Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
11-44089173-T-C c.1-5T>C splice_region ACCS 1 83086 1.20357E-5 41543 0 NA
11-44089173-T-G c.1-5T>G splice_region ACCS 1 83086 1.20357E-5 41543 0 8.6146E-6
11-44089209-C-T p.Ala11Val missense ACCS 2 83264 2.402E-5 41632 0 2.00884E-5
11-44089210-T-C p.Ala11Ala synonymous ACCS 1 83266 1.20097E-5 41633 0 NA
11-44089218-C-T p.Thr14Ile missense ACCS 2 83272 2.40177E-5 41636 0 NA
11-44089221-G-C p.Cys15Ser missense ACCS 13 83278 1.56104E-4 41639 0 1.59215E-4
11-44089221-G-A p.Cys15Tyr missense ACCS 1 83278 1.2008E-5 41639 0 NA
11-44089233-C-A p.Thr19Asn missense ACCS 1 83280 1.20077E-5 41640 0 NA
11-44089233-C-T p.Thr19Ile missense ACCS 1 83280 1.20077E-5 41640 0 3.18512E-5
11-44089235-T-C p.Cys20Arg missense ACCS 2 83290 2.40125E-5 41645 0 2.79E-5
11-44089244-G-A p.Asp23Asn missense ACCS 3 83310 3.60101E-5 41655 0 8.24865E-6
11-44089247-C-A p.Leu24Met missense ACCS 1 83326 1.20011E-5 41663 0 NA
11-44089260-A-G p.His28Arg missense ACCS 1 83364 1.19956E-5 41682 0 NA
11-44089261-T-TG p.Glu30fs frameshift ACCS 1 83364 1.19956E-5 41682 0 NA
11-44089264-G-T p.Gly29Gly synonymous ACCS 1 83376 1.19939E-5 41688 0 6.25E-4
11-44089282-A-T p.Glu35Asp missense ACCS 1 83380 1.19933E-5 41690 0 8.23845E-6
11-44089286-T-G p.Ser37Ala missense ACCS 2 83382 2.3986E-5 41691 0 6.37064E-5
11-44089299-A-T p.Asp41Val missense ACCS 1 83390 1.19918E-5 41695 0 NA
11-44089313-G-A p.Glu46Lys missense ACCS 1 83380 1.19933E-5 41690 0 8.23764E-6
11-44089319-C-T p.Arg48Cys missense ACCS 7 83382 8.3951E-5 41691 0 6.25E-4
11-44089320-G-A p.Arg48His missense ACCS 6 83382 7.1958E-5 41691 0 1.31233E-4
11-44089328-G-A p.Gly51Ser missense ACCS 2 83384 2.39854E-5 41692 0 3.57907E-5
11-44089337-G-A p.Ala54Thr missense ACCS 2 83394 2.39825E-5 41697 0 8.23818E-6
11-44089340-A-G p.Met55Val missense ACCS 2 83394 2.39825E-5 41697 0 3.97649E-6
11-44089344-TCTC-T p.Ser58del disruptive_inframe_deletion ACCS 1 83400 1.19904E-5 41700 0 NA
11-44089347-C-T p.Ser57Phe missense ACCS 1 83398 1.19907E-5 41699 0 NA
11-44089350-C-T p.Ser58Phe missense ACCS 1 83396 1.1991E-5 41698 0 3.97687E-6
11-44089352-G-A p.Asp59Asn missense ACCS 16961 83210 0.203834 41605 2058 0.233029
11-44089359-C-G p.Ser61Cys missense ACCS 2 83388 2.39843E-5 41694 0 NA
11-44089389-A-C p.Lys71Thr missense ACCS 2 83350 2.39952E-5 41675 0 NA
11-44089393-G-T p.Trp72Cys missense ACCS 1 83334 1.19999E-5 41667 0 1.19351E-5
11-44089412-G-T p.Glu79* stop_gained ACCS 4 83282 4.80296E-5 41641 0 6.25E-4
11-44089415-G-A p.Gly80Ser missense ACCS 1 83258 1.20109E-5 41629 0 8.4246E-6
11-44089418-T-C p.Tyr81His missense ACCS 1 83244 1.20129E-5 41622 0 NA
11-44089420-C-T p.Tyr81Tyr synonymous ACCS 1 83226 1.20155E-5 41613 0 NA
11-44089430-C-G p.His85Asp missense ACCS 1 83122 1.20305E-5 41561 0 2.57635E-5
11-44089433-A-G p.Met86Val missense ACCS 21 83096 2.5272E-4 41548 0 0.00151057
11-44089437-A-T p.Asp87Val missense ACCS 2 83076 2.40743E-5 41538 0 8.12117E-6
11-44089447-T-G p.Asp90Glu missense ACCS 2 82926 2.41179E-5 41463 0 NA
11-44089454-A-G p.Lys93Glu missense ACCS 2 82730 2.4175E-5 41365 0 NA
11-44089466-G-GGCATCATTAACT c.288+1_288+2insGCATCATTAACT splice_donor ACCS 1 82438 1.21303E-5 41219 0 NA
11-44092798-A-C c.289-8A>C splice_region ACCS 2 83254 2.40229E-5 41627 0 NA
11-44092801-T-A c.289-5T>A splice_region ACCS 7 83262 8.4072E-5 41631 0 NA
11-44092807-G-A p.Gly97Asp missense+splice_region ACCS 2 83300 2.40096E-5 41650 0 NA
11-44092819-TG-T p.Gly102fs frameshift ACCS 1 83318 1.20022E-5 41659 0 3.18674E-5
11-44092819-T-C p.Leu101Ser missense ACCS 3 83318 3.60066E-5 41659 0 3.18674E-5
11-44092824-A-G p.Thr103Ala missense ACCS 1 83320 1.20019E-5 41660 0 3.18654E-5
11-44092832-G-A p.Glu105Glu synonymous ACCS 2 83324 2.40027E-5 41662 0 3.97662E-6
11-44092839-C-A p.Leu108Ile missense ACCS 1 83330 1.20005E-5 41665 0 8.23669E-6
11-44092852-T-C p.Leu112Pro missense ACCS 1 83304 1.20042E-5 41652 0 NA
11-44092857-T-C p.Ser114Pro missense ACCS 2 83278 2.40159E-5 41639 0 6.37389E-5
11-44092863-C-T p.Arg116Trp missense+splice_region ACCS 1 83256 1.20111E-5 41628 0 1.27551E-4
11-44092865-G-GTTTCTCTGATGAGCAGAACAAGCGTTCAGCTTTACCTGCCCT c.348_348+1insTTTCTCTGATGAGCAGAACAAGCGTTCAGCTTTACCTGCCCT splice_donor ACCS 1 83252 1.20117E-5 41626 0 NA
11-44094889-C-T n.386-5C>T splice_region ACCS 1 67828 1.47432E-5 33914 0 NA
11-44094890-G-A n.386-4G>A splice_region ACCS 3 67948 4.41514E-5 33974 0 NA
11-44094892-A-G n.386-2A>G splice_acceptor ACCS 10 69172 1.44567E-4 34586 0 6.37105E-5
11-44094893-GT-G n.388delT splice_region ACCS 1 69620 1.43637E-5 34810 0 NA
11-44095008-C-T p.Arg120Arg synonymous ACCS 16 81752 1.95714E-4 40876 0 0.001875
11-44095009-G-A p.Asp121Asn missense ACCS 2 81802 2.44493E-5 40901 0 3.63848E-5
11-44095010-A-T p.Asp121Val missense ACCS 8 81810 9.77876E-5 40905 0 0.00375
11-44095018-AG-A p.Val125fs frameshift ACCS 1 81922 1.22067E-5 40961 0 NA
11-44095021-G-A p.Val125Met missense ACCS 1 81962 1.22008E-5 40981 0 1.20435E-5
11-44095025-A-C p.Glu126Ala missense ACCS 1 81990 1.21966E-5 40995 0 NA
11-44095050-C-G p.Asp134Glu missense ACCS 460 82172 0.00559801 41086 6 0.0105082
11-44095063-C-A p.Leu139Met missense ACCS 1 82148 1.21732E-5 41074 0 1.31323E-5
11-44095065-G-A p.Leu139Leu splice_region+synonymous ACCS 1 82160 1.21714E-5 41080 0 6.3678E-5
11-44095067-T-TCCTCCGGGAGGAA c.419_419+1insCCTCCGGGAGGAA splice_donor ACCS 2 82154 2.43445E-5 41077 1 NA
11-44095067-T-G p.Phe140Cys missense+splice_region ACCS 1 82154 1.21723E-5 41077 0 NA
11-44095084-G-A n.602G>A splice_region ACCS 20 82022 2.43837E-4 41011 0 1.80402E-4
11-44096162-C-G p.Phe140Leu missense+splice_region ACCS 1 82908 1.20616E-5 41454 0 NA
11-44096166-C-T p.Arg142Trp missense ACCS 11 82928 1.32645E-4 41464 0 0.00100705
11-44096167-G-A p.Arg142Gln missense ACCS 3 82938 3.61716E-5 41469 0 5.17417E-5
11-44096172-G-A p.Glu144Lys missense ACCS 1 82994 1.20491E-5 41497 0 NA
11-44096178-G-A p.Ala146Thr missense ACCS 1 83032 1.20435E-5 41516 0 NA
11-44096187-C-G p.Leu149Val missense ACCS 6 83062 7.22352E-5 41531 0 3.19285E-4
11-44096215-C-A p.Pro158His missense ACCS 1 83052 1.20406E-5 41526 0 NA
11-44096221-G-T p.Arg160Ile missense ACCS 1 83010 1.20467E-5 41505 0 NA
11-44096227-A-G p.Glu162Gly missense ACCS 2 82980 2.41022E-5 41490 0 1.64747E-5
11-44096232-G-GTGGTTGTCC c.489+1_489+2insTGGTTGTCC splice_donor ACCS 1 82938 1.20572E-5 41469 0 NA
11-44096238-G-A c.489+7G>A splice_region ACCS 55168 78632 0.701597 39316 19491 0.749073
11-44096238-G-C c.489+7G>C splice_region ACCS 2 82858 2.41377E-5 41429 0 1.64842E-5
11-44097070-C-T c.490-6C>T splice_region ACCS 1 83128 1.20296E-5 41564 0 NA
11-44097087-GAATGGTGGTGCC-G p.Glu144_Leu148delinsVal disruptive_inframe_deletion ACCS 1 83208 1.20181E-5 41604 0 NA
11-44097094-G-C p.Gly170Arg missense ACCS 2 83212 2.4035E-5 41606 0 8.24185E-6
11-44097095-GTGCCTCGCTCTTCTC-G p.Ser172_Ala176del disruptive_inframe_deletion ACCS 1 83218 1.20166E-5 41609 0 8.24198E-6
11-44097097-G-A p.Ala171Thr missense ACCS 1 83224 1.20158E-5 41612 0 NA
11-44097104-T-C p.Leu173Pro missense ACCS 45 83232 5.40657E-4 41616 6 0.00805639
11-44097111-T-C p.Cys152Arg missense ACCS 2 83228 2.40304E-5 41614 0 1.64872E-5
11-44097117-G-T p.Gly154Cys missense ACCS 1 83212 1.20175E-5 41606 0 3.18471E-5
11-44097122-C-T p.Thr179Met missense ACCS 6 83190 7.21241E-5 41595 0 4.14013E-4
11-44097138-C-T p.Ala184Ala synonymous ACCS 1 83088 1.20354E-5 41544 0 5.578E-5
11-44097138-CG-C c.556+1delG splice_donor ACCS 1 83088 1.20354E-5 41544 0 NA
11-44097142-G-GAGGCTTTCCTGATCCCCACCCCTTACTATGGC c.556_556+1insAGGCTTTCCTGATCCCCACCCCTTACTATGGC splice_donor ACCS 1 83072 1.20378E-5 41536 0 NA
11-44097406-C-T n.960C>T splice_region ACCS 1 11138 8.97827E-5 5569 0 9.55901E-5
11-44098829-A-G p.Glu186Gly missense+splice_region ACCS 2 83134 2.40575E-5 41567 0 3.18613E-5
11-44098844-C-T p.Pro191Leu missense ACCS 1 83206 1.20184E-5 41603 0 NA
11-44098845-C-T p.Pro191Pro synonymous ACCS 1 83212 1.20175E-5 41606 0 NA
11-44098847-C-A p.Thr192Asn missense ACCS 1 83222 1.20161E-5 41611 0 1.99086E-5
11-44098851-T-TTA p.Tyr195fs frameshift ACCS 1 83254 1.20114E-5 41627 0 8.24865E-6
11-44098860-C-T p.Gly196Gly synonymous ACCS 1 83272 1.20088E-5 41636 0 1.64883E-5
11-44098860-C-G p.Gly196Gly synonymous ACCS 1 83272 1.20088E-5 41636 0 NA
11-44098861-G-A p.Ala197Thr missense ACCS 5 83270 6.00456E-5 41635 0 2.23058E-4
11-44098865-T-C p.Ile198Thr missense ACCS 1 83266 1.20097E-5 41633 0 1.64853E-5
11-44098868-C-A p.Thr199Lys missense ACCS 2 83276 2.40165E-5 41638 0 3.97814E-6
11-44098874-A-G p.His201Arg missense ACCS 1 83268 1.20094E-5 41634 0 NA
11-44098875-C-T n.65C>T splice_region ACCS 104 83262 0.00124907 41631 0 0.0025811
11-44098876-G-A p.Val202Met missense ACCS 6 83276 7.20496E-5 41638 0 6.76154E-5
11-44098878-G-A p.Val202Val synonymous ACCS 185 83268 0.00222174 41634 4 0.00474794
11-44098880-G-A p.Cys203Tyr missense ACCS 2 83284 2.40142E-5 41642 0 1.64821E-5
11-44098884-C-G p.Leu204Leu synonymous ACCS 1 83292 1.2006E-5 41646 0 3.97719E-6
11-44098890-C-T p.Gly206Gly synonymous ACCS 2 83296 2.40108E-5 41648 0 NA
11-44098897-C-T p.Arg209Trp missense ACCS 2 83296 2.40108E-5 41648 0 4.77297E-5
11-44098898-G-A p.Arg209Gln missense ACCS 1 83298 1.20051E-5 41649 0 3.2962E-5
11-44098924-G-A p.Glu218Lys missense+splice_region ACCS 64 83232 7.68935E-4 41616 0 0.00321738
11-44098930-A-ACTGGGCTAGACACACGCCCCTTCCAGCTCACAGTG c.654+4_654+5insCTGGGCTAGACACACGCCCCTTCCAGCTCACAGTG splice_region ACCS 1 83214 1.20172E-5 41607 0 NA
11-44099395-G-GTC p.Thr220fs frameshift ACCS 1 83184 1.20215E-5 41592 0 NA
11-44099402-G-A p.Gly221Glu missense ACCS 290 83216 0.00348491 41608 4 0.00654582
11-44099404-C-G p.Leu222Val missense ACCS 2 83218 2.40333E-5 41609 0 NA
11-44099413-C-T p.Arg225Cys missense ACCS 129 83242 0.0015497 41621 1 8.68443E-4
11-44099414-G-A p.Arg225His missense ACCS 1 83240 1.20135E-5 41620 0 8.37858E-6
11-44099427-C-T p.Leu229Leu synonymous ACCS 3 83268 3.60282E-5 41634 0 9.19333E-5
11-44099433-G-A p.Val231Val synonymous ACCS 1 83272 1.20088E-5 41636 0 NA
11-44099439-G-T p.Lys233Asn missense ACCS 22 83266 2.64213E-4 41633 0 0.00100806
11-44099444-A-C p.Glu235Ala missense ACCS 1 83258 1.20109E-5 41629 0 NA
11-44099449-G-A p.Ala237Thr missense ACCS 5 83234 6.00716E-5 41617 0 NA
11-44099449-G-T p.Ala237Ser missense ACCS 1 83234 1.20143E-5 41617 0 NA
11-44099472-G-A p.Glu244Glu splice_region+synonymous ACCS 2 83190 2.40414E-5 41595 0 3.98765E-6
11-44099477-G-A c.732+5G>A splice_region ACCS 1 83138 1.20282E-5 41569 0 NA
11-44100242-G-A p.Lys247Lys synonymous ACCS 39 83226 4.68604E-4 41613 0 9.24391E-4
11-44100245-C-T p.Val248Val synonymous ACCS 23 83234 2.76329E-4 41617 1 0.0040282
11-44100250-G-A p.Gly250Asp missense ACCS 10 83250 1.2012E-4 41625 0 0.00375
11-44100286-A-G p.Asp262Gly missense ACCS 2 83270 2.40183E-5 41635 0 NA
11-44100288-G-A p.Val263Ile missense ACCS 2 83266 2.40194E-5 41633 0 3.19101E-5
11-44100293-C-T p.Tyr264Tyr synonymous ACCS 2 83258 2.40217E-5 41629 0 8.26583E-6
11-44100294-T-C p.Ser265Pro missense ACCS 1 83258 1.20109E-5 41629 0 NA
11-44100314-G-A p.Glu271Glu synonymous ACCS 3 83212 3.60525E-5 41606 0 NA
11-44100321-G-C p.Val274Leu missense ACCS 1 83190 1.20207E-5 41595 0 NA
11-44100331-A-G p.Lys277Arg missense ACCS 1 83126 1.20299E-5 41563 0 NA
11-44100332-G-A p.Lys277Lys splice_region+synonymous ACCS 5 83120 6.0154E-5 41560 0 8.53403E-6
11-44101077-C-T c.834-4C>T splice_region ACCS 19 81618 2.32792E-4 40809 0 0.00135534
11-44101085-A-G p.Arg280Gly missense ACCS 1 81732 1.22351E-5 40866 0 NA
11-44101098-T-C p.Ile284Thr missense ACCS 1 81854 1.22169E-5 40927 0 4.24683E-5
11-44101106-G-A p.Glu287Lys missense ACCS 31 81898 3.7852E-4 40949 0 5.41677E-4
11-44101118-C-T p.Leu291Leu synonymous ACCS 10410 81784 0.127287 40892 729 0.15861
11-44101122-C-G p.Ser292Cys missense ACCS 1 82052 1.21874E-5 41026 0 1.00016E-5
11-44101130-G-C p.Glu295Gln missense ACCS 1 82084 1.21826E-5 41042 0 1.01447E-5
11-44101136-T-G p.Ser297Ala missense ACCS 1 82064 1.21856E-5 41032 0 NA
11-44101143-G-A p.Gly299Glu missense ACCS 2 82040 2.43784E-5 41020 0 1.21645E-5
11-44101148-C-T p.Arg301Cys missense ACCS 13 82004 1.58529E-4 41002 0 0.00201613
11-44101149-G-A p.Arg301His missense ACCS 16 82020 1.95074E-4 41010 0 0.00504032
11-44102571-C-T p.Leu309Phe missense+splice_region ACCS 1 82934 1.20578E-5 41467 0 2.47231E-5
11-44102583-C-T p.Gln313* stop_gained ACCS 1 82926 1.20589E-5 41463 0 8.24049E-6
11-44102594-T-C p.His316His synonymous ACCS 3 82914 3.61821E-5 41457 0 1.64796E-5
11-44102599-T-G p.Met318Arg missense ACCS 3 82896 3.61899E-5 41448 0 8.23968E-6
11-44102600-G-A p.Met318Ile missense ACCS 5 82900 6.03136E-5 41450 0 4.94364E-5
11-44102613-AAGGTGAGTTCCTGGCTGGCCTTGGGGGTGTCAGAAGGGTGGGAGGGCAGAGAGGTGGGTGGAACCAGCTTCCTCCATGGAGGGCTGGCCACCGCCTAGGGTGCTTCTTCCTGC-A p.Asp324fs frameshift ACCS 7 82882 8.44574E-5 41441 0 NA
11-44102616-G-A c.969+1G>A splice_donor ACCS 1 82890 1.20642E-5 41445 0 6.36943E-5
11-44102618-G-A c.969+3G>A splice_region ACCS 2 82858 2.41377E-5 41429 0 8.23981E-6
11-44102620-G-A c.969+5G>A splice_region ACCS 2 82844 2.41418E-5 41422 0 6.7624E-5
11-44102729-G-T p.Asp324Tyr missense+splice_region ACCS 2 83212 2.4035E-5 41606 0 2.47313E-5
11-44102733-T-C p.Phe325Ser missense ACCS 1 83214 1.20172E-5 41607 0 NA
11-44102734-C-T p.Phe325Phe synonymous ACCS 3 83206 3.60551E-5 41603 0 1.19315E-5
11-44102735-G-A p.Gly326Arg missense ACCS 1 83216 1.20169E-5 41608 0 3.97744E-6
11-44102738-A-G p.Met327Val missense ACCS 1 83206 1.20184E-5 41603 0 3.18573E-5
11-44102744-G-C p.Gly329Arg missense ACCS 2 83214 2.40344E-5 41607 0 3.97728E-6
11-44102749-C-CAG p.Arg331fs frameshift ACCS 1 83194 1.20201E-5 41597 0 NA
11-44102750-C-T p.Arg331Cys missense ACCS 5 83196 6.0099E-5 41598 0 1.19315E-5
11-44102750-C-A p.Arg331Ser missense ACCS 1 83196 1.20198E-5 41598 0 NA
11-44102751-G-A p.Arg331His missense ACCS 42 83178 5.04941E-4 41589 0 0.00124251
11-44102752-CTT-C p.Phe332fs frameshift ACCS 1 83182 1.20218E-5 41591 0 NA
11-44102756-G-C p.Gly333Arg missense ACCS 6 83154 7.21553E-5 41577 0 0.00151057
11-44102757-G-T p.Gly333Val missense ACCS 1 83136 1.20285E-5 41568 0 NA
11-44102760-C-T p.Thr334Met missense ACCS 3 83126 3.60898E-5 41563 0 3.30147E-5
11-44102763-T-C p.Leu335Pro missense ACCS 1 83128 1.20296E-5 41564 0 8.25546E-6
11-44102769-C-A p.Thr337Lys missense ACCS 1 83076 1.20372E-5 41538 0 NA
11-44102794-C-T p.Ala345Ala synonymous ACCS 296 82608 0.00358319 41304 4 0.00855992
11-44102798-G-C p.Ala347Pro missense ACCS 113 82482 0.00137 41241 2 0.0115811
11-44102803-C-T p.Ser348Ser synonymous ACCS 1 82312 1.21489E-5 41156 0 NA
11-44102810-C-T p.Arg351Cys missense ACCS 2 81920 2.44141E-5 40960 0 6.3678E-5
11-44102811-G-A p.Arg351His missense ACCS 6 81788 7.33604E-5 40894 0 9.55414E-5
11-44102818-C-T p.His353His synonymous ACCS 16 81366 1.96642E-4 40683 0 5.03525E-4
11-44102825-A-G p.Ser356Gly missense ACCS 1 80700 1.23916E-5 40350 0 NA
11-44102837-C-T p.Gln360* stop_gained ACCS 3 79120 3.79171E-5 39560 0 6.36699E-5
11-44102838-A-G p.Gln360Arg missense ACCS 1 78930 1.26695E-5 39465 0 5.03525E-4
11-44102862-G-T p.Arg368Leu missense ACCS 1 74528 1.34178E-5 37264 0 2.41307E-5
11-44102862-G-A p.Arg368Gln missense ACCS 16 74528 2.14684E-4 37264 0 1.43698E-4
11-44102867-C-T p.Arg370Cys missense ACCS 1 72970 1.37043E-5 36485 0 2.54436E-5
11-44102868-G-A p.Arg370His missense+splice_region ACCS 51 72820 7.00357E-4 36410 0 0.00654582
11-44102869-T-C p.Arg370Arg splice_region+synonymous ACCS 1 72704 1.37544E-5 36352 0 NA
11-44103742-T-TACTGGATCAACCAG n.599_599+1insACTGGATCAACCAG splice_donor ACCS 1 6 0.166667 3 0 NA
11-44104725-T-C p.Ile373Thr missense ACCS 1 83320 1.20019E-5 41660 0 NA
11-44104732-G-A p.Gln375Gln synonymous ACCS 2 83332 2.40004E-5 41666 0 3.18552E-5
11-44104733-G-C p.Val376Leu missense ACCS 2 83336 2.39992E-5 41668 0 1.59317E-4
11-44104735-G-T p.Val376Val synonymous ACCS 35 83336 4.19987E-4 41668 1 2.54858E-4
11-44104743-C-T p.Pro379Leu missense ACCS 15 83358 1.79947E-4 41679 0 5.03525E-4
11-44104743-C-G p.Pro379Arg missense ACCS 3 83358 3.59893E-5 41679 0 6.25E-4
11-44104744-G-A p.Pro379Pro synonymous ACCS 2 83354 2.3994E-5 41677 0 1.64739E-5
11-44104752-A-G p.His382Arg missense ACCS 1 83352 1.19973E-5 41676 0 6.37105E-5
11-44104757-C-T p.Arg384Trp missense ACCS 6 83350 7.19856E-5 41675 0 7.4129E-5
11-44104758-G-A p.Arg384Gln missense ACCS 1 83352 1.19973E-5 41676 0 4.11828E-5
11-44104792-G-A p.Glu395Glu synonymous ACCS 1 83376 1.19939E-5 41688 0 NA
11-44104795-T-A p.Leu396Leu synonymous ACCS 11 83372 1.31939E-4 41686 0 0.00151057
11-44104800-C-G p.Ala398Gly missense ACCS 2 83370 2.39894E-5 41685 0 NA
11-44104802-T-C p.Leu399Leu synonymous ACCS 1 83372 1.19944E-5 41686 0 NA
11-44104823-C-T p.Arg406Cys missense ACCS 13 83364 1.55943E-4 41682 0 6.25E-4
11-44104824-G-A p.Arg406His missense ACCS 1 83366 1.19953E-5 41683 0 8.23655E-5
11-44104834-CTT-C p.Phe410fs frameshift ACCS 2 83366 2.39906E-5 41683 0 6.37227E-5
11-44104836-T-C p.Phe410Ser missense ACCS 2 83364 2.39912E-5 41682 0 1.27445E-4
11-44104837-CTT-C p.Phe411fs frameshift ACCS 2 83362 2.39917E-5 41681 0 6.37146E-5
11-44104843-C-T p.Ile412Ile synonymous ACCS 2 83360 2.39923E-5 41680 0 1.64731E-5
11-44104859-AAGGTAATGCTGGTGGAGGTGCGGGCTGAGAGGGAGTTTCAGGTCTCCCTCCAGCAGGTGAGGGGCAGTTGGTGAGGGGTCTCAGCTATGTCCTGAGCCCCTTCCACCCTCTC-A p.Lys418fs frameshift ACCS 5 83340 5.99952E-5 41670 0 NA
11-44104976-C-T p.Tyr419Tyr splice_region+synonymous ACCS 2 82996 2.40975E-5 41498 0 8.27007E-6
11-44104979-GCC-TCT p.LeuPro420LeuLeu missense ACCS 1 82994 1.20491E-5 41497 0 NA
11-44104981-C-T p.Pro421Leu missense ACCS 34051 82202 0.414236 41101 7262 0.453676
11-44104981-CC-TG p.Pro421Leu missense ACCS 2 82978 2.41028E-5 41489 0 NA
11-44104982-C-G p.Pro421Pro synonymous ACCS 2 82968 2.41057E-5 41484 0 1.32015E-4
11-44104987-G-A p.Gly423Asp missense ACCS 2 82950 2.41109E-5 41475 0 NA
11-44104988-C-A p.Gly423Gly synonymous ACCS 1 82942 1.20566E-5 41471 0 0.00125
11-44104996-A-G p.Glu426Gly missense ACCS 1 82954 1.20549E-5 41477 0 6.37186E-5
11-44105005-T-G p.Met429Arg missense ACCS 7 82898 8.44411E-5 41449 0 7.95748E-6
11-44105016-C-T p.Arg433Cys missense ACCS 2 82782 2.41598E-5 41391 0 1.0719E-4
11-44105016-C-G p.Arg433Gly missense ACCS 2 82782 2.41598E-5 41391 0 3.9795E-6
11-44105017-G-A p.Arg433His missense ACCS 12 82772 1.44977E-4 41386 0 1.31346E-4
11-44105019-C-T p.Arg434Cys missense ACCS 2 82782 2.41598E-5 41391 0 7.16275E-5
11-44105020-G-A p.Arg434His missense ACCS 4 82782 4.83197E-5 41391 0 4.12235E-5
11-44105036-G-A p.Lys439Lys synonymous ACCS 22 82818 2.65643E-4 41409 0 0.00151057
11-44105037-G-A p.Val440Met missense ACCS 1 82802 1.2077E-5 41401 0 8.24185E-6
11-44105037-G-C p.Val440Leu missense ACCS 1 82802 1.2077E-5 41401 0 NA
11-44105039-G-A p.Val440Val synonymous ACCS 1 82776 1.20808E-5 41388 0 8.24212E-6
11-44105042-G-T p.Leu441Leu synonymous ACCS 1 82788 1.2079E-5 41394 0 1.64829E-5
11-44105063-C-T p.Phe448Phe synonymous ACCS 2 82910 2.41225E-5 41455 0 1.64796E-5
11-44105064-G-A p.Glu449Lys missense ACCS 3 82890 3.61925E-5 41445 0 2.22475E-4
11-44105066-G-C p.Glu449Asp missense ACCS 2 82914 2.41214E-5 41457 0 3.1835E-5
11-44105070-A-G p.Lys451Glu missense ACCS 2 82962 2.41074E-5 41481 0 3.97871E-6
11-44105073-G-C p.Glu452Gln missense ACCS 1 82972 1.20523E-5 41486 0 1.6478E-5
11-44105075-G-A p.Glu452Glu synonymous ACCS 1 82974 1.2052E-5 41487 0 NA
11-44105076-C-T p.Pro453Ser missense ACCS 1 82980 1.20511E-5 41490 0 2.47182E-5
11-44105078-T-C p.Pro453Pro synonymous ACCS 1 83020 1.20453E-5 41510 0 9.55171E-5
11-44105079-G-A p.Gly454Ser missense ACCS 1 83028 1.20441E-5 41514 0 NA
11-44105089-G-A p.Arg457His missense ACCS 4 83080 4.81464E-5 41540 0 0.00100705
11-44105094-G-T p.Val459Phe missense ACCS 2 83110 2.40645E-5 41555 0 1.27348E-4
11-44105114-C-T p.His465His synonymous ACCS 5 83196 6.0099E-5 41598 0 5.03525E-4
11-44105116-G-A p.Arg466Gln missense ACCS 1 83188 1.2021E-5 41594 0 3.1837E-5
11-44105122-G-A p.Cys468Tyr missense ACCS 1 83190 1.20207E-5 41595 0 NA
11-44105123-C-T p.Cys468Cys synonymous ACCS 1 83198 1.20195E-5 41599 0 NA
11-44105126-GGGTGAGCAGCCTGCCTTTCCAGCCCAGTCCTAACTGCAGCCTTCACTGTGGCCTCCGCTTGTTTGTCCCCACCCACGTGGCCATCAGTGCCAACTGGCCCCTCACTTCCCCTTCCCA-G p.Met471fs frameshift ACCS 4 83210 4.80711E-5 41605 0 NA
11-44105135-G-C c.1408+8G>C splice_region ACCS 1 83196 1.20198E-5 41598 0 NA
11-44105242-C-T c.1409-3C>T splice_region ACCS 1 83056 1.20401E-5 41528 0 NA
11-44105254-G-A p.Arg473Lys missense ACCS 7 83070 8.42663E-5 41535 0 5.81251E-5
11-44105278-A-T p.Lys481Ile missense ACCS 1 83058 1.20398E-5 41529 0 NA
11-44105280-TC-T p.Gln483fs frameshift ACCS 6 83064 7.22335E-5 41532 0 9.56389E-5
11-44105296-A-AC p.Arg489fs frameshift ACCS 1 82984 1.20505E-5 41492 0 NA
11-44105300-C-T p.Pro488Pro synonymous ACCS 4 82990 4.81986E-5 41495 0 1.72861E-5
11-44105301-C-T p.Arg489Cys missense ACCS 187 82976 0.00225366 41488 4 0.00455501
11-44105302-G-A p.Arg489His missense ACCS 5 82950 6.02773E-5 41475 0 3.60069E-5
11-44105302-G-T p.Arg489Leu missense ACCS 1 82950 1.20555E-5 41475 0 NA
11-44105318-G-A p.Gln494Gln synonymous ACCS 1 82844 1.20709E-5 41422 0 9.53871E-6
11-44105319-G-A p.Glu495Lys missense ACCS 1 82836 1.2072E-5 41418 0 NA
11-44105326-G-A p.Ser497Asn missense ACCS 2 82754 2.4168E-5 41377 0 4.05055E-6
11-44105334-C-T p.Arg500Cys missense ACCS 4 82604 4.84238E-5 41302 0 6.67082E-5
11-44105341-G-A p.Ter502Ter stop_retained ACCS 1 82460 1.21271E-5 41230 0 NA
11-44105439-AGGAAGG-A n.529_*2delGGAAGG splice_region ACCS 1 73596 1.35877E-5 36798 0 NA