Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
15-89379428-C-T c.-7-3C>T splice_region ACAN 2 82348 2.42872E-5 41174 0 2.43699E-4
15-89379442-C-T p.Thr2Ile missense ACAN 1 82418 1.21333E-5 41209 0 2.57061E-5
15-89379443-C-A p.Thr2Thr synonymous ACAN 1 82422 1.21327E-5 41211 0 2.81113E-5
15-89379448-T-C p.Leu4Ser missense ACAN 20 82412 2.42683E-4 41206 0 7.227E-5
15-89379462-G-A p.Val9Met missense ACAN 1 82446 1.21292E-5 41223 0 3.61327E-5
15-89379462-G-C p.Val9Leu missense ACAN 2 82446 2.42583E-5 41223 0 NA
15-89379486-G-T p.Ala17Ser missense ACAN 1 82456 1.21277E-5 41228 0 8.56957E-6
15-89381895-C-A p.Asp24Glu missense+splice_region ACAN 10 82202 1.21652E-4 41101 0 3.46538E-4
15-89381903-A-G p.Asn27Ser missense ACAN 5 82344 6.07209E-5 41172 0 1.34381E-5
15-89381906-C-G p.Ser28Trp missense ACAN 2 82364 2.42825E-5 41182 0 2.71155E-5
15-89381907-G-A p.Ser28Ser synonymous ACAN 9 82338 1.09306E-4 41169 0 6.25E-4
15-89381930-C-T p.Pro36Leu missense ACAN 1 82568 1.21112E-5 41284 0 4.16889E-6
15-89381931-G-A p.Pro36Pro synonymous ACAN 4 82564 4.84473E-5 41282 0 2.32126E-4
15-89381936-C-T p.Pro38Leu missense ACAN 7 82596 8.47499E-5 41298 0 0.00125
15-89381937-G-A p.Pro38Pro synonymous ACAN 19 82574 2.30097E-4 41287 0 0.00100705
15-89381947-C-G p.Leu42Val missense ACAN 2 82636 2.42025E-5 41318 0 NA
15-89381957-C-T p.Thr45Ile missense ACAN 1 82622 1.21033E-5 41311 0 NA
15-89381958-C-T p.Thr45Thr synonymous ACAN 2 82632 2.42037E-5 41316 0 8.46525E-6
15-89381983-A-G p.Ile54Val missense ACAN 1 82610 1.21051E-5 41305 0 NA
15-89381985-C-T p.Ile54Ile synonymous ACAN 31 82604 3.75284E-4 41302 0 1.91192E-4
15-89381986-G-A p.Asp55Asn missense ACAN 1 82586 1.21086E-5 41293 0 2.00874E-5
15-89381986-G-C p.Asp55His missense ACAN 1 82586 1.21086E-5 41293 0 NA
15-89381987-A-G p.Asp55Gly missense ACAN 4 82586 4.84344E-5 41293 0 1.16115E-4
15-89381991-C-T p.Pro56Pro synonymous ACAN 1 82598 1.21068E-5 41299 0 0.00151057
15-89382008-C-A p.Thr62Asn missense ACAN 36 82590 4.35888E-4 41295 0 4.49424E-4
15-89382009-C-T p.Thr62Thr synonymous ACAN 146 82602 0.00176751 41301 2 0.00318512
15-89382009-C-A p.Thr62Thr synonymous ACAN 1 82606 1.21057E-5 41303 0 NA
15-89382010-G-A p.Ala63Thr missense ACAN 6 82602 7.26375E-5 41301 0 4.14243E-5
15-89382018-T-C p.Ser65Ser synonymous ACAN 7 82614 8.47314E-5 41307 0 8.28377E-6
15-89382021-C-G p.Thr66Thr synonymous ACAN 1 82608 1.21054E-5 41304 0 NA
15-89382022-G-A p.Ala67Thr missense ACAN 136 82592 0.00164665 41296 0 0.00134822
15-89382026-C-A p.Pro68Gln missense ACAN 1 82624 1.2103E-5 41312 0 1.20361E-5
15-89382027-A-C p.Pro68Pro synonymous ACAN 155 82618 0.0018761 41309 7 0.00875
15-89382027-A-G p.Pro68Pro synonymous ACAN 1 82618 1.21039E-5 41309 0 NA
15-89382032-C-T p.Ala70Val missense ACAN 1 82632 1.21018E-5 41316 0 NA
15-89382040-A-G p.Ile73Val missense ACAN 2 82638 2.42019E-5 41319 0 7.62293E-5
15-89382052-C-T p.Arg77Cys missense ACAN 9 82644 1.08901E-4 41322 0 5.03525E-4
15-89382053-G-A p.Arg77His missense ACAN 63 82644 7.62306E-4 41322 1 0.00207072
15-89382055-G-A p.Val78Met missense ACAN 1 82648 1.20995E-5 41324 0 NA
15-89382061-A-C p.Lys80Gln missense ACAN 1 82652 1.20989E-5 41326 0 NA
15-89382064-GAGA-G p.Lys82del conservative_inframe_deletion ACAN 1 82644 1.21001E-5 41322 0 NA
15-89382065-A-G p.Glu81Gly missense ACAN 1 82644 1.21001E-5 41322 0 3.31279E-5
15-89382073-G-T p.Val84Leu missense ACAN 1 82640 1.21007E-5 41320 0 8.28144E-6
15-89382085-G-A p.Val88Met missense ACAN 2 82624 2.4206E-5 41312 0 NA
15-89382088-G-A p.Ala89Thr missense ACAN 2 82606 2.42113E-5 41303 0 3.18471E-5
15-89382100-C-G p.Arg93Gly missense ACAN 1 82520 1.21183E-5 41260 0 1.65629E-5
15-89382103-G-A p.Val94Met missense ACAN 18 82496 2.18192E-4 41248 0 5.03525E-4
15-89382103-G-C p.Val94Leu missense ACAN 4 82496 4.84872E-5 41248 0 1.60499E-5
15-89382106-C-T p.Arg95Trp missense ACAN 11 82452 1.33411E-4 41226 0 2.80926E-5
15-89382107-G-A p.Arg95Gln missense ACAN 1 82456 1.21277E-5 41228 0 9.55657E-5
15-89382125-A-C p.Gln101Pro missense ACAN 1 82352 1.2143E-5 41176 0 NA
15-89382129-C-A p.Asp102Glu missense ACAN 1851 82248 0.0225051 41124 96 0.0453474
15-89382141-G-T p.Leu106Leu synonymous ACAN 1 82200 1.21655E-5 41100 0 NA
15-89382152-C-T p.Pro110Leu missense ACAN 4 82084 4.87306E-5 41042 0 6.37146E-5
15-89382153-G-A p.Pro110Pro synonymous ACAN 14 82068 1.7059E-4 41034 0 1.49145E-4
15-89382168-C-T p.Asp115Asp synonymous ACAN 3 81888 3.66354E-5 40944 0 4.97488E-5
15-89382169-G-A p.Ala116Thr missense ACAN 1 81878 1.22133E-5 40939 0 6.37024E-5
15-89382181-G-T p.Val120Phe missense ACAN 2 81744 2.44666E-5 40872 0 1.59246E-4
15-89382193-C-T p.Arg124Cys missense ACAN 1 81510 1.22684E-5 40755 0 3.18471E-5
15-89382194-G-A p.Arg124His missense ACAN 2 81440 2.4558E-5 40720 0 2.01266E-5
15-89382201-T-C p.Asn126Asn synonymous ACAN 1 81322 1.22968E-5 40661 0 NA
15-89382211-G-T p.Val130Phe missense ACAN 2 81026 2.46834E-5 40513 0 NA
15-89382217-C-T p.Arg132Cys missense ACAN 22 80706 2.72594E-4 40353 0 0.00151057
15-89382218-G-A p.Arg132His missense ACAN 1 80632 1.2402E-5 40316 0 2.02754E-5
15-89382222-C-T p.Cys133Cys synonymous ACAN 3 80354 3.73348E-5 40177 0 3.34035E-5
15-89382223-G-A p.Glu134Lys missense ACAN 1 80430 1.24332E-5 40215 0 4.17585E-5
15-89382240-C-T p.Ile139Ile synonymous ACAN 18 79000 2.27848E-4 39500 0 5.04032E-4
15-89382249-C-T p.Ser142Ser synonymous ACAN 1 77686 1.28723E-5 38843 0 3.1841E-5
15-89382250-G-A p.Glu143Lys missense ACAN 2 77648 2.57573E-5 38824 0 5.04032E-4
15-89382255-C-A p.Ala144Ala synonymous ACAN 25 76888 3.25148E-4 38444 0 8.9172E-4
15-89382261-G-A p.Leu146Leu synonymous ACAN 617 76132 0.00810434 38066 4 0.00990446
15-89382267-C-T p.Val148Val synonymous ACAN 3 74830 4.00909E-5 37415 0 1.0062E-4
15-89382268-G-A p.Val149Met missense ACAN 1 74636 1.33984E-5 37318 0 8.41269E-6
15-89382284-G-A c.454+7G>A splice_region ACAN 1 71138 1.40572E-5 35569 0 NA
15-89383244-C-T p.Gly152Gly splice_region+synonymous ACAN 6 82064 7.31137E-5 41032 0 1.59286E-4
15-89383253-C-T p.Phe155Phe synonymous ACAN 1 82110 1.21788E-5 41055 0 4.41692E-6
15-89383275-C-T p.Arg163Cys missense ACAN 1 82122 1.2177E-5 41061 0 5.04032E-4
15-89383276-G-A p.Arg163His missense ACAN 1 82106 1.21794E-5 41053 0 3.43702E-5
15-89383280-C-T p.Tyr164Tyr synonymous ACAN 8 82114 9.74255E-5 41057 0 1.86821E-4
15-89383287-G-A p.Asp167Asn missense ACAN 5 82116 6.08895E-5 41058 0 2.17503E-5
15-89383289-C-T p.Asp167Asp synonymous ACAN 1 82122 1.2177E-5 41061 0 1.64447E-5
15-89383296-A-C p.Arg170Arg synonymous ACAN 1 82102 1.218E-5 41051 0 4.36296E-6
15-89383297-G-A p.Arg170Lys missense ACAN 1 82106 1.21794E-5 41053 0 NA
15-89383300-C-T p.Ala171Val missense ACAN 1 82052 1.21874E-5 41026 0 1.75409E-5
15-89383301-G-A p.Ala171Ala synonymous ACAN 1 82026 1.21913E-5 41013 0 3.24528E-5
15-89383305-C-T p.Arg173Trp missense ACAN 4 81998 4.87817E-5 40999 0 3.22872E-5
15-89383306-G-A p.Arg173Gln missense ACAN 3 82032 3.65711E-5 41016 0 2.56929E-4
15-89383307-G-T p.Arg173Arg synonymous ACAN 26 82040 3.16919E-4 41020 0 2.55257E-4
15-89383310-C-G p.Ala174Ala synonymous ACAN 10 82030 1.21907E-4 41015 0 4.13881E-4
15-89383321-A-T p.Asn178Ile missense ACAN 1 81978 1.21984E-5 40989 0 NA
15-89383324-G-A p.Ser179Asn missense ACAN 1 81962 1.22008E-5 40981 0 1.52416E-5
15-89383330-T-A p.Ile181Asn missense ACAN 10 81894 1.22109E-4 40947 0 9.55475E-5
15-89383335-G-A p.Ala183Thr missense ACAN 1 81814 1.22228E-5 40907 0 NA
15-89383339-C-T p.Thr184Met missense ACAN 16 81782 1.95642E-4 40891 0 0.00125
15-89383340-G-A p.Thr184Thr synonymous ACAN 223 81772 0.00272709 40886 2 0.00461695
15-89383341-C-A p.Pro185Thr missense ACAN 5 81780 6.11396E-5 40890 0 1.04046E-4
15-89383355-G-T p.Gln189His missense ACAN 1 81570 1.22594E-5 40785 0 NA
15-89383358-C-T p.Ala190Ala synonymous ACAN 2 81412 2.45664E-5 40706 0 8.89179E-5
15-89383359-G-A p.Ala191Thr missense ACAN 3 81352 3.68768E-5 40676 0 3.1198E-4
15-89383364-C-T p.Tyr192Tyr synonymous ACAN 5 81250 6.15385E-5 40625 0 8.85347E-5
15-89383365-G-A p.Glu193Lys missense ACAN 6 81204 7.3888E-5 40602 0 3.18431E-5
15-89383370-C-T p.Asp194Asp synonymous ACAN 77 81096 9.49492E-4 40548 0 0.00455005
15-89383372-G-A p.Gly195Asp missense ACAN 1 80914 1.23588E-5 40457 0 1.48043E-5
15-89383388-C-T p.Asp200Asp synonymous ACAN 2 80430 2.48663E-5 40215 0 4.72605E-5
15-89383391-C-T p.Ala201Ala synonymous ACAN 3 80168 3.74214E-5 40084 0 1.60082E-5
15-89383411-C-T p.Thr208Ile missense ACAN 1 78748 1.26987E-5 39374 0 4.52304E-6
15-89383416-A-G p.Arg210Gly missense+splice_region ACAN 1 78406 1.27541E-5 39203 0 3.73483E-5
15-89383422-G-A c.629+5G>A splice_region ACAN 2 77510 2.58031E-5 38755 0 1.95633E-5
15-89384963-C-T c.630-8C>T splice_region ACAN 7 82250 8.51064E-5 41125 0 1.27543E-4
15-89384967-G-A c.630-4G>A splice_region ACAN 2 82318 2.4296E-5 41159 0 3.18837E-5
15-89384968-C-T c.630-3C>T splice_region ACAN 1 82344 1.21442E-5 41172 0 2.00748E-5
15-89384973-A-T p.Tyr211Phe missense+splice_region ACAN 1 82416 1.21336E-5 41208 0 NA
15-89384990-C-T p.Arg217Trp missense ACAN 1 82578 1.21098E-5 41289 0 1.65673E-5
15-89384991-G-A p.Arg217Gln missense ACAN 2 82592 2.42154E-5 41296 0 2.8084E-5
15-89385003-A-G p.Tyr221Cys missense ACAN 3 82678 3.62853E-5 41339 0 1.20338E-5
15-89385014-G-T p.Asp225Tyr missense ACAN 1 82698 1.20922E-5 41349 0 8.02227E-6
15-89385016-TGA-T p.Glu226fs frameshift ACAN 1 82694 1.20928E-5 41347 0 NA
15-89385017-G-A p.Glu226Lys missense ACAN 1 82696 1.20925E-5 41348 0 3.31219E-5
15-89385019-G-A p.Glu226Glu synonymous ACAN 4 82710 4.83617E-5 41355 0 8.02214E-6
15-89385037-G-A p.Thr232Thr synonymous ACAN 1 82712 1.20901E-5 41356 0 9.57916E-5
15-89385044-A-T p.Ile235Phe missense ACAN 3 82702 3.62748E-5 41351 0 1.59724E-4
15-89385045-T-A p.Ile235Asn missense ACAN 1 82700 1.20919E-5 41350 0 NA
15-89385048-G-A p.Arg236Gln missense ACAN 1 82674 1.20957E-5 41337 0 8.28048E-6
15-89385055-C-G p.Thr238Thr synonymous ACAN 1 82684 1.20942E-5 41342 0 8.28048E-6
15-89385058-C-T p.Asn239Asn synonymous ACAN 1 82674 1.20957E-5 41337 0 1.27869E-4
15-89385059-G-A p.Glu240Lys missense ACAN 5 82674 6.04785E-5 41337 0 1.28025E-4
15-89385066-A-C p.Tyr242Ser missense ACAN 1 82686 1.20939E-5 41343 0 NA
15-89385073-G-T p.Val244Val synonymous ACAN 1 82640 1.21007E-5 41320 0 4.01146E-6
15-89385085-C-T p.Ala248Ala synonymous ACAN 247 82480 0.00299467 41240 1 0.0057648
15-89385086-G-A p.Glu249Lys missense ACAN 14 82492 1.69713E-4 41246 0 2.31911E-4
15-89385088-G-C p.Glu249Asp missense ACAN 3 82494 3.63663E-5 41247 0 3.20472E-5
15-89385093-T-C p.Met251Thr missense ACAN 3 82464 3.63795E-5 41232 0 2.48484E-5
15-89386581-C-T c.758-5C>T splice_region ACAN 1 80252 1.24607E-5 40126 0 NA
15-89386590-G-A p.Glu254Glu synonymous ACAN 3 80280 3.73692E-5 40140 0 3.18492E-5
15-89386622-C-T p.Thr265Ile missense ACAN 1 80712 1.23897E-5 40356 0 NA
15-89386628-A-G p.Gln267Arg missense ACAN 1 80862 1.23667E-5 40431 0 NA
15-89386644-G-A p.Glu272Glu synonymous ACAN 1 81024 1.2342E-5 40512 0 NA
15-89386648-C-T p.Arg274Trp missense ACAN 25 80984 3.08703E-4 40492 0 0.001875
15-89386649-G-A p.Arg274Gln missense ACAN 2 80986 2.46956E-5 40493 0 6.37633E-5
15-89386651-C-T p.Arg275Trp missense ACAN 1 80954 1.23527E-5 40477 0 NA
15-89386652-G-A p.Arg275Gln missense ACAN 11439 80736 0.141684 40368 863 0.15375
15-89386656-G-A p.Leu276Leu synonymous ACAN 9 81018 1.11086E-4 40509 0 4.09403E-5
15-89386661-C-G p.Ala278Gly missense ACAN 2 80982 2.46968E-5 40491 0 NA
15-89386664-G-A p.Arg279Gln missense ACAN 15 80998 1.8519E-4 40499 0 2.00634E-4
15-89386676-C-T p.Thr283Met missense ACAN 2 81116 2.4656E-5 40558 0 6.37349E-5
15-89386677-G-T p.Thr283Thr synonymous ACAN 5 81082 6.1666E-5 40541 0 4.09658E-6
15-89386688-A-G p.Tyr287Cys missense ACAN 2 81242 2.46178E-5 40621 0 4.40288E-5
15-89386702-G-A p.Ala292Thr missense ACAN 1 81180 1.23183E-5 40590 0 2.65788E-5
15-89386703-C-G p.Ala292Gly missense ACAN 1 81150 1.23229E-5 40575 0 NA
15-89386706-G-A p.Gly293Asp missense ACAN 1 81152 1.23226E-5 40576 0 NA
15-89386709-T-C p.Met294Thr missense ACAN 19 81160 2.34105E-4 40580 0 NA
15-89386714-A-C p.Met296Leu missense ACAN 2 81134 2.46506E-5 40567 0 8.90504E-6
15-89386715-T-C p.Met296Thr missense ACAN 2 81138 2.46494E-5 40569 0 4.5221E-5
15-89386722-C-T p.Ser298Ser synonymous ACAN 6 80760 7.42942E-5 40380 0 1.59357E-4
15-89386723-G-A p.Ala299Thr missense ACAN 8 80670 9.91695E-5 40335 0 0.00100705
15-89386724-C-A p.Ala299Asp missense ACAN 3 80654 3.71959E-5 40327 0 8.24565E-6
15-89386725-C-T p.Ala299Ala synonymous ACAN 3 80688 3.71802E-5 40344 0 8.95335E-5
15-89386726-G-A p.Gly300Ser missense ACAN 3 80692 3.71784E-5 40346 0 0.00151057
15-89386734-G-A p.Leu302Leu synonymous ACAN 1 80598 1.24073E-5 40299 0 NA
15-89386737-C-T p.Ala303Ala synonymous ACAN 2 80528 2.48361E-5 40264 0 8.0274E-5
15-89386741-C-T p.Arg305Cys missense ACAN 24 80516 2.98077E-4 40258 0 5.03525E-4
15-89386741-C-G p.Arg305Gly missense ACAN 1 80516 1.24199E-5 40258 0 4.10179E-6
15-89386742-G-A p.Arg305His missense ACAN 3 80446 3.72921E-5 40223 0 2.65957E-5
15-89386751-G-A p.Arg308His missense ACAN 1 80254 1.24604E-5 40127 0 3.5084E-5
15-89386752-C-G p.Arg308Arg synonymous ACAN 6 80344 7.46789E-5 40172 0 4.11494E-4
15-89386772-G-A p.Arg315Gln missense ACAN 1 80142 1.24779E-5 40071 0 NA
15-89386782-C-T p.Cys318Cys synonymous ACAN 1 79728 1.25426E-5 39864 0 3.18735E-5
15-89386797-G-A p.Leu323Leu synonymous ACAN 1 79152 1.26339E-5 39576 0 NA
15-89386801-G-A p.Val325Met missense ACAN 7 78710 8.89341E-5 39355 0 0.00100705
15-89386801-G-T p.Val325Leu missense ACAN 1 78714 1.27042E-5 39357 0 8.55534E-6
15-89386807-A-G p.Thr327Ala missense ACAN 1 78216 1.27851E-5 39108 0 NA
15-89386819-C-T p.His331Tyr missense ACAN 1 76932 1.29985E-5 38466 0 NA
15-89386826-A-G p.Asn333Ser missense ACAN 1 76162 1.31299E-5 38081 0 2.46907E-5
15-89386832-C-T p.Thr335Met missense ACAN 5 75228 6.64646E-5 37614 0 6.37105E-5
15-89386833-G-A p.Thr335Thr synonymous ACAN 6 75010 7.99893E-5 37505 0 1.9118E-4
15-89386833-G-C p.Thr335Thr synonymous ACAN 1 75010 1.33316E-5 37505 0 NA
15-89386836-C-T p.Gly336Gly synonymous ACAN 2 74414 2.68767E-5 37207 0 0.00100806
15-89386840-C-G p.Pro338Ala missense ACAN 4 73722 5.42579E-5 36861 0 8.7437E-6
15-89386841-C-T p.Pro338Leu missense ACAN 4 73588 5.43567E-5 36794 0 2.62352E-5
15-89386843-G-A p.Asp339Asn missense ACAN 1 72990 1.37005E-5 36495 0 4.38166E-5
15-89386845-C-A p.Asp339Glu missense ACAN 1 72904 1.37167E-5 36452 0 8.35736E-6
15-89386846-C-T p.Pro340Ser missense ACAN 2 72828 2.7462E-5 36414 0 NA
15-89386855-C-T p.Arg343Cys missense ACAN 1 71292 1.40268E-5 35646 0 1.78674E-5
15-89386856-G-A p.Arg343His missense ACAN 5 70812 7.06095E-5 35406 0 3.83907E-5
15-89386858-T-C p.Tyr344His missense ACAN 2 70508 2.83656E-5 35254 0 8.96829E-6
15-89386859-A-G p.Tyr344Cys missense ACAN 4 70290 5.69071E-5 35145 0 3.00025E-5
15-89386860-C-T p.Tyr344Tyr synonymous ACAN 3 69876 4.29332E-5 34938 0 4.49398E-5
15-89386861-G-A p.Asp345Asn missense ACAN 3 69310 4.32838E-5 34655 0 3.18573E-5
15-89386864-G-A p.Ala346Thr missense ACAN 2 68070 2.93815E-5 34035 0 2.71233E-5
15-89386885-G-A c.1051+6G>A splice_region ACAN 1 63304 1.57968E-5 31652 0 NA
15-89388736-G-A p.Gly351Asp missense+splice_region ACAN 1 81508 1.22687E-5 40754 0 4.11872E-6
15-89388746-T-C p.Phe354Phe synonymous ACAN 2 81910 2.4417E-5 40955 0 NA
15-89388749-G-A p.Val355Val synonymous ACAN 2 82016 2.43855E-5 41008 0 4.05653E-6
15-89388750-G-A p.Asp356Asn missense ACAN 1 82022 1.21919E-5 41011 0 NA
15-89388773-A-G p.Gly363Gly synonymous ACAN 1 82400 1.21359E-5 41200 0 NA
15-89388776-G-C p.Val364Val synonymous ACAN 2 82418 2.42665E-5 41209 0 9.55779E-5
15-89388776-G-T p.Val364Val synonymous ACAN 1 82418 1.21333E-5 41209 0 NA
15-89388781-G-A p.Gly366Asp missense ACAN 1 82410 1.21345E-5 41205 0 8.35227E-6
15-89388796-C-T p.Thr371Ile missense ACAN 1 82454 1.2128E-5 41227 0 NA
15-89388797-C-G p.Thr371Thr synonymous ACAN 29 82460 3.51686E-4 41230 0 0.00100705
15-89388802-A-T p.Gln373Leu missense ACAN 1 82476 1.21247E-5 41238 0 4.01481E-6
15-89388805-C-G p.Thr374Arg missense ACAN 3 82474 3.63751E-5 41237 0 8.30303E-6
15-89388811-C-G p.Thr376Ser missense ACAN 5 82466 6.0631E-5 41233 0 1.27364E-4
15-89388816-C-A p.Pro378Thr missense ACAN 3 82470 3.63769E-5 41235 0 8.29779E-6
15-89388825-G-C p.Glu381Gln missense ACAN 1 82488 1.2123E-5 41244 0 NA
15-89388840-C-T p.Arg386* stop_gained ACAN 1 82562 1.21121E-5 41281 0 NA
15-89388846-A-G p.Ile388Val missense ACAN 1 82566 1.21115E-5 41283 0 1.20408E-5
15-89388847-T-C p.Ile388Thr missense ACAN 1 82568 1.21112E-5 41284 0 NA
15-89388865-G-A p.Arg394Gln missense ACAN 5 82520 6.05914E-5 41260 0 2.54793E-4
15-89388867-G-A p.Gly395Ser missense ACAN 20 82524 2.42354E-4 41262 0 0.00110187
15-89388868-G-A p.Gly395Asp missense ACAN 1 82510 1.21197E-5 41255 0 NA
15-89388871-G-C p.Ser396Thr missense ACAN 3 82512 3.63583E-5 41256 0 8.28391E-6
15-89388872-C-T p.Ser396Ser synonymous ACAN 3 82506 3.6361E-5 41253 0 0.00117797
15-89388873-G-A p.Val397Met missense ACAN 7 82500 8.48485E-5 41250 0 6.36821E-5
15-89388879-C-T p.Leu399Phe missense ACAN 1 82512 1.21194E-5 41256 0 1.65681E-5
15-89388884-C-T p.Thr400Thr synonymous ACAN 2 82492 2.42448E-5 41246 0 6.25E-4
15-89388885-G-A p.Val401Ile missense ACAN 3 82480 3.63725E-5 41240 0 5.03525E-4
15-89388890-G-C p.Lys402Asn missense ACAN 2 82468 2.42518E-5 41234 0 NA
15-89388894-A-G p.Ile404Val missense ACAN 295 82456 0.00357767 41228 18 0.0151975
15-89388899-C-T p.Phe405Phe synonymous ACAN 1 82378 1.21392E-5 41189 0 8.28775E-6
15-89388900-G-A p.Glu406Lys missense ACAN 3 82358 3.64263E-5 41179 0 1.12661E-4
15-89388904-T-C p.Val407Ala missense ACAN 1 82290 1.21521E-5 41145 0 NA
15-89388905-C-T p.Val407Val synonymous ACAN 4025 82204 0.0489636 41102 135 0.0840886
15-89388907-C-T p.Ser408Phe missense ACAN 1 82324 1.21471E-5 41162 0 4.02622E-6
15-89388907-C-G p.Ser408Cys missense ACAN 3 82324 3.64414E-5 41162 0 1.20787E-5
15-89388910-C-T p.Pro409Leu missense ACAN 3 82316 3.64449E-5 41158 0 1.20793E-5
15-89388920-G-A p.Leu412Leu synonymous ACAN 779 82272 0.00946859 41136 8 0.01375
15-89388926-C-T p.Pro414Pro synonymous ACAN 45 82256 5.47073E-4 41128 0 0.00100705
15-89388927-G-A p.Glu415Lys missense ACAN 4 82246 4.86346E-5 41123 0 2.01371E-5
15-89388930-G-A p.Glu416Lys missense ACAN 8 82246 9.72692E-5 41123 0 6.25E-4
15-89388939-A-C p.Thr419Pro missense ACAN 2 82182 2.43362E-5 41091 0 2.4175E-5
15-89388940-C-T p.Thr419Met missense ACAN 7 82172 8.51872E-5 41086 0 6.25E-4
15-89388941-G-A p.Thr419Thr synonymous ACAN 7 82160 8.51996E-5 41080 0 1.59226E-4
15-89388948-C-T p.Pro422Ser missense ACAN 2 82114 2.43564E-5 41057 0 NA
15-89388949-C-G p.Pro422Arg missense ACAN 1 82126 1.21764E-5 41063 0 8.60748E-6
15-89388953-A-G p.Glu423Glu synonymous ACAN 1 82126 1.21764E-5 41063 0 NA
15-89388959-G-C p.Gly425Gly synonymous ACAN 2 82134 2.43505E-5 41067 0 1.61368E-5
15-89388963-A-G p.Thr427Ala missense ACAN 2 82144 2.43475E-5 41072 0 2.71759E-5
15-89388965-T-A p.Thr427Thr synonymous ACAN 1 82124 1.21767E-5 41062 0 NA
15-89388969-T-C p.Phe429Leu missense ACAN 1 82138 1.21746E-5 41069 0 3.18431E-5
15-89388971-C-T p.Phe429Phe synonymous ACAN 2 82086 2.43647E-5 41043 0 5.61419E-5
15-89388972-G-A p.Ala430Thr missense ACAN 7 82042 8.53221E-5 41021 0 4.70208E-5
15-89388972-G-T p.Ala430Ser missense ACAN 2 82042 2.43778E-5 41021 0 9.55292E-5
15-89388973-C-T p.Ala430Val missense ACAN 1 82050 1.21877E-5 41025 0 NA
15-89388983-G-C p.Glu433Asp missense ACAN 6 81992 7.31779E-5 40996 0 5.04032E-4
15-89389000-C-T p.Ala439Val missense ACAN 2 81650 2.44948E-5 40825 0 NA
15-89389007-G-T p.Arg441Ser missense ACAN 1 81506 1.2269E-5 40753 0 NA
15-89389018-T-C p.Phe445Ser missense ACAN 1 81290 1.23016E-5 40645 0 NA
15-89389036-G-C p.Gly451Ala missense ACAN 4 80768 4.95246E-5 40384 0 6.10998E-5
15-89389045-C-T p.Thr454Met missense ACAN 8 80460 9.94283E-5 40230 0 6.25E-4
15-89389046-G-T p.Thr454Thr synonymous ACAN 1 80376 1.24415E-5 40188 0 1.76993E-5
15-89389046-G-A p.Thr454Thr synonymous ACAN 3 80378 3.73236E-5 40189 0 3.53986E-5
15-89389048-C-T p.Ala455Val missense ACAN 1 80316 1.24508E-5 40158 0 NA
15-89389050-T-C p.Phe456Leu missense ACAN 263 80252 0.00327718 40126 0 0.011027
15-89389054-C-T p.Thr457Ile missense ACAN 1 80136 1.24788E-5 40068 0 NA
15-89389054-C-G p.Thr457Ser missense ACAN 1 80136 1.24788E-5 40068 0 NA
15-89389068-G-A p.Val462Ile missense ACAN 3 79218 3.78702E-5 39609 0 8.59904E-6
15-89389068-G-T p.Val462Phe missense ACAN 1 79218 1.26234E-5 39609 0 3.18512E-5
15-89389070-C-T p.Val462Val synonymous ACAN 2 78992 2.5319E-5 39496 0 3.18552E-5
15-89389077-G-A p.Val465Met missense ACAN 2 78488 2.54816E-5 39244 0 9.61834E-6
15-89389082-C-T p.Thr466Thr synonymous ACAN 355 78010 0.0045507 39005 0 0.0150188
15-89389083-G-A p.Ala467Thr missense ACAN 2 77704 2.57387E-5 38852 0 1.04367E-5
15-89389086-G-C p.Val468Leu missense ACAN 1 77532 1.28979E-5 38766 0 NA
15-89389093-G-C p.Gly470Ala missense ACAN 1 77242 1.29463E-5 38621 0 NA
15-89389093-G-A p.Gly470Glu missense ACAN 3 77242 3.8839E-5 38621 0 0.00187735
15-89389094-G-A p.Gly470Gly synonymous ACAN 1 77042 1.29799E-5 38521 0 NA
15-89389095-C-A p.Gln471Lys missense ACAN 1 77110 1.29685E-5 38555 0 2.66028E-4
15-89389099-C-T p.Pro472Leu missense ACAN 1 76554 1.30627E-5 38277 0 NA
15-89389100-G-A p.Pro472Pro synonymous ACAN 13 76444 1.70059E-4 38222 0 4.42957E-4
15-89389106-G-T p.Leu474Phe missense ACAN 3 75994 3.94768E-5 37997 0 NA
15-89389111-G-A p.Gly476Glu missense+splice_region ACAN 1 75580 1.3231E-5 37790 0 NA
15-89390469-C-T c.1430-5C>T splice_region ACAN 10 79174 1.26304E-4 39587 0 6.28931E-4
15-89390476-G-T p.Val478Phe missense+splice_region ACAN 4 79190 5.05114E-5 39595 0 0.00259875
15-89390478-C-T p.Val478Val synonymous ACAN 2 79236 2.52411E-5 39618 0 6.26511E-6
15-89390479-G-A p.Val479Ile missense ACAN 1 79328 1.26059E-5 39664 0 6.26778E-5
15-89390484-C-A p.Phe480Leu missense ACAN 1 79542 1.2572E-5 39771 0 NA
15-89390485-C-T p.His481Tyr missense ACAN 1 79558 1.25694E-5 39779 0 6.14296E-6
15-89390491-C-T p.Arg483Cys missense ACAN 7 79682 8.78492E-5 39841 0 1.20643E-5
15-89390492-G-A p.Arg483His missense ACAN 39 79656 4.89605E-4 39828 0 0.00153531
15-89390492-G-T p.Arg483Leu missense ACAN 1 79658 1.25537E-5 39829 0 NA
15-89390495-C-T p.Pro484Leu missense ACAN 2 79890 2.50344E-5 39945 0 1.17665E-5
15-89390496-G-A p.Pro484Pro synonymous ACAN 1 80000 1.25E-5 40000 0 3.18532E-5
15-89390506-C-T p.Arg488Cys missense ACAN 1 80330 1.24486E-5 40165 0 NA
15-89390507-G-A p.Arg488His missense ACAN 7 80330 8.71405E-5 40165 0 1.37061E-4
15-89390510-A-G p.Tyr489Cys missense ACAN 2 80448 2.48608E-5 40224 0 5.57184E-6
15-89390513-C-T p.Ser490Leu missense ACAN 914 80508 0.0113529 40254 5 0.0337922
15-89390514-G-A p.Ser490Ser synonymous ACAN 7 80580 8.68702E-5 40290 0 1.30879E-4
15-89390520-C-G p.Thr492Thr synonymous ACAN 485 80808 0.00600188 40404 21 0.0115771
15-89390528-A-G p.Glu495Gly missense ACAN 13 80888 1.60716E-4 40444 0 1.41271E-4
15-89390529-G-A p.Glu495Glu synonymous ACAN 1 80906 1.236E-5 40453 0 NA
15-89390534-A-T p.Gln497Leu missense ACAN 19 80950 2.34713E-4 40475 1 0.00231955
15-89390537-A-G p.Gln498Arg missense ACAN 1 80996 1.23463E-5 40498 0 5.3586E-6
15-89390539-G-T p.Ala499Ser missense ACAN 1 80988 1.23475E-5 40494 0 5.37843E-6
15-89390540-C-T p.Ala499Val missense ACAN 1 81036 1.23402E-5 40518 0 3.50452E-4
15-89390540-C-A p.Ala499Asp missense ACAN 1 81036 1.23402E-5 40518 0 1.0705E-5
15-89390548-C-T p.Arg502Cys missense ACAN 33 81116 4.06825E-4 40558 0 0.00253807
15-89390549-G-A p.Arg502His missense ACAN 2 81126 2.4653E-5 40563 0 3.18654E-5
15-89390549-G-C p.Arg502Pro missense ACAN 1 81126 1.23265E-5 40563 0 NA
15-89390551-A-G p.Thr503Ala missense ACAN 1 81158 1.23216E-5 40579 0 NA
15-89390554-G-T p.Gly504Trp missense ACAN 1 81250 1.23077E-5 40625 0 3.18654E-5
15-89390558-C-T p.Ala505Val missense ACAN 2 81260 2.46124E-5 40630 0 0.00125078
15-89390559-G-A p.Ala505Ala synonymous ACAN 1006 81280 0.012377 40640 40 0.0267385
15-89390570-C-T p.Ser509Leu missense ACAN 1 81434 1.22799E-5 40717 0 9.41561E-5
15-89390571-G-A p.Ser509Ser synonymous ACAN 8 81440 9.82318E-5 40720 0 6.25E-4
15-89390573-C-T p.Pro510Leu missense ACAN 1 81446 1.22781E-5 40723 0 NA
15-89390574-G-A p.Pro510Pro synonymous ACAN 1005 81464 0.0123367 40732 40 0.0267066
15-89390585-A-C p.Gln514Pro missense ACAN 1 81590 1.22564E-5 40795 0 NA
15-89390589-C-T p.Ala515Ala synonymous ACAN 1 81530 1.22654E-5 40765 0 6.25E-4
15-89390590-G-A p.Ala516Thr missense ACAN 6 81538 7.35853E-5 40769 0 0.0020202
15-89390595-C-T p.Tyr517Tyr synonymous ACAN 1 81558 1.22612E-5 40779 0 2.62577E-5
15-89390611-C-G p.Gln523Glu missense ACAN 10 81424 1.22814E-4 40712 0 2.22987E-4
15-89390619-C-T p.Asp525Asp synonymous ACAN 46 81184 5.66614E-4 40592 0 0.00104663
15-89390619-C-G p.Asp525Glu missense ACAN 1 81184 1.23177E-5 40592 0 3.13988E-4
15-89390620-G-A p.Ala526Thr missense ACAN 1 81086 1.23326E-5 40543 0 7.8182E-5
15-89390622-C-T p.Ala526Ala synonymous ACAN 5 81010 6.17208E-5 40505 0 1.34048E-4
15-89390632-C-T p.Arg530Trp missense ACAN 5 80798 6.18827E-5 40399 0 0.00151515
15-89390632-C-A p.Arg530Arg synonymous ACAN 2 80798 2.47531E-5 40399 0 2.76564E-5
15-89390633-G-A p.Arg530Gln missense ACAN 6 80824 7.42354E-5 40412 0 6.25E-4
15-89390640-G-C p.Gln532His missense ACAN 1 80656 1.23983E-5 40328 0 2.84981E-4
15-89390644-G-A p.Val534Ile missense ACAN 3 80530 3.72532E-5 40265 0 8.80178E-5
15-89390646-C-T p.Val534Val splice_region+synonymous ACAN 2 80566 2.48244E-5 40283 0 NA
15-89391156-G-A p.Ser540Asn missense ACAN 2 82466 2.42524E-5 41233 0 NA
15-89391160-C-A p.Pro541Pro synonymous ACAN 61397 81738 0.751144 40869 23347 0.791835
15-89391160-CC-AT p.ProArg541ProTrp missense ACAN 1 82470 1.21256E-5 41235 0 NA
15-89391161-C-T p.Arg542Trp missense ACAN 7 82478 8.48711E-5 41239 0 9.55657E-5
15-89391162-G-A p.Arg542Gln missense ACAN 4 82472 4.85013E-5 41236 0 3.31378E-5
15-89391164-A-AC p.Cys545fs frameshift ACAN 1 82476 1.21247E-5 41238 0 NA
15-89391164-A-T p.Thr543Ser missense ACAN 1 82476 1.21247E-5 41238 0 NA
15-89391165-C-T p.Thr543Ile missense ACAN 2 82472 2.42507E-5 41236 0 NA
15-89391169-A-G p.Pro544Pro synonymous ACAN 2 82486 2.42465E-5 41243 0 NA
15-89391172-C-T p.Cys545Cys synonymous ACAN 1 82484 1.21236E-5 41242 0 4.14202E-5
15-89391173-G-A p.Val546Met missense ACAN 1 82486 1.21233E-5 41243 0 4.01452E-6
15-89391175-G-C p.Val546Val synonymous ACAN 3 82490 3.6368E-5 41245 0 3.39578E-4
15-89391203-A-G p.Arg556Gly missense ACAN 1 82508 1.212E-5 41254 0 NA
15-89391212-G-T p.Gly559Cys missense ACAN 1 82496 1.21218E-5 41248 0 6.36902E-5
15-89391215-G-A p.Val560Met missense ACAN 12 82494 1.45465E-4 41247 0 6.25E-4
15-89391215-G-T p.Val560Leu missense ACAN 1 82494 1.21221E-5 41247 0 NA
15-89391218-C-T p.Arg561Cys missense ACAN 2 82482 2.42477E-5 41241 0 2.40743E-5
15-89391219-G-A p.Arg561His missense ACAN 13 82486 1.57602E-4 41243 0 6.62581E-5
15-89391220-C-G p.Arg561Arg synonymous ACAN 2 82496 2.42436E-5 41248 0 1.65645E-5
15-89391221-C-G p.Pro562Ala missense ACAN 3 82496 3.63654E-5 41248 0 6.37308E-5
15-89391239-G-A p.Asp568Asn missense ACAN 1 82434 1.21309E-5 41217 0 0.00100705
15-89391245-T-C p.Tyr570His missense ACAN 1 82414 1.21339E-5 41207 0 0.00125
15-89391246-A-G p.Tyr570Cys missense ACAN 1 82414 1.21339E-5 41207 0 NA
15-89391256-A-G p.Val573Val synonymous ACAN 1019 82312 0.0123797 41156 40 0.0266696
15-89391267-A-G p.Glu577Gly missense+splice_region ACAN 1 82114 1.21782E-5 41057 0 2.49551E-5
15-89392682-C-T p.Phe582Phe synonymous ACAN 5 78988 6.33008E-5 39494 0 1.63222E-4
15-89392683-G-A p.Ala583Thr missense ACAN 2 79008 2.53139E-5 39504 0 0.00101317
15-89392689-C-A p.Arg585Ser missense ACAN 275 79212 0.0034717 39606 12 0.0191468
15-89392689-C-T p.Arg585Cys missense ACAN 3 79230 3.78644E-5 39615 0 6.34518E-4
15-89392690-G-A p.Arg585His missense ACAN 14 79274 1.76603E-4 39637 0 1.14223E-4
15-89392695-G-A p.Glu587Lys missense ACAN 4 79466 5.0336E-5 39733 0 1.2747E-4
15-89392699-A-G p.Gln588Arg missense ACAN 1 79572 1.25672E-5 39786 0 1.08954E-5
15-89392700-G-T p.Gln588His missense ACAN 4 79600 5.02513E-5 39800 0 NA
15-89392742-T-G p.Asn602Lys missense ACAN 2 80106 2.49669E-5 40053 0 3.18634E-5
15-89392745-T-C p.Ala603Ala synonymous ACAN 74610 75650 0.986252 37825 36797 0.997482
15-89392747-C-T p.Thr604Met missense ACAN 2 80026 2.49919E-5 40013 0 0.00100705
15-89392747-C-G p.Thr604Arg missense ACAN 1 80026 1.24959E-5 40013 0 NA
15-89392748-G-A p.Thr604Thr synonymous ACAN 2 80032 2.499E-5 40016 0 9.26345E-5
15-89392757-C-T p.Thr607Thr synonymous ACAN 1 80178 1.24722E-5 40089 0 NA
15-89392759-C-T p.Thr608Met missense ACAN 1 80192 1.24701E-5 40096 0 NA
15-89392773-G-A p.Ala613Thr missense ACAN 3 80300 3.73599E-5 40150 0 6.25E-4
15-89392775-C-T p.Ala613Ala synonymous ACAN 21 80330 2.61422E-4 40165 0 7.71342E-4
15-89392775-C-G p.Ala613Ala synonymous ACAN 1 80330 1.24486E-5 40165 0 2.26865E-5
15-89392776-G-A p.Ala614Thr missense ACAN 5 80374 6.22092E-5 40187 0 4.83814E-5
15-89392778-C-T p.Ala614Ala synonymous ACAN 3 80490 3.72717E-5 40245 0 6.11274E-5
15-89392786-G-A p.Arg617His missense ACAN 1000 80538 0.0124165 40269 40 0.02671
15-89392793-G-A p.Leu619Leu synonymous ACAN 1 80896 1.23616E-5 40448 0 2.25327E-5
15-89392796-C-T p.Asp620Asp synonymous ACAN 2 80974 2.46993E-5 40487 0 NA
15-89392799-G-C p.Lys621Asn missense ACAN 1 81022 1.23423E-5 40511 0 NA
15-89392802-C-T p.Cys622Cys synonymous ACAN 996 81018 0.0122936 40509 40 0.0265927
15-89392805-T-C p.Tyr623Tyr synonymous ACAN 2 81058 2.46737E-5 40529 0 1.11857E-5
15-89392809-G-A p.Gly625Ser missense ACAN 1 81054 1.23375E-5 40527 0 3.18735E-5
15-89392809-G-T p.Gly625Cys missense ACAN 1 81054 1.23375E-5 40527 0 2.26531E-5
15-89392816-T-C p.Leu627Pro missense ACAN 1 81024 1.2342E-5 40512 0 NA
15-89392818-G-A p.Ala628Thr missense ACAN 290 80918 0.00358388 40459 17 0.0196834
15-89392820-C-T p.Ala628Ala synonymous ACAN 3 80910 3.70782E-5 40455 0 6.37674E-5
15-89392821-G-A p.Asp629Asn missense ACAN 4 80808 4.95E-5 40404 0 0.00100705
15-89392823-C-T p.Asp629Asp synonymous ACAN 14 80772 1.73327E-4 40386 0 0.00151057
15-89392824-G-A p.Gly630Ser missense ACAN 3 80878 3.70929E-5 40439 0 0.00100705
15-89392833-C-T p.Arg633Cys missense ACAN 5 81228 6.15551E-5 40614 0 3.18735E-5
15-89392834-G-A p.Arg633His missense ACAN 11 81104 1.35628E-4 40552 0 1.06765E-4
15-89392844-C-T p.Ile636Ile synonymous ACAN 1 81508 1.22687E-5 40754 0 3.05948E-5
15-89392845-G-A p.Val637Ile missense ACAN 6 81458 7.36576E-5 40729 0 1.32044E-4
15-89392849-C-T p.Thr638Ile missense ACAN 1 81628 1.22507E-5 40814 0 2.97844E-5
15-89392853-A-G p.Pro639Pro synonymous ACAN 1 81632 1.22501E-5 40816 0 2.93209E-5
15-89392856-G-C p.Arg640Ser missense ACAN 4 81590 4.90256E-5 40795 0 3.6811E-5
15-89392857-C-T p.Pro641Ser missense ACAN 1 81598 1.22552E-5 40799 0 NA
15-89392865-C-T p.Cys643Cys synonymous ACAN 16 81472 1.96386E-4 40736 0 0.00151057
15-89392866-G-A p.Gly644Ser missense ACAN 2 81560 2.45218E-5 40780 0 1.02257E-4
15-89392877-G-T p.Lys647Asn missense ACAN 1 81766 1.223E-5 40883 0 NA
15-89392880-A-G p.Pro648Pro synonymous ACAN 6 81778 7.33694E-5 40889 0 8.09625E-6
15-89392883-C-T p.Gly649Gly synonymous ACAN 1 81694 1.22408E-5 40847 0 3.18593E-5
15-89392884-G-A p.Val650Met missense ACAN 11 81702 1.34636E-4 40851 0 1.70058E-4
15-89392887-A-G p.Arg651Gly missense ACAN 1 81702 1.22396E-5 40851 0 8.67107E-6
15-89392891-C-T p.Thr652Met missense ACAN 5 81616 6.12625E-5 40808 0 1.27445E-4
15-89392893-G-A p.Val653Ile missense ACAN 1 81572 1.22591E-5 40786 0 4.04685E-6
15-89392904-C-T p.Tyr656Tyr synonymous ACAN 465 81490 0.00570622 40745 8 0.0106417
15-89392905-C-G p.Pro657Ala missense ACAN 2 81488 2.45435E-5 40744 0 4.04747E-6
15-89392911-C-G p.Gln659Glu missense ACAN 10 81458 1.22763E-4 40729 0 3.35983E-4
15-89392912-A-G p.Gln659Arg missense ACAN 4 81440 4.91159E-5 40720 0 4.04793E-5
15-89392915-C-T p.Thr660Met missense ACAN 7 81382 8.60141E-5 40691 0 8.5118E-5
15-89392919-C-T p.Gly661Gly synonymous ACAN 1 81286 1.23022E-5 40643 0 8.51267E-6
15-89392921-T-G p.Leu662Arg missense ACAN 2 81290 2.46033E-5 40645 0 1.70164E-5
15-89392931-A-G p.Pro665Pro synonymous ACAN 1 81166 1.23204E-5 40583 0 NA
15-89392938-C-T p.Arg668Trp missense ACAN 3 81068 3.7006E-5 40534 0 6.89409E-5
15-89392939-G-A p.Arg668Gln missense ACAN 465 81000 0.00574074 40500 8 0.0106701
15-89392960-G-A p.Arg675Gln missense+splice_region ACAN 45 80706 5.57579E-4 40353 1 7.96128E-4
15-89392970-G-C p.Gln678His missense ACAN 1074 80516 0.013339 40258 12 0.014874
15-89392971-C-G p.Pro679Ala missense ACAN 2 80524 2.48373E-5 40262 0 NA
15-89392987-A-T p.Asn684Ile missense ACAN 1 80294 1.24542E-5 40147 0 3.18451E-5
15-89393003-G-GGA p.Thr692fs frameshift ACAN 2 79800 2.50627E-5 39900 0 6.15593E-5
15-89393013-C-A p.Pro693Thr missense ACAN 40 79348 5.04108E-4 39674 0 5.578E-4
15-89393014-C-T p.Pro693Leu missense ACAN 1 79354 1.26018E-5 39677 0 4.90971E-6
15-89393026-C-T p.Pro697Leu missense ACAN 1 79034 1.26528E-5 39517 0 1.65184E-5
15-89393027-G-A p.Pro697Pro synonymous ACAN 1 78986 1.26605E-5 39493 0 2.93358E-5
15-89393029-A-C p.Asp698Ala missense ACAN 1 78900 1.26743E-5 39450 0 NA
15-89393030-T-C p.Asp698Asp synonymous ACAN 1 78886 1.26765E-5 39443 0 1.59215E-4
15-89393041-C-T p.Thr702Ile missense ACAN 1 78708 1.27052E-5 39354 0 6.0598E-6
15-89393049-C-T p.Pro705Ser missense ACAN 1 78614 1.27204E-5 39307 0 NA
15-89393062-G-A p.Ser709Asn missense ACAN 1 78244 1.27805E-5 39122 0 NA
15-89393065-A-T p.Lys710Met missense ACAN 1 78206 1.27867E-5 39103 0 NA
15-89393067-A-T p.Lys711* stop_gained ACAN 142 78184 0.00181623 39092 0 0.00337558
15-89393080-C-G p.Pro715Arg missense ACAN 23 77676 2.96102E-4 38838 0 8.31517E-4
15-89393084-G-A p.Leu716Leu synonymous ACAN 1 77374 1.29242E-5 38687 0 3.18431E-5
15-89395034-C-T p.Ala679Val missense ACAN 2 82332 2.42919E-5 41166 0 5.3952E-5
15-89395035-G-A p.Ala679Ala synonymous ACAN 24 82374 2.91354E-4 41187 0 0.004375
15-89395036-G-T p.Val680Phe missense ACAN 3 82382 3.64157E-5 41191 0 3.18593E-5
15-89395041-T-C p.Pro681Pro synonymous ACAN 1 82416 1.21336E-5 41208 0 6.74066E-5
15-89395055-A-G p.Glu686Gly missense ACAN 1 82540 1.21153E-5 41270 0 NA
15-89395059-G-A p.Glu687Glu synonymous ACAN 8 82560 9.68992E-5 41280 0 4.86997E-5
15-89395062-T-A p.Gly688Gly synonymous ACAN 1 82560 1.21124E-5 41280 0 NA
15-89395078-C-A p.Pro694Thr missense ACAN 1 82618 1.21039E-5 41309 0 NA
15-89395084-G-T p.Gly696Cys missense ACAN 1 82620 1.21036E-5 41310 0 NA
15-89395098-G-T p.Trp700Cys missense ACAN 1 82624 1.2103E-5 41312 0 NA
15-89395102-G-A p.Val702Met missense ACAN 1 82612 1.21048E-5 41306 0 3.18674E-5
15-89395111-G-A p.Val705Met missense ACAN 1 82620 1.21036E-5 41310 0 NA
15-89395119-T-C p.Pro707Pro synonymous ACAN 2 82628 2.42049E-5 41314 0 9.56206E-5
15-89395120-G-A p.Gly708Ser missense ACAN 292 82626 0.003534 41313 2 0.00726763
15-89395120-G-C p.Gly708Arg missense ACAN 4 82628 4.84097E-5 41314 0 2.13634E-5
15-89395123-G-C p.Val709Leu missense ACAN 1 82616 1.21042E-5 41308 0 NA
15-89395129-G-A p.Ala711Thr missense ACAN 1 82578 1.21098E-5 41289 0 NA
15-89395137-C-T p.Pro713Pro synonymous ACAN 2 82522 2.4236E-5 41261 0 0.0020141
15-89395138-G-A p.Val714Ile missense ACAN 2 82526 2.42348E-5 41263 0 2.08117E-5
15-89395151-C-T p.Thr718Ile missense ACAN 1 82552 1.21136E-5 41276 0 NA
15-89395152-A-G p.Thr718Thr synonymous ACAN 2 82564 2.42236E-5 41282 0 6.37918E-5
15-89395159-G-A p.Val721Ile missense ACAN 1 82574 1.21103E-5 41287 0 1.62422E-5
15-89395173-G-A p.Glu725Glu synonymous ACAN 1 82598 1.21068E-5 41299 0 1.00762E-5
15-89395179-T-G p.Thr727Thr synonymous ACAN 1 82602 1.21062E-5 41301 0 NA
15-89395180-G-A p.Ala728Thr missense ACAN 1 82600 1.21065E-5 41300 0 NA
15-89395185-C-T p.Ile729Ile synonymous ACAN 1 82606 1.21057E-5 41303 0 NA
15-89395194-C-A p.Phe732Leu missense ACAN 2 82588 2.42166E-5 41294 0 3.09751E-5
15-89395200-C-T p.Thr734Thr synonymous ACAN 3 82586 3.63258E-5 41293 0 0.00100705
15-89395201-G-A p.Glu735Lys missense ACAN 20 82602 2.42125E-4 41301 0 6.25E-4
15-89395209-A-C p.Glu737Asp missense ACAN 1 82644 1.21001E-5 41322 0 4.07143E-6
15-89395216-A-T p.Thr740Ser missense ACAN 10 82634 1.21016E-4 41317 0 7.74662E-5
15-89395243-GT-G p.Val749fs frameshift ACAN 1 82568 1.21112E-5 41284 0 NA
15-89395245-G-A p.Val749Val synonymous ACAN 230 82538 0.0027866 41269 3 0.00855584
15-89395255-C-A p.Pro753Thr missense ACAN 1 82436 1.21306E-5 41218 0 3.18857E-5
15-89395256-C-T p.Pro753Leu missense ACAN 2 82432 2.42624E-5 41216 0 1.27551E-4
15-89395257-G-A p.Pro753Pro synonymous ACAN 7 82354 8.49989E-5 41177 0 9.42566E-5
15-89395257-G-T p.Pro753Pro synonymous ACAN 1 82354 1.21427E-5 41177 0 NA
15-89395259-T-C p.Leu754Pro missense ACAN 5 82334 6.07283E-5 41167 0 5.61617E-4
15-89395260-G-A p.Leu754Leu synonymous ACAN 1 82264 1.2156E-5 41132 0 3.26723E-5
15-89395268-G-A c.2266+4G>A splice_region ACAN 1 82210 1.2164E-5 41105 0 NA
15-89398077-C-T c.2267-6C>T splice_region ACAN 5 79012 6.32815E-5 39506 0 NA
15-89398096-T-A p.Thr760Thr synonymous ACAN 20 80054 2.49831E-4 40027 0 0.00153522
15-89398105-C-T p.Pro763Pro synonymous ACAN 41670 78122 0.533396 39061 11795 0.55738
15-89398108-T-C p.Thr764Thr synonymous ACAN 3 80342 3.73404E-5 40171 0 NA
15-89398109-G-T p.Gly765Cys missense ACAN 1 80352 1.24452E-5 40176 0 NA
15-89398111-C-T p.Gly765Gly synonymous ACAN 9 80232 1.12175E-4 40116 0 0.00100705
15-89398112-G-A p.Ala766Thr missense ACAN 1 80174 1.24729E-5 40087 0 5.38837E-5
15-89398113-C-T p.Ala766Val missense ACAN 2 80414 2.48713E-5 40207 0 NA
15-89398123-G-A p.Glu769Glu synonymous ACAN 41 81122 5.05412E-4 40561 1 0.00224052
15-89398150-T-A p.Thr778Thr synonymous ACAN 1 82098 1.21806E-5 41049 0 NA
15-89398152-A-C p.Glu779Ala missense ACAN 1 82162 1.21711E-5 41081 0 NA
15-89398161-C-T p.Ser782Phe missense ACAN 1 82278 1.21539E-5 41139 0 3.18532E-5
15-89398167-C-T p.Ser784Leu missense ACAN 6 82316 7.28898E-5 41158 0 4.04957E-5
15-89398168-A-C p.Ser784Ser synonymous ACAN 1 82318 1.2148E-5 41159 0 4.49305E-6
15-89398172-G-A p.Glu786Lys missense ACAN 3 82340 3.64343E-5 41170 0 3.18796E-5
15-89398180-C-T p.Ser788Ser synonymous ACAN 1 82372 1.214E-5 41186 0 4.4924E-6
15-89398195-A-G p.Pro793Pro synonymous ACAN 1 82436 1.21306E-5 41218 0 NA
15-89398206-A-G p.Glu797Gly missense ACAN 330 82472 0.00400136 41236 2 0.0085211
15-89398210-G-GCCATCCCCCTCAGAGGAA p.Ser800_Pro805dup disruptive_inframe_insertion ACAN 1 82446 1.21292E-5 41223 0 NA
15-89398213-A-C p.Pro799Pro synonymous ACAN 1 82456 1.21277E-5 41228 0 NA
15-89398217-C-G p.Pro801Ala missense ACAN 2 82460 2.42542E-5 41230 0 NA
15-89398228-ACCATTCCCCTCAGTGAGG-A p.Arg810_Val815del conservative_inframe_deletion ACAN 1 82462 1.21268E-5 41231 0 NA
15-89398234-C-T p.Phe806Phe synonymous ACAN 3 82472 3.6376E-5 41236 0 NA
15-89398259-G-A p.Val815Met missense ACAN 1 82486 1.21233E-5 41243 0 3.18878E-5
15-89398266-T-C p.Leu817Pro missense ACAN 45 82472 5.4564E-4 41236 0 3.8283E-4
15-89398277-GAGGAGCCATTCCCCTCCA-G p.Phe824_Pro829del disruptive_inframe_deletion ACAN 1 82466 1.21262E-5 41233 0 1.17165E-5
15-89398287-T-C p.Phe824Ser missense ACAN 1 82454 1.2128E-5 41227 0 NA
15-89398297-G-A p.Lys827Lys synonymous ACAN 2 82426 2.42642E-5 41213 0 NA
15-89398299-A-G p.Glu828Gly missense ACAN 11 82422 1.3346E-4 41211 0 2.48307E-4
15-89398306-C-T p.Ser830Ser synonymous ACAN 1 82442 1.21297E-5 41221 0 2.22445E-5
15-89398317-A-C p.Glu834Ala missense ACAN 2 82450 2.42571E-5 41225 0 NA
15-89398318-A-T p.Glu834Asp missense ACAN 1 82430 1.21315E-5 41215 0 NA
15-89398330-G-A p.Ser838Ser synonymous ACAN 64199 79038 0.812255 39519 26367 0.870091
15-89398330-G-T p.Ser838Ser synonymous ACAN 3 82378 3.64175E-5 41189 0 1.42061E-4
15-89398338-C-T p.Pro841Leu missense ACAN 2 82366 2.42819E-5 41183 0 0.00100705
15-89398339-G-A p.Pro841Pro synonymous ACAN 28 82348 3.4002E-4 41174 0 4.77981E-4
15-89398344-C-G p.Thr843Arg missense ACAN 2 82358 2.42842E-5 41179 0 2.63899E-5
15-89398347-C-G p.Pro844Arg missense ACAN 1 82356 1.21424E-5 41178 0 NA
15-89398352-C-G p.Pro846Ala missense ACAN 5 82314 6.0743E-5 41157 0 NA
15-89398354-C-T p.Pro846Pro synonymous ACAN 1 82326 1.21468E-5 41163 0 8.7509E-6
15-89398357-C-T p.Pro847Pro synonymous ACAN 106 82314 0.00128775 41157 0 0.00337094
15-89398358-G-A p.Val848Met missense ACAN 25 82314 3.03715E-4 41157 0 5.03525E-4
15-89398360-G-A p.Val848Val synonymous ACAN 5 82298 6.07548E-5 41149 0 3.18552E-5
15-89398364-A-G p.Ser850Gly missense ACAN 128 82284 0.00155559 41142 0 0.00372683
15-89398375-G-C p.Glu853Asp missense ACAN 12 82188 1.46007E-4 41094 0 5.03525E-4
15-89398388-G-A p.Gly858Arg missense ACAN 4 82074 4.87365E-5 41037 0 0.00125
15-89398407-C-T p.Pro864Leu missense ACAN 13090 81022 0.161561 40511 1117 0.157646
15-89398410-A-ATGT p.Val866dup disruptive_inframe_insertion ACAN 2 81720 2.44738E-5 40860 0 3.18512E-5
15-89398418-G-A p.Gly868Ser missense ACAN 1 81562 1.22606E-5 40781 0 NA
15-89398419-G-A p.Gly868Asp missense ACAN 3 81536 3.67936E-5 40768 0 2.04065E-5
15-89398446-C-T p.Ser877Leu missense ACAN 1 81212 1.23135E-5 40606 0 NA
15-89398449-G-A p.Gly878Glu missense ACAN 3 81194 3.69485E-5 40597 0 3.18532E-5
15-89398464-G-A p.Ser883Asn missense ACAN 1 81198 1.23156E-5 40599 0 NA
15-89398468-G-A p.Gly884Gly synonymous ACAN 1 81182 1.2318E-5 40591 0 NA
15-89398479-G-T p.Gly888Val missense ACAN 2 81302 2.45996E-5 40651 0 NA
15-89398490-A-G p.Ser892Gly missense ACAN 2 81452 2.45543E-5 40726 0 1.20795E-5
15-89398501-C-G p.Pro895Pro synonymous ACAN 10 81604 1.22543E-4 40802 0 4.4261E-5
15-89398520-A-G p.Ser902Gly missense ACAN 1 81886 1.22121E-5 40943 0 NA
15-89398524-G-A p.Gly903Asp missense ACAN 2 81904 2.44188E-5 40952 0 6.37024E-5
15-89398525-T-A p.Gly903Gly synonymous ACAN 29 81936 3.53935E-4 40968 0 1.52749E-4
15-89398553-C-A p.Pro913Thr missense ACAN 7647 81956 0.0933062 40978 400 0.10323
15-89398561-A-G p.Glu915Glu synonymous ACAN 1 82272 1.21548E-5 41136 0 9.55657E-5
15-89398564-T-A p.Ser916Arg missense ACAN 3 82310 3.64476E-5 41155 0 1.66011E-5
15-89398566-G-GACT p.Leu918dup disruptive_inframe_insertion ACAN 1 82316 1.21483E-5 41158 0 NA
15-89398574-T-C p.Ser920Pro missense ACAN 4 82366 4.85637E-5 41183 0 4.01494E-6
15-89398576-A-G p.Ser920Ser synonymous ACAN 1 82414 1.21339E-5 41207 0 8.29931E-6
15-89398578-G-T p.Gly921Val missense ACAN 1 82404 1.21353E-5 41202 0 8.29931E-6
15-89398586-G-A p.Glu924Lys missense ACAN 3 82462 3.63804E-5 41231 0 NA
15-89398601-C-T p.Pro929Ser missense ACAN 1 82534 1.21162E-5 41267 0 1.00381E-4
15-89398605-G-T p.Ser930Ile missense ACAN 44161 78630 0.56163 39315 12454 0.584089
15-89398610-C-T p.Pro932Ser missense ACAN 1 82580 1.21095E-5 41290 0 4.01487E-6
15-89398614-C-T p.Thr933Met missense ACAN 9 82600 1.08959E-4 41300 0 6.02284E-5
15-89398615-G-A p.Thr933Thr synonymous ACAN 4 82598 4.84273E-5 41299 0 5.80422E-5
15-89398631-T-A p.Ser939Thr missense ACAN 42288 78404 0.53936 39202 11581 0.559919
15-89398634-G-A p.Gly940Arg missense ACAN 1 82668 1.20966E-5 41334 0 3.18451E-5
15-89398645-CCTAGAGGGCTCTGCCTCTGGAGTTGGGGATCTCAGTGGACTTCCTTCTGGAGAAGTT-C p.Gly946_Glu964del conservative_inframe_deletion ACAN 11 82696 1.33017E-4 41348 0 3.18512E-5
15-89398652-G-T p.Gly946Cys missense ACAN 1 82714 1.20899E-5 41357 0 8.29036E-6
15-89398658-G-C p.Ala948Pro missense ACAN 7 82724 8.46187E-5 41362 0 3.72986E-4
15-89398659-C-T p.Ala948Val missense ACAN 34 82722 4.11015E-4 41361 0 0.001875
15-89398665-G-T p.Gly950Val missense ACAN 1 82738 1.20863E-5 41369 0 NA
15-89398665-G-C p.Gly950Ala missense ACAN 1 82738 1.20863E-5 41369 0 NA
15-89398710-C-T p.Thr965Ile missense ACAN 1 82758 1.20834E-5 41379 0 4.01152E-6
15-89398712-T-A p.Ser966Thr missense ACAN 3 82758 3.62503E-5 41379 0 3.19632E-5
15-89398718-T-C p.Ser968Pro missense ACAN 10 82752 1.20843E-4 41376 0 6.27353E-4
15-89398728-G-A p.Gly971Glu missense ACAN 2 82742 2.41715E-5 41371 0 3.31625E-5
15-89398729-A-G p.Gly971Gly synonymous ACAN 2 82744 2.41709E-5 41372 0 1.80686E-4
15-89398733-CTCAGTGGGCTTCCTTCTGGAGAAGTTCTAGAGACCACTGCCCCTGGAGTAGAGGACA-C p.Gly975_Ser993del disruptive_inframe_deletion ACAN 4 82736 4.83465E-5 41368 0 7.4638E-4
15-89398733-C-A p.Leu973Ile missense ACAN 1 82736 1.20866E-5 41368 0 3.31724E-5
15-89398733-C-T p.Leu973Phe missense ACAN 1 82744 1.20855E-5 41372 0 NA
15-89398734-T-C p.Leu973Pro missense ACAN 3 82738 3.6259E-5 41369 0 6.26566E-4
15-89398738-T-C p.Ser974Ser synonymous ACAN 19 82722 2.29685E-4 41361 0 0.00100705
15-89398745-C-T p.Pro977Ser missense ACAN 1 82694 1.20928E-5 41347 0 5.81251E-5
15-89398752-G-T p.Gly979Val missense ACAN 3 82654 3.62959E-5 41327 0 8.31324E-5
15-89398756-A-G p.Glu980Glu synonymous ACAN 8 82616 9.68335E-5 41308 0 4.99052E-5
15-89398763-G-C p.Glu983Gln missense ACAN 13 82536 1.57507E-4 41268 0 6.58377E-4
15-89398768-C-T p.Thr984Thr synonymous ACAN 16 82266 1.94491E-4 41133 0 0.00110358
15-89398769-A-G p.Thr985Ala missense ACAN 13 82230 1.58093E-4 41115 0 0.0022598
15-89398771-T-C p.Thr985Thr synonymous ACAN 8 82406 9.70803E-5 41203 0 0.00251762
15-89398781-G-A p.Val989Ile missense ACAN 8 82096 9.74469E-5 41048 0 1.28287E-4
15-89398781-G-C p.Val989Leu missense ACAN 1 82096 1.21809E-5 41048 0 NA
15-89398795-C-T p.Ser993Ser synonymous ACAN 1 80592 1.24082E-5 40296 0 0.00100806
15-89398796-G-A p.Gly994Arg missense ACAN 4 80280 4.98256E-5 40140 0 1.32433E-4
15-89398800-T-C p.Leu995Pro missense ACAN 1 79102 1.26419E-5 39551 0 NA
15-89398805-T-G p.Ser997Ala missense ACAN 4 77418 5.16676E-5 38709 0 1.94704E-4
15-89398807-TG-T p.Gly998fs frameshift ACAN 1 76688 1.30398E-5 38344 0 NA
15-89398816-T-C p.Val1000Val synonymous ACAN 1 72352 1.38213E-5 36176 0 NA
15-89398820-G-C p.Glu1002Gln missense ACAN 5 68540 7.29501E-5 34270 0 1.49352E-5
15-89398822-GACC-G p.Thr1004del disruptive_inframe_deletion ACAN 1 65888 1.51773E-5 32944 0 0.0017604
15-89398823-A-G p.Thr1003Ala missense ACAN 1 64418 1.55236E-5 32209 0 NA
15-89398825-C-T p.Thr1003Thr synonymous ACAN 12284 46994 0.261395 23497 2969 0.594706
15-89398825-C-A p.Thr1003Thr synonymous ACAN 45 61072 7.36835E-4 30536 2 0.00652247
15-89398826-A-G p.Thr1004Ala missense ACAN 60 59006 0.00101685 29503 2 0.0914679
15-89398831-C-T p.Ala1005Ala synonymous ACAN 24 49808 4.8185E-4 24904 0 0.00253807
15-89398863-C-G p.Ser1016Cys missense ACAN 1 23282 4.29516E-5 11641 0 NA
15-89398882-C-T p.Thr1022Thr synonymous ACAN 1 2248 4.4484E-4 1124 0 0.5
15-89399966-G-A p.Ala1384Thr missense ACAN 1 42162 2.3718E-5 21081 0 0.0428254
15-89399966-GCTGCCCCTGGAGTAGAGGACATCAGCGGGCTTCCTTCTGGAGAAGTTCTAGAGACTA-G p.Asp1390_Glu1408del disruptive_inframe_deletion ACAN 93 44094 0.00210913 22047 14 0.0257843
15-89399966-G-GCTGCCCCTGGAGTAGAGGACATCAGCGGGCTTCCTTCTGGAGAAGTTCTAGAGACTA p.Asp1390_Glu1408dup disruptive_inframe_insertion ACAN 5 43814 1.14119E-4 21907 0 0.00226731
15-89399966-GCTGCCCCTGGAGTAGAGGACATCAGCGGGCTTCCTTCTGGAGAAGTTCTAGAGACTACTGCCCCTGGAGTAGAGGAGATCAGCGGGCTTCCTTCTGGAGAAGTTCTAGAGACTACTGCCCCTGGAGTAGATGAGATCAGTGGGCTTCCTTCTGGAGAAGTTCTAGAGACTA-G p.Asp1390_Glu1446del disruptive_inframe_deletion ACAN 9 44206 2.03592E-4 22103 0 3.91338E-4
15-89399986-C-G p.Asp1390Glu missense ACAN 4 53294 7.50554E-5 26647 0 0.0761628
15-89399986-C-CATCAGCGGGCTTCCTTCTGGAGAAGTTCTAGAGACTACTGCCCCTGGAGTAGATGAG p.Val1407_Glu1408insAspGluIleSerGlyLeuProSerGlyGluValLeuGluThrThrAlaProGlyVal disruptive_inframe_insertion ACAN 2 54046 3.70055E-5 27023 0 1.18483E-5
15-89399986-CATCAGCGGGCTTCCTTCTGGAGAAGTTCTAGAGACTACTGCCCCTGGAGTAGAGGAG-C p.Glu1408_Val1426del disruptive_inframe_deletion ACAN 8 54020 1.48093E-4 27010 0 0.0292085
15-89399986-CATCAGCGGGCTTCCTTCTGGAGAAGTTCTAGAGACTACTGCCCCTGGAGTAGAGGAGATCAGCGGGCTTCCTTCTGGAGAAGTTCTAGAGACTACTGCCCCTGGAGTAGATGAGATCAGTGGGCTTCCTTCTGGAGAAGTTCTAGAGACTACTGCCCCTGGAGTAGAGGAG-C p.Thr1403_Thr1459del conservative_inframe_deletion ACAN 4 53770 7.43909E-5 26885 0 0.00123609
15-89399992-CGGGCTTCCTTCTGGAGAAGTTCTAGAGACTACTGCCCCTGGAGTAGAGGAGATCAGCGGGCTTCCTTCTGGAGAAGTTCTAGAGACTACTGCCCCTGGAGTAGATGAGATCAGT-C p.Thr1422_Thr1459del conservative_inframe_deletion ACAN 26 58042 4.47951E-4 29021 0 0.00342551
15-89400022-TAC-T p.Thr1403fs frameshift ACAN 2 77296 2.58746E-5 38648 0 NA
15-89400023-A-G p.Thr1403Ala missense ACAN 564 37900 0.0148813 18950 13 0.376089
15-89400040-G-T p.Glu1408Asp missense ACAN 1 80476 1.24261E-5 40238 0 0.00900424
15-89400043-G-C p.Glu1409Asp missense ACAN 645 74010 0.00871504 37005 0 0.0989418
15-89400080-A-G p.Thr1422Ala missense ACAN 332 81582 0.00406953 40791 2 0.025227
15-89400091-A-C p.Gly1425Gly synonymous ACAN 1 82120 1.21773E-5 41060 0 NA
15-89400097-TGAGATCAGTGGGCTTCCTTCTGGAGAAGTTCTAGAGACTACTGCCCCTGGAGTAGAG-T p.Gly1431_Ser1449del disruptive_inframe_deletion ACAN 2 82164 2.43416E-5 41082 0 1.67628E-5
15-89400097-T-G p.Asp1427Glu missense ACAN 6 82128 7.30567E-5 41064 0 0.001287
15-89400106-T-C p.Ser1430Ser synonymous ACAN 49 82082 5.96964E-4 41041 1 0.0287009
15-89400109-G-T p.Gly1431Gly synonymous ACAN 1 82250 1.21581E-5 41125 0 5.03525E-4
15-89400136-T-A p.Thr1440Thr synonymous ACAN 1 82430 1.21315E-5 41215 0 NA
15-89400136-T-C p.Thr1440Thr synonymous ACAN 1 82430 1.21315E-5 41215 0 8.30413E-6
15-89400137-A-G p.Thr1441Ala missense ACAN 14 82360 1.69985E-4 41180 0 0.00811688
15-89400154-G-C p.Glu1446Asp missense ACAN 5 82562 6.05605E-5 41281 0 1.60501E-5
15-89400157-G-C p.Glu1447Asp missense ACAN 2 82550 2.42277E-5 41275 0 0.00106291
15-89400163-C-T p.Ser1449Ser synonymous ACAN 74 82610 8.95775E-4 41305 1 0.00189155
15-89400166-G-GCTTCCTTCTGGAGAAGTTCTAGAGACTTCTACCTCTGCGGTAGGGGACCTCAGTGGA p.Glu1455_Gly1473dup disruptive_inframe_insertion ACAN 2 82664 2.41943E-5 41332 0 NA
15-89400166-GCTTCCTTCTGGAGAAGTTCTAGAGACTTCTACCTCTGCGGTAGGGGACCTCAGTGGA-G p.Glu1455_Gly1473del disruptive_inframe_deletion ACAN 3 82662 3.62924E-5 41331 0 5.05628E-4
15-89400168-T-C p.Leu1451Pro missense ACAN 1 82688 1.20937E-5 41344 0 NA
15-89400178-A-G p.Gly1454Gly synonymous ACAN 1 82728 1.20878E-5 41364 0 NA
15-89400179-G-A p.Glu1455Lys missense ACAN 1 82726 1.20881E-5 41363 0 8.2905E-6
15-89400194-T-G p.Ser1460Ala missense ACAN 1 82756 1.20837E-5 41378 0 4.97413E-5
15-89400197-A-G p.Thr1461Ala missense ACAN 1 82762 1.20828E-5 41381 0 5.80537E-5
15-89400198-C-T p.Thr1461Ile missense ACAN 3 82768 3.62459E-5 41384 0 6.37227E-5
15-89400200-T-C p.Ser1462Pro missense ACAN 1 82772 1.20814E-5 41386 0 4.97356E-5
15-89400203-G-A p.Ala1463Thr missense ACAN 1 82768 1.2082E-5 41384 0 NA
15-89400204-C-T p.Ala1463Val missense ACAN 7 82772 8.45697E-5 41386 0 0.0018797
15-89400204-C-G p.Ala1463Gly missense ACAN 1 82772 1.20814E-5 41386 0 4.97587E-5
15-89400205-G-A p.Ala1463Ala synonymous ACAN 4 82772 4.83255E-5 41386 0 1.07796E-4
15-89400205-G-C p.Ala1463Ala synonymous ACAN 2 82772 2.41628E-5 41386 0 2.4876E-5
15-89400206-G-A p.Val1464Ile missense ACAN 1 82774 1.20811E-5 41387 0 NA
15-89400212-G-T p.Asp1466Tyr missense ACAN 1 82774 1.20811E-5 41387 0 NA
15-89400217-C-T p.Leu1467Leu synonymous ACAN 3 82784 3.62389E-5 41392 0 4.97133E-5
15-89400221-G-C p.Gly1469Arg missense ACAN 2 82784 2.41593E-5 41392 0 4.012E-6
15-89400223-ACTTCCTTCTGGAGGAGAAGTTCTAGAGATTTCTGTCTCTGGAGTAGAGGACATCAGTGGG-A p.Gly1474_Gly1493del disruptive_inframe_deletion ACAN 5 82784 6.03981E-5 41392 0 9.63639E-5
15-89400236-G-A p.Gly1474Arg missense ACAN 2 82780 2.41604E-5 41390 0 1.65648E-5
15-89400241-A-C p.Glu1475Asp missense ACAN 4 82770 4.83267E-5 41385 0 4.41296E-5
15-89400245-C-G p.Leu1477Val missense ACAN 1 82764 1.20825E-5 41382 0 9.11064E-5
15-89400251-A-G p.Ile1479Val missense ACAN 3 82758 3.62503E-5 41379 0 5.03525E-4
15-89400254-T-A p.Ser1480Thr missense ACAN 2 82756 2.41674E-5 41378 0 8.0251E-6
15-89400259-C-G p.Val1481Val synonymous ACAN 3 82760 3.62494E-5 41380 0 3.21295E-5
15-89400263-G-GGA p.Val1484fs frameshift ACAN 1 82756 1.20837E-5 41378 0 NA
15-89400266-GTAGAGGACATCAGTGGGCTTCCTTCTGGAGAGGTTGTAGAGACTTCTGCCTCTGGAA-G p.Ile1487_Asp1505del disruptive_inframe_deletion ACAN 1 82756 1.20837E-5 41378 0 4.01194E-6
15-89400274-C-G p.Asp1486Glu missense ACAN 1 82746 1.20852E-5 41373 0 0.00187735
15-89400275-A-G p.Ile1487Val missense ACAN 1 82748 1.20849E-5 41374 0 NA
15-89400287-C-T p.Pro1491Ser missense ACAN 2 82732 2.41744E-5 41366 0 8.28253E-6
15-89400302-G-A p.Val1496Ile missense ACAN 6 82702 7.25496E-5 41351 0 0.00250313
15-89400316-C-T p.Ala1500Ala synonymous ACAN 1 82696 1.20925E-5 41348 0 NA
15-89400328-G-A p.Glu1504Glu synonymous ACAN 1 82690 1.20934E-5 41345 0 6.37267E-5
15-89400339-A-C p.Glu1508Ala missense ACAN 46398 82066 0.565374 41033 13664 0.575025
15-89400339-AAC-CAT p.GluLeu1508AlaPhe missense ACAN 53 82642 6.4132E-4 41321 1 NA
15-89400341-C-T p.Leu1509Phe missense ACAN 134 82638 0.00162153 41319 0 0.00245364
15-89400348-C-T p.Ser1511Leu missense ACAN 1 82638 1.2101E-5 41319 0 NA
15-89400350-G-A p.Gly1512Arg missense ACAN 1 82640 1.21007E-5 41320 0 4.01233E-6
15-89400351-GAGA-G p.Glu1513del disruptive_inframe_deletion ACAN 2 82628 2.42049E-5 41314 0 NA
15-89400380-G-T p.Val1522Leu missense ACAN 1 82606 1.21057E-5 41303 0 NA
15-89400385-G-A p.Glu1523Glu synonymous ACAN 1 82616 1.21042E-5 41308 0 4.01339E-6
15-89400421-A-G p.Leu1535Leu synonymous ACAN 1 82558 1.21127E-5 41279 0 3.18735E-5
15-89400421-A-C p.Leu1535Leu synonymous ACAN 2 82556 2.4226E-5 41278 0 2.00797E-5
15-89400425-A-T p.Ile1537Phe missense ACAN 1 82546 1.21145E-5 41273 0 NA
15-89400433-C-T p.Ala1539Ala synonymous ACAN 1 82542 1.2115E-5 41271 0 NA
15-89400445-G-A p.Gly1543Gly synonymous ACAN 2 82518 2.42371E-5 41259 0 3.18654E-5
15-89400455-G-A p.Gly1547Arg missense ACAN 7 82500 8.48485E-5 41250 0 6.25E-4
15-89400470-G-A p.Gly1552Arg missense ACAN 1 82476 1.21247E-5 41238 0 NA
15-89400471-GAGA-G p.Glu1553del disruptive_inframe_deletion ACAN 1 82458 1.21274E-5 41229 0 NA
15-89400472-A-G p.Gly1552Gly synonymous ACAN 1 82462 1.21268E-5 41231 0 8.03174E-6
15-89400477-G-T p.Gly1554Val missense ACAN 1 82462 1.21268E-5 41231 0 4.01629E-6
15-89400477-G-A p.Gly1554Asp missense ACAN 1 82462 1.21268E-5 41231 0 3.18796E-5
15-89400478-T-C p.Gly1554Gly synonymous ACAN 3 82454 3.63839E-5 41227 0 4.01594E-6
15-89400483-A-T p.Glu1556Val missense ACAN 6 82460 7.27626E-5 41230 0 5.03525E-4
15-89400491-G-C p.Ala1559Pro missense ACAN 1 82444 1.21294E-5 41222 0 4.01474E-6
15-89400506-ACTGACCTCAGTGGGCTTCCTT-A p.Asp1565_Ser1571del disruptive_inframe_deletion ACAN 33 82364 4.0066E-4 41182 1 1.9232E-4
15-89400511-C-G p.Asp1565Glu missense ACAN 2 82362 2.4283E-5 41181 0 6.37714E-5
15-89400520-G-T p.Gly1568Gly synonymous ACAN 1 82346 1.21439E-5 41173 0 NA
15-89400525-C-T p.Pro1570Leu missense ACAN 4 82366 4.85637E-5 41183 0 6.3678E-5
15-89400535-G-A p.Arg1573Arg synonymous ACAN 1 82356 1.21424E-5 41178 0 NA
15-89400538-G-A p.Glu1574Glu synonymous ACAN 1 82368 1.21406E-5 41184 0 NA
15-89400539-G-C p.Gly1575Arg missense ACAN 2 82360 2.42836E-5 41180 0 NA
15-89400540-G-A p.Gly1575Asp missense ACAN 1 82366 1.21409E-5 41183 0 1.65703E-5
15-89400554-G-C p.Ala1580Pro missense ACAN 1 82354 1.21427E-5 41177 0 NA
15-89400561-G-A p.Gly1582Glu missense ACAN 2 82350 2.42866E-5 41175 0 9.22828E-5
15-89400564-C-G p.Ala1583Gly missense ACAN 1 82344 1.21442E-5 41172 0 4.01252E-6
15-89400565-T-G p.Ala1583Ala synonymous ACAN 1 82342 1.21445E-5 41171 0 8.28226E-6
15-89400571-C-T p.Asp1585Asp synonymous ACAN 363 82308 0.00441026 41154 11 0.0139428
15-89400584-C-T p.Pro1590Ser missense ACAN 7 82266 8.50898E-5 41133 0 2.24714E-4
15-89400589-T-C p.Ser1591Ser synonymous ACAN 2 82276 2.43084E-5 41138 0 8.28157E-6
15-89400610-G-A p.Gly1598Gly synonymous ACAN 3 82192 3.64999E-5 41096 0 NA
15-89400622-A-T p.Gly1602Gly synonymous ACAN 2 82138 2.43493E-5 41069 0 NA
15-89400625-C-T p.Asp1603Asp synonymous ACAN 1 82118 1.21776E-5 41059 0 NA
15-89400637-C-A p.Gly1607Gly synonymous ACAN 1 82038 1.21895E-5 41019 0 NA
15-89400641-C-G p.Leu1609Val missense ACAN 1 82058 1.21865E-5 41029 0 NA
15-89400643-G-A p.Leu1609Leu synonymous ACAN 1 82074 1.21841E-5 41037 0 1.65653E-5
15-89400646-T-C p.Pro1610Pro synonymous ACAN 2 82084 2.43653E-5 41042 0 NA
15-89400659-G-C p.Gly1615Arg missense ACAN 19 82092 2.31448E-4 41046 0 9.55292E-5
15-89400665-G-A p.Gly1617Arg missense ACAN 1 82110 1.21788E-5 41055 0 6.37024E-5
15-89400679-A-T p.Glu1621Asp missense ACAN 1 82244 1.21589E-5 41122 0 NA
15-89400680-A-G p.Thr1622Ala missense ACAN 4518 82146 0.0549996 41073 184 0.0855992
15-89400692-C-T p.Pro1626Ser missense ACAN 3 82304 3.64502E-5 41152 0 5.03525E-4
15-89400694-C-T p.Pro1626Pro synonymous ACAN 1 82342 1.21445E-5 41171 0 1.65659E-5
15-89400711-A-C p.Glu1632Ala missense ACAN 1 82392 1.21371E-5 41196 0 8.28226E-6
15-89400713-T-C p.Tyr1633His missense ACAN 10 82402 1.21356E-4 41201 0 3.31285E-5
15-89400728-C-T p.Leu1638Phe missense ACAN 1 82428 1.21318E-5 41214 0 NA
15-89400736-T-A p.Ser1640Arg missense ACAN 1 82418 1.21333E-5 41209 0 NA
15-89400746-T-G p.Ser1644Ala missense ACAN 1 82430 1.21315E-5 41215 0 NA
15-89400747-C-G p.Ser1644Cys missense ACAN 1 82434 1.21309E-5 41217 0 NA
15-89400756-C-T p.Pro1647Leu missense ACAN 1 82438 1.21303E-5 41219 0 NA
15-89400767-G-A p.Gly1651Arg missense ACAN 1 82434 1.21309E-5 41217 0 NA
15-89400777-C-G p.Ser1654Cys missense ACAN 1 82400 1.21359E-5 41200 0 8.28144E-6
15-89400788-A-G p.Thr1658Ala missense ACAN 3 82360 3.64254E-5 41180 0 8.28157E-6
15-89400791-G-C p.Val1659Leu missense ACAN 2 82334 2.42913E-5 41167 0 2.48447E-5
15-89400815-G-C p.Val1667Leu missense ACAN 1 82294 1.21516E-5 41147 0 3.18451E-5
15-89400828-C-G p.Thr1671Arg missense ACAN 1 82264 1.2156E-5 41132 0 NA
15-89400850-G-A p.Leu1678Leu synonymous ACAN 1 82400 1.21359E-5 41200 0 NA
15-89400867-T-C p.Ile1684Thr missense ACAN 1 82476 1.21247E-5 41238 0 NA
15-89400872-A-T p.Ile1686Phe missense ACAN 2 82500 2.42424E-5 41250 0 1.98728E-4
15-89400894-C-A p.Ser1693Tyr missense ACAN 4 82538 4.84625E-5 41269 0 4.81421E-5
15-89400894-C-T p.Ser1693Phe missense ACAN 2 82538 2.42313E-5 41269 0 NA
15-89400901-G-A p.Leu1695Leu synonymous ACAN 2 82498 2.4243E-5 41249 0 8.2802E-6
15-89400914-C-T p.Leu1700Leu synonymous ACAN 1 82544 1.21148E-5 41272 0 1.65615E-5
15-89400932-G-A p.Ala1706Thr missense ACAN 1 82520 1.21183E-5 41260 0 1.65615E-5
15-89400962-A-C p.Ser1716Arg missense ACAN 1 82448 1.21289E-5 41224 0 2.48439E-5
15-89400963-G-T p.Ser1716Ile missense ACAN 307 82440 0.00372392 41220 18 0.0163222
15-89400972-C-T p.Ala1719Val missense ACAN 1 82434 1.21309E-5 41217 0 8.28116E-6
15-89400976-T-G p.Ser1720Ser synonymous ACAN 1 82452 1.21283E-5 41226 0 3.18492E-5
15-89400981-C-G p.Ser1722Cys missense ACAN 4 82452 4.85131E-5 41226 0 3.18613E-5
15-89400985-T-C p.Pro1723Pro synonymous ACAN 1 82440 1.213E-5 41220 0 NA
15-89401002-T-C p.Ile1729Thr missense ACAN 1 82442 1.21297E-5 41221 0 NA
15-89401006-T-A p.Pro1730Pro synonymous ACAN 1 82444 1.21294E-5 41222 0 1.65634E-5
15-89401012-C-G p.Leu1732Leu synonymous ACAN 2 82444 2.42589E-5 41222 0 NA
15-89401030-G-A p.Gln1738Gln synonymous ACAN 1 82434 1.21309E-5 41217 0 NA
15-89401031-C-A p.Pro1739Thr missense ACAN 1 82428 1.21318E-5 41214 0 4.01162E-6
15-89401033-A-G p.Pro1739Pro synonymous ACAN 1 82428 1.21318E-5 41214 0 NA
15-89401037-G-C p.Gly1741Arg missense ACAN 4 82434 4.85237E-5 41217 0 NA
15-89401039-G-A p.Gly1741Gly synonymous ACAN 4 82422 4.85307E-5 41211 0 NA
15-89401040-T-C p.Phe1742Leu missense ACAN 3 82426 3.63963E-5 41213 0 8.28212E-6
15-89401053-G-A p.Ser1746Asn missense ACAN 1 82406 1.2135E-5 41203 0 8.28253E-6
15-89401062-C-T p.Thr1749Ile missense ACAN 2 82402 2.42713E-5 41201 0 8.28253E-6
15-89401069-A-G p.Gly1751Gly synonymous ACAN 3 82394 3.64104E-5 41197 0 1.65664E-5
15-89401079-C-A p.Leu1755Ile missense ACAN 1 82372 1.214E-5 41186 0 4.01191E-6
15-89401080-T-A p.Leu1755His missense ACAN 3 82374 3.64193E-5 41187 0 8.28295E-6
15-89401084-C-G p.Ser1756Arg missense ACAN 1 82342 1.21445E-5 41171 0 NA
15-89401085-G-A p.Gly1757Arg missense ACAN 3 82336 3.64361E-5 41168 0 6.62647E-5
15-89401109-A-G p.Ile1765Val missense ACAN 67470 82142 0.821382 41071 28037 0.871601
15-89401121-G-C p.Ala1769Pro missense ACAN 2 82260 2.43132E-5 41130 0 NA
15-89401133-C-A p.Leu1773Ile missense ACAN 6 82250 7.29483E-5 41125 0 6.25E-4
15-89401133-C-G p.Leu1773Val missense ACAN 1 82250 1.21581E-5 41125 0 3.18776E-5
15-89401134-T-C p.Leu1773Pro missense ACAN 76 82242 9.24102E-4 41121 0 8.60475E-4
15-89401136-T-G p.Tyr1774Asp missense ACAN 2 82222 2.43244E-5 41111 0 8.2905E-6
15-89401136-T-C p.Tyr1774His missense ACAN 1 82222 1.21622E-5 41111 0 4.01268E-6
15-89401137-A-G p.Tyr1774Cys missense ACAN 1 82220 1.21625E-5 41110 0 4.01249E-6
15-89401146-G-C p.Ser1777Thr missense ACAN 1 82236 1.21601E-5 41118 0 NA
15-89401169-C-G p.Leu1785Val missense ACAN 2 82284 2.43061E-5 41142 0 6.25E-4
15-89401184-T-A p.Ser1790Thr missense ACAN 144 82348 0.00174868 41174 0 0.00179125
15-89401198-T-C p.Asp1794Asp synonymous ACAN 11 82388 1.33515E-4 41194 0 0.00125
15-89401199-C-A p.Leu1795Ile missense ACAN 1 82388 1.21377E-5 41194 0 1.65876E-5
15-89401207-G-A p.Gly1797Gly synonymous ACAN 1 82398 1.21362E-5 41199 0 NA
15-89401216-A-G p.Ser1800Ser synonymous ACAN 3 82436 3.63919E-5 41218 0 1.65887E-5
15-89401217-G-C p.Gly1801Arg missense ACAN 1 82440 1.213E-5 41220 0 NA
15-89401234-T-G p.Ser1806Arg missense ACAN 1 82458 1.21274E-5 41229 0 8.29311E-6
15-89401235-G-A p.Gly1807Arg missense ACAN 1 82462 1.21268E-5 41231 0 1.65832E-5
15-89401237-G-A p.Gly1807Gly synonymous ACAN 1 82464 1.21265E-5 41232 0 NA
15-89401239-C-A p.Ala1808Glu missense ACAN 1 82474 1.2125E-5 41237 0 NA
15-89401258-C-T p.Asp1814Asp synonymous ACAN 1 82468 1.21259E-5 41234 0 8.29201E-6
15-89401259-C-T p.Leu1815Leu synonymous ACAN 3 82474 3.63751E-5 41237 0 NA
15-89401259-C-A p.Leu1815Met missense ACAN 1 82474 1.2125E-5 41237 0 NA
15-89401274-A-G p.Thr1820Ala missense ACAN 2 82476 2.42495E-5 41238 0 3.31631E-5
15-89401276-G-A p.Thr1820Thr synonymous ACAN 2 82474 2.42501E-5 41237 0 0.00100705
15-89401285-C-T p.Ser1823Ser synonymous ACAN 1 82458 1.21274E-5 41229 0 1.91217E-4
15-89401286-G-A p.Gly1824Ser missense ACAN 2 82458 2.42548E-5 41229 0 6.37308E-5
15-89401287-G-A p.Gly1824Asp missense ACAN 3 82456 3.6383E-5 41228 0 3.18573E-5
15-89401288-T-C p.Gly1824Gly synonymous ACAN 1 82442 1.21297E-5 41221 0 NA
15-89401295-T-G p.Ser1827Ala missense ACAN 1 82428 1.21318E-5 41214 0 8.28912E-6
15-89401297-T-C p.Ser1827Ser synonymous ACAN 1 82430 1.21315E-5 41215 0 1.27429E-4
15-89401308-T-A p.Phe1831Tyr missense ACAN 4 82388 4.85508E-5 41194 0 2.54988E-4
15-89401318-C-T p.Thr1834Thr synonymous ACAN 5 82360 6.07091E-5 41180 1 3.18695E-5
15-89401345-A-G p.Thr1843Thr synonymous ACAN 3 82292 3.64555E-5 41146 0 NA
15-89401348-TAAA-T p.Lys1845del conservative_inframe_deletion ACAN 1 82276 1.21542E-5 41138 0 3.18674E-5
15-89401349-AAAG-A p.Glu1848del disruptive_inframe_deletion ACAN 1 82286 1.21527E-5 41143 0 3.18532E-5
15-89401356-A-T p.Glu1847Val missense ACAN 2 82296 2.43025E-5 41148 0 8.28885E-6
15-89401362-G-T p.Gly1849Val missense ACAN 1007 82296 0.0122363 41148 39 0.0265188
15-89401369-G-C p.Gly1851Gly synonymous ACAN 1 82324 1.21471E-5 41162 0 8.28844E-6
15-89401379-C-T p.Leu1855Phe missense ACAN 123 82312 0.00149431 41156 0 0.006875
15-89401383-G-A p.Ser1856Asn missense ACAN 86 82314 0.00104478 41157 0 0.00140127
15-89401395-C-A p.Ser1860Tyr missense ACAN 1 82316 1.21483E-5 41158 0 8.28569E-6
15-89401397-G-A p.Gly1861Arg missense ACAN 5 82312 6.07445E-5 41156 0 6.36902E-5