Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
10-27484144-CATTT-C c.*2211_*2214delAAAT splice_region ACBD5 2 47568 4.20451E-5 23784 0 NA
10-27493362-G-C c.1592+7C>G splice_region ACBD5 4 82818 4.82987E-5 41409 0 3.18512E-5
10-27493373-T-G p.Arg530Arg synonymous ACBD5 1 82934 1.20578E-5 41467 0 NA
10-27493384-T-A p.Tyr526Phe missense ACBD5 1 83042 1.20421E-5 41521 0 1.6506E-5
10-27493397-C-T p.Val522Met missense ACBD5 1 83128 1.20296E-5 41564 0 NA
10-27493397-C-A p.Val522Leu missense ACBD5 3 83128 3.60889E-5 41564 0 8.24987E-6
10-27493402-C-A p.Trp520Leu missense ACBD5 1 83148 1.20267E-5 41574 0 3.97826E-6
10-27493405-T-G p.Gln519Pro missense ACBD5 1 83160 1.2025E-5 41580 0 NA
10-27493408-G-A p.Ala518Val missense ACBD5 1 83170 1.20236E-5 41585 0 3.18329E-5
10-27493424-T-A p.Ile513Leu missense ACBD5 1 83200 1.20192E-5 41600 0 NA
10-27493427-T-C p.Ile512Val missense ACBD5 3 83196 3.60594E-5 41598 0 4.85329E-4
10-27493428-G-A p.Ala511Ala synonymous ACBD5 3 83202 3.60568E-5 41601 0 1.65131E-5
10-27493431-A-C p.Phe510Leu missense ACBD5 2 83204 2.40373E-5 41602 0 NA
10-27493435-G-A p.Thr509Met missense ACBD5 2 83178 2.40448E-5 41589 0 1.27348E-4
10-27493446-A-G p.Pro505Pro synonymous ACBD5 2 83198 2.4039E-5 41599 0 NA
10-27493451-A-G p.Ser504Pro missense ACBD5 1 83178 1.20224E-5 41589 0 3.18329E-5
10-27493457-C-T p.Glu502Lys missense ACBD5 2 83134 2.40575E-5 41567 0 1.98976E-5
10-27493458-G-A p.Phe501Phe synonymous ACBD5 1 83150 1.20265E-5 41575 0 6.36943E-5
10-27493463-G-A p.Pro500Ser missense ACBD5 1 83110 1.20322E-5 41555 0 9.55231E-5
10-27494120-G-T c.1482+7C>A splice_region ACBD5 1 82218 1.21628E-5 41109 0 NA
10-27494127-C-T p.Gln494Gln splice_region+synonymous ACBD5 2 82470 2.42512E-5 41235 0 NA
10-27494136-G-A p.Pro491Pro synonymous ACBD5 2 82638 2.42019E-5 41319 0 3.98026E-6
10-27494143-G-A p.Pro489Leu missense ACBD5 1 82722 1.20887E-5 41361 0 NA
10-27494144-G-A p.Pro489Ser missense ACBD5 1 82714 1.20899E-5 41357 0 3.97934E-6
10-27494147-C-A p.Ala488Ser missense ACBD5 11 82726 1.32969E-4 41363 0 2.23001E-4
10-27494149-G-A p.Thr487Ile missense ACBD5 1 82758 1.20834E-5 41379 0 6.36983E-5
10-27494155-A-G p.Leu485Ser missense ACBD5 2 82806 2.41528E-5 41403 0 7.95754E-6
10-27494156-A-T p.Leu485Met missense ACBD5 1 82790 1.20788E-5 41395 0 3.1837E-5
10-27494169-T-C p.Ser480Ser synonymous ACBD5 1 82754 1.2084E-5 41377 0 2.4766E-5
10-27494171-A-C p.Ser480Ala missense ACBD5 2 82732 2.41744E-5 41366 0 4.95295E-5
10-27497190-C-T p.Thr472Thr synonymous ACBD5 2 82752 2.41686E-5 41376 0 6.3743E-5
10-27497191-G-A p.Thr472Met missense ACBD5 4584 82710 0.0554226 41355 201 0.060165
10-27497223-C-A p.Gln461His missense ACBD5 1 83110 1.20322E-5 41555 0 NA
10-27497233-T-C p.Glu458Gly missense ACBD5 1 83150 1.20265E-5 41575 0 NA
10-27497244-C-G p.Met454Ile missense ACBD5 1 83162 1.20247E-5 41581 0 8.24063E-6
10-27497245-A-G p.Met454Thr missense ACBD5 1 83166 1.20241E-5 41583 0 NA
10-27497259-G-A p.Ile449Ile synonymous ACBD5 13 83144 1.56355E-4 41572 1 0.00100705
10-27497262-C-G p.Gln448His missense ACBD5 1 83152 1.20262E-5 41576 0 NA
10-27497294-C-T p.Asp438Asn missense ACBD5 1 83196 1.20198E-5 41598 0 3.18532E-5
10-27497295-G-A p.Ser437Ser synonymous ACBD5 1 83194 1.20201E-5 41597 0 0.0020141
10-27497305-C-T p.Arg434His missense ACBD5 2 83214 2.40344E-5 41607 0 1.19333E-5
10-27497306-G-A p.Arg434Cys missense ACBD5 2 83198 2.4039E-5 41599 0 1.64775E-5
10-27497306-G-C p.Arg434Gly missense ACBD5 1 83198 1.20195E-5 41599 0 NA
10-27497308-T-C p.Glu433Gly missense ACBD5 1 83216 1.20169E-5 41608 0 6.37186E-5
10-27497324-T-C p.Ser428Gly missense ACBD5 1 83282 1.20074E-5 41641 0 NA
10-27497331-C-T p.Gln425Gln synonymous ACBD5 2 83294 2.40113E-5 41647 0 7.95412E-6
10-27497334-C-T p.Arg424Arg synonymous ACBD5 1 83272 1.20088E-5 41636 0 3.977E-6
10-27497345-T-G p.Thr421Pro missense ACBD5 38 83280 4.56292E-4 41640 2 7.64137E-4
10-27497352-G-A p.Ser418Ser synonymous ACBD5 32 83210 3.84569E-4 41605 0 6.37064E-4
10-27497360-G-A p.His416Tyr missense ACBD5 1 83118 1.20311E-5 41559 0 NA
10-27497364-C-T p.Met414Ile missense ACBD5 2 83048 2.40825E-5 41524 0 NA
10-27497367-C-T p.Arg413Arg synonymous ACBD5 1 83004 1.20476E-5 41502 0 NA
10-27497370-A-G p.His412His synonymous ACBD5 1 82960 1.2054E-5 41480 0 NA
10-27497381-T-C c.1232-7A>G splice_region ACBD5 2 82590 2.4216E-5 41295 0 8.24987E-6
10-27497381-T-G c.1232-7A>C splice_region ACBD5 1 82590 1.2108E-5 41295 0 NA
10-27499740-C-CACA c.1231+2_1231+3insTGT splice_donor ACBD5 4 83310 4.80134E-5 41655 0 3.18243E-5
10-27499754-C-T p.Arg407Lys missense ACBD5 1 83366 1.19953E-5 41683 0 NA
10-27499763-G-C p.Ser404Cys missense ACBD5 3 83388 3.59764E-5 41694 0 1.64742E-5
10-27499763-G-A p.Ser404Phe missense ACBD5 2 83388 2.39843E-5 41694 0 6.25E-4
10-27499765-G-C p.Phe403Leu missense ACBD5 2 83390 2.39837E-5 41695 0 3.97649E-6
10-27499765-G-T p.Phe403Leu missense ACBD5 4 83390 4.79674E-5 41695 0 8.2371E-6
10-27499769-T-C p.Glu402Gly missense ACBD5 9 83394 1.07921E-4 41697 0 7.11786E-4
10-27499770-C-T p.Glu402Lys missense ACBD5 4 83392 4.79662E-5 41696 0 1.19299E-5
10-27499771-G-A p.Asp401Asp synonymous ACBD5 3975 83242 0.0477523 41621 179 0.0704136
10-27499780-T-C p.Gly398Gly synonymous ACBD5 4 83398 4.79628E-5 41699 0 3.97646E-5
10-27499782-C-T p.Gly398Arg missense ACBD5 2 83398 2.39814E-5 41699 0 3.1841E-5
10-27499783-G-A p.Gly397Gly synonymous ACBD5 2 83398 2.39814E-5 41699 0 5.16948E-5
10-27499785-C-T p.Gly397Ser missense ACBD5 1 83398 1.19907E-5 41699 0 NA
10-27499787-C-T p.Arg396Gln missense ACBD5 1 83396 1.1991E-5 41698 0 1.19296E-5
10-27499788-G-A p.Arg396* stop_gained ACBD5 1 83398 1.19907E-5 41699 0 7.95323E-6
10-27499797-G-A p.Arg393Trp missense ACBD5 19 83398 2.27823E-4 41699 0 0.00100705
10-27499802-G-A p.Pro391Leu missense ACBD5 1 83394 1.19913E-5 41697 0 NA
10-27499804-T-C p.Ala390Ala synonymous ACBD5 4016 83314 0.0482032 41657 189 0.0704867
10-27499809-C-T p.Gly389Arg missense ACBD5 14 83394 1.67878E-4 41697 0 5.03525E-4
10-27499810-G-A p.Ser388Ser synonymous ACBD5 6 83394 7.19476E-5 41697 0 1.64731E-5
10-27499813-G-A p.Asn387Asn synonymous ACBD5 2 83396 2.3982E-5 41698 0 NA
10-27499816-A-T p.Asn386Lys missense ACBD5 1 83396 1.1991E-5 41698 0 3.97646E-6
10-27499821-T-G p.Arg385Arg synonymous ACBD5 1 83398 1.19907E-5 41699 0 NA
10-27499823-C-T p.Gly384Asp missense ACBD5 2 83398 2.39814E-5 41699 0 NA
10-27499825-A-G p.Asp383Asp synonymous ACBD5 3 83398 3.59721E-5 41699 0 2.47097E-5
10-27499825-ATCT-A p.Glu382del disruptive_inframe_deletion ACBD5 1 83400 1.19904E-5 41700 0 3.97636E-6
10-27499840-C-T p.Lys378Lys synonymous ACBD5 2 83402 2.39802E-5 41701 0 3.18431E-5
10-27499869-C-T p.Val369Ile missense ACBD5 1 83400 1.19904E-5 41700 0 9.55475E-5
10-27499886-A-G p.Ile363Thr missense ACBD5 1 83392 1.19916E-5 41696 0 8.23655E-6
10-27499889-T-A p.Asn362Ile missense ACBD5 1 83392 1.19916E-5 41696 0 NA
10-27499904-G-A p.Pro357Leu missense ACBD5 2 83392 2.39831E-5 41696 0 NA
10-27499909-T-C p.Gln355Gln synonymous ACBD5 2 83388 2.39843E-5 41694 0 3.97665E-6
10-27499913-A-G p.Ile354Thr missense ACBD5 1 83388 1.19921E-5 41694 0 1.64731E-5
10-27499917-C-T p.Asp353Asn missense ACBD5 47 83376 5.63711E-4 41688 0 6.25E-4
10-27499922-C-A p.Arg351Leu missense ACBD5 1 83368 1.1995E-5 41684 0 NA
10-27499923-G-A p.Arg351Cys missense ACBD5 4 83366 4.79812E-5 41683 0 3.29462E-5
10-27499936-T-C p.Glu346Glu synonymous ACBD5 1 83348 1.19979E-5 41674 0 NA
10-27499954-A-C p.His340Gln missense ACBD5 2 83318 2.40044E-5 41659 0 8.23683E-6
10-27499958-C-A p.Gly339Val missense ACBD5 1 83316 1.20025E-5 41658 0 NA
10-27499965-A-G p.Leu337Leu synonymous ACBD5 4 83310 4.80134E-5 41655 0 6.36902E-5
10-27499979-G-T p.Pro332Gln missense ACBD5 371 83266 0.0044556 41633 12 0.0127601
10-27499982-C-A p.Gly331Val missense ACBD5 1 83276 1.20083E-5 41638 0 2.47178E-5
10-27499990-G-A p.Ser328Ser synonymous ACBD5 1 83260 1.20106E-5 41630 0 NA
10-27499993-C-G p.Thr327Thr synonymous ACBD5 1 83250 1.2012E-5 41625 0 NA
10-27499993-C-A p.Thr327Thr synonymous ACBD5 2 83250 2.4024E-5 41625 0 2.78496E-5
10-27499994-G-A p.Thr327Met missense ACBD5 3 83242 3.60395E-5 41621 0 3.18512E-5
10-27499995-T-C p.Thr327Ala missense ACBD5 1 83248 1.20123E-5 41624 0 NA
10-27500005-T-C p.Leu323Leu synonymous ACBD5 1 83230 1.20149E-5 41615 0 NA
10-27500013-A-G c.964-3T>C splice_region ACBD5 1 83186 1.20213E-5 41593 0 8.28034E-6
10-27504466-C-T p.Glu321Lys missense+splice_region ACBD5 3 82768 3.62459E-5 41384 0 6.36902E-5
10-27504492-T-A p.Asp312Val missense ACBD5 1 82900 1.20627E-5 41450 0 NA
10-27504501-ACTTCACTGTCTGAATCGCTTGT-A p.Thr302fs frameshift ACBD5 1 82900 1.20627E-5 41450 0 NA
10-27504515-A-C p.Asp304Glu missense ACBD5 1 82906 1.20619E-5 41453 0 1.19604E-5
10-27504518-G-A p.Ser303Ser synonymous ACBD5 2 82880 2.41313E-5 41440 0 8.73271E-5
10-27504527-A-C p.His300Gln missense ACBD5 1 82892 1.20639E-5 41446 0 0.00100705
10-27504528-T-G p.His300Pro missense ACBD5 4 82866 4.82707E-5 41433 0 3.9881E-6
10-27504553-C-T p.Val292Ile missense ACBD5 2 82696 2.4185E-5 41348 0 8.01051E-6
10-27504553-C-A p.Val292Phe missense ACBD5 1 82696 1.20925E-5 41348 0 9.61631E-6
10-27504561-T-A p.Asp289Val missense ACBD5 1 82564 1.21118E-5 41282 0 4.01581E-6
10-27504566-T-C p.Ile287Met missense ACBD5 1 82486 1.21233E-5 41243 0 4.03359E-6
10-27504570-T-C p.Asp286Gly missense+splice_region ACBD5 1 82404 1.21353E-5 41202 0 1.04093E-5
10-27504571-C-T c.857-1G>A splice_acceptor ACBD5 1 82392 1.21371E-5 41196 0 NA
10-27504578-T-C c.857-8A>G splice_region ACBD5 1 82238 1.21598E-5 41119 0 NA
10-27506901-G-T c.856+8C>A splice_region ACBD5 1 82986 1.20502E-5 41493 0 3.18593E-5
10-27506925-A-G p.Ala280Ala synonymous ACBD5 2 83208 2.40361E-5 41604 0 3.9775E-6
10-27506937-A-G p.Thr276Thr synonymous ACBD5 1 83290 1.20062E-5 41645 0 NA
10-27506947-A-C p.Leu273Trp missense ACBD5 1 83308 1.20036E-5 41654 0 NA
10-27506948-A-G p.Leu273Leu synonymous ACBD5 2 83314 2.40056E-5 41657 0 7.95412E-6
10-27506961-G-A p.Pro268Pro synonymous ACBD5 4002 83234 0.0480813 41617 187 0.0705316
10-27506976-A-G p.Thr263Thr synonymous ACBD5 1 83326 1.20011E-5 41663 0 NA
10-27506977-G-A p.Thr263Ile missense ACBD5 1 83322 1.20016E-5 41661 0 NA
10-27506979-G-A p.Ser262Ser synonymous ACBD5 2 83310 2.40067E-5 41655 0 NA
10-27506984-T-G p.Arg261Arg synonymous ACBD5 4 83298 4.80204E-5 41649 0 3.29495E-5
10-27506985-G-A p.Gly260Gly synonymous ACBD5 5 83300 6.0024E-5 41650 0 1.27397E-4
10-27506988-A-G p.Asn259Asn synonymous ACBD5 2 83300 2.40096E-5 41650 0 4.11868E-5
10-27506993-G-C p.Leu258Val missense ACBD5 1 83290 1.20062E-5 41645 0 NA
10-27507011-T-C p.Ile252Val missense ACBD5 3 83278 3.60239E-5 41639 0 8.23723E-6
10-27507021-T-C p.Ile248Met missense ACBD5 2 83266 2.40194E-5 41633 0 3.18431E-5
10-27507027-C-A p.Gln246His missense ACBD5 1 83266 1.20097E-5 41633 0 NA
10-27507052-C-T p.Gly238Asp missense ACBD5 2 83216 2.40338E-5 41608 0 1.59118E-5
10-27507053-C-T p.Gly238Ser missense ACBD5 3 83218 3.60499E-5 41609 0 4.11862E-5
10-27507059-T-C p.Thr236Ala missense ACBD5 1 83202 1.20189E-5 41601 0 NA
10-27507060-G-A p.Val235Val synonymous ACBD5 2 83194 2.40402E-5 41597 0 3.18471E-5
10-27507065-T-C p.Ile234Val missense ACBD5 2 83152 2.40523E-5 41576 0 8.23723E-6
10-27507071-C-A p.Glu232* stop_gained ACBD5 1 83122 1.20305E-5 41561 0 6.36862E-5
10-27507079-T-G p.Lys229Thr missense ACBD5 2 83026 2.40888E-5 41513 0 6.36598E-5
10-27507080-T-C p.Lys229Glu missense ACBD5 1 83008 1.2047E-5 41504 0 3.97883E-6
10-27507088-G-C p.Ala226Gly missense ACBD5 1 82914 1.20607E-5 41457 0 NA
10-27507092-ACTT-A p.Lys224del conservative_inframe_deletion ACBD5 1 82856 1.20691E-5 41428 0 3.18329E-5
10-27507111-A-G p.Asp218Asp splice_region+synonymous ACBD5 2 82578 2.42195E-5 41289 0 NA
10-27507112-T-TCATTATCA c.653-1_653insTGATAATG splice_acceptor ACBD5 1 82546 1.21145E-5 41273 0 NA
10-27507113-C-CA c.653-2_653-1insT splice_acceptor ACBD5 2 82512 2.42389E-5 41256 0 NA
10-27507119-C-T c.653-7G>A splice_region ACBD5 3792 81920 0.0462891 40960 132 0.0704997
10-27507120-G-A c.653-8C>T splice_region ACBD5 2 82184 2.43356E-5 41092 0 8.24402E-6
10-27508678-ACTT-A p.Glu208del disruptive_inframe_deletion ACBD5 1 83334 1.19999E-5 41667 0 7.95475E-6
10-27508691-C-T p.Ala205Thr missense ACBD5 1 83336 1.19996E-5 41668 0 8.2375E-6
10-27508699-T-C p.Glu202Gly missense ACBD5 1 83336 1.19996E-5 41668 0 NA
10-27508701-C-T p.Glu201Glu synonymous ACBD5 1 83334 1.19999E-5 41667 0 3.97788E-6
10-27508709-C-T p.Glu199Lys missense ACBD5 15 83328 1.80012E-4 41664 1 6.92212E-4
10-27508710-G-T p.Ala198Ala synonymous ACBD5 1 83328 1.20008E-5 41664 0 3.97848E-6
10-27508746-G-A p.Thr186Thr synonymous ACBD5 838 83244 0.0100668 41622 37 0.03875
10-27508754-C-T p.Ala184Thr missense ACBD5 3 83238 3.60412E-5 41619 0 1.55182E-4
10-27508755-G-A p.Asn183Asn synonymous ACBD5 4 83238 4.8055E-5 41619 0 3.97864E-6
10-27508758-T-C p.Pro182Pro synonymous ACBD5 33348 79610 0.418892 39805 6991 0.45285
10-27508758-TG-CA p.Pro182Leu missense ACBD5 1 83236 1.2014E-5 41618 0 NA
10-27508759-G-A p.Pro182Leu missense ACBD5 1 83238 1.20137E-5 41619 0 3.97902E-6
10-27508774-A-C p.Val177Gly missense ACBD5 1 83196 1.20198E-5 41598 0 NA
10-27508786-T-C p.Asp173Gly missense+splice_region ACBD5 2 83116 2.40628E-5 41558 0 NA
10-27508788-T-TGAGGTTATATC c.518-3_518-2insGATATAACCTC splice_region ACBD5 1 83106 1.20328E-5 41553 0 NA
10-27512133-T-C c.517+3A>G splice_region ACBD5 1 72056 1.38781E-5 36028 0 NA
10-27512137-T-G p.Glu172Asp missense+splice_region ACBD5 13 72744 1.78709E-4 36372 0 1.27356E-4
10-27512147-T-A p.Lys169Ile missense ACBD5 1 74310 1.34571E-5 37155 0 NA
10-27512153-A-T p.Ile167Asn missense ACBD5 2 75000 2.66667E-5 37500 0 5.96872E-6
10-27512165-C-T p.Arg163Gln missense ACBD5 1 76406 1.3088E-5 38203 0 8.06777E-5
10-27512165-C-A p.Arg163Leu missense ACBD5 3 76406 3.92639E-5 38203 0 4.03388E-5
10-27512166-G-A p.Arg163* stop_gained ACBD5 1 76588 1.30569E-5 38294 0 3.18573E-5
10-27512168-ACTGGCGCGTGAAAGTAAGAAAAAAAATCAGAGATACAAATATTAATATGTGCATAATATATCAGTTGATGAATTTAAAAATAGGTAAAATAGTCCAAC-A c.484+1_485-1delGTTGGACTATTTTACCTATTTTTAAATTCATCAACTGATATATTATGCACATATTAATATTTGTATCTCTGATTTTTTTTCTTACTTTCACGCGCCAG splice_acceptor ACBD5 2 76970 2.59841E-5 38485 0 NA
10-27512173-C-T c.485-5G>A splice_region ACBD5 1 77382 1.29229E-5 38691 0 3.49699E-5
10-27512174-G-A c.485-6C>T splice_region ACBD5 1 77342 1.29296E-5 38671 0 6.37349E-5
10-27512175-C-T c.485-7G>A splice_region ACBD5 5 77762 6.42988E-5 38881 0 3.19061E-5
10-27512176-G-A c.485-8C>T splice_region ACBD5 7 78008 8.97344E-5 39004 0 1.56426E-4
10-27512265-A-G c.484+2T>C splice_donor ACBD5 1 83054 1.20404E-5 41527 0 NA
10-27512272-G-A p.Thr160Ile missense ACBD5 1 83124 1.20302E-5 41562 0 NA
10-27512285-T-C p.Ser156Gly missense ACBD5 2 83172 2.40466E-5 41586 0 0.0292044
10-27512293-C-T p.Ser153Asn missense ACBD5 1 83226 1.20155E-5 41613 0 8.24158E-6
10-27512297-T-C p.Lys152Glu missense ACBD5 13 83222 1.56209E-4 41611 2 6.01615E-4
10-27512299-T-C p.Lys151Arg missense ACBD5 3 83228 3.60456E-5 41614 0 5.03525E-4
10-27512300-T-C p.Lys151Glu missense ACBD5 2 83228 2.40304E-5 41614 0 1.64818E-5
10-27512307-G-A p.Val148Val synonymous ACBD5 2 83242 2.40263E-5 41621 0 3.18796E-5
10-27512331-G-GACA p.Val140dup disruptive_inframe_insertion ACBD5 1 83248 1.20123E-5 41624 0 NA
10-27512334-A-C p.Arg139Arg synonymous ACBD5 1 83252 1.20117E-5 41626 0 NA
10-27512335-C-T p.Arg139His missense ACBD5 14 83252 1.68164E-4 41626 0 6.25E-4
10-27512350-A-G p.Val134Ala missense ACBD5 4 83196 4.80792E-5 41598 0 6.59772E-5
10-27512365-G-T p.Pro129Gln missense ACBD5 1 83134 1.20288E-5 41567 0 NA
10-27512380-A-G p.Ile124Thr missense+splice_region ACBD5 1 83056 1.20401E-5 41528 0 NA
10-27512383-T-TTTTTCATTTCTTCAACATATGCAATCATGGCTTCCTCTTTG c.370-3_370-2insCAAAGAGGAAGCCATGATTGCATATGTTGAAGAAATGAAAA splice_region ACBD5 4 83028 4.81765E-5 41514 2 NA
10-27520686-T-C p.Glu120Glu synonymous ACBD5 1 83002 1.20479E-5 41501 0 NA
10-27520687-T-G p.Glu120Ala missense ACBD5 1 83004 1.20476E-5 41502 0 NA
10-27520698-T-C p.Ala116Ala synonymous ACBD5 1 83010 1.20467E-5 41505 0 7.96147E-6
10-27520698-T-G p.Ala116Ala synonymous ACBD5 1 83010 1.20467E-5 41505 0 NA
10-27520707-G-A p.Ala113Ala synonymous ACBD5 1 83006 1.20473E-5 41503 0 3.1839E-5
10-27520717-T-C p.Lys110Arg missense ACBD5 1 83008 1.2047E-5 41504 0 8.25137E-6
10-27520734-T-G p.Ser104Ser synonymous ACBD5 1 82960 1.2054E-5 41480 0 NA
10-27520748-C-T p.Asp100Asn missense+splice_region ACBD5 1 82894 1.20636E-5 41447 0 NA
10-27520750-C-CATTTATATCTTCCAATAGGATCCCAAAATCCAGGCCT c.297-2_297-1insAGGCCTGGATTTTGGGATCCTATTGGAAGATATAAAT splice_acceptor ACBD5 1 82872 1.20668E-5 41436 0 NA
10-27524027-T-C p.Tyr97Cys missense ACBD5 2 83244 2.40258E-5 41622 0 NA
10-27524061-A-G p.Ser86Pro missense ACBD5 32 83278 3.84255E-4 41639 0 8.67754E-4
10-27524062-A-C p.Leu85Leu synonymous ACBD5 1 83278 1.2008E-5 41639 0 1.19361E-5
10-27524065-T-A p.Lys84Asn missense ACBD5 10 83280 1.20077E-4 41640 0 6.3674E-5
10-27524066-T-G p.Lys84Thr missense ACBD5 1 83282 1.20074E-5 41641 0 8.26132E-6
10-27524067-T-C p.Lys84Glu missense ACBD5 3 83284 3.60213E-5 41642 0 6.3674E-5
10-27524080-A-C p.Thr79Thr synonymous ACBD5 1 83280 1.20077E-5 41640 0 NA
10-27524083-T-C p.Ala78Ala synonymous ACBD5 1 83274 1.20085E-5 41637 0 2.47586E-5
10-27524115-T-A p.Met68Leu missense ACBD5 1 83230 1.20149E-5 41615 0 1.64932E-5
10-27524127-T-C p.Thr64Ala missense ACBD5 3 83220 3.6049E-5 41610 0 8.24701E-6
10-27524133-G-A p.Gln62* stop_gained ACBD5 2 83198 2.4039E-5 41599 0 NA
10-27524142-C-CATTCTTCGGCAAACTCTGGATCACCTTCACGGCCGCCTCAAACCTAGTCTCG c.176-2_176-1insCGAGACTAGGTTTGAGGCGGCCGTGAAGGTGATCCAGAGTTTGCCGAAGAAT splice_acceptor ACBD5 2 83182 2.40437E-5 41591 1 NA
10-27529248-C-T p.Gly59Ser missense+splice_region ACBD5 1 83264 1.201E-5 41632 0 3.9795E-6
10-27529264-C-G p.Gln53His missense ACBD5 4 83272 4.80354E-5 41636 0 3.18695E-5
10-27529269-T-C p.Ile52Val missense ACBD5 4 83258 4.80434E-5 41629 0 NA
10-27529279-G-C p.Ala48Ala synonymous ACBD5 40 83274 4.80342E-4 41637 0 0.00178583
10-27529284-C-T p.Ala47Thr missense ACBD5 1 83298 1.20051E-5 41649 0 1.27421E-4
10-27529285-C-T p.Glu46Glu synonymous ACBD5 3 83294 3.6017E-5 41647 0 1.19316E-5
10-27529293-T-G p.Arg44Arg synonymous ACBD5 1 83286 1.20068E-5 41643 0 NA
10-27529302-G-A p.His41Tyr missense ACBD5 1 83280 1.20077E-5 41640 0 NA
10-27529307-G-T p.Ser39Tyr missense ACBD5 1 83280 1.20077E-5 41640 0 NA
10-27529313-G-A p.Thr37Met missense ACBD5 188 83268 0.00225777 41634 0 0.009375
10-27529331-T-C p.Gln31Arg missense ACBD5 8 83290 9.60499E-5 41645 0 1.40466E-4
10-27529341-G-A p.Gln28* stop_gained ACBD5 3 83280 3.60231E-5 41640 0 9.56633E-5
10-27529358-C-A p.Arg22Ile missense ACBD5 1 83216 1.20169E-5 41608 0 8.39955E-6
10-27529363-G-C p.Ala20Ala synonymous ACBD5 3 83198 3.60586E-5 41599 0 1.44141E-4
10-27529366-G-A c.-144C>T 5_prime_UTR_premature_start_codon_gain ACBD5 1 83200 1.20192E-5 41600 0 3.42742E-5
10-27529374-GGCA-G p.Cys16del conservative_inframe_deletion ACBD5 2 83198 2.4039E-5 41599 0 1.59719E-5
10-27529376-C-G p.Cys16Ser missense ACBD5 1 83180 1.20221E-5 41590 0 NA
10-27529384-G-A c.-162C>T 5_prime_UTR_premature_start_codon_gain ACBD5 1 83138 1.20282E-5 41569 0 NA
10-27529403-C-A p.Gly16Val missense+splice_region ACBD5 2 83066 2.40772E-5 41533 0 1.65066E-5
10-27529404-C-A c.47-1G>T splice_acceptor ACBD5 1 83074 1.20375E-5 41537 0 NA
10-27529408-A-G c.47-5T>C splice_region ACBD5 3 83032 3.61306E-5 41516 0 3.68505E-5
10-27529409-TG-T p.His5fs frameshift ACBD5 1 83020 1.20453E-5 41510 0 NA
10-27529422-T-G c.-200A>C 5_prime_UTR_premature_start_codon_gain ACBD5 2 82896 2.41266E-5 41448 0 4.46847E-6
10-27529422-T-A c.-200A>T 5_prime_UTR_premature_start_codon_gain ACBD5 1 82896 1.20633E-5 41448 0 NA
10-27529536-C-A c.-314G>T 5_prime_UTR_premature_start_codon_gain ACBD5 5 81830 6.11023E-5 40915 0 NA
10-27529549-C-A c.-327G>T 5_prime_UTR_premature_start_codon_gain ACBD5 57474 79826 0.719991 39913 20727 0.725535
10-27529568-C-T c.-346G>A 5_prime_UTR_premature_start_codon_gain ACBD5 1 81738 1.22342E-5 40869 0 1.30142E-5
10-27529575-G-A c.-353C>T 5_prime_UTR_premature_start_codon_gain ACBD5 6 81610 7.35204E-5 40805 0 1.59408E-4
10-27529579-C-A c.-357G>T 5_prime_UTR_premature_start_codon_gain ACBD5 1 81608 1.22537E-5 40804 0 6.5072E-6
10-27529592-AAAC-A c.15+8_15+10delGTT splice_region ACBD5 2 81542 2.45272E-5 40771 0 1.95031E-5
10-27529602-C-T c.15+1G>A splice_donor ACBD5 2 81314 2.4596E-5 40657 0 NA
10-27529604-G-A p.Ser5Leu missense+splice_region ACBD5 2 81264 2.46111E-5 40632 0 6.51033E-6
10-27529612-G-A p.Leu13Phe missense ACBD5 4 81154 4.9289E-5 40577 0 2.66861E-4
10-27529612-G-C p.Leu13Val missense ACBD5 1 81154 1.23223E-5 40577 0 NA
10-27529619-T-C p.Arg10Arg synonymous ACBD5 1 80836 1.23707E-5 40418 0 6.51559E-6
10-27529622-A-C p.Ala9Ala synonymous ACBD5 1 80700 1.23916E-5 40350 0 NA
10-27529632-A-T p.Leu6Gln missense ACBD5 2 80128 2.49601E-5 40064 0 6.53749E-6
10-27529641-C-G p.Gly3Ala missense ACBD5 2 79688 2.50979E-5 39844 0 3.19448E-5
10-27529644-G-A p.Pro2Leu missense ACBD5 1 79572 1.25672E-5 39786 0 NA
10-27529690-G-A c.-468C>T 5_prime_UTR_premature_start_codon_gain ACBD5 2 77596 2.57745E-5 38798 0 NA
10-27529702-C-G c.-480G>C 5_prime_UTR_premature_start_codon_gain ACBD5 2 77108 2.59376E-5 38554 0 NA
10-27529722-C-A c.-500G>T 5_prime_UTR_premature_start_codon_gain ACBD5 1 75394 1.32637E-5 37697 0 NA
10-27529747-C-A c.-99G>T 5_prime_UTR_premature_start_codon_gain ACBD5 8 72002 1.11108E-4 36001 0 NA