2 77254 2.58886E-5 38627 0 4.16497E-6
16-67694203-A-G p.Leu60Pro missense ACD 1 77514 1.29009E-5 38757 0 3.18898E-5
16-67694208-C-T p.Lys58Lys synonymous ACD 4 78258 5.1113E-5 39129 0 5.89131E-5
16-67694219-G-T p.Arg55Ser missense ACD 1 78874 1.26784E-5 39437 0 1.92519E-5
16-67694220-G-A p.Pro54Pro synonymous ACD 218 78946 0.00276138 39473 1 0.00535714
16-67694224-CGGA-C p.Leu52del disruptive_inframe_deletion ACD 1 79056 1.26493E-5 39528 0 8.54905E-6
16-67694225-G-A p.Arg53Trp missense ACD 1 79314 1.26081E-5 39657 0 6.8524E-5
16-67694226-GA-G p.Leu52fs frameshift ACD 2 79416 2.51838E-5 39708 0 3.18776E-5
16-67694233-AGGCCCCGCCCACGTACACCCCGCGCCTGCGCACGAG-A p.Pro38_Gly49del disruptive_inframe_deletion ACD 1 79702 1.25467E-5 39851 0 NA
16-67694234-G-A p.Leu50Phe missense ACD 1 79850 1.25235E-5 39925 0 NA
16-67694244-AC-A p.Arg46fs frameshift ACD 6 80300 7.47198E-5 40150 0 4.68935E-5
16-67694249-C-T p.Val45Ile missense ACD 2 80594 2.48157E-5 40297 0 NA
16-67694251-C-G p.Gly44Ala missense ACD 1 80686 1.23937E-5 40343 0 NA
16-67694251-C-A p.Gly44Val missense ACD 1 80686 1.23937E-5 40343 0 3.18695E-5
16-67694251-C-T p.Gly44Asp missense ACD 2 80686 2.47874E-5 40343 0 NA
16-67694259-C-T p.Gln41Gln synonymous ACD 1 80902 1.23606E-5 40451 0 4.23506E-6
16-67694260-T-G p.Gln41Pro missense ACD 8 80898 9.889E-5 40449 0 5.04032E-4
16-67694266-C-T p.Arg39His missense ACD 2 80948 2.47072E-5 40474 0 1.91278E-4
16-67694267-G-A p.Arg39Cys missense ACD 1 81054 1.23375E-5 40527 0 2.11143E-5
16-67694273-G-A p.Arg37Cys missense ACD 1 81226 1.23113E-5 40613 0 1.68835E-5
16-67694273-G-T p.Arg37Ser missense ACD 1 81228 1.2311E-5 40614 0 3.18674E-5
16-67694279-C-T p.Ala35Thr missense ACD 1 81324 1.22965E-5 40662 0 NA
16-67694282-G-C p.Arg34Gly missense ACD 1 81382 1.22877E-5 40691 0 8.42673E-6
16-67694282-G-A p.Arg34* stop_gained ACD 2 81382 2.45755E-5 40691 0 4.21336E-6
16-67694286-G-T p.Gly32Gly synonymous ACD 9 81448 1.105E-4 40724 0 5.05051E-4
16-67694288-C-G p.Gly32Arg missense ACD 2 81552 2.45242E-5 40776 0 3.18634E-5
16-67694288-C-A p.Gly32Cys missense ACD 3 81552 3.67863E-5 40776 0 6.37267E-5
16-67694288-C-T p.Gly32Ser missense ACD 1 81552 1.22621E-5 40776 0 NA
16-67694290-G-C p.Thr31Arg missense ACD 2 81616 2.4505E-5 40808 0 3.18715E-5
16-67694295-C-T p.Leu29Leu synonymous ACD 2 81666 2.449E-5 40833 0 3.18776E-5
16-67694296-A-C p.Leu29Arg missense ACD 2 81700 2.44798E-5 40850 0 3.18898E-5
16-67694298-A-G p.Ser28Ser synonymous ACD 5 81706 6.1195E-5 40853 0 3.96975E-5
16-67694300-T-TCCCGCTGGTCCAC p.Ser28fs frameshift ACD 1 81738 1.22342E-5 40869 0 4.58009E-5
16-67694302-C-T p.Gly27Glu missense ACD 9 81826 1.09989E-4 40913 0 3.18715E-5
16-67694304-G-A p.Ser26Ser synonymous ACD 2 81824 2.44427E-5 40912 0 3.18776E-5
16-67694310-CC-GG p.Trp24Ser missense ACD 5 81846 6.10903E-5 40923 0 NA
16-67694313-C-G p.Gly23Gly synonymous ACD 4 81952 4.88091E-5 40976 0 5.82332E-5
16-67694317-G-A p.Ala22Val missense ACD 1 81950 1.22026E-5 40975 0 9.6043E-6
16-67694320-G-A p.Pro21Leu missense ACD 1 82020 1.21921E-5 41010 0 9.53016E-6
16-67694322-T-G p.Ala20Ala synonymous ACD 1 82032 1.21904E-5 41016 0 8.19363E-6
16-67694323-G-A p.Ala20Val missense ACD 1 82030 1.21907E-5 41015 0 NA
16-67694339-C-T p.Gly15Arg missense ACD 1 82126 1.21764E-5 41063 0 3.18756E-5
16-67694340-G-T p.Asn14Lys missense ACD 1 82130 1.21758E-5 41065 0 NA
16-67694347-C-G p.Arg12Thr missense ACD 9 82166 1.09534E-4 41083 0 2.53904E-4
16-67694353-G-C p.Ala10Gly missense ACD 1 82118 1.21776E-5 41059 0 NA
16-67694355-G-A p.Ala9Ala synonymous ACD 1 82102 1.218E-5 41051 0 6.28829E-5
16-67694357-C-T p.Ala9Thr missense ACD 1 82106 1.21794E-5 41053 0 NA
16-67694362-C-G p.Ser7Thr missense ACD 3 82136 3.65248E-5 41068 0 3.56831E-5
16-67694373-G-C p.Gly3Gly synonymous ACD 3 81986 3.65916E-5 40993 0 5.32538E-5
16-67694397-A-G c.-16T>C 5_prime_UTR_premature_start_codon_gain ACD 1 81320 1.22971E-5 40660 0 NA
16-67694441-G-A c.-60C>T 5_prime_UTR_premature_start_codon_gain ACD 2 79346 2.52061E-5 39673 0 NA
16-67694489-G-A c.-108C>T 5_prime_UTR_premature_start_codon_gain ACD 65 76948 8.44726E-4 38474 0 8.6053E-4
16-67694579-G-A c.-198C>T 5_prime_UTR_premature_start_codon_gain ACD 6 56794 1.05645E-4 28397 0 NA
16-67694584-C-T c.-203G>A 5_prime_UTR_premature_start_codon_gain ACD 2 54800 3.64963E-5 27400 0 NA