Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
1-1228950-C-G p.Glu758Asp missense ACAP3 2 40984 4.87995E-5 20492 0 NA
1-1228954-T-C p.Glu757Gly missense ACAP3 1 41040 2.43665E-5 20520 0 1.02438E-5
1-1228971-G-A p.Phe751Phe synonymous ACAP3 2 41148 4.8605E-5 20574 0 NA
1-1228991-G-A p.Arg745Cys missense ACAP3 1 41164 2.42931E-5 20582 0 NA
1-1228993-A-G p.Phe744Ser missense ACAP3 1 41130 2.43132E-5 20565 0 NA
1-1229001-C-G p.Glu741Asp missense ACAP3 2 41080 4.86855E-5 20540 0 9.68117E-5
1-1229004-C-T p.Thr740Thr synonymous ACAP3 38 41042 9.25881E-4 20521 0 0.00303343
1-1229005-G-A p.Thr740Met missense ACAP3 1 41028 2.43736E-5 20514 0 NA
1-1229029-G-A p.Pro732Leu missense ACAP3 2 40724 4.91111E-5 20362 0 1.07158E-4
1-1229031-G-A p.Pro731Pro synonymous ACAP3 1 40742 2.45447E-5 20371 0 0.00409757
1-1229033-G-A p.Pro731Ser missense ACAP3 1 40716 2.45604E-5 20358 0 NA
1-1229041-G-A p.Ala728Val missense ACAP3 1 40668 2.45894E-5 20334 0 2.29885E-4
1-1229043-A-G p.Ala727Ala synonymous ACAP3 3 40638 7.38225E-5 20319 1 NA
1-1229044-G-C p.Ala727Gly missense ACAP3 1 40618 2.46196E-5 20309 0 NA
1-1229054-C-G p.Glu724Gln missense ACAP3 2 40492 4.93925E-5 20246 0 NA
1-1229068-G-A p.Ala719Val missense ACAP3 3 40272 7.44934E-5 20136 0 NA
1-1229087-GCCTACGGGGAGGCACAGCGTGAGACGCCCCTGCCCTGGAGGCCCCGCCCCTGCCCTGGAGGCCCCGCCCCTGCCCTGGAGGCCCCGCCCAGCCCCGAGGGCCCGGCCGCGCTCA-G p.Leu713fs frameshift ACAP3 1 40014 2.49913E-5 20007 0 NA
1-1229088-C-T p.Leu712Leu splice_region+synonymous ACAP3 3 39998 7.50038E-5 19999 0 NA
1-1229091-A-G c.2136-3T>C splice_region ACAP3 1 39932 2.50426E-5 19966 0 NA
1-1229093-G-A c.2136-5C>T splice_region ACAP3 2 39912 5.01102E-5 19956 0 6.55609E-5
1-1229191-GGCCGCGCTCACA-G p.Leu712fs frameshift ACAP3 1 40334 2.4793E-5 20167 0 NA
1-1229195-G-T c.2135+8C>A splice_region ACAP3 1 40498 2.46926E-5 20249 0 NA
1-1229197-G-A c.2135+6C>T splice_region ACAP3 1 40612 2.46233E-5 20306 0 2.51357E-5
1-1229205-T-C p.Thr711Thr splice_region+synonymous ACAP3 13 40946 3.17491E-4 20473 1 4.90517E-4
1-1229222-T-G p.Asn706His missense ACAP3 1 41290 2.42189E-5 20645 0 9.48317E-6
1-1229222-T-C p.Asn706Asp missense ACAP3 2 41290 4.84379E-5 20645 0 NA
1-1229223-G-A p.Ala705Ala synonymous ACAP3 3 41354 7.25444E-5 20677 0 6.25E-4
1-1229225-C-T p.Ala705Thr missense ACAP3 22 41352 5.32018E-4 20676 0 0.00121981
1-1229226-C-G p.Ala704Ala synonymous ACAP3 5 41368 1.20866E-4 20684 0 5.65974E-5
1-1229227-G-A p.Ala704Val missense ACAP3 1 41356 2.41803E-5 20678 0 3.21937E-5
1-1229237-C-T p.Ala701Thr missense ACAP3 1 41614 2.40304E-5 20807 0 NA
1-1229242-G-A p.Ala699Val missense ACAP3 1 41702 2.39797E-5 20851 0 1.85839E-5
1-1229280-G-T p.Asp686Glu missense ACAP3 1 41714 2.39728E-5 20857 0 NA
1-1229280-G-C p.Asp686Glu missense ACAP3 2 41714 4.79455E-5 20857 0 4.72536E-6
1-1229286-G-A p.Gly684Gly synonymous ACAP3 14 41574 3.36749E-4 20787 0 0.00625
1-1229318-G-A c.2025-5C>T splice_region ACAP3 5 41020 1.21892E-4 20510 0 8.56295E-5
1-1229321-G-T c.2025-8C>A splice_region ACAP3 2 40784 4.90388E-5 20392 0 5.02902E-6
1-1229463-G-T c.2024+7C>A splice_region ACAP3 1 53772 1.8597E-5 26886 0 6.25E-4
1-1229471-C-T p.Gly675Ser missense+splice_region ACAP3 1 56750 1.76211E-5 28375 0 5.76203E-6
1-1229483-G-A p.Leu671Leu synonymous ACAP3 45 60516 7.43605E-4 30258 0 0.0027513
1-1229484-C-T p.Leu670Leu synonymous ACAP3 1 60708 1.64723E-5 30354 0 5.26826E-6
1-1229506-G-A p.Ala663Val missense ACAP3 14 65890 2.12475E-4 32945 1 8.69809E-4
1-1229507-C-T p.Ala663Thr missense ACAP3 1 66230 1.50989E-5 33115 0 1.66095E-4
1-1229513-C-T p.Gly661Ser missense ACAP3 1 68230 1.46563E-5 34115 0 NA
1-1229517-G-T p.Ser659Arg missense ACAP3 1 69260 1.44383E-5 34630 0 NA
1-1229524-CTT-C p.Asp658fs frameshift ACAP3 2 70912 2.8204E-5 35456 0 4.61225E-6
1-1229537-C-T p.Asp653Asn missense ACAP3 6 72068 8.32547E-5 36034 0 2.28791E-5
1-1229538-C-T p.Ala652Ala synonymous ACAP3 530 71962 0.007365 35981 5 0.0128066
1-1229539-G-A p.Ala652Val missense ACAP3 1 71938 1.39009E-5 35969 0 NA
1-1229539-G-C p.Ala652Gly missense ACAP3 1 71940 1.39005E-5 35970 0 3.20041E-5
1-1229544-G-A p.Asn650Asn synonymous ACAP3 3 72472 4.13953E-5 36236 0 4.56296E-6
1-1229556-G-A p.Phe646Phe synonymous ACAP3 1 72274 1.38362E-5 36137 0 4.65038E-6
1-1229582-G-A c.1915-3C>T splice_region ACAP3 1 69722 1.43427E-5 34861 0 NA
1-1229585-G-GGGA c.1915-7_1915-6insTCC splice_region ACAP3 1 69204 1.445E-5 34602 0 NA
1-1229585-G-C c.1915-6C>G splice_region ACAP3 1 69204 1.445E-5 34602 0 NA
1-1229788-C-T p.Val636Val synonymous ACAP3 1 44160 2.26449E-5 22080 0 NA
1-1229825-G-T p.Ala624Glu missense ACAP3 1 42622 2.34621E-5 21311 0 3.17622E-5
1-1229827-G-C p.Asp623Glu missense ACAP3 3 42544 7.05152E-5 21272 0 5.45995E-6
1-1229830-C-T p.Ala622Ala synonymous ACAP3 1 42460 2.35516E-5 21230 0 NA
1-1229832-C-T p.Ala622Thr missense ACAP3 1 42426 2.35705E-5 21213 0 NA
1-1229845-G-C p.Ala617Ala synonymous ACAP3 1 41980 2.38209E-5 20990 0 3.84113E-5
1-1229854-G-A p.Ala614Ala synonymous ACAP3 1 41850 2.38949E-5 20925 0 2.60532E-5
1-1229863-C-T p.Ala611Ala synonymous ACAP3 2 41710 4.79501E-5 20855 0 4.705E-5
1-1229871-G-C p.Leu609Val missense ACAP3 1 41778 2.3936E-5 20889 0 NA
1-1229873-G-T p.Ala608Glu missense ACAP3 1 41738 2.3959E-5 20869 0 NA
1-1229878-A-C p.Leu606Leu synonymous ACAP3 69 41740 0.00165309 20870 2 0.00345452
1-1229886-G-C p.Arg604Gly missense ACAP3 1 41632 2.402E-5 20816 0 4.92334E-4
1-1229899-G-A p.Arg599Arg synonymous ACAP3 1 41784 2.39326E-5 20892 0 1.97722E-5
1-1229901-G-A p.Arg599Cys missense ACAP3 1 41832 2.39051E-5 20916 0 NA
1-1229902-G-A p.His598His synonymous ACAP3 1 41868 2.38846E-5 20934 0 3.20472E-5
1-1229913-G-A p.Leu595Phe missense ACAP3 1 42098 2.37541E-5 21049 0 NA
1-1229917-C-T p.Pro593Pro synonymous ACAP3 1 42188 2.37034E-5 21094 0 NA
1-1229917-C-A p.Pro593Pro synonymous ACAP3 4 42188 9.48137E-5 21094 1 NA
1-1229928-C-G p.Glu590Gln missense ACAP3 1 42494 2.35327E-5 21247 0 1.07643E-5
1-1229938-C-G p.Ala586Ala synonymous ACAP3 1 43016 2.32472E-5 21508 0 NA
1-1229946-C-T p.Gly584Ser missense ACAP3 3 43592 6.882E-5 21796 0 3.82307E-5
1-1229953-C-T p.Glu581Glu synonymous ACAP3 19 43922 4.32585E-4 21961 0 0.00103842
1-1229956-G-A p.Ala580Ala synonymous ACAP3 1 43948 2.27542E-5 21974 0 NA
1-1229958-CCTCAGT-C p.Thr578_Glu579del conservative_inframe_deletion ACAP3 2 44182 4.52673E-5 22091 0 1.82282E-5
1-1229961-C-T p.Glu579Lys missense ACAP3 1 44562 2.24406E-5 22281 0 6.39836E-5
1-1229964-T-C p.Thr578Ala missense ACAP3 1 44632 2.24054E-5 22316 0 1.06293E-4
1-1229970-C-T p.Gly576Arg missense ACAP3 1 44998 2.22232E-5 22499 0 8.62411E-6
1-1229976-C-T p.Ala574Thr missense ACAP3 1 45474 2.19906E-5 22737 0 NA
1-1229991-C-T p.Glu569Lys missense ACAP3 2 46484 4.30256E-5 23242 0 3.19754E-5
1-1229995-C-T p.Ser567Ser synonymous ACAP3 3 46584 6.43998E-5 23292 0 1.04954E-4
1-1230008-TCTGTGGGGAGGGGGCGGTCAGGGAAAGCAACCCCCGGGGCTGCCCAGGGGCTGGGCAGGGGCCTCGGGCGAGGGCAAGACGCCACCCAC-T c.1688-89_1688-1delGTGGGTGGCGTCTTGCCCTCGCCCGAGGCCCCTGCCCAGCCCCTGGGCAGCCCCGGGGGTTGCTTTCCCTGACCGCCCCCTCCCCACAG splice_acceptor ACAP3 7 47974 1.45912E-4 23987 0 NA
1-1230014-G-C c.1688-6C>G splice_region ACAP3 1 48374 2.06723E-5 24187 0 NA
1-1230093-C-G c.1912+5G>C splice_region ACAP3 1 58940 1.69664E-5 29470 0 NA
1-1230098-C-T p.Glu638Lys missense+splice_region ACAP3 2 59458 3.36372E-5 29729 0 5.89067E-5
1-1230108-G-C p.Val634Val synonymous ACAP3 2 60628 3.29881E-5 30314 0 NA
1-1230110-C-T p.Val634Ile missense ACAP3 1 60654 1.6487E-5 30327 0 NA
1-1230111-G-A p.Ser633Ser synonymous ACAP3 17 60720 2.79974E-4 30360 0 8.05431E-4
1-1230114-G-A p.Asp632Asp synonymous ACAP3 1 61286 1.63169E-5 30643 0 5.71886E-5
1-1230116-C-G p.Asp632His missense ACAP3 1 61596 1.62348E-5 30798 0 3.19816E-5
1-1230116-C-T p.Asp632Asn missense ACAP3 1 61596 1.62348E-5 30798 0 NA
1-1230129-C-G p.Ser627Ser synonymous ACAP3 1 61748 1.61949E-5 30874 0 0.00307692
1-1230134-C-T p.Gly626Ser missense ACAP3 3 62392 4.80831E-5 31196 0 6.25E-4
1-1230135-G-T p.Phe625Leu missense ACAP3 4 62576 6.39223E-5 31288 0 1.67523E-4
1-1230135-G-A p.Phe625Phe synonymous ACAP3 1 62576 1.59806E-5 31288 0 NA
1-1230144-G-A p.Val622Val synonymous ACAP3 2 62936 3.17783E-5 31468 0 NA
1-1230147-GTCCGAGCTGCCA-G p.Gly618_Asp621del disruptive_inframe_deletion ACAP3 5 62632 7.98314E-5 31316 0 6.39795E-5
1-1230147-G-A p.Asp621Asp synonymous ACAP3 1 62632 1.59663E-5 31316 0 NA
1-1230148-T-A p.Asp621Val missense ACAP3 1 62656 1.59602E-5 31328 0 NA
1-1230150-C-T p.Ser620Ser synonymous ACAP3 1 62282 1.6056E-5 31141 0 6.40041E-5
1-1230159-A-G p.Asp617Asp synonymous ACAP3 1 62146 1.60911E-5 31073 0 NA
1-1230162-C-T p.Ser616Ser synonymous ACAP3 3 61784 4.85563E-5 30892 0 NA
1-1230186-G-A p.Ser608Ser synonymous ACAP3 1 58858 1.699E-5 29429 0 5.66958E-5
1-1230203-G-T c.1814-7C>A splice_region ACAP3 1 56674 1.76448E-5 28337 0 6.77195E-6
1-1230819-A-G c.1687+8T>C splice_region ACAP3 2 81240 2.46184E-5 40620 0 9.58895E-5
1-1230829-C-T p.Arg562His missense+splice_region ACAP3 15 81478 1.84099E-4 40739 0 6.44714E-5
1-1230833-G-T p.Pro561Thr missense ACAP3 27 81610 3.30842E-4 40805 0 1.91485E-4
1-1230835-CCAGCCCCTG-C p.Ala557_Ala559del disruptive_inframe_deletion ACAP3 3 81664 3.67359E-5 40832 0 8.53199E-6
1-1230840-C-A p.Gly558Gly synonymous ACAP3 1 81814 1.22228E-5 40907 0 8.5221E-6
1-1230842-C-T p.Gly558Arg missense ACAP3 1 81880 1.2213E-5 40940 0 NA
1-1230846-G-A p.Ala556Ala synonymous ACAP3 68 81864 8.30646E-4 40932 1 0.00277565
1-1230851-C-T p.Gly555Arg missense ACAP3 12 82038 1.46274E-4 41019 0 2.8688E-4
1-1230854-C-T p.Ala554Thr missense ACAP3 2 82030 2.43813E-5 41015 0 4.01194E-6
1-1230855-G-A p.Asp553Asp synonymous ACAP3 2 82066 2.43706E-5 41033 0 5.04032E-4
1-1230855-G-C p.Asp553Glu missense ACAP3 1 82066 1.21853E-5 41033 0 NA
1-1230857-C-T p.Asp553Asn missense ACAP3 1 82060 1.21862E-5 41030 0 9.56633E-5
1-1230858-G-A p.Phe552Phe synonymous ACAP3 5 82078 6.09177E-5 41039 0 1.9448E-4
1-1230870-G-A p.Leu548Leu synonymous ACAP3 1 82208 1.21643E-5 41104 0 1.68859E-5
1-1230873-C-T p.Ser547Ser synonymous ACAP3 2 82176 2.4338E-5 41088 0 9.56694E-5
1-1230873-CGAGTCCAGCTCGTCGGGACAGAAGAGG-C p.Leu539_Ser547del disruptive_inframe_deletion ACAP3 2 82176 2.4338E-5 41088 0 NA
1-1230874-G-A p.Ser547Leu missense ACAP3 1 82198 1.21657E-5 41099 0 3.19E-5
1-1230874-G-C p.Ser547Trp missense ACAP3 2 82198 2.43315E-5 41099 0 1.60345E-5
1-1230885-G-T p.Asp543Glu missense ACAP3 1 82172 1.21696E-5 41086 0 NA
1-1230885-G-A p.Asp543Asp synonymous ACAP3 2 82172 2.43392E-5 41086 0 4.00924E-6
1-1230887-C-T p.Asp543Asn missense ACAP3 2 82162 2.43422E-5 41081 0 8.46081E-6
1-1230888-G-C p.Pro542Pro synonymous ACAP3 2 82174 2.43386E-5 41087 0 4.01004E-6
1-1230900-G-A p.Ser538Ser synonymous ACAP3 2 82158 2.43433E-5 41079 0 5.04032E-4
1-1230907-C-T p.Arg536Gln missense ACAP3 3 82070 3.65542E-5 41035 0 NA
1-1230908-G-T p.Arg536Arg synonymous ACAP3 2 82044 2.43772E-5 41022 0 3.18796E-5
1-1230908-G-C p.Arg536Gly missense ACAP3 2 82044 2.43772E-5 41022 0 4.01439E-6
1-1230908-G-A p.Arg536* stop_gained ACAP3 1 82044 1.21886E-5 41022 0 NA
1-1230909-G-C p.Arg535Arg synonymous ACAP3 2 82022 2.43837E-5 41011 0 8.02761E-6
1-1230910-C-T p.Arg535His missense ACAP3 3 81996 3.65871E-5 40998 0 2.00777E-5
1-1230911-G-A p.Arg535Cys missense ACAP3 3 82004 3.65836E-5 41002 0 0.00100908
1-1230920-G-C p.Arg532Gly missense ACAP3 1 81888 1.22118E-5 40944 0 NA
1-1230924-C-T p.Leu530Leu synonymous ACAP3 1 81856 1.22166E-5 40928 0 NA
1-1230927-G-A p.Thr529Thr synonymous ACAP3 1 81762 1.22306E-5 40881 0 1.61164E-5
1-1230928-G-C p.Thr529Ser missense ACAP3 1 81738 1.22342E-5 40869 0 4.02784E-6
1-1230931-C-T p.Gly528Asp missense ACAP3 1 81630 1.22504E-5 40815 0 4.03727E-6
1-1230932-C-T p.Gly528Ser missense+splice_region ACAP3 1 81626 1.2251E-5 40813 0 9.09471E-6
1-1230936-T-C c.1580-2A>G splice_acceptor ACAP3 1 81590 1.22564E-5 40795 0 NA
1-1230942-G-A c.1580-8C>T splice_region ACAP3 2 81502 2.45393E-5 40751 0 3.78601E-5
1-1231128-C-T p.Ala523Thr missense ACAP3 1 80506 1.24214E-5 40253 0 3.18715E-5
1-1231129-G-A p.Ala522Ala synonymous ACAP3 2 80634 2.48034E-5 40317 0 3.36123E-5
1-1231147-G-T p.Pro516Pro synonymous ACAP3 26 81308 3.19772E-4 40654 0 4.77951E-4
1-1231147-G-A p.Pro516Pro synonymous ACAP3 24 81310 2.95167E-4 40655 0 7.96584E-4
1-1231150-C-T p.Glu515Glu synonymous ACAP3 1 81332 1.22953E-5 40666 0 9.09587E-6
1-1231153-A-C p.Leu514Leu synonymous ACAP3 1 81652 1.22471E-5 40826 0 NA
1-1231157-C-T p.Arg513Gln missense ACAP3 5 81742 6.11681E-5 40871 0 6.26566E-4
1-1231158-G-A p.Arg513Trp missense ACAP3 2 81806 2.44481E-5 40903 0 NA
1-1231162-C-T p.Lys511Lys synonymous ACAP3 4 81900 4.884E-5 40950 0 NA
1-1231166-C-A p.Arg510Leu missense ACAP3 3 81928 3.66175E-5 40964 0 4.43428E-5
1-1231167-G-A p.Arg510Cys missense ACAP3 2 81938 2.44087E-5 40969 0 6.3743E-5
1-1231170-G-A p.Arg509Cys missense ACAP3 1 82030 1.21907E-5 41015 0 4.40118E-5
1-1231182-C-T p.Ala505Thr missense ACAP3 1 81686 1.2242E-5 40843 0 3.18939E-5
1-1231183-G-A p.Arg504Arg synonymous ACAP3 1 81838 1.22193E-5 40919 0 3.18796E-5
1-1231184-C-T p.Arg504His missense ACAP3 5 81904 6.10471E-5 40952 0 8.70065E-6
1-1231184-C-G p.Arg504Pro missense ACAP3 1 81904 1.22094E-5 40952 0 NA
1-1231185-G-C p.Arg504Gly missense ACAP3 2 82034 2.43801E-5 41017 0 3.18776E-5
1-1231185-G-A p.Arg504Cys missense ACAP3 4 82034 4.87603E-5 41017 0 1.14307E-4
1-1231186-G-A p.Pro503Pro synonymous ACAP3 4 82116 4.87116E-5 41058 0 0.00125313
1-1231197-G-C p.His500Asp missense ACAP3 1 82334 1.21457E-5 41167 0 4.05973E-6
1-1231200-G-A p.Pro499Ser missense ACAP3 1 82354 1.21427E-5 41177 0 NA
1-1231202-C-A p.Arg498Leu missense ACAP3 2 82340 2.42895E-5 41170 0 8.54073E-6
1-1231203-G-A p.Arg498Trp missense ACAP3 6 82342 7.28668E-5 41171 0 1.8772E-4
1-1231205-A-G p.Leu497Pro missense ACAP3 2 82420 2.4266E-5 41210 0 3.18878E-5
1-1231208-C-T p.Cys496Tyr missense ACAP3 94 82502 0.00113937 41251 0 0.00153051
1-1231212-T-G p.Lys495Gln missense ACAP3 1 82606 1.21057E-5 41303 0 NA
1-1231237-C-A p.Glu486Asp missense ACAP3 1 82798 1.20776E-5 41399 0 NA
1-1231245-C-G p.Ala484Pro missense ACAP3 90 82780 0.00108722 41390 1 0.00204108
1-1231248-G-C p.Pro483Ala missense ACAP3 1 82810 1.20758E-5 41405 0 NA
1-1231251-C-T p.Ala482Thr missense ACAP3 1 82812 1.20755E-5 41406 0 NA
1-1231259-G-A p.Ala479Val missense ACAP3 2 82844 2.41418E-5 41422 0 7.22874E-5
1-1231259-G-T p.Ala479Glu missense ACAP3 1 82844 1.20709E-5 41422 0 NA
1-1231260-C-G p.Ala479Pro missense ACAP3 3 82848 3.62109E-5 41424 0 0.001875
1-1231261-C-T p.Lys478Lys synonymous ACAP3 5 82856 6.03457E-5 41428 0 NA
1-1231265-C-T p.Arg477Gln missense ACAP3 3 82868 3.62022E-5 41434 0 9.56816E-5
1-1231266-G-A p.Arg477Trp missense ACAP3 4 82882 4.82614E-5 41441 0 1.08342E-4
1-1231280-T-A p.Glu472Val missense ACAP3 238 82906 0.00287072 41453 0 0.00593074
1-1231284-C-T p.Val471Met missense ACAP3 2 82924 2.41185E-5 41462 0 4.00747E-6
1-1231285-G-A p.Tyr470Tyr synonymous ACAP3 2 82918 2.41202E-5 41459 0 1.6721E-5
1-1231289-T-C p.Lys469Arg missense ACAP3 1 82910 1.20613E-5 41455 0 8.35967E-6
1-1231303-G-C p.Ala464Ala synonymous ACAP3 1 82836 1.2072E-5 41418 0 4.00458E-6
1-1231312-G-C p.Asp461Glu missense ACAP3 1 82786 1.20793E-5 41393 0 NA
1-1231317-GCCTGGACCAGGGGGGAACATGAGGCTGTGCCCCCAGGCTGGGGCTCCCTGACTGATCCAGACTGTACCCCACCTCA-G p.Gln460fs frameshift ACAP3 12 82748 1.45019E-4 41374 5 NA
1-1231317-G-T p.Gln460Lys missense+splice_region ACAP3 1 82750 1.20846E-5 41375 0 1.59429E-4
1-1231325-CA-C c.1377-8delT splice_region ACAP3 5 82720 6.04449E-5 41360 0 7.61017E-5
1-1231396-G-A p.Arg459Trp missense+splice_region ACAP3 3 82426 3.63963E-5 41213 0 6.37877E-5
1-1231418-C-T p.Arg451Arg synonymous ACAP3 2 82592 2.42154E-5 41296 0 8.34446E-6
1-1231419-C-T p.Arg451Lys missense ACAP3 1 82598 1.21068E-5 41299 0 4.00131E-6
1-1231422-C-G p.Ser450Thr missense ACAP3 1 82586 1.21086E-5 41293 0 7.50951E-5
1-1231428-G-A p.Ala448Val missense ACAP3 1 82568 1.21112E-5 41284 0 6.25E-4
1-1231431-C-T p.Gly447Asp missense ACAP3 1 82600 1.21065E-5 41300 0 NA
1-1231432-C-A p.Gly447Cys missense ACAP3 1 82604 1.2106E-5 41302 0 3.18959E-5
1-1231434-T-G p.Glu446Ala missense ACAP3 1 82612 1.21048E-5 41306 0 8.34404E-6
1-1231454-C-T p.Gln439Gln synonymous ACAP3 1 82560 1.21124E-5 41280 0 NA
1-1231463-A-G p.Ala436Ala synonymous ACAP3 2 82452 2.42565E-5 41226 0 NA
1-1231465-C-T p.Ala436Thr missense ACAP3 1 82388 1.21377E-5 41194 0 6.38121E-5
1-1231466-G-A p.Ser435Ser synonymous ACAP3 4 82388 4.85508E-5 41194 0 3.19061E-5
1-1231472-T-G p.Gly433Gly synonymous ACAP3 1 82354 1.21427E-5 41177 0 8.36778E-6
1-1231489-GCTAGCGGGAGACAGGGCGAGCAGGCATCAGTGCGAACCTGCAGACCCCAGCTCCCGCCCCCACAAACGGGGTCCCGTGGCCTCCAGGAGCCCCACACGCAC-G c.1281+1_1282-1del splice_acceptor ACAP3 1 82120 1.21773E-5 41060 0 NA
1-1231493-G-C c.1282-4C>G splice_region ACAP3 7 81950 8.54179E-5 40975 0 3.60701E-5
1-1231494-C-T c.1282-5G>A splice_region ACAP3 2 81890 2.4423E-5 40945 0 2.57272E-5
1-1231495-G-A c.1282-6C>T splice_region ACAP3 2 81896 2.44212E-5 40948 0 4.31913E-5
1-1231584-C-T c.1281+7G>A splice_region ACAP3 2 79476 2.51648E-5 39738 0 4.82044E-5
1-1231586-C-T c.1281+5G>A splice_region ACAP3 2 79368 2.51991E-5 39684 0 9.90933E-5
1-1231587-G-A c.1281+4C>T splice_region ACAP3 3370 78804 0.0427643 39402 99 0.0636166
1-1231605-G-A p.Pro423Ser missense ACAP3 1 77500 1.29032E-5 38750 0 3.18593E-5
1-1231611-A-G p.Trp421Arg missense ACAP3 1 76906 1.30029E-5 38453 0 NA
1-1231620-G-A p.Leu418Leu synonymous ACAP3 1 74720 1.33833E-5 37360 0 3.85446E-5
1-1231622-G-A p.Thr417Met missense ACAP3 2 74176 2.69629E-5 37088 0 3.97899E-5
1-1231623-T-C p.Thr417Ala missense ACAP3 2 74004 2.70256E-5 37002 0 NA
1-1231631-C-T p.Arg414Gln missense ACAP3 1 71650 1.39567E-5 35825 0 4.1542E-5
1-1231642-G-A p.Cys410Cys synonymous ACAP3 2 68760 2.90867E-5 34380 0 NA
1-1231647-G-A p.His409Tyr missense ACAP3 7 67446 1.03787E-4 33723 0 NA
1-1231650-C-T p.Val408Ile missense ACAP3 1 66318 1.50789E-5 33159 0 NA
1-1231656-G-A p.Leu406Leu synonymous ACAP3 2405 64238 0.0374389 32119 57 0.0692407
1-1231805-C-T p.Arg404Lys missense+splice_region ACAP3 1 44914 2.22648E-5 22457 0 NA
1-1231831-G-A p.Leu395Leu synonymous ACAP3 26 46538 5.58683E-4 23269 1 9.82842E-5
1-1231837-C-G p.Val393Val synonymous ACAP3 1 46706 2.14105E-5 23353 0 NA
1-1231840-G-A p.Gly392Gly synonymous ACAP3 2 46712 4.28156E-5 23356 0 1.40611E-5
1-1231862-C-T p.Arg385His missense ACAP3 16 47620 3.35993E-4 23810 0 3.28098E-4
1-1231867-G-A p.Asp383Asp synonymous ACAP3 19 47898 3.96676E-4 23949 0 0.00413162
1-1231870-C-A p.Pro382Pro synonymous ACAP3 2 47848 4.1799E-5 23924 0 0.00167785
1-1231871-G-C p.Pro382Arg missense ACAP3 1 47886 2.08829E-5 23943 0 NA
1-1231878-C-T p.Gly380Ser missense ACAP3 2 48524 4.12167E-5 24262 0 7.20025E-6
1-1231885-G-T p.Gly377Gly synonymous ACAP3 3 49144 6.10451E-5 24572 0 7.29182E-5
1-1231888-G-A p.Cys376Cys synonymous ACAP3 1 49770 2.00924E-5 24885 0 6.46607E-5
1-1231894-G-A p.Ser374Ser synonymous ACAP3 1 50964 1.96217E-5 25482 0 NA
1-1231909-A-G p.Ser369Ser synonymous ACAP3 1 52906 1.89014E-5 26453 0 NA
1-1231919-C-T p.Arg366His missense ACAP3 3 54448 5.50984E-5 27224 0 1.42967E-5
1-1231920-G-A p.Arg366Cys missense ACAP3 11 54448 2.02028E-4 27224 0 6.94252E-5
1-1231926-G-A p.Leu364Leu synonymous ACAP3 1 55662 1.79656E-5 27831 0 7.13959E-6
1-1231936-G-A p.Gly360Gly synonymous ACAP3 42 56586 7.42233E-4 28293 0 0.00111614
1-1231945-G-A p.Gly357Gly synonymous ACAP3 2 57660 3.46861E-5 28830 0 6.7769E-5
1-1231963-G-A p.Thr351Thr synonymous ACAP3 1 59700 1.67504E-5 29850 0 5.38793E-4
1-1231969-G-A p.Ser349Ser synonymous ACAP3 192 59884 0.0032062 29942 0 0.0157368
1-1231975-G-A p.Ile347Ile synonymous ACAP3 1 59814 1.67185E-5 29907 0 NA
1-1231975-G-C p.Ile347Met missense ACAP3 2 59814 3.3437E-5 29907 0 NA
1-1231984-C-T p.Thr344Thr synonymous ACAP3 2 59650 3.35289E-5 29825 0 0.00125
1-1231985-G-A p.Thr344Met missense ACAP3 3 59928 5.00601E-5 29964 0 9.56938E-5
1-1231986-T-C p.Thr344Ala missense ACAP3 2 59686 3.35087E-5 29843 0 1.42761E-5
1-1231990-C-T p.Pro342Pro synonymous ACAP3 5 59472 8.40732E-5 29736 0 5.10074E-4
1-1231991-G-A p.Pro342Leu missense ACAP3 3 59628 5.03119E-5 29814 0 1.57064E-4
1-1232003-C-T p.Arg338His missense ACAP3 1 59152 1.69056E-5 29576 0 2.15647E-5
1-1232004-G-A p.Arg338Cys missense ACAP3 168 59294 0.00283334 29647 0 0.00475249
1-1232005-G-C p.Asp337Glu missense ACAP3 1 59298 1.6864E-5 29649 0 3.18878E-5
1-1232010-G-C p.Leu336Val missense ACAP3 2 59104 3.38387E-5 29552 0 NA
1-1232016-G-A c.1003-3C>T splice_region ACAP3 1 58754 1.70201E-5 29377 0 6.9185E-5
1-1232020-G-A c.1003-7C>T splice_region ACAP3 2 58546 3.41612E-5 29273 0 6.93193E-5
1-1233199-C-T c.1002+3G>A splice_region ACAP3 1 53566 1.86686E-5 26783 0 NA
1-1233204-C-T p.Glu334Lys missense+splice_region ACAP3 1 54144 1.84693E-5 27072 0 3.19489E-5
1-1233205-G-A p.Ser333Ser synonymous ACAP3 1 54300 1.84162E-5 27150 0 0.00101626
1-1233208-A-G p.Tyr332Tyr synonymous ACAP3 1 54924 1.8207E-5 27462 0 NA
1-1233220-A-G p.Pro328Pro synonymous ACAP3 2 56138 3.56265E-5 28069 0 3.19632E-5
1-1233223-G-T p.Ser327Arg missense ACAP3 2 56202 3.55859E-5 28101 0 3.19489E-5
1-1233229-G-A p.Arg325Arg synonymous ACAP3 1 56418 1.77248E-5 28209 0 1.70372E-5
1-1233230-C-T p.Arg325His missense ACAP3 3 56530 5.30692E-5 28265 0 1.70349E-5
1-1233231-G-C p.Arg325Gly missense ACAP3 3 56586 5.30166E-5 28293 0 2.47132E-4
1-1233231-G-A p.Arg325Cys missense ACAP3 1 56586 1.76722E-5 28293 0 3.40872E-5
1-1233238-G-A p.Ser322Ser synonymous ACAP3 1 56720 1.76305E-5 28360 0 3.67963E-5
1-1233244-G-A p.Ile320Ile synonymous ACAP3 21 56824 3.69562E-4 28412 0 2.70003E-4
1-1233246-T-C p.Ile320Val missense ACAP3 2 57168 3.49846E-5 28584 0 5.04541E-4
1-1233260-G-A p.Ala315Val missense ACAP3 2 57144 3.49993E-5 28572 0 6.39304E-5
1-1233271-G-A p.Ala311Ala synonymous ACAP3 7 57112 1.22566E-4 28556 0 2.23614E-4
1-1233274-T-G p.Gln310His missense ACAP3 2 56886 3.5158E-5 28443 0 NA
1-1233275-T-A p.Gln310Leu missense ACAP3 1 56846 1.75914E-5 28423 0 6.39264E-5
1-1233289-G-A p.Ser305Ser synonymous ACAP3 2 56790 3.52175E-5 28395 0 6.00487E-5
1-1233292-G-C p.Asp304Glu missense ACAP3 1 57012 1.75402E-5 28506 0 NA
1-1233293-TCAGCCTG-T p.Gln302fs frameshift ACAP3 1 56956 1.75574E-5 28478 0 NA
1-1233300-G-A p.Gln302* stop_gained ACAP3 1 57070 1.75223E-5 28535 0 NA
1-1233301-C-T p.Leu301Leu synonymous ACAP3 1 57144 1.74996E-5 28572 0 4.50768E-5
1-1233304-C-G p.Met300Ile missense ACAP3 1 57392 1.7424E-5 28696 0 3.19448E-5
1-1233308-C-T p.Cys299Tyr missense ACAP3 1 57342 1.74392E-5 28671 0 8.68689E-6
1-1233312-TCCTGCAGGCAGTGGAGGGGCGGGCGTCAGCTCCGGTGGGCAGGTACGCCCCCCGCCCCACCCTGGGCTGGGCCTCCTCA-T p.Ser298fs frameshift ACAP3 7 57392 1.21968E-4 28696 0 NA
1-1233312-TCCTGCAGGCAGTGGAGGGGCGGGCGTCAGCTCCGGTGGGCAGGTACGCCCCCCGCCCCACCCTGGGCTGGGCCTCCTCACTTGGTGGGTGACAGCA-T p.Val292fs frameshift ACAP3 4 57394 6.96937E-5 28697 0 NA
1-1233316-G-C c.891-3C>G splice_region ACAP3 1 57508 1.73889E-5 28754 0 NA
1-1233317-C-T c.891-4G>A splice_region ACAP3 1 57610 1.73581E-5 28805 0 NA
1-1233321-C-G c.891-8G>C splice_region ACAP3 2 57740 3.4638E-5 28870 0 2.46985E-5
1-1233392-C-T c.890+1G>A splice_donor ACAP3 1 64654 1.54669E-5 32327 0 NA
1-1233393-T-C p.Lys297Arg missense+splice_region ACAP3 1 64656 1.54665E-5 32328 0 1.27812E-4
1-1233396-G-T p.Thr296Asn missense ACAP3 1 64904 1.54074E-5 32452 0 NA
1-1233398-G-A p.Pro295Pro synonymous ACAP3 1 65018 1.53804E-5 32509 0 9.13759E-6
1-1233401-T-TA p.Pro295fs frameshift ACAP3 1 65106 1.53596E-5 32553 0 NA
1-1233410-C-T p.Glu291Glu synonymous ACAP3 1 65648 1.52328E-5 32824 0 4.08577E-6
1-1233413-G-A p.Phe290Phe synonymous ACAP3 1 65818 1.51934E-5 32909 0 1.22631E-5
1-1233428-C-T p.Glu285Glu synonymous ACAP3 1 66372 1.50666E-5 33186 0 6.25E-4
1-1233430-C-A p.Glu285* stop_gained ACAP3 1 66464 1.50457E-5 33232 0 NA
1-1233431-G-A p.Ile284Ile synonymous ACAP3 68 66456 0.00102323 33228 1 0.00302419
1-1233443-C-T p.Pro280Pro synonymous ACAP3 3 67072 4.47281E-5 33536 0 0.00100806
1-1233443-C-G p.Pro280Pro synonymous ACAP3 1 67072 1.49094E-5 33536 0 NA
1-1233444-G-A p.Pro280Leu missense ACAP3 1 66712 1.49898E-5 33356 0 4.11489E-6
1-1233467-G-A p.Asp272Asp synonymous ACAP3 3 65792 4.55982E-5 32896 0 1.27624E-4
1-1233473-C-T p.Val270Val synonymous ACAP3 1 65642 1.52341E-5 32821 0 3.18959E-5
1-1233476-C-T p.Val269Val synonymous ACAP3 1 65572 1.52504E-5 32786 0 2.11646E-5
1-1233482-G-A p.Thr267Thr synonymous ACAP3 16 64926 2.46434E-4 32463 0 0.00105303
1-1233490-C-T p.Ala265Thr missense ACAP3 6 64172 9.34987E-5 32086 0 1.51995E-4
1-1233493-C-T p.Asp264Asn missense+splice_region ACAP3 1 64198 1.55768E-5 32099 0 1.30179E-5
1-1233557-T-A n.81+8A>T splice_region ACAP3 1 60186 1.66152E-5 30093 0 NA
1-1233743-G-C c.789+7C>G splice_region ACAP3 2 79108 2.52819E-5 39554 0 9.56694E-5
1-1233756-C-T p.Lys261Lys synonymous ACAP3 1 79566 1.25682E-5 39783 0 3.18837E-5
1-1233758-T-G p.Lys261Gln missense ACAP3 1 79668 1.25521E-5 39834 0 8.74952E-6
1-1233771-C-T p.Leu256Leu synonymous ACAP3 1 79744 1.25401E-5 39872 0 NA
1-1233779-T-C p.Ser254Gly missense ACAP3 11 79944 1.37596E-4 39972 0 2.55086E-4
1-1233791-A-C p.Ser250Ala missense ACAP3 1 79882 1.25185E-5 39941 0 8.83283E-6
1-1233794-A-C p.Phe249Val missense ACAP3 1 79876 1.25194E-5 39938 0 NA
1-1233798-G-C p.Arg247Arg synonymous ACAP3 2 79820 2.50564E-5 39910 1 NA
1-1233807-TG-T c.738-7delC splice_region ACAP3 1 79788 1.25332E-5 39894 0 8.89727E-6
1-1233939-C-T c.737+8G>A splice_region ACAP3 1 80236 1.24632E-5 40118 0 6.48424E-5
1-1233941-T-C c.737+6A>G splice_region ACAP3 14618 78818 0.185465 39409 2748 0.319637
1-1233955-T-A p.Thr243Thr synonymous ACAP3 27 81688 3.30526E-4 40844 0 0.00504541
1-1233966-C-T p.Ala240Thr missense ACAP3 1 82036 1.21898E-5 41018 0 2.00409E-5
1-1233967-G-A p.Asn239Asn synonymous ACAP3 159 82110 0.00193643 41055 1 0.00605449
1-1233976-C-T p.Arg236Arg synonymous ACAP3 1 82254 1.21575E-5 41127 0 3.20636E-5
1-1233982-G-A p.Phe234Phe synonymous ACAP3 1 82336 1.21454E-5 41168 0 NA
1-1234006-C-T p.Gly226Gly synonymous ACAP3 1 82450 1.21286E-5 41225 0 4.00356E-6
1-1234009-A-G p.Ser225Ser synonymous ACAP3 1 82408 1.21347E-5 41204 0 8.37353E-6
1-1234015-C-T p.Ala223Ala synonymous ACAP3 1 82322 1.21474E-5 41161 0 3.19714E-5
1-1234016-G-A p.Ala223Val missense ACAP3 1 82344 1.21442E-5 41172 0 6.70006E-5
1-1234017-C-T p.Ala223Thr missense ACAP3 4 82338 4.85802E-5 41169 0 1.20157E-5
1-1234018-G-A p.Asp222Asp synonymous ACAP3 2 82354 2.42854E-5 41177 0 6.25E-4
1-1234024-G-A p.Asp220Asp synonymous ACAP3 1 82288 1.21524E-5 41144 0 2.8044E-5
1-1234027-A-G p.Phe219Phe synonymous ACAP3 1 82296 1.21513E-5 41148 0 3.19611E-5
1-1234035-C-T p.Val217Met missense ACAP3 1 82234 1.21604E-5 41117 0 4.00692E-6
1-1234047-C-T p.Asp213Asn missense ACAP3 1 81968 1.21999E-5 40984 0 6.37511E-5
1-1234048-G-A p.Tyr212Tyr synonymous ACAP3 3 81954 3.66059E-5 40977 0 1.2621E-4
1-1234049-TAGG-T p.Ser211del disruptive_inframe_deletion ACAP3 7 81886 8.54847E-5 40943 0 2.52406E-5
1-1234052-G-C p.Ser211Cys missense ACAP3 2 81828 2.44415E-5 40914 0 4.01175E-6
1-1234052-G-A p.Ser211Phe missense ACAP3 1 81828 1.22208E-5 40914 0 NA
1-1234054-G-A p.Phe210Phe synonymous ACAP3 2 81744 2.44666E-5 40872 0 8.43711E-6
1-1234057-G-A p.Asp209Asp splice_region+synonymous ACAP3 19 81602 2.32837E-4 40801 0 7.33652E-4
1-1234065-G-A c.625-6C>T splice_region ACAP3 1 81276 1.23038E-5 40638 0 NA
1-1234067-G-A c.625-8C>T splice_region ACAP3 2 81146 2.46469E-5 40573 0 4.02768E-6
1-1234125-C-T n.1945G>A splice_region ACAP3 8 77132 1.03718E-4 38566 0 NA
1-1234126-G-A n.1944C>T splice_region ACAP3 18 76914 2.34028E-4 38457 0 NA
1-1234728-C-T p.Leu207Leu synonymous ACAP3 1 79920 1.25125E-5 39960 0 3.18817E-5
1-1234735-G-A p.Thr205Met missense+splice_region ACAP3 2 79910 2.50282E-5 39955 0 3.2596E-5
1-1234742-G-A c.613-6C>T splice_region ACAP3 3 79956 3.75206E-5 39978 0 1.28515E-5
1-1234743-G-A c.613-7C>T splice_region ACAP3 1 79928 1.25113E-5 39964 0 4.87016E-6
1-1235203-G-A c.612+8C>T splice_region ACAP3 2 78182 2.55813E-5 39091 0 1.29438E-5
1-1235212-C-T p.Arg204Gln missense+splice_region ACAP3 1 78500 1.27389E-5 39250 0 1.25835E-5
1-1235225-C-T p.Ala200Thr missense ACAP3 1 78356 1.27623E-5 39178 0 4.83729E-5
1-1235226-G-A p.Ala199Ala synonymous ACAP3 1 78390 1.27567E-5 39195 0 5.91017E-5
1-1235228-C-T p.Ala199Thr missense ACAP3 2 78244 2.55611E-5 39122 0 5.76901E-5
1-1235229-G-A p.His198His synonymous ACAP3 3 78338 3.82956E-5 39169 0 0.00102459
1-1235236-C-T p.Arg196Gln missense ACAP3 3 78346 3.82917E-5 39173 0 0.00254842
1-1235249-G-A p.Arg192Cys missense ACAP3 1 78032 1.28153E-5 39016 0 3.82878E-5
1-1235252-T-C p.Lys191Glu missense ACAP3 1 78296 1.2772E-5 39148 0 NA
1-1235259-C-T p.Ala188Ala synonymous ACAP3 3 78066 3.8429E-5 39033 0 0.0010142
1-1235263-G-C p.Ser187Cys missense ACAP3 2 78072 2.56174E-5 39036 0 3.18593E-5
1-1235267-C-T p.Asp186Asn missense ACAP3 1 77790 1.28551E-5 38895 0 1.45553E-4
1-1235268-G-A p.Ile185Ile synonymous ACAP3 3 77688 3.8616E-5 38844 0 1.38998E-4
1-1235268-G-T p.Ile185Ile synonymous ACAP3 1 77690 1.28717E-5 38845 0 2.31664E-5
1-1235269-A-G p.Ile185Thr missense ACAP3 1 77784 1.28561E-5 38892 0 NA
1-1235275-A-C p.Leu183Arg missense ACAP3 1 77770 1.28584E-5 38885 0 NA
1-1235282-C-G p.Asp181His missense ACAP3 2 77440 2.58264E-5 38720 0 NA
1-1235285-GCTGTTGGGGGTGGCATTAGGGAAGGTCACGGAGGCCTGGCCCAGCCCCACCCCTCCCAAAGGCTCAC-G c.537+1_538-1delGTGAGCCTTTGGGAGGGGTGGGGCTGGGCCAGGCCTCCGTGACCTTCCCTAATGCCACCCCCAACAG splice_acceptor ACAP3 6 77332 7.75875E-5 38666 0 NA
1-1235347-G-A c.537+6C>T splice_region ACAP3 2 75008 2.66638E-5 37504 0 NA
1-1235355-C-T p.Glu179Lys missense+splice_region ACAP3 1 74448 1.34322E-5 37224 0 1.27478E-4
1-1235356-G-A p.Ala178Ala synonymous ACAP3 1 74142 1.34876E-5 37071 0 1.27453E-4
1-1235373-T-C p.Met173Val missense ACAP3 1 74240 1.34698E-5 37120 0 4.03982E-6
1-1235377-G-A p.Pro171Pro synonymous ACAP3 1 74122 1.34913E-5 37061 0 8.65546E-6
1-1235387-T-C p.Gln168Arg missense ACAP3 2 73944 2.70475E-5 36972 0 8.6192E-6
1-1235389-G-A p.His167His synonymous ACAP3 1 73982 1.35168E-5 36991 0 0.00100908
1-1235391-G-A p.His167Tyr missense ACAP3 1 73928 1.35267E-5 36964 0 NA
1-1235394-G-A p.Leu166Leu synonymous ACAP3 1 73908 1.35303E-5 36954 0 NA
1-1235396-A-C p.Leu165Arg missense ACAP3 1 73832 1.35443E-5 36916 0 NA
1-1235397-G-C p.Leu165Val missense ACAP3 4 73876 5.41448E-5 36938 0 6.05122E-5
1-1235397-G-T p.Leu165Ile missense ACAP3 1 73876 1.35362E-5 36938 0 NA
1-1235407-C-T p.Gln161Gln synonymous ACAP3 2 73728 2.71267E-5 36864 0 NA
1-1235416-G-A p.Phe158Phe synonymous ACAP3 148 73518 0.00201311 36759 0 0.00223058
1-1235420-C-A p.Ser157Ile missense ACAP3 2 73310 2.72814E-5 36655 0 NA
1-1235431-G-A p.His153His synonymous ACAP3 27 73162 3.69044E-4 36581 1 0.001116
1-1235440-G-A p.Ser150Ser synonymous ACAP3 2 73606 2.71717E-5 36803 0 NA
1-1235448-TCTGCGGGGGCAGCACAGGTGAGGCCCAAGCACACCCGGTCCAGCCCCCAACATGCAGCCTGTGCTCAGGGGCAGCCCCCACGCACTCAC-T c.441+1_442-1delGTGAGTGCGTGGGGGCTGCCCCTGAGCACAGGCTGCATGTTGGGGGCTGGACCGGGTGTGCTTGGGCCTCACCTGTGCTGCCCCCGCAG splice_acceptor ACAP3 7 73414 9.53497E-5 36707 0 NA
1-1235451-G-A c.442-3C>T splice_region ACAP3 1 73092 1.36814E-5 36546 0 1.61929E-5
1-1235452-C-T c.442-4G>A splice_region ACAP3 6 72858 8.2352E-5 36429 0 9.5645E-5
1-1235452-CG-C c.442-5delC splice_region ACAP3 2 72858 2.74507E-5 36429 0 3.18817E-5
1-1235453-G-A c.442-5C>T splice_region ACAP3 1 72738 1.3748E-5 36369 0 2.02583E-5
1-1235530-G-A c.441+8C>T splice_region ACAP3 1 68658 1.45649E-5 34329 0 8.1706E-6
1-1235539-G-C p.Ser147Cys missense+splice_region ACAP3 3 68196 4.39909E-5 34098 0 1.71981E-5
1-1235550-C-T p.Glu143Glu synonymous ACAP3 2 66774 2.99518E-5 33387 0 4.09403E-6
1-1235559-C-T p.Lys140Lys synonymous ACAP3 1 65816 1.51939E-5 32908 0 NA
1-1235567-C-T p.Ala138Thr missense ACAP3 1 64596 1.54808E-5 32298 0 1.74195E-5
1-1235579-T-A p.Asn134Tyr missense ACAP3 2 63696 3.13991E-5 31848 0 NA
1-1235901-G-C p.Asp128Glu missense ACAP3 2 81620 2.45038E-5 40810 0 NA
1-1235917-C-T p.Arg123His missense ACAP3 1 81604 1.22543E-5 40802 0 4.05551E-6
1-1235948-C-T p.Gly113Arg missense ACAP3 1 81944 1.22035E-5 40972 0 1.68831E-5
1-1235949-G-C p.Thr112Thr synonymous ACAP3 4 82018 4.87698E-5 41009 0 0.00125
1-1235967-G-A p.His106His synonymous ACAP3 2 82368 2.42813E-5 41184 0 1.21652E-5
1-1235970-G-A p.Pro105Pro synonymous ACAP3 14 82426 1.69849E-4 41213 0 5.09846E-4
1-1235971-G-T p.Pro105His missense ACAP3 1 82444 1.21294E-5 41222 0 2.03568E-5
1-1235982-C-T p.Pro101Pro synonymous ACAP3 6 82566 7.26691E-5 41283 0 0.00100806
1-1235994-G-A p.Asn97Asn synonymous ACAP3 2 82654 2.41973E-5 41327 0 6.25E-4
1-1236006-G-C p.Ser93Ser synonymous ACAP3 1 82744 1.20855E-5 41372 0 NA
1-1236021-C-T p.Glu88Glu synonymous ACAP3 1 82806 1.20764E-5 41403 0 NA
1-1236028-A-C p.Val86Gly missense ACAP3 3 82774 3.62433E-5 41387 0 NA
1-1236029-C-T p.Val86Met missense ACAP3 1 82788 1.2079E-5 41394 0 4.06524E-6
1-1236040-T-C p.Gln82Arg missense ACAP3 1 82758 1.20834E-5 41379 0 NA
1-1236064-C-T p.Arg74Gln missense ACAP3 1 82466 1.21262E-5 41233 0 NA
1-1236075-G-A c.213-3C>T splice_region ACAP3 1 82242 1.21592E-5 41121 0 NA
1-1236079-G-A c.213-7C>T splice_region ACAP3 1 82064 1.21856E-5 41032 0 1.26166E-5
1-1237238-G-A n.483C>T splice_region ACAP3 3 69914 4.29099E-5 34957 0 NA
1-1237370-T-C p.Lys70Lys splice_region+synonymous ACAP3 1 81814 1.22228E-5 40907 0 3.45543E-5
1-1237379-G-A p.Ser67Ser synonymous ACAP3 1 81894 1.22109E-5 40947 0 6.25782E-4
1-1237395-C-T p.Arg62Gln missense ACAP3 3 81870 3.66435E-5 40935 0 6.25782E-4
1-1237396-G-T p.Arg62Arg synonymous ACAP3 2 81880 2.4426E-5 40940 0 NA
1-1237396-G-A p.Arg62Trp missense ACAP3 2 81880 2.4426E-5 40940 0 1.72909E-5
1-1237397-C-T p.Val61Val synonymous ACAP3 1 81918 1.22073E-5 40959 0 NA
1-1237399-C-T p.Val61Met missense ACAP3 2 81912 2.44164E-5 40956 0 4.40238E-6
1-1237400-G-A p.Ser60Ser synonymous ACAP3 35 81780 4.27978E-4 40890 0 5.04032E-4
1-1237411-C-T p.Ala57Thr missense ACAP3 1 81700 1.22399E-5 40850 0 NA
1-1237414-G-C p.Gln56Glu missense ACAP3 3 81500 3.68098E-5 40750 0 3.18837E-5
1-1237426-T-A p.Ile52Phe missense+splice_region ACAP3 1 81240 1.23092E-5 40620 0 NA
1-1238294-G-A c.153+8C>T splice_region ACAP3 2 80314 2.49023E-5 40157 0 3.19775E-5
1-1238296-G-A c.153+6C>T splice_region ACAP3 1 80406 1.24369E-5 40203 0 9.5761E-5
1-1238301-C-T c.153+1G>A splice_donor ACAP3 1 80666 1.23968E-5 40333 0 NA
1-1238303-A-G p.Met51Thr missense+splice_region ACAP3 1 80742 1.23851E-5 40371 0 5.05051E-4
1-1238304-T-C p.Met51Val missense+splice_region ACAP3 1 80754 1.23833E-5 40377 0 NA
1-1238316-C-T p.Val47Met missense ACAP3 5 80984 6.17406E-5 40492 0 5.63126E-5
1-1238317-C-T p.Val46Val synonymous ACAP3 8 81008 9.87557E-5 40504 0 6.57437E-5
1-1238325-G-T p.Gln44Lys missense ACAP3 1 81130 1.23259E-5 40565 0 NA
1-1238335-A-G p.Ala40Ala synonymous ACAP3 1 81210 1.23138E-5 40605 0 3.19183E-5
1-1238338-G-A p.Phe39Phe synonymous ACAP3 6 81230 7.38643E-5 40615 0 4.05492E-5
1-1238341-C-T p.Arg38Arg synonymous ACAP3 2 81290 2.46033E-5 40645 0 2.02769E-5
1-1238352-A-T p.Cys35Ser missense ACAP3 2 81396 2.45712E-5 40698 0 NA
1-1238354-T-TCCGAGATGACGGTGTCGC p.Gly28_Ser33dup conservative_inframe_insertion ACAP3 3 81408 3.68514E-5 40704 0 NA
1-1238355-C-T p.Glu34Lys missense+splice_region ACAP3 1 81396 1.22856E-5 40698 0 1.22292E-5
1-1238359-G-GC c.100-5_100-4insG splice_region ACAP3 1 81406 1.22841E-5 40703 0 NA
1-1238360-A-ACTGCTG c.100-6_100-5insCAGCAG splice_region ACAP3 1 81402 1.22847E-5 40701 0 NA
1-1238361-G-A c.100-6C>T splice_region ACAP3 1 81420 1.2282E-5 40710 0 1.03033E-5
1-1238543-G-A p.Ser33Leu missense+splice_region ACAP3 1 81258 1.23065E-5 40629 0 2.01955E-5
1-1238551-G-A p.Thr30Thr synonymous ACAP3 3 81362 3.68723E-5 40681 0 3.69987E-5
1-1238552-G-A p.Thr30Ile missense ACAP3 1 81368 1.22898E-5 40684 0 3.18898E-5
1-1238554-G-T p.Asp29Glu missense ACAP3 7 81398 8.59972E-5 40699 0 3.18817E-5
1-1238557-G-A p.Gly28Gly synonymous ACAP3 2 81378 2.45767E-5 40689 0 1.03448E-4
1-1238580-C-T p.Asp21Asn missense ACAP3 1 81356 1.22917E-5 40678 0 NA
1-1238581-G-A p.Arg20Arg synonymous ACAP3 1 81366 1.22901E-5 40683 0 3.19E-5
1-1238581-G-T p.Arg20Arg synonymous ACAP3 1 81368 1.22898E-5 40684 0 NA
1-1238583-G-A p.Arg20Cys missense ACAP3 930 81334 0.0114343 40667 8 0.020625
1-1238586-C-T p.Val19Ile missense ACAP3 2 81350 2.45851E-5 40675 0 6.37836E-5
1-1238587-G-A p.Gly18Gly synonymous ACAP3 6 81272 7.38262E-5 40636 0 6.37755E-5
1-1238595-C-T p.Val16Met missense ACAP3 1 81134 1.23253E-5 40567 0 2.95674E-5
1-1238596-G-A p.Phe15Phe synonymous ACAP3 4 81076 4.93364E-5 40538 0 1.67744E-5
1-1238611-G-A p.Ser10Ser synonymous ACAP3 1 80640 1.24008E-5 40320 0 NA
1-1238630-G-C p.Ala4Gly missense ACAP3 3 79086 3.79334E-5 39543 0 NA
1-1238635-C-T p.Val2Val synonymous ACAP3 1 78650 1.27146E-5 39325 0 9.55901E-5
1-1238641-G-A p.Gly42Gly synonymous ACAP3 1 77990 1.28222E-5 38995 0 1.95031E-5
1-1238644-A-G p.Ser41Ser synonymous ACAP3 1 77690 1.28717E-5 38845 0 NA
1-1238647-G-T p.Cys40* stop_gained ACAP3 1 77450 1.29116E-5 38725 0 NA
1-1239461-T-A c.-22+5A>T splice_region ACAP3 1 80702 1.23913E-5 40351 0 NA
1-1239492-C-A p.Val27Leu missense ACAP3 10 80988 1.23475E-4 40494 0 1.59327E-4
1-1239496-G-A p.Thr41Met missense ACAP3 1 80948 1.23536E-5 40474 0 5.101E-5
1-1239497-T-C p.Asp25Gly missense ACAP3 3 80948 3.70608E-5 40474 0 NA
1-1239499-C-A p.Arg40Leu missense ACAP3 13 80950 1.60593E-4 40475 0 6.25E-4
1-1239500-G-A p.Thr24Met missense ACAP3 1 80934 1.23557E-5 40467 0 6.47929E-6
1-1239510-C-T p.Glu21Lys missense ACAP3 2 80946 2.47078E-5 40473 0 6.48197E-6
1-1239511-G-A p.Thr36Met missense ACAP3 3 80936 3.70663E-5 40468 0 3.18695E-5
1-1239517-G-T p.Pro34Gln missense ACAP3 1 80898 1.23612E-5 40449 0 NA
1-1239520-C-T p.Arg33Gln missense ACAP3 1 80888 1.23628E-5 40444 0 5.10673E-5
1-1239521-G-A p.Arg33* stop_gained ACAP3 1 80840 1.23701E-5 40420 0 3.18735E-5
1-1242445-T-A n.135+7A>T splice_region ACAP3 1 71528 1.39805E-5 35764 0 NA
1-1242448-G-C n.135+4C>G splice_region ACAP3 35 71684 4.88254E-4 35842 0 0.00250156
1-1242451-C-G n.135+1G>C splice_donor ACAP3 2 72090 2.77431E-5 36045 0 NA
1-1242452-T-G n.135A>C splice_region ACAP3 1 72130 1.38639E-5 36065 0 3.18634E-5
1-1242534-C-T n.53G>A splice_region ACAP3 2 75364 2.65379E-5 37682 0 6.25E-4
1-1242535-G-A n.52C>T splice_region ACAP3 4 75368 5.30729E-5 37684 0 7.43307E-6
1-1242708-GCACCCTA-G c.94+2_94+8delTAGGGTG splice_donor ACAP3 1 75462 1.32517E-5 37731 0 NA
1-1242709-C-G c.94+8G>C splice_region ACAP3 1 75458 1.32524E-5 37729 0 NA
1-1242716-C-T c.94+1G>A splice_donor ACAP3 1 75462 1.32517E-5 37731 0 NA
1-1242717-C-T p.Gly32Arg missense+splice_region ACAP3 1 75470 1.32503E-5 37735 0 3.18573E-5
1-1242721-G-A p.Ala30Ala synonymous ACAP3 5 75452 6.62673E-5 37726 0 3.18674E-5
1-1242723-C-T p.Ala30Thr missense ACAP3 1 75460 1.32521E-5 37730 0 7.43064E-6
1-1242731-GC-G p.Ala27fs frameshift ACAP3 1 75426 1.3258E-5 37713 0 7.43174E-6
1-1242749-T-TC p.Glu21fs frameshift ACAP3 6 75410 7.9565E-5 37705 0 3.18634E-5
1-1242750-C-A p.Glu21* stop_gained ACAP3 2 75418 2.65189E-5 37709 0 8.13008E-5
1-1243145-G-A c.-80+4C>T splice_region ACAP3 8 34788 2.29964E-4 17394 0 4.43262E-4
1-1243178-C-T p.Glu6Glu synonymous ACAP3 1 34410 2.90613E-5 17205 0 NA
1-1243181-G-C p.Phe5Leu missense ACAP3 1 33998 2.94135E-5 16999 0 NA
1-1243211-G-A c.-142C>T 5_prime_UTR_premature_start_codon_gain ACAP3 1 28904 3.45973E-5 14452 0 NA
1-1243245-G-A c.-176C>T 5_prime_UTR_premature_start_codon_gain ACAP3 1 18790 5.32198E-5 9395 0 NA
1-1243257-G-A c.-188C>T 5_prime_UTR_premature_start_codon_gain ACAP3 1 14376 6.95604E-5 7188 0 NA
1-1244819-T-C n.168+3A>G splice_region ACAP3 1 71330 1.40193E-5 35665 0 3.18613E-5
1-1244822-C-T n.168G>A splice_region ACAP3 11 71752 1.53306E-4 35876 0 1.85309E-5