Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
17-7239901-T-C c.-153T>C 5_prime_UTR_premature_start_codon_gain ACAP1 34 65090 5.22354E-4 32545 0 5.11738E-4
17-7239934-C-T c.-120C>T 5_prime_UTR_premature_start_codon_gain ACAP1 3 76836 3.90442E-5 38418 0 NA
17-7240013-C-T c.-41C>T 5_prime_UTR_premature_start_codon_gain ACAP1 2 82322 2.42948E-5 41161 0 3.3145E-5
17-7240027-C-T c.-27C>T 5_prime_UTR_premature_start_codon_gain ACAP1 1 82376 1.21395E-5 41188 0 3.19101E-5
17-7240057-A-T p.Thr2Ser missense ACAP1 3 82436 3.63919E-5 41218 0 8.24824E-6
17-7240057-A-G p.Thr2Ala missense ACAP1 2 82436 2.42612E-5 41218 0 3.19387E-5
17-7240058-C-T p.Thr2Met missense ACAP1 6 82436 7.27837E-5 41218 2 2.78793E-5
17-7240059-G-A p.Thr2Thr synonymous ACAP1 22 82436 2.66874E-4 41218 0 2.87155E-4
17-7240074-C-T c.-251C>T 5_prime_UTR_premature_start_codon_gain ACAP1 43 82348 5.22174E-4 41174 0 0.001875
17-7240092-C-T p.Asp13Asp synonymous ACAP1 1 82300 1.21507E-5 41150 0 1.1957E-5
17-7240094-C-T p.Ser14Leu missense ACAP1 1 82284 1.2153E-5 41142 0 NA
17-7240100-G-A p.Arg16His missense ACAP1 6 82296 7.29076E-5 41148 0 2.23357E-4
17-7240108-T-C c.53+2T>C splice_donor ACAP1 3 82294 3.64547E-5 41147 0 8.24661E-6
17-7240114-T-G c.53+8T>G splice_region ACAP1 1 82292 1.21518E-5 41146 0 3.99138E-6
17-7240578-GCAGA-G c.-218-3_-218delCAGA splice_acceptor ACAP1 2 82978 2.41028E-5 41489 0 NA
17-7240589-A-T c.-211A>T 5_prime_UTR_premature_start_codon_gain ACAP1 1 83152 1.20262E-5 41576 0 NA
17-7240627-C-T c.54-4C>T splice_region ACAP1 2 83352 2.39946E-5 41676 0 NA
17-7240631-A-G p.Arg18Arg splice_region+synonymous ACAP1 1 83358 1.19964E-5 41679 0 NA
17-7240632-G-A p.Ala19Thr missense+splice_region ACAP1 13 83352 1.55965E-4 41676 0 5.41505E-4
17-7240634-C-G p.Ala19Ala synonymous ACAP1 3 83364 3.59868E-5 41682 0 5.04032E-4
17-7240656-G-A p.Glu27Lys missense ACAP1 1 83392 1.19916E-5 41696 0 1.98825E-5
17-7240670-G-T p.Leu31Phe missense ACAP1 2 83386 2.39848E-5 41693 0 3.97652E-6
17-7240695-C-G c.111+7C>G splice_region ACAP1 1 83362 1.19959E-5 41681 0 6.37105E-5
17-7245259-T-C c.112-8T>C splice_region ACAP1 1 83170 1.20236E-5 41585 0 NA
17-7245267-C-G p.Leu38Val missense+splice_region ACAP1 5 83186 6.01063E-5 41593 0 6.37389E-5
17-7245303-C-T p.Arg50Cys missense ACAP1 1 83228 1.20152E-5 41614 0 3.29544E-5
17-7245304-G-A p.Arg50His missense ACAP1 3 83218 3.60499E-5 41609 0 6.25E-4
17-7245314-T-C p.Leu53Leu synonymous ACAP1 1 83228 1.20152E-5 41614 0 2.47137E-5
17-7245315-G-A p.Ala54Thr missense ACAP1 1 83222 1.20161E-5 41611 0 3.18634E-5
17-7245319-C-A p.Ala55Asp missense ACAP1 1 83230 1.20149E-5 41615 0 NA
17-7245322-GC-G p.Arg57fs frameshift ACAP1 1 83214 1.20172E-5 41607 0 NA
17-7245324-C-G p.Arg57Gly missense ACAP1 1 83230 1.20149E-5 41615 0 NA
17-7245325-G-A p.Arg57His missense ACAP1 10 83212 1.20175E-4 41606 0 6.37186E-5
17-7245326-C-T p.Arg57Arg synonymous ACAP1 2 83210 2.40356E-5 41605 0 6.25E-4
17-7245328-C-A p.Ala58Asp missense ACAP1 3 83208 3.60542E-5 41604 0 3.18552E-5
17-7245332-C-T c.-46C>T 5_prime_UTR_premature_start_codon_gain ACAP1 1 83206 1.20184E-5 41603 0 3.29565E-5
17-7245333-G-A p.Val60Ile missense ACAP1 1 83206 1.20184E-5 41603 0 6.37389E-5
17-7245336-G-T p.Val61Phe missense ACAP1 1 83208 1.20181E-5 41604 0 8.23873E-6
17-7245338-C-T c.-40C>T 5_prime_UTR_premature_start_codon_gain ACAP1 4 83192 4.80815E-5 41596 0 1.47176E-4
17-7245339-G-A p.Gly62Ser missense ACAP1 7 83186 8.41488E-5 41593 0 4.94332E-5
17-7245343-T-C p.Ile63Thr missense ACAP1 3 83192 3.60612E-5 41596 0 3.18634E-5
17-7245350-C-G p.Asp65Glu missense ACAP1 1 83172 1.20233E-5 41586 0 NA
17-7245355-C-T p.Ala67Val missense ACAP1 4 83166 4.80966E-5 41583 0 0.00125
17-7245357-C-T p.Arg68Cys missense ACAP1 633 83142 0.00761348 41571 11 0.0151129
17-7245358-G-A p.Arg68His missense ACAP1 7 83156 8.41791E-5 41578 0 5.03525E-4
17-7245370-CA-TG p.Pro72Leu missense ACAP1 3 83122 3.60915E-5 41561 0 NA
17-7245370-C-T p.Pro72Leu missense ACAP1 1 83122 1.20305E-5 41561 0 3.29723E-5
17-7245371-A-G p.Pro72Pro synonymous ACAP1 32192 82412 0.390623 41206 6436 0.392693
17-7245382-T-C p.Met76Thr missense ACAP1 15 83102 1.80501E-4 41551 0 4.46372E-4
17-7245383-G-A p.Met76Ile missense ACAP1 8 83104 9.62649E-5 41552 0 9.55901E-5
17-7245385-C-T p.Ala77Val missense+splice_region ACAP1 2 83046 2.4083E-5 41523 0 3.18918E-5
17-7245386-G-A p.Ala77Ala splice_region+synonymous ACAP1 3 83050 3.61228E-5 41525 0 1.27445E-4
17-7245392-C-T c.231+6C>T splice_region ACAP1 1 82998 1.20485E-5 41499 0 7.97849E-6
17-7245393-G-A c.231+7G>A splice_region ACAP1 4 83014 4.81846E-5 41507 0 3.30442E-5
17-7245597-T-C p.Cys79Arg missense ACAP1 1 83312 1.20031E-5 41656 0 NA
17-7245598-G-A p.Cys79Tyr missense ACAP1 1 83316 1.20025E-5 41658 0 NA
17-7245604-A-C p.Glu81Ala missense ACAP1 1 83322 1.20016E-5 41661 0 8.23696E-6
17-7245614-C-T p.Thr84Thr synonymous ACAP1 3 83344 3.59954E-5 41672 0 2.47109E-5
17-7245632-G-A p.Lys90Lys synonymous ACAP1 2 83376 2.39877E-5 41688 0 3.18512E-5
17-7245633-C-T p.Leu91Leu synonymous ACAP1 2 83374 2.39883E-5 41687 0 NA
17-7245646-CGGTAAGTAGGGGAAGGTAAGGATTGTCGGGGTGGTGGCCAGGTCACCTGTGGTCCTGACCCCAGTCTACCAACTTCTCCTTCCCTCA-C p.Glu96fs frameshift ACAP1 9 83374 1.07947E-4 41687 3 NA
17-7245646-C-T p.Ala95Val missense+splice_region ACAP1 2 83376 2.39877E-5 41688 0 6.37024E-5
17-7245647-G-A p.Ala95Ala splice_region+synonymous ACAP1 11 83374 1.31936E-4 41687 0 9.55292E-5
17-7245740-TC-T p.Leu98fs frameshift ACAP1 1 83264 1.201E-5 41632 0 NA
17-7245749-C-T p.Ala100Ala synonymous ACAP1 2 83204 2.40373E-5 41602 0 1.6481E-5
17-7245755-A-G p.Gln102Gln synonymous ACAP1 2 83182 2.40437E-5 41591 0 NA
17-7245764-G-A p.Leu105Leu synonymous ACAP1 2 83124 2.40604E-5 41562 0 NA
17-7245765-C-A p.Gln106Lys missense ACAP1 4 83100 4.81348E-5 41550 0 1.19331E-5
17-7245779-G-T p.Gln110His missense ACAP1 1 82848 1.20703E-5 41424 0 3.18552E-5
17-7245785-G-C p.Leu112Leu synonymous ACAP1 1 82700 1.20919E-5 41350 0 3.98137E-6
17-7245790-A-G p.Lys114Arg missense ACAP1 1 82534 1.21162E-5 41267 0 4.95901E-5
17-7245801-G-A c.344+8G>A splice_region ACAP1 1 81920 1.2207E-5 40960 0 9.55779E-5
17-7246071-A-G n.760A>G splice_region ACAP1 2 12248 1.63292E-4 6124 0 NA
17-7246701-T-G p.Gly116Gly synonymous ACAP1 1 82906 1.20619E-5 41453 0 8.03368E-6
17-7246705-C-G p.Arg118Gly missense ACAP1 1 82986 1.20502E-5 41493 0 1.69342E-5
17-7246705-C-T p.Arg118Trp missense ACAP1 1 82986 1.20502E-5 41493 0 1.60671E-5
17-7246706-G-A p.Arg118Gln missense ACAP1 1 83010 1.20467E-5 41505 0 6.40205E-4
17-7246709-G-A p.Gly119Asp missense ACAP1 2 83048 2.40825E-5 41524 0 3.37268E-5
17-7246714-C-T p.Arg121* stop_gained ACAP1 1 83070 1.2038E-5 41535 0 6.37267E-5
17-7246723-C-T p.Arg124Cys missense ACAP1 3 83086 3.61072E-5 41543 0 3.18613E-5
17-7246724-G-A p.Arg124His missense ACAP1 2 82984 2.4101E-5 41492 0 6.37146E-5
17-7246726-C-T p.Arg125Trp missense ACAP1 1 83038 1.20427E-5 41519 0 8.37058E-6
17-7246738-C-CG p.Ala131fs frameshift ACAP1 1 82976 1.20517E-5 41488 0 8.35422E-6
17-7246739-G-A p.Arg129Gln missense ACAP1 5 83046 6.02076E-5 41523 0 3.60612E-5
17-7246739-G-C p.Arg129Pro missense ACAP1 2 83046 2.4083E-5 41523 0 NA
17-7246743-G-T p.Gly130Gly synonymous ACAP1 2 83030 2.40877E-5 41515 0 3.99946E-6
17-7246751-G-A p.Ser133Asn missense ACAP1 1 82988 1.20499E-5 41494 0 NA
17-7246776-C-T p.Asn141Asn synonymous ACAP1 2 82942 2.41132E-5 41471 0 1.66149E-5
17-7246776-C-G p.Asn141Lys missense ACAP1 1 82942 1.20566E-5 41471 0 NA
17-7246777-G-A p.Ala142Thr missense ACAP1 9 82962 1.08483E-4 41481 0 1.27429E-4
17-7246788-C-T p.Pro145Pro synonymous ACAP1 2 83006 2.40946E-5 41503 0 3.98816E-6
17-7246795-C-T p.Arg148Trp missense ACAP1 1 83056 1.20401E-5 41528 0 3.32165E-5
17-7246796-G-A p.Arg148Gln missense ACAP1 2 83064 2.40778E-5 41532 0 3.32127E-5
17-7246807-G-A p.Ala152Thr missense ACAP1 2 83114 2.40633E-5 41557 0 3.98661E-6
17-7246835-C-T p.Thr161Met missense ACAP1 2 83100 2.40674E-5 41550 0 3.98826E-5
17-7246836-G-A p.Thr161Thr synonymous ACAP1 3 83082 3.61089E-5 41541 0 5.03525E-4
17-7246841-G-A p.Arg163Gln missense ACAP1 2 83092 2.40697E-5 41546 0 3.98851E-5
17-7246851-C-T p.Tyr166Tyr synonymous ACAP1 4317 83052 0.0519795 41526 147 0.0650932
17-7246853-G-A p.Arg167Gln missense ACAP1 3 83112 3.60959E-5 41556 0 3.18695E-5
17-7246859-G-A p.Arg169Gln missense ACAP1 11 83110 1.32355E-4 41555 0 6.25E-4
17-7246878-GCAGGTGCCTGCCCCAATCTGTCTTCCTGGGGTACCAGAGCCTCAAGTGTCACCTCGAGGCTTGGGGGTCTCCAGTGTGCAGTGGGAAGGGGTGCTGTGTCTTCAAGACTGATCTGGGGTTTTTTACGTCCTCTTTTACGTCCT-G p.???102fs frameshift ACAP1 4 83138 4.81128E-5 41569 1 NA
17-7247017-G-A c.529-8G>A splice_region ACAP1 393 83096 0.00472947 41548 5 0.0110318
17-7247017-G-T c.529-8G>T splice_region ACAP1 3 83108 3.60976E-5 41554 0 3.18837E-5
17-7247043-A-G p.Lys183Glu missense ACAP1 2 83072 2.40755E-5 41536 0 NA
17-7247069-TGTGAGTTGTGGCGGGGGTGAGGGCAGGGTGGAGAAGAGCCTGCTGCCAGCACAAGGGAATGGGGAGAGGGGTTCTTCCTCAGCCTTCCCACTGCCCGCCTTGTCCCCCAG-T c.573+1_574-1del splice_acceptor ACAP1 2 82962 2.41074E-5 41481 0 NA
17-7247173-C-T c.574-7C>T splice_region ACAP1 27 82744 3.26308E-4 41372 0 8.61244E-4
17-7247174-C-T c.574-6C>T splice_region ACAP1 1 82760 1.20831E-5 41380 0 6.37959E-5
17-7247186-C-A p.Arg194Ser missense ACAP1 1 82718 1.20893E-5 41359 0 NA
17-7247187-G-A p.Arg194His missense ACAP1 4 82722 4.83547E-5 41361 0 0.00151057
17-7247192-G-A p.Val196Met missense ACAP1 1 82710 1.20904E-5 41355 0 6.25E-4
17-7247199-C-T p.Ala198Val missense ACAP1 1 82604 1.2106E-5 41302 0 NA
17-7247236-G-A p.Leu210Leu synonymous ACAP1 2 82330 2.42925E-5 41165 0 NA
17-7247240-C-T p.Arg212Trp missense ACAP1 229 82206 0.00278568 41103 0 0.00656566
17-7247241-G-A p.Arg212Gln missense ACAP1 19 82188 2.31177E-4 41094 0 5.04541E-4
17-7247258-A-C p.Lys218Gln missense ACAP1 1 81956 1.22017E-5 40978 0 NA
17-7247266-G-A p.Leu220Leu synonymous ACAP1 2 81880 2.4426E-5 40940 0 3.18776E-5
17-7247269-CGCCCAGGTGGGGCCCCAGGGCACAGCAGGTGGTAGAGGGAGGTTAGGGACTCCTAACTGGGGGGCCTTGGACATCTGAGATGCCCTTCCTGT-C p.Ala222_Gln223del splice_donor ACAP1 8 81760 9.78474E-5 40880 0 NA
17-7247270-G-A p.Ala148Thr missense+splice_region ACAP1 2 81752 2.44642E-5 40876 0 0.00203046
17-7247272-C-A p.Ala148Ala splice_region+synonymous ACAP1 1 81736 1.22345E-5 40868 0 NA
17-7247277-T-TG c.669+2_669+3insG splice_region ACAP1 1 81646 1.2248E-5 40823 0 NA
17-7247281-G-T c.669+6G>T splice_region ACAP1 2 81592 2.45122E-5 40796 0 2.25999E-5
17-7247282-C-T c.669+7C>T splice_region ACAP1 1 81590 1.22564E-5 40795 0 NA
17-7247359-T-TGTGC c.670-9_670-8insGTGC splice_region ACAP1 1 79416 1.25919E-5 39708 0 NA
17-7247360-G-T c.670-8G>T splice_region ACAP1 1 79342 1.26037E-5 39671 0 NA
17-7247363-C-T c.670-5C>T splice_region ACAP1 1 79168 1.26314E-5 39584 0 3.18654E-5
17-7247390-C-T p.Ser231Leu missense ACAP1 1 77434 1.29142E-5 38717 0 3.18776E-5
17-7247417-A-G p.Gln240Arg missense ACAP1 1 73616 1.3584E-5 36808 0 4.92587E-6
17-7247421-A-AC p.His242fs frameshift ACAP1 1 72690 1.37571E-5 36345 0 3.18735E-5
17-7247422-C-T p.His242Tyr missense ACAP1 1 72480 1.37969E-5 36240 0 5.05107E-6
17-7247424-C-T p.His242His synonymous ACAP1 12 71804 1.67122E-4 35902 0 2.9036E-5
17-7247425-G-A p.Val243Met missense ACAP1 2 71628 2.7922E-5 35814 0 5.14647E-6
17-7247873-G-A p.Glu254Lys missense ACAP1 2 79848 2.50476E-5 39924 0 9.55414E-5
17-7247900-C-T p.Pro263Ser missense ACAP1 1 80260 1.24595E-5 40130 0 NA
17-7247906-G-A p.Gly265Ser missense ACAP1 1 80366 1.24431E-5 40183 0 6.39215E-6
17-7247936-C-T p.Arg275Trp missense ACAP1 1 80384 1.24403E-5 40192 0 4.88998E-5
17-7247946-A-G p.Asn278Ser missense ACAP1 7 80162 8.73232E-5 40081 0 2.45966E-4
17-7247947-C-T p.Asn278Asn synonymous ACAP1 2 80072 2.49775E-5 40036 0 4.92174E-5
17-7247948-G-A p.Ala279Thr missense ACAP1 1 80068 1.24894E-5 40034 0 1.2798E-5
17-7247959-C-G p.Thr282Thr synonymous ACAP1 3 79674 3.76534E-5 39837 0 3.18817E-5
17-7247970-G-A c.854+3G>A splice_region ACAP1 1 78978 1.26618E-5 39489 0 NA
17-7247972-G-T c.854+5G>T splice_region ACAP1 1 78812 1.26884E-5 39406 0 3.18552E-5
17-7249582-A-G p.Ser292Gly missense ACAP1 1 83400 1.19904E-5 41700 0 3.18431E-5
17-7249594-G-A p.Val296Ile missense ACAP1 1 83398 1.19907E-5 41699 0 1.64731E-5
17-7249612-AAGGTGAGTGGACCTGGGTCCTGGATGCCTGGGCCCCAGGGAGACTCAGCTCTTGCCTGCAGCTGGACATCTGGCCCCTTATCACCTTATCCTGCC-A p.Asp303fs frameshift ACAP1 13 83398 1.55879E-4 41699 6 NA
17-7249614-G-C p.Lys302Asn missense+splice_region ACAP1 5 83396 5.99549E-5 41698 0 NA
17-7249620-T-C c.906+6T>C splice_region ACAP1 3 83384 3.59781E-5 41692 0 1.19288E-5
17-7249621-G-A c.906+7G>A splice_region ACAP1 2 83384 2.39854E-5 41692 0 NA
17-7249702-C-T c.907-8C>T splice_region ACAP1 1 83388 1.19921E-5 41694 0 8.25505E-6
17-7249703-C-A c.907-7C>A splice_region ACAP1 1 83392 1.19916E-5 41696 0 NA
17-7249704-T-G c.907-6T>G splice_region ACAP1 1 83388 1.19921E-5 41694 0 NA
17-7249705-G-T c.907-5G>T splice_region ACAP1 1 83386 1.19924E-5 41693 0 6.25E-4
17-7249708-A-G c.907-2A>G splice_acceptor ACAP1 1 83384 1.19927E-5 41692 0 NA
17-7249720-C-A p.Thr306Asn missense ACAP1 76 83396 9.11315E-4 41698 0 0.00184702
17-7249723-T-C p.Val307Ala missense ACAP1 1 83398 1.19907E-5 41699 0 3.98311E-6
17-7249731-G-C p.Asp310His missense ACAP1 1 83400 1.19904E-5 41700 0 3.98356E-6
17-7249733-TGAC-T p.Asp311del conservative_inframe_deletion ACAP1 1 83400 1.19904E-5 41700 0 3.98298E-6
17-7249740-C-T p.Arg313Cys missense ACAP1 2 83390 2.39837E-5 41695 0 3.18593E-5
17-7249741-G-A p.Arg313His missense ACAP1 1 83386 1.19924E-5 41693 0 NA
17-7249742-T-A p.Arg313Arg synonymous ACAP1 3 83386 3.59773E-5 41693 0 9.11864E-5
17-7249759-T-C p.Leu319Pro missense ACAP1 1 83376 1.19939E-5 41688 0 3.18674E-5
17-7249801-C-T p.Ser333Phe missense ACAP1 1 83320 1.20019E-5 41660 0 3.18634E-5
17-7249814-A-T c.1007+4A>T splice_region ACAP1 2 83276 2.40165E-5 41638 0 4.2452E-6
17-7250123-C-T c.1008-4C>T splice_region ACAP1 4 82912 4.82439E-5 41456 0 3.18654E-5
17-7250145-T-G p.Ala342Ala synonymous ACAP1 1 82982 1.20508E-5 41491 0 NA
17-7250155-C-T p.Arg346Cys missense ACAP1 1 82964 1.20534E-5 41482 0 1.65169E-5
17-7250157-C-A p.Arg346Arg synonymous ACAP1 1 82980 1.20511E-5 41490 0 3.18674E-5
17-7250167-C-T p.Leu350Leu synonymous ACAP1 2 82944 2.41127E-5 41472 0 3.18573E-5
17-7250169-G-A p.Leu350Leu synonymous ACAP1 1 82968 1.20528E-5 41484 0 1.65016E-5
17-7250176-A-G p.Ser353Gly missense ACAP1 1 82970 1.20525E-5 41485 0 3.98229E-6
17-7250182-G-A p.Val355Met missense ACAP1 2 82974 2.41039E-5 41487 0 8.25028E-6
17-7250211-T-C p.Ser364Ser synonymous ACAP1 1 83020 1.20453E-5 41510 0 NA
17-7250214-G-A p.Gln365Gln synonymous ACAP1 1 83006 1.20473E-5 41503 0 NA
17-7250218-C-T p.Arg367Cys missense ACAP1 3 83014 3.61385E-5 41507 0 9.09828E-5
17-7250219-G-A p.Arg367His missense ACAP1 1 83032 1.20435E-5 41516 0 4.13674E-5
17-7250228-A-G p.Asp370Gly missense ACAP1 1 83008 1.2047E-5 41504 0 8.30523E-6
17-7250235-C-T p.Pro372Pro synonymous ACAP1 1 82970 1.20525E-5 41485 0 8.33681E-6
17-7250236-C-T p.Arg373Trp missense ACAP1 9 82956 1.08491E-4 41478 0 1.35758E-4
17-7250237-G-A p.Arg373Gln missense ACAP1 1 82956 1.20546E-5 41478 0 1.66987E-5
17-7250245-G-C p.Gly376Arg missense ACAP1 1 82926 1.20589E-5 41463 0 NA
17-7250246-GCCAGGTACCTTAACCTGGGGGTGCGGAGCCAGGCTGCCTGTGGAGATGGGGCACCCTTTACCCTAGGCCCCTTGGCCACCCTTTCTTCCCCTCTCTCCC-G p.Gly378fs frameshift ACAP1 12 82916 1.44725E-4 41458 5 NA
17-7250247-C-A p.Gly376Gly synonymous ACAP1 1 82896 1.20633E-5 41448 0 8.40704E-6
17-7250358-A-G p.Gly380Gly synonymous ACAP1 1 82218 1.21628E-5 41109 0 9.12375E-6
17-7250361-C-T p.His381His synonymous ACAP1 1 82258 1.21569E-5 41129 0 NA
17-7250364-GG-AA p.LeuAla382LeuThr missense ACAP1 1 82300 1.21507E-5 41150 0 NA
17-7250376-T-A p.Ser386Ser synonymous ACAP1 7 82436 8.49144E-5 41218 0 6.25E-4
17-7250383-A-G p.Thr389Ala missense ACAP1 1 82396 1.21365E-5 41198 0 NA
17-7250394-T-C p.Ser392Ser synonymous ACAP1 1 82492 1.21224E-5 41246 0 NA
17-7250396-G-A p.Gly393Asp missense ACAP1 3 82512 3.63583E-5 41256 0 8.08996E-6
17-7250404-GC-G p.Arg397fs frameshift ACAP1 1 82500 1.21212E-5 41250 0 NA
17-7250406-C-T p.Ala396Ala synonymous ACAP1 1 82494 1.21221E-5 41247 0 8.05776E-6
17-7250411-G-A p.Gly398Glu missense ACAP1 6 82520 7.27096E-5 41260 0 8.54175E-6
17-7250414-G-A p.Arg399Lys missense ACAP1 1 82542 1.2115E-5 41271 0 5.03525E-4
17-7250423-G-C p.Gly402Ala missense ACAP1 2 82544 2.42295E-5 41272 0 5.91246E-5
17-7250425-G-A p.Gly403Arg missense ACAP1 2 82550 2.42277E-5 41275 0 4.0066E-6
17-7250426-G-C p.Gly403Ala missense ACAP1 1 82534 1.21162E-5 41267 0 8.42091E-6
17-7250428-G-C p.Val404Leu missense ACAP1 10 82526 1.21174E-4 41263 0 2.23143E-4
17-7250430-C-T p.Val404Val synonymous ACAP1 1 82518 1.21186E-5 41259 0 NA
17-7250436-C-T p.His406His synonymous ACAP1 2 82534 2.42324E-5 41267 0 3.18878E-5
17-7250437-G-C p.Val407Leu missense ACAP1 2 82516 2.42377E-5 41258 0 3.18756E-5
17-7250437-G-A p.Val407Met missense ACAP1 3 82516 3.63566E-5 41258 0 1.9988E-5
17-7250438-T-A p.Val407Glu missense ACAP1 1 82522 1.2118E-5 41261 0 NA
17-7250443-G-A p.Ala409Thr missense ACAP1 1 82490 1.21227E-5 41245 0 NA
17-7250463-T-C p.Asp415Asp synonymous ACAP1 1 82556 1.2113E-5 41278 0 8.28624E-6
17-7250481-C-T p.Cys421Cys synonymous ACAP1 8 82232 9.72857E-5 41116 0 5.03525E-4
17-7250488-C-T p.Arg424Trp missense ACAP1 31 81986 3.78113E-4 40993 0 7.97296E-4
17-7250489-G-A p.Arg424Gln missense ACAP1 2 82032 2.43807E-5 41016 0 5.03525E-4
17-7250490-G-A p.Arg424Arg synonymous ACAP1 1 81968 1.21999E-5 40984 0 NA
17-7250493-G-A p.Glu425Glu synonymous ACAP1 1 81884 1.22124E-5 40942 0 8.26993E-6
17-7250497-G-GCC p.Glu429fs frameshift ACAP1 1 81736 1.22345E-5 40868 0 NA
17-7250502-G-A p.Pro428Pro synonymous ACAP1 5 81578 6.1291E-5 40789 0 2.48213E-5
17-7250550-C-T p.Ser444Ser synonymous ACAP1 1 76286 1.31086E-5 38143 0 5.92237E-5
17-7250551-G-A p.Gly445Ser missense ACAP1 2 76048 2.62992E-5 38024 0 3.18857E-5
17-7250553-C-T p.Gly445Gly synonymous ACAP1 165 75566 0.00218352 37783 6 0.0186304
17-7250555-T-C p.Ile446Thr missense ACAP1 1 75242 1.32904E-5 37621 0 NA
17-7251235-C-A c.1344-6C>A splice_region ACAP1 1 82866 1.20677E-5 41433 0 1.65074E-5
17-7251241-G-A p.Arg448Arg splice_region+synonymous ACAP1 2 82902 2.41249E-5 41451 0 5.17026E-5
17-7251243-G-A p.Ser449Asn missense+splice_region ACAP1 5 82920 6.02991E-5 41460 0 3.97712E-6
17-7251244-C-A p.Ser449Arg missense ACAP1 1 82920 1.20598E-5 41460 0 1.19308E-5
17-7251257-T-C p.Phe454Leu missense ACAP1 2 83038 2.40854E-5 41519 0 6.37064E-5
17-7251270-G-A p.Arg458Gln missense ACAP1 1 83092 1.20349E-5 41546 0 3.97659E-6
17-7251305-G-C p.Val470Leu missense ACAP1 1 83106 1.20328E-5 41553 0 3.18471E-5
17-7251315-CTT-C c.1413+6_1413+7delTT splice_region ACAP1 3 83114 3.6095E-5 41557 0 3.57916E-5
17-7251469-C-T p.Val479Val synonymous ACAP1 2 83086 2.40714E-5 41543 0 3.98305E-6
17-7251483-T-C p.Ile484Thr missense ACAP1 1 83104 1.20331E-5 41552 0 NA
17-7251496-C-T p.Arg488Arg synonymous ACAP1 52 83108 6.25692E-4 41554 0 0.00140261
17-7251497-G-A p.Val489Met missense ACAP1 1 83106 1.20328E-5 41553 0 NA
17-7251504-C-T p.Ala491Val missense ACAP1 1 83140 1.20279E-5 41570 0 NA
17-7251511-A-C p.Ala493Ala synonymous ACAP1 1 83152 1.20262E-5 41576 0 NA
17-7251524-G-A p.Gly498Arg missense ACAP1 3 83116 3.60941E-5 41558 0 8.60689E-6
17-7251526-G-A p.Gly498Gly synonymous ACAP1 2 83086 2.40714E-5 41543 0 8.61564E-6
17-7251539-CGGTGAGCTTGGGGTTTAGCCTCCCAGGGGAATGGGGGACCCCTGGAGCAGAAGAGGGAAGACTGCGTGCTTCTCCCCTCCCACA-C p.Gln504fs frameshift ACAP1 5 83054 6.02018E-5 41527 0 NA
17-7251539-C-T p.Arg503Trp missense+splice_region ACAP1 2 83060 2.4079E-5 41530 0 4.017E-6
17-7251547-T-C c.1508+7T>C splice_region ACAP1 1 83024 1.20447E-5 41512 0 8.80344E-6
17-7251617-TCC-T c.1509-6_1509-5delCC splice_region ACAP1 1 82986 1.20502E-5 41493 0 NA
17-7251648-A-G p.His511Arg missense ACAP1 2 82942 2.41132E-5 41471 0 5.4137E-5
17-7251658-C-T p.Tyr514Tyr synonymous ACAP1 5 82890 6.03209E-5 41445 0 8.04959E-5
17-7251662-GAGA-G p.Lys518del conservative_inframe_deletion ACAP1 1 82860 1.20685E-5 41430 0 5.07202E-5
17-7251668-AA-TT p.Lys518Leu missense ACAP1 2 82820 2.41488E-5 41410 0 NA
17-7251676-G-A p.Leu520Leu synonymous ACAP1 5 82738 6.04317E-5 41369 0 1.59266E-4
17-7251676-G-C p.Leu520Leu synonymous ACAP1 1 82738 1.20863E-5 41369 0 NA
17-7251678-C-T p.Thr521Ile missense ACAP1 6 82730 7.25251E-5 41365 0 3.57974E-5
17-7251696-G-A p.Arg527Gln missense ACAP1 1 82476 1.21247E-5 41238 0 NA
17-7251701-C-G p.Arg529Gly missense ACAP1 1 82378 1.21392E-5 41189 0 2.79533E-5
17-7251711-GC-G p.Arg533fs frameshift ACAP1 4 82258 4.86275E-5 41129 0 NA
17-7251713-C-T p.Arg533Trp missense ACAP1 781 82154 0.00950654 41077 5 0.0160878
17-7251714-G-A p.Arg533Gln missense ACAP1 1 82184 1.21678E-5 41092 0 5.12694E-6
17-7251720-G-A p.Arg535His missense ACAP1 2 82062 2.43718E-5 41031 0 3.18837E-5
17-7251723-C-G p.Pro536Arg missense ACAP1 1 82106 1.21794E-5 41053 0 NA
17-7251730-G-T p.Gly538Gly synonymous ACAP1 1 81986 1.21972E-5 40993 0 2.17372E-5
17-7251735-C-A p.Pro540His missense ACAP1 4 82016 4.8771E-5 41008 0 1.25835E-5
17-7251741-T-C p.Val542Ala missense ACAP1 1 81948 1.22029E-5 40974 0 NA
17-7251742-GC-TT p.ValPro542ValSer missense ACAP1 1 81934 1.22049E-5 40967 0 NA
17-7251744-C-T p.Pro543Leu missense ACAP1 4 81946 4.88126E-5 40973 0 1.02527E-4
17-7251749-A-C p.Lys545Gln missense ACAP1 3 81898 3.66309E-5 40949 0 5.04032E-4
17-7251752-C-A p.Pro546Thr missense ACAP1 1 81858 1.22163E-5 40929 0 5.6844E-5
17-7251757-C-A p.Ser547Ser synonymous ACAP1 2 81802 2.44493E-5 40901 0 NA
17-7251758-A-G p.Ile548Val missense ACAP1 2 81792 2.44523E-5 40896 0 3.18532E-5
17-7251764-C-T p.Pro550Ser missense ACAP1 2 81640 2.44978E-5 40820 0 0.00201613
17-7251765-C-T p.Pro550Leu missense ACAP1 2 81600 2.45098E-5 40800 0 3.62135E-5
17-7251767-C-T p.Arg551Trp missense ACAP1 1 81590 1.22564E-5 40795 0 2.41158E-5
17-7251768-G-A p.Arg551Gln missense ACAP1 1 81592 1.22561E-5 40796 0 7.68876E-5
17-7251769-G-T p.Arg551Arg synonymous ACAP1 1 81574 1.22588E-5 40787 0 8.08081E-6
17-7251792-C-A p.Pro559Gln missense+splice_region ACAP1 5 81018 6.17147E-5 40509 0 1.27445E-4
17-7252302-TC-T c.1679-7delC splice_region ACAP1 1 80480 1.24254E-5 40240 0 3.63742E-5
17-7252307-C-G c.1679-7C>G splice_region ACAP1 2 80676 2.47905E-5 40338 0 NA
17-7252308-G-A c.1679-6G>A splice_region ACAP1 3 80694 3.71775E-5 40347 0 9.58957E-5
17-7252315-G-GC p.Ser563fs frameshift ACAP1 1 80876 1.23646E-5 40438 0 NA
17-7252320-C-A p.Pro562His missense ACAP1 1 80972 1.23499E-5 40486 0 6.38488E-5
17-7252320-C-G p.Pro562Arg missense ACAP1 1 80972 1.23499E-5 40486 0 3.61382E-5
17-7252323-C-T p.Ser563Phe missense ACAP1 2 81058 2.46737E-5 40529 0 3.19224E-5
17-7252343-C-T p.His570Tyr missense ACAP1 1 81406 1.22841E-5 40703 0 NA
17-7252343-C-G p.His570Asp missense ACAP1 1 81406 1.22841E-5 40703 0 NA
17-7252346-C-T p.Pro571Ser missense ACAP1 2 81484 2.45447E-5 40742 0 9.56999E-5
17-7252365-G-A p.Arg577Gln missense ACAP1 5 81998 6.09771E-5 40999 0 4.14832E-4
17-7252368-C-T p.Ala578Val missense ACAP1 4 82026 4.8765E-5 41013 0 0.00125
17-7252369-G-A p.Ala578Ala synonymous ACAP1 49 82130 5.96615E-4 41065 0 0.00252016
17-7252375-G-T p.Gly580Gly synonymous ACAP1 36 82272 4.37573E-4 41136 0 7.65795E-4
17-7252380-C-T p.Pro582Leu missense ACAP1 1 82420 1.2133E-5 41210 0 NA
17-7252392-C-T p.Pro586Leu missense ACAP1 1 82600 1.21065E-5 41300 0 NA
17-7252401-C-T p.Ala589Val missense ACAP1 1 82660 1.20978E-5 41330 0 NA
17-7252426-T-G p.Asp597Glu missense ACAP1 3 82608 3.63161E-5 41304 0 NA
17-7252440-A-G p.Asn602Ser missense ACAP1 1 82460 1.21271E-5 41230 0 NA
17-7252446-G-A p.Gly604Asp missense ACAP1 7 82342 8.50113E-5 41171 0 9.06499E-5
17-7252475-G-T p.Ala614Ser missense ACAP1 1 81352 1.22923E-5 40676 0 4.00365E-6
17-7252480-A-G p.Thr615Thr synonymous ACAP1 1 81238 1.23095E-5 40619 0 NA
17-7253273-C-T p.Leu621Leu synonymous ACAP1 1 83282 1.20074E-5 41641 0 4.01371E-6
17-7253280-G-A p.Cys623Tyr missense ACAP1 1 83276 1.20083E-5 41638 0 NA
17-7253282-G-A p.Glu624Lys missense ACAP1 2 83280 2.40154E-5 41640 0 1.67291E-5
17-7253307-A-C p.Asn632Thr missense ACAP1 1 83272 1.20088E-5 41636 0 3.18532E-5
17-7253308-C-T p.Asn632Asn synonymous ACAP1 2 83266 2.40194E-5 41633 0 3.98498E-6
17-7253309-G-C p.Val633Leu missense ACAP1 1 83268 1.20094E-5 41634 0 NA
17-7253319-C-A p.Ala636Glu missense ACAP1 5 83262 6.00514E-5 41631 0 6.36943E-5
17-7253319-C-T p.Ala636Val missense ACAP1 4 83262 4.80411E-5 41631 0 7.17257E-5
17-7253325-G-A p.Ser638Asn missense ACAP1 1 83242 1.20132E-5 41621 0 NA
17-7253330-G-A p.Gly640Ser missense ACAP1 1 83226 1.20155E-5 41613 0 NA
17-7253339-C-G p.Pro643Ala missense ACAP1 1 83212 1.20175E-5 41606 0 NA
17-7253353-A-G p.Ala647Ala synonymous ACAP1 1 83176 1.20227E-5 41588 0 1.19669E-5
17-7253369-A-G p.Thr653Ala missense ACAP1 1 83112 1.2032E-5 41556 0 NA
17-7253372-GGGTAGGGATGATGGCATGGGGAGGAAGGCTGGGAGAAGTTGGGCGGCCGGCTGACCCTGGCTCTTCTCTCCA-G p.Leu655fs frameshift ACAP1 8 83110 9.6258E-5 41555 0 NA
17-7253373-G-C p.Gly654Ala missense+splice_region ACAP1 1 83114 1.20317E-5 41557 0 NA
17-7253449-C-T p.Leu655Leu synonymous ACAP1 14 82668 1.69352E-4 41334 0 1.59337E-4
17-7253453-T-C p.Cys657Arg missense ACAP1 2 82826 2.4147E-5 41413 0 NA
17-7253456-C-G p.Leu658Val missense ACAP1 2 82886 2.41295E-5 41443 0 NA
17-7253480-C-G p.Leu666Val missense ACAP1 11 82968 1.32581E-4 41484 0 1.31249E-4
17-7253486-G-T p.Ala668Ser missense ACAP1 1 82924 1.20592E-5 41462 0 NA
17-7253490-G-C p.Arg669Pro missense ACAP1 1 82950 1.20555E-5 41475 0 NA
17-7253499-A-T p.Glu672Val missense ACAP1 1 82946 1.2056E-5 41473 0 NA
17-7253506-G-A p.Arg674Arg synonymous ACAP1 1 82872 1.20668E-5 41436 0 2.3861E-5
17-7253516-A-G p.Thr678Ala missense ACAP1 8 82794 9.66254E-5 41397 0 2.23585E-4
17-7253525-A-G p.Met681Val missense ACAP1 1 82704 1.20913E-5 41352 0 NA
17-7253530-A-G p.Glu682Glu synonymous ACAP1 2 82606 2.42113E-5 41303 0 9.14869E-5
17-7253533-A-G p.Thr683Thr synonymous ACAP1 12 82524 1.45412E-4 41262 0 6.38203E-5
17-7253560-A-G c.2072+4A>G splice_region ACAP1 5 80728 6.19364E-5 40364 0 8.34697E-6
17-7253665-G-T c.-75G>T 5_prime_UTR_premature_start_codon_gain ACAP1 3 49414 6.07115E-5 24707 0 9.59877E-5
17-7253694-C-T c.-46C>T 5_prime_UTR_premature_start_codon_gain ACAP1 89 34986 0.00254387 17493 0 0.00516629
17-7253714-GCTGCGCGAAGTGTGCA-G c.-22_-17+10delCGCGAAGTGTGCACTG splice_donor ACAP1 4 28006 1.42827E-4 14003 0 NA
17-7253730-A-G c.-17+7A>G splice_region ACAP1 1 23866 4.19006E-5 11933 0 7.38647E-4
17-7253757-G-T c.-17+8G>T splice_region ACAP1 22 19816 0.00111021 9908 0 0.00211633
17-7253857-C-T c.-15C>T 5_prime_UTR_premature_start_codon_gain ACAP1 1 8532 1.17206E-4 4266 0 0.00131579
17-7253876-A-G p.Asn2Ser missense ACAP1 1 8116 1.23213E-4 4058 0 NA
17-7253924-G-A c.47+6G>A splice_region ACAP1 1 7788 1.28403E-4 3894 0 NA
17-7254269-G-C p.Arg16Ser missense+splice_region ACAP1 1 82970 1.20525E-5 41485 0 NA
17-7254272-A-G c.-13A>G 5_prime_UTR_premature_start_codon_gain ACAP1 1 82984 1.20505E-5 41492 0 NA
17-7254291-G-A p.Glu699Lys missense ACAP1 3 82996 3.61463E-5 41498 0 1.99033E-5
17-7254293-G-A p.Glu699Glu synonymous ACAP1 8 83002 9.63832E-5 41501 0 6.37267E-5
17-7254302-G-A p.Ala702Ala synonymous ACAP1 1 82988 1.20499E-5 41494 0 NA
17-7254311-G-A p.Gly705Gly synonymous ACAP1 3 82974 3.61559E-5 41487 0 9.56084E-5
17-7254315-G-A p.Ala707Thr missense ACAP1 5816 82824 0.0702212 41412 232 0.121853
17-7254623-C-A p.Thr711Lys missense ACAP1 1 82344 1.21442E-5 41172 0 NA
17-7254636-C-T p.Ile715Ile synonymous ACAP1 1 82456 1.21277E-5 41228 0 3.9969E-6
17-7254648-C-T p.Phe719Phe synonymous ACAP1 1 82378 1.21392E-5 41189 0 7.98645E-6
17-7254652-C-T p.Leu721Phe missense ACAP1 2 82416 2.42671E-5 41208 0 NA
17-7254667-G-A p.Asp726Asn missense ACAP1 1 82272 1.21548E-5 41136 0 NA
17-7254672-G-A p.Pro727Pro synonymous ACAP1 1 82310 1.21492E-5 41155 0 NA
17-7254692-G-A p.Ser734Asn missense ACAP1 8 82082 9.74635E-5 41041 0 8.32609E-5
17-7254697-G-C p.Asp736His missense ACAP1 7 81960 8.54075E-5 40980 0 6.36902E-5
17-7254697-G-A p.Asp736Asn missense ACAP1 5 81960 6.10054E-5 40980 0 4.68498E-5
17-7254709-C-G p.Leu740Val missense ACAP1 1 81638 1.22492E-5 40819 0 NA
17-7254711-G-A p.Leu740Leu synonymous ACAP1 1 81554 1.22618E-5 40777 0 1.00628E-5