Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
17-43210025-C-T c.-411C>T 5_prime_UTR_premature_start_codon_gain ACBD4 1 6654 1.50286E-4 3327 0 6.39468E-5
17-43210035-G-C c.-406+5G>C splice_region ACBD4 9 5372 0.00167535 2686 0 0.00249185
17-43212963-G-T c.-150G>T splice_region ACBD4 1446 2946 0.490835 1473 364 0.45568
17-43213171-C-T c.-187C>T 5_prime_UTR_premature_start_codon_gain ACBD4 17 5394 0.00315165 2697 0 0.00589547
17-43213282-C-T c.-76C>T 5_prime_UTR_premature_start_codon_gain ACBD4 1 32816 3.04729E-5 16408 0 NA
17-43213380-A-G c.-132A>G 5_prime_UTR_premature_start_codon_gain ACBD4 3 72238 4.15294E-5 36119 0 NA
17-43213439-C-A c.-73C>A 5_prime_UTR_premature_start_codon_gain ACBD4 2 80598 2.48145E-5 40299 0 NA
17-43213476-G-A c.-36G>A splice_region ACBD4 1 81786 1.2227E-5 40893 0 8.60556E-6
17-43213515-G-T p.Gly2Cys missense ACBD4 15 82176 1.82535E-4 41088 1 0.00109417
17-43213528-A-C p.Glu6Ala missense ACBD4 62 82226 7.54019E-4 41113 0 0.00124354
17-43213529-AA-GC p.GluSer6GluArg missense ACBD4 2 82230 2.4322E-5 41115 0 NA
17-43213532-C-G p.Ser7Arg missense ACBD4 8 82236 9.7281E-5 41118 0 4.147E-4
17-43213532-C-T p.Ser7Ser synonymous ACBD4 2 82236 2.43202E-5 41118 0 6.37999E-5
17-43213536-G-C p.Glu9Gln missense ACBD4 1 82254 1.21575E-5 41127 0 NA
17-43213546-G-T p.Cys12Phe missense ACBD4 2 82258 2.43137E-5 41129 0 NA
17-43213559-C-G p.Phe16Leu missense ACBD4 1 82266 1.21557E-5 41133 0 NA
17-43213562-G-A p.Gln17Gln synonymous ACBD4 1 82278 1.21539E-5 41139 0 NA
17-43213564-C-A p.Ala18Asp missense ACBD4 2 82270 2.43102E-5 41135 0 NA
17-43213580-CC-GG p.IleGln23MetGlu missense ACBD4 1 82268 1.21554E-5 41134 0 NA
17-43213580-C-T p.Ile23Ile synonymous ACBD4 1 82268 1.21554E-5 41134 0 2.82668E-5
17-43213583-G-C p.Gln24His missense ACBD4 2 82256 2.43143E-5 41128 0 NA
17-43213591-C-T p.Pro27Leu missense ACBD4 1 82280 1.21536E-5 41140 0 NA
17-43213598-C-T p.Asn29Asn splice_region+synonymous ACBD4 1 82274 1.21545E-5 41137 0 6.25E-4
17-43213599-G-T p.Gly30Cys missense+splice_region ACBD4 1 82264 1.2156E-5 41132 0 6.91951E-5
17-43213606-C-T c.88+7C>T splice_region ACBD4 5 82220 6.08125E-5 41110 0 9.13776E-6
17-43213875-C-T p.Arg33Cys missense ACBD4 1 83040 1.20424E-5 41520 0 8.39166E-6
17-43213875-C-A p.Arg33Ser missense ACBD4 4 83040 4.81696E-5 41520 0 NA
17-43213876-G-A p.Arg33His missense ACBD4 1 83030 1.20438E-5 41515 0 1.59449E-4
17-43213885-A-G p.Tyr36Cys missense ACBD4 2 83070 2.40761E-5 41535 0 6.38407E-5
17-43213894-T-C p.Met39Thr missense ACBD4 1 83108 1.20325E-5 41554 0 1.66528E-5
17-43213913-C-G p.Tyr45* stop_gained ACBD4 9 83126 1.08269E-4 41563 0 4.15835E-5
17-43213914-T-C p.Tyr46His missense ACBD4 2 83114 2.40633E-5 41557 0 NA
17-43213918-A-C p.Lys47Thr missense ACBD4 1 83110 1.20322E-5 41555 0 1.66323E-5
17-43213922-G-A p.Gln48Gln synonymous ACBD4 2 83108 2.40651E-5 41554 0 8.31628E-6
17-43213946-C-A p.Val56Val synonymous ACBD4 1 83140 1.20279E-5 41570 0 3.18552E-5
17-43213950-C-T p.Arg58Trp missense ACBD4 2 83154 2.40518E-5 41577 0 1.60617E-5
17-43213952-GC-G p.Phe61fs frameshift ACBD4 3 83132 3.60872E-5 41566 0 NA
17-43213954-C-T p.Pro59Leu missense ACBD4 1 83136 1.20285E-5 41568 0 4.01519E-6
17-43213959-T-C p.Phe61Leu missense ACBD4 2 83102 2.40668E-5 41551 0 NA
17-43213972-T-C p.Ile65Thr missense ACBD4 3 83122 3.60915E-5 41561 1 3.21257E-5
17-43213977-C-T p.Arg67* stop_gained ACBD4 1 83118 1.20311E-5 41559 0 4.01716E-6
17-43213981-A-AT p.Lys69fs frameshift ACBD4 2 83132 2.40581E-5 41566 0 NA
17-43213986-TGGTGAGCTCCCTGCTGGCTGGGCAGACAAGCCTCAGCTGTCAAGCAGCCCTCTCACAGCCCTCTGCCCCCA-T p.Asp71fs frameshift ACBD4 7 83140 8.41953E-5 41570 0 NA
17-43213993-C-T c.209+6C>T splice_region ACBD4 9 83098 1.08306E-4 41549 0 1.91168E-4
17-43214052-C-T c.210-7C>T splice_region ACBD4 1 83078 1.20369E-5 41539 0 4.98339E-5
17-43214060-G-T p.Asp71Tyr missense+splice_region ACBD4 1 83084 1.2036E-5 41542 0 NA
17-43214062-C-T p.Thr31Met missense ACBD4 1 83076 1.20372E-5 41538 0 2.49083E-5
17-43214079-G-T p.Gly77Val missense ACBD4 3 83116 3.60941E-5 41558 0 4.00933E-5
17-43214091-G-A p.Arg81Lys missense ACBD4 1 83134 1.20288E-5 41567 0 NA
17-43214092-G-A p.Arg81Arg synonymous ACBD4 1 83142 1.20276E-5 41571 0 3.18552E-5
17-43214117-A-G p.Thr90Ala missense ACBD4 1 83000 1.20482E-5 41500 0 NA
17-43214129-C-T p.Leu94Leu synonymous ACBD4 3 82784 3.62389E-5 41392 0 3.3279E-5
17-43214132-G-A p.Val95Met missense ACBD4 11 82714 1.32988E-4 41357 0 2.54972E-4
17-43214139-A-G p.Gln97Arg missense ACBD4 1 82526 1.21174E-5 41263 0 NA
17-43214140-G-A p.Gln97Gln synonymous ACBD4 1 82496 1.21218E-5 41248 0 3.18776E-5
17-43214391-C-T p.Ile100Ile synonymous ACBD4 2 83008 2.40941E-5 41504 0 3.18776E-5
17-43214424-C-T p.Asp111Asp synonymous ACBD4 9 83136 1.08256E-4 41568 0 3.331E-5
17-43214426-T-C p.Met112Thr missense ACBD4 2 83146 2.40541E-5 41573 0 8.3257E-6
17-43214432-G-A p.Gly114Asp missense ACBD4 4 83144 4.81093E-5 41572 0 4.01207E-5
17-43214439-C-T p.Phe116Phe synonymous ACBD4 2 83150 2.40529E-5 41575 0 9.15522E-5
17-43214440-G-A p.Glu117Lys missense ACBD4 2 83146 2.40541E-5 41573 0 1.66409E-5
17-43214443-C-A p.Pro118Thr missense ACBD4 2 83154 2.40518E-5 41577 0 NA
17-43214444-C-T p.Pro118Leu missense ACBD4 81 83154 9.74096E-4 41577 0 0.00191241
17-43214454-G-C p.Gln121His missense ACBD4 2 83174 2.4046E-5 41587 0 7.48291E-5
17-43214458-A-T p.Ile123Phe missense ACBD4 1 83178 1.20224E-5 41589 0 NA
17-43214459-T-C p.Ile123Thr missense ACBD4 1 83184 1.20215E-5 41592 0 8.31255E-6
17-43214464-G-A p.Asp125Asn missense ACBD4 2 83166 2.40483E-5 41583 0 1.66223E-5
17-43214469-G-A p.Met126Ile missense ACBD4 1 83138 1.20282E-5 41569 0 1.20296E-5
17-43214471-C-T p.Pro127Leu missense ACBD4 3 83126 3.60898E-5 41563 0 6.64827E-5
17-43214475-GC-TT p.ArgPro128SerSer missense ACBD4 4 83114 4.81267E-5 41557 0 NA
17-43214479-C-G p.Pro130Ala missense ACBD4 2 83100 2.40674E-5 41550 0 2.80669E-5
17-43214486-C-T p.Thr132Ile missense ACBD4 4 83064 4.81556E-5 41532 0 1.66141E-5
17-43214492-T-C p.Leu134Pro missense ACBD4 1 83020 1.20453E-5 41510 0 4.00991E-6
17-43214499-G-C p.Arg136Ser missense ACBD4 3 82946 3.61681E-5 41473 0 0.00125
17-43214734-G-A c.416-1G>A splice_acceptor ACBD4 1 83156 1.20256E-5 41578 0 3.18674E-5
17-43214738-G-A p.Trp140* stop_gained ACBD4 1 83140 1.20279E-5 41570 0 8.31421E-6
17-43214745-G-C p.Glu142Asp missense ACBD4 1 83164 1.20244E-5 41582 0 4.01049E-6
17-43214748-G-A p.Gln143Gln synonymous ACBD4 2 83172 2.40466E-5 41586 0 NA
17-43214750-T-C p.Val144Ala missense ACBD4 1 83158 1.20253E-5 41579 0 8.3138E-6
17-43214757-T-C p.Asn146Asn synonymous ACBD4 2 83170 2.40471E-5 41585 0 NA
17-43214762-A-T p.Asp148Val missense ACBD4 1 83148 1.20267E-5 41574 0 NA
17-43214765-T-C p.Val149Ala missense ACBD4 1 83158 1.20253E-5 41579 0 1.6624E-5
17-43214790-C-A p.Cys157* stop_gained ACBD4 1 83080 1.20366E-5 41540 0 3.19203E-5
17-43214793-C-A p.Leu158Leu synonymous ACBD4 2 83110 2.40645E-5 41555 0 2.49513E-5
17-43214804-C-T p.Pro162Leu missense ACBD4 15 83050 1.80614E-4 41525 0 7.9077E-4
17-43214805-G-A p.Pro162Pro synonymous ACBD4 1 83018 1.20456E-5 41509 0 4.01178E-6
17-43214808-AC-A p.Pro165fs frameshift ACBD4 1 82990 1.20496E-5 41495 0 8.32792E-6
17-43214818-C-T p.Pro167Ser missense ACBD4 1 82940 1.20569E-5 41470 0 NA
17-43214819-C-CAGAGTCCCATTCACCCAGGGACCTGGACTCCG c.502_502+1insAGTCCCATTCACCCAGGGACCTGGACTCCGAG splice_donor ACBD4 1 82924 1.20592E-5 41462 0 NA
17-43214829-C-T c.502+8C>T splice_region ACBD4 1 82756 1.20837E-5 41378 0 NA
17-43215001-A-G n.802A>G splice_region ACBD4 1 79090 1.26438E-5 39545 0 NA
17-43215081-C-T c.503-8C>T splice_region ACBD4 3 82850 3.621E-5 41425 0 1.20331E-5
17-43215099-G-A p.Trp171* stop_gained ACBD4 2 82992 2.40987E-5 41496 0 1.60346E-5
17-43215107-C-G p.Thr174Ser missense ACBD4 3 83038 3.6128E-5 41519 0 8.29944E-6
17-43215113-C-T p.Pro176Leu missense ACBD4 1 83058 1.20398E-5 41529 0 NA
17-43215124-C-T p.Gln180* stop_gained ACBD4 1 83078 1.20369E-5 41539 0 NA
17-43215126-G-A c.503-1G>A splice_acceptor ACBD4 16 83082 1.92581E-4 41541 0 5.03525E-4
17-43215128-G-A p.Ser181Asn missense ACBD4 1 83086 1.20357E-5 41543 0 9.12091E-5
17-43215142-G-C p.Arg173Thr missense ACBD4 1 83104 1.20331E-5 41552 0 NA
17-43215156-G-A p.Glu178Lys missense ACBD4 6 83108 7.21952E-5 41554 0 4.00737E-5
17-43215158-G-T p.Glu178Asp missense ACBD4 1 83104 1.20331E-5 41552 0 NA
17-43215168-G-A p.Asp182Asn missense ACBD4 1 83130 1.20294E-5 41565 0 1.68307E-4
17-43215191-T-C p.Leu202Pro missense ACBD4 1 83142 1.20276E-5 41571 0 4.00753E-6
17-43215196-TGGTGAGCCCAGTCCCCATTCCCCCCTTTTCCCACCCCACTGTGCTCCCACTCCCACCCTCAGCTCTCTGACTCATCTCAGCA-T p.Val192fs frameshift ACBD4 7 83140 8.41953E-5 41570 0 NA
17-43215196-TGGTGAGCCCAGTCCCCATTCCCCCCTTTTCCCACCCCACTGTGCTCCCACTCCCACCCTCA-T c.573+1_574-22delGTGAGCCCAGTCCCCATTCCCCCCTTTTCCCACCCCACTGTGCTCCCACTCCCACCCTCAG splice_donor ACBD4 1 83140 1.20279E-5 41570 0 NA
17-43215205-C-T c.573+8C>T splice_region ACBD4 3 83122 3.60915E-5 41561 0 1.65942E-5
17-43215277-C-G c.574-3C>G splice_region ACBD4 1 83082 1.20363E-5 41541 0 NA
17-43215284-G-A p.Trp193* stop_gained ACBD4 2 83072 2.40755E-5 41536 0 NA
17-43215285-G-C p.Trp193Cys missense ACBD4 1 83072 1.20378E-5 41536 0 1.20335E-5
17-43215291-G-C p.Ser192Thr missense+splice_region ACBD4 1 83060 1.20395E-5 41530 0 1.67232E-5
17-43215293-A-G p.Gln196Arg missense ACBD4 2 83038 2.40854E-5 41519 0 3.19387E-5
17-43215296-G-A p.Arg197Gln missense ACBD4 1 83002 1.20479E-5 41501 0 3.19203E-5
17-43215317-G-A p.Arg204His missense ACBD4 1 82820 1.20744E-5 41410 0 7.66257E-5
17-43215322-C-T p.Pro206Ser missense ACBD4 1 82820 1.20744E-5 41410 0 1.71341E-5
17-43215334-C-T p.Pro210Ser missense ACBD4 1 82582 1.21092E-5 41291 0 NA
17-43215337-G-A p.Val211Met missense ACBD4 1 82442 1.21297E-5 41221 0 5.03525E-4
17-43215346-A-G p.Thr214Ala missense ACBD4 1 82178 1.21687E-5 41089 0 3.18918E-5
17-43215353-A-G p.Lys216Arg missense+splice_region ACBD4 1 81982 1.21978E-5 40991 0 NA
17-43215361-C-T c.649+6C>T splice_region ACBD4 2 81556 2.4523E-5 40778 0 3.18451E-5
17-43216383-C-A c.650-5C>A splice_region ACBD4 2 80808 2.475E-5 40404 0 5.27872E-5
17-43216384-G-A c.650-4G>A splice_region ACBD4 1 80878 1.23643E-5 40439 0 1.74948E-5
17-43216396-C-T p.Arg220Trp missense ACBD4 1 81640 1.22489E-5 40820 0 4.45377E-5
17-43216397-G-A p.Arg220Gln missense ACBD4 2 81798 2.44505E-5 40899 0 8.65142E-6
17-43216406-C-T p.Pro223Leu missense ACBD4 19 82122 2.31363E-4 41061 0 2.87173E-4
17-43216408-C-CCGGGGTCCAACT p.Gly222_Pro223insProThrArgGly disruptive_inframe_insertion ACBD4 4 82210 4.86559E-5 41105 0 4.03362E-6
17-43216409-C-T p.Pro224Leu missense ACBD4 29 82272 3.52489E-4 41136 0 2.87191E-4
17-43216422-G-A p.Ser225Asn missense ACBD4 1 82554 1.21133E-5 41277 0 NA
17-43216427-A-C p.Asp230Ala missense ACBD4 1 82586 1.21086E-5 41293 0 NA
17-43216428-C-T p.Thr227Met missense ACBD4 10 82608 1.21054E-4 41304 0 6.25E-4
17-43216429-G-A p.Val231Met missense ACBD4 1 82650 1.20992E-5 41325 0 2.53773E-5
17-43216429-G-C p.Val231Leu missense ACBD4 1 82650 1.20992E-5 41325 0 1.20662E-5
17-43216432-T-G p.Trp232Gly missense ACBD4 1 82688 1.20937E-5 41344 0 3.19061E-5
17-43216445-C-A p.Thr236Lys missense ACBD4 1 82692 1.20931E-5 41346 0 NA
17-43216450-C-T p.Arg238* stop_gained ACBD4 3 82734 3.62608E-5 41367 0 1.20608E-5
17-43216468-A-G p.Met244Val missense ACBD4 5 82826 6.03675E-5 41413 0 6.25E-4
17-43216472-A-G p.Gln245Arg missense ACBD4 7053 82608 0.0853791 41304 346 0.0996619
17-43216472-A-C p.Gln245Pro missense ACBD4 1 82830 1.20729E-5 41415 0 NA
17-43216476-G-A p.Arg243Lys missense ACBD4 6 82840 7.24288E-5 41420 0 4.20713E-5
17-43216482-G-A p.Arg245Lys missense ACBD4 1 82836 1.2072E-5 41418 0 NA
17-43216489-G-T p.Val251Leu missense ACBD4 2 82814 2.41505E-5 41407 0 3.18776E-5
17-43216505-G-A p.Ser256Asn missense ACBD4 2 82766 2.41645E-5 41383 0 NA
17-43216513-C-T p.Arg259Trp missense ACBD4 1 82736 1.20866E-5 41368 0 6.25E-4
17-43216514-G-A p.Arg259Gln missense ACBD4 1 82684 1.20942E-5 41342 0 1.69325E-5
17-43216516-C-T p.Pro260Ser missense ACBD4 2 82680 2.41896E-5 41340 0 8.46797E-6
17-43220813-C-A p.Pro265Thr missense ACBD4 2 81448 2.45555E-5 40724 0 1.04388E-5
17-43220815-G-A p.Arg278His missense ACBD4 2 81492 2.45423E-5 40746 0 1.67091E-5
17-43220824-G-T p.Arg268Ser missense ACBD4 1 81882 1.22127E-5 40941 0 NA
17-43220843-C-G p.Pro275Ala missense ACBD4 2 82498 2.4243E-5 41249 0 4.04675E-6
17-43220845-C-G p.Pro288Arg missense ACBD4 257 82590 0.00311176 41295 2 0.00682093
17-43220851-G-A p.Gly290Asp missense ACBD4 5 82696 6.04624E-5 41348 0 3.63278E-5
17-43220854-C-T p.Ser291Phe missense ACBD4 2 82718 2.41785E-5 41359 0 NA
17-43220855-C-T p.Pro279Ser missense ACBD4 3 82732 3.62617E-5 41366 0 2.54933E-5
17-43220857-G-A p.Arg292Gln missense ACBD4 1 82756 1.20837E-5 41378 0 NA
17-43220860-G-A p.Gly293Asp missense ACBD4 22 82810 2.65668E-4 41405 0 6.25782E-4
17-43220865-C-T p.Ala282Val missense ACBD4 7 82862 8.44778E-5 41431 0 4.02554E-6
17-43220866-G-A p.Arg295His missense ACBD4 7 82878 8.44615E-5 41439 0 3.35447E-5
17-43220871-T-C p.Leu284Pro missense ACBD4 2 83016 2.40917E-5 41508 0 8.36876E-6
17-43220876-TTCC-T p.Leu288del disruptive_inframe_deletion ACBD4 3 83054 3.61211E-5 41527 0 1.67288E-5
17-43220880-T-G p.Leu287Arg missense ACBD4 1 83098 1.2034E-5 41549 0 1.20515E-5
17-43220888-C-T p.Pro290Ser missense ACBD4 1 83146 1.2027E-5 41573 0 3.18756E-5
17-43220896-C-T p.Ser305Leu missense ACBD4 1 83176 1.20227E-5 41588 0 NA
17-43220908-C-A p.Ser309Tyr missense ACBD4 104 83218 0.00124973 41609 0 0.00404536
17-43220921-C-T p.Arg301Trp missense ACBD4 34 83240 4.08457E-4 41620 0 5.41505E-4
17-43220923-G-A p.Gly314Glu missense ACBD4 1 83234 1.20143E-5 41617 0 4.01139E-6
17-43220935-G-GTGAC p.Cys320fs frameshift ACBD4 1 83230 1.20149E-5 41615 0 NA
17-43220941-G-C p.Cys320Ser missense ACBD4 1 83236 1.2014E-5 41618 0 4.01136E-6
17-43220942-T-TC p.Gln321fs frameshift ACBD4 1 83232 1.20146E-5 41616 0 8.33542E-6
17-43220943-C-T p.Gln321* stop_gained ACBD4 1 83228 1.20152E-5 41614 0 NA
17-43220945-G-C p.Gln321His missense ACBD4 1 83208 1.20181E-5 41604 0 2.50108E-5
17-43220949-A-AG p.Leu325fs frameshift ACBD4 4 83212 4.807E-5 41606 0 2.5507E-4
17-43220964-C-G p.Gln328Glu missense ACBD4 2 83204 2.40373E-5 41602 0 1.66892E-5
17-43220981-CTG-C p.Ala335fs frameshift ACBD4 1 83150 1.20265E-5 41575 0 NA
17-43220981-C-T p.Cys333Cys synonymous ACBD4 1 83150 1.20265E-5 41575 0 1.67272E-5
17-43220989-T-G p.Leu336Arg missense ACBD4 1 83108 1.20325E-5 41554 0 8.39546E-6
17-43220992-G-A p.Ser337Asn missense ACBD4 4 83092 4.81394E-5 41546 0 1.27486E-4
17-43220996-TC-CT p.LeuPro338LeuSer missense ACBD4 51 83068 6.13955E-4 41534 0 NA
17-43220996-T-C p.Leu338Leu synonymous ACBD4 1 83066 1.20386E-5 41533 0 0.00153032
17-43220997-C-T p.Pro339Ser missense ACBD4 3 83056 3.61202E-5 41528 0 0.00152944
17-43221004-T-G p.Val341Gly missense ACBD4 2 82992 2.40987E-5 41496 0 NA
17-43221216-G-A c.*208G>A splice_region ACBD4 1 33338 2.99958E-5 16669 0 NA