Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
17-7120468-T-C p.Leu2Leu synonymous ACADVL 1 72228 1.3845E-5 36114 0 NA
17-7120473-G-A p.Gly3Gly synonymous ACADVL 1 72200 1.38504E-5 36100 0 3.72135E-5
17-7120478-T-C p.Leu5Pro missense ACADVL 46 72178 6.37313E-4 36089 0 0.00128837
17-7120482-C-T p.Ala6Ala synonymous ACADVL 2 72104 2.77377E-5 36052 0 3.20266E-5
17-7120485-G-A p.Ala7Ala synonymous ACADVL 3 72062 4.16308E-5 36031 0 3.20616E-5
17-7120487-C-T p.Ala8Val missense ACADVL 1 72090 1.38715E-5 36045 0 NA
17-7120491-G-A p.Ala9Ala splice_region+synonymous ACADVL 4 72190 5.54093E-5 36095 0 NA
17-7121041-G-A p.Arg12Gln missense ACADVL 7 34804 2.01126E-4 17402 0 0.00111545
17-7121058-A-G p.Ile18Val missense ACADVL 10 34824 2.87158E-4 17412 0 0.00118302
17-7121059-T-TAGAAGC p.Glu21_Ala22dup conservative_inframe_insertion ACADVL 1 34818 2.87208E-5 17409 0 NA
17-7121092-C-T p.Thr29Ile missense ACADVL 2 34866 5.73625E-5 17433 0 2.33754E-5
17-7121105-C-A p.Gly33Gly synonymous ACADVL 995 34866 0.0285378 17433 20 0.04625
17-7121109-C-A p.Pro35Thr missense ACADVL 2 34882 5.73362E-5 17441 0 NA
17-7121116-C-T p.Ala37Val missense ACADVL 1 34884 2.86664E-5 17442 0 3.19183E-5
17-7121131-C-T p.Thr42Met missense ACADVL 6 34894 1.71949E-4 17447 0 6.25E-4
17-7121134-T-C p.Met43Thr missense ACADVL 1 34908 2.86467E-5 17454 0 1.5588E-5
17-7123138-C-T c.-166C>T 5_prime_UTR_premature_start_codon_gain ACADVL 3 44086 6.80488E-5 22043 0 3.80958E-5
17-7123147-G-T c.-157G>T 5_prime_UTR_premature_start_codon_gain ACADVL 1 44334 2.25561E-5 22167 0 NA
17-7123197-G-T c.-107G>T 5_prime_UTR_premature_start_codon_gain ACADVL 1 45434 2.20099E-5 22717 0 NA
17-7123306-G-A p.Met1? start_lost ACADVL 1 49256 2.03021E-5 24628 0 2.67709E-5
17-7123309-G-A p.Gln2Gln synonymous ACADVL 1 49176 2.03351E-5 24588 0 NA
17-7123312-G-A p.Ala3Ala synonymous ACADVL 1 48868 2.04633E-5 24434 0 NA
17-7123352-C-T p.Leu17Phe missense ACADVL 323 47610 0.00678429 23805 11 0.0197011
17-7123354-C-T p.Leu17Leu synonymous ACADVL 1 47528 2.10402E-5 23764 0 2.21818E-5
17-7123363-AAGGTCTGTGTGTGACAAGAGGGACGGTGGGCAGCGGCCCTGGGCACCGGGCCGGCACTGAACCCCCACTCCCCAC-A c.62+1_63-1delGTCTGTGTGTGACAAGAGGGACGGTGGGCAGCGGCCCTGGGCACCGGGCCGGCACTGAACCCCCACTCCCCACAG splice_acceptor ACADVL 8 47060 1.69996E-4 23530 0 NA
17-7123374-G-A p.Cys24Tyr missense ACADVL 1 47200 2.11864E-5 23600 0 1.21854E-4
17-7123374-GT-G p.Cys24fs frameshift ACADVL 1 47200 2.11864E-5 23600 0 NA
17-7123383-G-A p.Arg27Lys missense ACADVL 10 47064 2.12477E-4 23532 0 1.27738E-4
17-7123387-C-T p.Asp28Asp synonymous ACADVL 1 46680 2.14225E-5 23340 0 NA
17-7123393-G-A p.Gly30Gly synonymous ACADVL 1 46536 2.14887E-5 23268 0 NA
17-7123404-G-C p.Trp34Ser missense ACADVL 4 46562 8.5907E-5 23281 0 5.27051E-5
17-7123406-G-A p.Ala35Thr missense ACADVL 22 46410 4.74036E-4 23205 0 0.00370139
17-7123407-C-T p.Ala35Val missense ACADVL 3 46406 6.46468E-5 23203 0 4.69647E-6
17-7123410-C-T p.Pro36Leu missense ACADVL 9 46406 1.9394E-4 23203 0 1.14263E-4
17-7123416-G-A p.Arg38Gln missense ACADVL 2 46434 4.30719E-5 23217 0 4.87724E-6
17-7123422-G-T p.Ter40Leuext*? stop_lost ACADVL 1 46658 2.14326E-5 23329 0 NA
17-7123423-A-G p.Ter40Trpext*? stop_lost ACADVL 2 46656 4.28669E-5 23328 0 NA
17-7123439-A-C c.63-2A>C splice_acceptor ACADVL 1 46848 2.13456E-5 23424 0 NA
17-7123443-C-T p.Ser22Leu missense+splice_region ACADVL 5 46804 1.06828E-4 23402 0 0.00155925
17-7123446-G-A p.Arg23Gln missense ACADVL 17 46764 3.63528E-4 23382 0 0.00200337
17-7123473-G-A p.Arg32Gln missense ACADVL 4 47340 8.44951E-5 23670 0 0.00478723
17-7123478-G-A p.Gly34Ser missense ACADVL 1 47672 2.09767E-5 23836 0 6.22045E-5
17-7123492-G-C p.Arg38Arg synonymous ACADVL 1 48492 2.0622E-5 24246 0 6.38162E-5
17-7123499-G-A p.Ala41Thr missense ACADVL 1 49054 2.03857E-5 24527 0 0.00173611
17-7123499-GC-AA p.Ala41Asn missense ACADVL 1 49054 2.03857E-5 24527 0 NA
17-7123501-C-T p.Ala41Ala synonymous ACADVL 1 49274 2.02947E-5 24637 0 7.66107E-6
17-7123506-G-A p.Gly43Asp missense ACADVL 1063 49424 0.0215078 24712 46 0.0361492
17-7123507-T-A p.Gly43Gly synonymous ACADVL 3 49512 6.05914E-5 24756 0 0.00236407
17-7123523-C-A c.*93+7C>A splice_region ACADVL 1 52122 1.91858E-5 26061 0 1.5564E-5
17-7123778-C-G c.*94-5C>G splice_region ACADVL 1 83192 1.20204E-5 41596 0 1.6497E-5
17-7123812-C-G p.Pro56Pro synonymous ACADVL 2 83284 2.40142E-5 41642 0 3.18471E-5
17-7123818-C-T p.Asp58Asp synonymous ACADVL 1 83288 1.20065E-5 41644 0 8.24226E-6
17-7123819-G-A p.Ala59Thr missense ACADVL 2 83270 2.40183E-5 41635 0 3.97709E-6
17-7123833-A-G p.Lys63Lys synonymous ACADVL 3 83308 3.60109E-5 41654 0 0.00151057
17-7123838-C-T p.Pro65Leu missense ACADVL 1292 83290 0.0155121 41645 55 0.0326877
17-7123843-A-T p.Lys67* stop_gained ACADVL 2 83328 2.40015E-5 41664 0 NA
17-7123847-CGGTAGGTAGCCCCGAGGCCAGGTGGACCTTAGCCAGACCCAACCAGAGCCCTGAAATTTGCCTCTCTCTGCCCA-C p.Glu47fs frameshift ACADVL 8 83314 9.60223E-5 41657 0 NA
17-7123908-CCT-C c.*160-8_*160-7delCT splice_region ACADVL 2 83386 2.39848E-5 41693 0 1.19304E-5
17-7123908-C-CCT c.*160-8_*160-7dupCT splice_region ACADVL 1 83386 1.19924E-5 41693 0 NA
17-7123915-CT-GC c.*160-8_*160-7delCTinsGC splice_region ACADVL 23 83382 2.75839E-4 41691 0 NA
17-7123915-C-G c.*160-8C>G splice_region ACADVL 1 83382 1.1993E-5 41691 0 2.30649E-4
17-7123916-T-C c.*160-7T>C splice_region ACADVL 1 83386 1.19924E-5 41693 0 2.30647E-4
17-7123933-C-T p.Ser50Phe missense ACADVL 2 83386 2.39848E-5 41693 0 3.97665E-6
17-7123934-C-T p.Ser50Ser synonymous ACADVL 5 83380 5.99664E-5 41690 0 1.56523E-4
17-7123939-C-T p.Ala52Val missense ACADVL 2 83386 2.39848E-5 41693 0 NA
17-7123968-A-G p.Thr62Ala missense ACADVL 2 83354 2.3994E-5 41677 0 1.64764E-5
17-7123973-T-C p.Asp63Asp synonymous ACADVL 3 83354 3.59911E-5 41677 0 3.57881E-5
17-7123974-C-T p.Gln64* stop_gained ACADVL 2 83354 2.3994E-5 41677 0 NA
17-7123976-G-C p.Gln64His missense ACADVL 1 83356 1.19967E-5 41678 0 NA
17-7123982-C-T p.Phe66Phe synonymous ACADVL 4 83352 4.79893E-5 41676 0 2.54793E-4
17-7123988-C-T p.Tyr68Tyr synonymous ACADVL 1 83346 1.19982E-5 41673 0 4.94324E-5
17-7123990-C-G p.Pro69Arg missense ACADVL 1 83340 1.1999E-5 41670 0 NA
17-7123994-CGGTAAGGGAAGGGATAATCAGAGCTGGGTGGGGCCAGGGTGGTTTCCCCTGCCAGCCTGGCCTGACCAGCCTGTCCCCCACCCTCTGCA-C c.*232+1_*233-1delGTAAGGGAAGGGATAATCAGAGCTGGGTGGGGCCAGGGTGGTTTCCCCTGCCAGCCTGGCCTGACCAGCCTGTCCCCCACCCTCTGCAG splice_acceptor ACADVL 5 83328 6.00038E-5 41664 2 NA
17-7123994-C-T p.Ser70Ser splice_region+synonymous ACADVL 2 83330 2.4001E-5 41665 0 3.18492E-5
17-7123995-G-A p.Val71Met missense+splice_region ACADVL 1 83336 1.19996E-5 41668 0 3.29565E-5
17-7124001-G-T c.*232+6G>T splice_region ACADVL 1 83310 1.20034E-5 41655 0 6.36821E-5
17-7124045-GCCAGCCTGGCCTGA-G n.544_*9delGCCTGACCAGCCTG splice_region ACADVL 2 83190 2.40414E-5 41595 0 NA
17-7124084-G-A c.*233-1G>A splice_acceptor ACADVL 1 83268 1.20094E-5 41634 0 3.97649E-6
17-7124093-G-A p.Glu74Lys missense ACADVL 20 83250 2.4024E-4 41625 0 3.50274E-4
17-7124101-GAC-G p.Gln78fs frameshift ACADVL 3 83256 3.60334E-5 41628 0 NA
17-7124105-C-G p.Gln78Glu missense ACADVL 2 83234 2.40286E-5 41617 0 3.29799E-5
17-7124115-A-G p.Lys81Arg missense ACADVL 196 83200 0.00235577 41600 1 0.0130916
17-7124122-G-A p.Leu83Leu synonymous ACADVL 1 83186 1.20213E-5 41593 0 8.24538E-6
17-7124132-G-A p.Val87Met missense ACADVL 1 83142 1.20276E-5 41571 0 4.94837E-5
17-7124147-GAGGTAAGGAATGACTCGGGGCTTGGTCCCTGGTGAGGTGTTTGGAGATGTTAAGCTCAAAAGGAGCCTGGATGTGGGATCCTGTGCCTTCCCC-G p.Glu93fs frameshift ACADVL 5 83094 6.01728E-5 41547 1 NA
17-7124147-G-A p.Glu92Lys missense+splice_region ACADVL 2 83098 2.4068E-5 41549 0 8.24892E-6
17-7124149-G-A p.Glu92Glu splice_region+synonymous ACADVL 1 83104 1.20331E-5 41552 0 NA
17-7124154-G-A c.*297+5G>A splice_region ACADVL 1 83102 1.20334E-5 41551 0 NA
17-7124202-C-A c.343-8C>A splice_region ACADVL 6 83186 7.21275E-5 41593 0 1.91071E-4
17-7124203-T-C c.343-7T>C splice_region ACADVL 35 83190 4.20724E-4 41595 1 0.00227764
17-7124205-A-T c.343-5A>T splice_region ACADVL 1 83204 1.20187E-5 41602 0 NA
17-7124212-G-T p.Glu115Asp missense+splice_region ACADVL 1 83212 1.20175E-5 41606 0 1.43224E-4
17-7124222-G-A p.Gly119Arg missense ACADVL 1 83208 1.20181E-5 41604 0 NA
17-7124241-AG-A p.Glu93fs frameshift ACADVL 1 83250 1.2012E-5 41625 0 9.55231E-5
17-7124243-G-C p.Glu93Gln missense+splice_region ACADVL 2 83252 2.40234E-5 41626 0 3.18552E-5
17-7124246-G-A p.Val94Met missense ACADVL 1 83250 1.2012E-5 41625 0 3.97766E-6
17-7124252-G-A p.Asp96Asn missense ACADVL 6 83244 7.20773E-5 41622 0 3.18532E-5
17-7124258-G-A p.Ala98Thr missense ACADVL 1 83256 1.20111E-5 41628 0 6.25E-4
17-7124264-A-G p.Asn68Asp missense+splice_region ACADVL 2 83266 2.40194E-5 41633 0 NA
17-7124269-C-T p.Asp101Asp synonymous ACADVL 2 83266 2.40194E-5 41633 0 6.37105E-5
17-7124271-C-T p.Ala102Val missense ACADVL 1 83266 1.20097E-5 41633 0 8.25001E-6
17-7124272-T-C p.Ala102Ala synonymous ACADVL 1 83266 1.20097E-5 41633 0 NA
17-7124281-G-A p.Met105Ile missense ACADVL 3 83280 3.60231E-5 41640 0 0.00125
17-7124290-G-C p.Glu108Asp missense ACADVL 1 83262 1.20103E-5 41631 0 NA
17-7124290-G-A p.Glu108Glu synonymous ACADVL 1 83262 1.20103E-5 41631 0 NA
17-7124293-C-G p.Thr109Thr synonymous ACADVL 3 83258 3.60326E-5 41629 0 2.38644E-5
17-7124306-C-T p.Leu114Phe missense ACADVL 1 83246 1.20126E-5 41623 0 7.95539E-6
17-7124332-G-C p.Leu122Leu synonymous ACADVL 1 83160 1.2025E-5 41580 0 6.37308E-5
17-7124343-G-A p.Ser126Asn missense ACADVL 1 83118 1.20311E-5 41559 0 NA
17-7124346-A-G p.Glu127Gly missense ACADVL 1 83108 1.20325E-5 41554 0 NA
17-7124356-T-C p.Gly130Gly synonymous ACADVL 1 83050 1.20409E-5 41525 0 3.18776E-5
17-7124376-A-G p.Gln137Arg missense+splice_region ACADVL 3 82784 3.62389E-5 41392 0 3.18857E-5
17-7124454-G-A n.737G>A splice_region ACADVL 11 75278 1.46125E-4 37639 0 1.27494E-4
17-7124834-CCA-C c.175-3_175-2delCA splice_acceptor ACADVL 2793 83140 0.0335939 41570 215 0.0649636
17-7124836-A-C c.175-2A>C splice_acceptor ACADVL 2 82664 2.41943E-5 41332 0 3.19E-5
17-7124841-C-G p.Pro60Ala missense ACADVL 1 83208 1.20181E-5 41604 0 NA
17-7124859-C-T p.Arg66Cys missense ACADVL 4 83284 4.80284E-5 41642 0 3.97662E-5
17-7124860-G-A p.Ala139Thr missense ACADVL 1 83282 1.20074E-5 41641 0 4.77228E-5
17-7124874-G-A p.Asp71Asn missense ACADVL 2 83298 2.40102E-5 41649 0 9.55475E-5
17-7124874-G-T p.Glu143Asp missense ACADVL 5 83298 6.00254E-5 41649 0 6.5937E-5
17-7124877-C-T p.Arg72Cys missense ACADVL 1 83294 1.20057E-5 41647 0 3.18674E-5
17-7124878-G-A p.Val145Met missense ACADVL 4 83298 4.80204E-5 41649 0 3.29685E-5
17-7124885-T-C p.Met147Thr missense ACADVL 2 83302 2.4009E-5 41651 0 3.97646E-6
17-7124896-G-C p.Gly151Arg missense ACADVL 2 83294 2.40113E-5 41647 0 NA
17-7124898-C-T p.Gly151Gly synonymous ACADVL 3 83288 3.60196E-5 41644 0 3.2975E-5
17-7124899-G-A p.Val152Met missense ACADVL 9 83284 1.08064E-4 41642 0 1.59357E-4
17-7124903-G-C p.Gly153Ala missense ACADVL 1 83280 1.20077E-5 41640 0 NA
17-7124912-T-C p.Leu156Pro missense ACADVL 1 83272 1.20088E-5 41636 0 NA
17-7124917-G-A p.Ala158Thr missense ACADVL 3 83260 3.60317E-5 41630 0 1.64886E-5
17-7124919-C-T p.Ala158Ala synonymous ACADVL 1 83258 1.20109E-5 41629 0 NA
17-7124931-C-T p.Ile162Ile synonymous ACADVL 1 83232 1.20146E-5 41616 0 3.29881E-5
17-7124936-TCAAAGGCATCCTGCTCTTTGGCA-T p.Ile167fs frameshift ACADVL 1 83226 1.20155E-5 41613 0 3.97681E-6
17-7124962-A-G p.Lys173Glu missense ACADVL 7 83178 8.41569E-5 41589 0 3.18492E-5
17-7124964-G-A p.Lys173Lys synonymous ACADVL 1 83190 1.20207E-5 41595 0 NA
17-7124965-G-C p.Ala174Pro missense ACADVL 1 83170 1.20236E-5 41585 0 3.97791E-6
17-7124966-C-T p.Ala174Val missense ACADVL 8 83162 9.61978E-5 41581 0 3.18654E-4
17-7124986-C-T p.Pro181Ser missense ACADVL 1 83080 1.20366E-5 41540 0 NA
17-7124991-G-C p.Lys182Asn missense ACADVL 2 83040 2.40848E-5 41520 0 NA
17-7125007-G-A c.*577+6G>A splice_region ACADVL 2 82892 2.41278E-5 41446 0 3.98982E-6
17-7125253-T-C c.623-3T>C splice_region ACADVL 4 83202 4.80758E-5 41601 0 3.19163E-5
17-7125263-C-T c.*578-8C>T splice_region ACADVL 280 83250 0.00336336 41625 3 0.00861519
17-7125268-C-G p.Thr212Arg missense ACADVL 1 83266 1.20097E-5 41633 0 7.96204E-6
17-7125270-G-A c.*578-1G>A splice_acceptor ACADVL 3 83290 3.60187E-5 41645 0 NA
17-7125284-C-T p.Ala190Ala synonymous ACADVL 214 83286 0.00256946 41643 1 0.00557858
17-7125285-G-A p.Ala191Thr missense ACADVL 3 83294 3.6017E-5 41647 0 2.475E-5
17-7125288-TTCTG-T p.Cys193fs frameshift ACADVL 1 83306 1.20039E-5 41653 0 3.18796E-5
17-7125292-G-C p.Cys193Ser missense ACADVL 1 83304 1.20042E-5 41652 0 8.24797E-6
17-7125311-C-T p.Ser199Ser synonymous ACADVL 69 83314 8.28192E-4 41657 0 0.00105236
17-7125312-G-A p.Gly200Arg missense ACADVL 2 83324 2.40027E-5 41662 0 1.19339E-5
17-7125323-A-T p.Ala203Ala synonymous ACADVL 4 83350 4.79904E-5 41675 0 NA
17-7125326-C-T p.Ala204Ala synonymous ACADVL 3 83358 3.59893E-5 41679 0 2.47255E-5
17-7125326-C-A p.Ala204Ala synonymous ACADVL 8 83358 9.59716E-5 41679 0 0.00100705
17-7125333-C-T p.Arg207* stop_gained ACADVL 1 83370 1.19947E-5 41685 0 3.18735E-5
17-7125341-T-A p.Ser209Ser synonymous ACADVL 341 83360 0.00409069 41680 6 0.0115811
17-7125341-T-C p.Ser209Ser synonymous ACADVL 5 83362 5.99794E-5 41681 0 4.94405E-5
17-7125355-C-T p.Pro214Leu missense ACADVL 2 83358 2.39929E-5 41679 0 NA
17-7125363-A-G p.Lys217Glu missense ACADVL 3 83366 3.59859E-5 41683 0 6.59011E-5
17-7125370-A-C p.Tyr219Ser missense ACADVL 2 83374 2.39883E-5 41687 0 NA
17-7125373-C-T p.Thr220Ile missense ACADVL 1 83372 1.19944E-5 41686 0 1.98817E-5
17-7125376-T-A p.Leu221His missense ACADVL 3 83370 3.59842E-5 41685 0 1.64739E-5
17-7125379-A-G p.Asn222Ser missense ACADVL 3 83374 3.59824E-5 41687 0 3.9763E-6
17-7125381-G-A p.Gly223Arg missense ACADVL 1 83370 1.19947E-5 41685 0 NA
17-7125394-G-T p.Trp227Leu missense ACADVL 1 83372 1.19944E-5 41686 0 NA
17-7125397-TCAGGCAACCTGCCTCCCATTTCTCCCCTTCTCCTCCGCCCAATTCCAGGCCCCACTGCTCCCCGTCCTCCACGCCCTGAATATCCCATTCTTCCA-T c.*707+1_*708-1delGCAACCTGCCTCCCATTTCTCCCCTTCTCCTCCGCCCAATTCCAGGCCCCACTGCTCCCCGTCCTCCACGCCCTGAATATCCCATTCTTCCACAG splice_acceptor ACADVL 2 83356 2.39935E-5 41678 0 NA
17-7125494-A-C c.*708-2A>C splice_acceptor ACADVL 2 83328 2.40015E-5 41664 0 3.18634E-5
17-7125499-T-C p.Asn230Asn synonymous ACADVL 3 83314 3.60084E-5 41657 0 5.03525E-4
17-7125502-G-A p.Gly231Gly synonymous ACADVL 7 83318 8.40155E-5 41659 0 1.9118E-4
17-7125503-G-A p.Gly232Ser missense ACADVL 2 83320 2.40038E-5 41660 0 1.59286E-4
17-7125523-G-A p.Thr238Thr synonymous ACADVL 24 83296 2.88129E-4 41648 0 0.00108342
17-7125537-C-T p.Thr243Ile missense ACADVL 1 83272 1.20088E-5 41636 0 NA
17-7125561-G-C p.Gly251Ala missense ACADVL 51 83304 6.12215E-4 41652 0 9.24156E-4
17-7125564-C-A p.Ala252Asp missense ACADVL 1 83298 1.20051E-5 41649 0 NA
17-7125564-C-T p.Ala252Val missense ACADVL 1 83298 1.20051E-5 41649 0 3.97709E-6
17-7125565-C-T p.Ala252Ala synonymous ACADVL 7 83294 8.40397E-5 41647 0 6.59587E-5
17-7125569-AAGG-A p.Glu255del conservative_inframe_deletion ACADVL 26 83302 3.12117E-4 41651 0 5.03525E-4
17-7125572-GAGA-G p.Lys256del disruptive_inframe_deletion ACADVL 3 83294 3.6017E-5 41647 0 1.98856E-5
17-7125576-A-T p.Lys256Met missense ACADVL 2 83294 2.40113E-5 41647 0 8.24824E-6
17-7125591-T-C p.Val261Ala missense ACADVL 129 83240 0.00154974 41620 0 0.00142895
17-7125593-G-T p.Val262Leu missense ACADVL 1 83232 1.20146E-5 41616 0 NA
17-7125598-G-C p.Glu263Asp missense ACADVL 2 83220 2.40327E-5 41610 0 1.98904E-5
17-7125598-G-A p.Glu263Glu synonymous ACADVL 2 83220 2.40327E-5 41610 0 1.19342E-5
17-7125601-G-A p.Arg264Arg synonymous ACADVL 1 83212 1.20175E-5 41606 0 3.18735E-5
17-7125604-C-T p.Gly265Gly synonymous ACADVL 1 83188 1.2021E-5 41594 0 NA
17-7125607-C-T p.Phe266Phe synonymous ACADVL 1 83160 1.2025E-5 41580 0 1.5918E-5
17-7125608-G-A p.Gly267Arg missense ACADVL 12 83148 1.44321E-4 41574 0 1.59357E-4
17-7125609-G-A p.Gly267Glu missense ACADVL 2 83142 2.40552E-5 41571 0 3.18695E-5
17-7125781-T-C n.1210T>C splice_region ACADVL 2 66366 3.01359E-5 33183 0 3.18837E-5
17-7125987-G-GGGCC p.Pro274fs frameshift ACADVL 1 83030 1.20438E-5 41515 0 1.92961E-5
17-7125988-G-A p.Gly272Glu missense+splice_region ACADVL 2 83030 2.40877E-5 41515 0 9.57396E-6
17-7125989-G-GC p.Glu275fs frameshift ACADVL 1 83030 1.20438E-5 41515 0 NA
17-7125993-CCT-C p.Pro274fs frameshift ACADVL 4 83078 4.81475E-5 41539 0 2.76447E-5
17-7125995-TGAG-T p.Glu275del conservative_inframe_deletion ACADVL 1 83090 1.20351E-5 41545 0 3.99272E-6
17-7125996-GAGA-G p.Lys277del disruptive_inframe_deletion ACADVL 2 83102 2.40668E-5 41551 0 4.50727E-5
17-7125998-G-A p.Glu275Glu synonymous ACADVL 1 83114 1.20317E-5 41557 0 NA
17-7126017-G-A p.Ala282Thr missense ACADVL 1 83192 1.20204E-5 41596 0 NA
17-7126026-A-G p.Thr285Ala missense ACADVL 1 83218 1.20166E-5 41609 0 NA
17-7126027-C-G p.Thr285Arg missense ACADVL 1 83216 1.20169E-5 41608 0 0.001875
17-7126054-G-A p.Arg294Gln missense ACADVL 2 83248 2.40246E-5 41624 0 3.31862E-5
17-7126057-T-C p.Val295Ala missense ACADVL 3 83246 3.60378E-5 41623 0 3.97966E-6
17-7126058-G-T p.Val295Val synonymous ACADVL 1 83250 1.2012E-5 41625 0 6.36902E-5
17-7126061-A-G p.Pro296Pro synonymous ACADVL 2 83264 2.402E-5 41632 0 6.37308E-5
17-7126063-C-T p.Ser297Leu missense ACADVL 10 83262 1.20103E-4 41631 0 5.03525E-4
17-7126064-G-A p.Ser297Ser synonymous ACADVL 6 83268 7.20565E-5 41634 0 3.18593E-5
17-7126070-C-T p.Asn299Asn synonymous ACADVL 15 83274 1.80128E-4 41637 0 0.00100705
17-7126076-G-A p.Leu301Leu synonymous ACADVL 1 83284 1.20071E-5 41642 0 1.65306E-5
17-7126088-G-C p.Gly305Gly synonymous ACADVL 1 83284 1.20071E-5 41642 0 3.9788E-6
17-7126099-A-C p.Lys309Thr missense ACADVL 2 83246 2.40252E-5 41623 0 3.18756E-5
17-7126108-T-C p.Met312Thr missense ACADVL 1 83250 1.2012E-5 41625 0 NA
17-7126111-A-C p.His313Pro missense ACADVL 2 83246 2.40252E-5 41623 0 NA
17-7126112-C-A p.His313Gln missense ACADVL 17 83240 2.04229E-4 41620 0 9.56389E-5
17-7126113-A-G p.Ile314Val missense ACADVL 2 83242 2.40263E-5 41621 0 8.256E-6
17-7126120-A-G p.Asn316Ser missense ACADVL 2 83236 2.40281E-5 41618 0 NA
17-7126124-T-C p.Asn317Asn synonymous ACADVL 1 83232 1.20146E-5 41616 0 NA
17-7126144-C-T p.Ala324Val missense ACADVL 2 83152 2.40523E-5 41576 0 1.19462E-5
17-7126145-G-A p.Ala324Ala synonymous ACADVL 916 83136 0.0110181 41568 30 0.0208001
17-7126152-G-A p.Ala327Thr missense ACADVL 3 83120 3.60924E-5 41560 0 3.18979E-5
17-7126160-C-T p.Thr329Thr synonymous ACADVL 1 83058 1.20398E-5 41529 0 NA
17-7126165-G-A p.Arg331Lys missense ACADVL 1 82990 1.20496E-5 41495 0 NA
17-7126168-GCAT-G p.Ile334del disruptive_inframe_deletion ACADVL 1 82926 1.20589E-5 41463 0 4.38663E-5
17-7126171-T-C p.Ile333Thr missense ACADVL 1 82902 1.20624E-5 41451 0 3.18959E-5
17-7126173-A-G p.Ile334Val missense ACADVL 88 82868 0.00106193 41434 1 0.00226446
17-7126183-C-T p.Ala337Val missense+splice_region ACADVL 2 82530 2.42336E-5 41265 0 3.1904E-5
17-7126184-G-A p.Ala337Ala splice_region+synonymous ACADVL 1 82512 1.21194E-5 41256 0 8.28171E-6
17-7126185-G-T c.*1032+1G>T splice_donor ACADVL 1 82496 1.21218E-5 41248 0 4.0017E-6
17-7126455-G-A p.Asp339Asn missense ACADVL 1 83206 1.20184E-5 41603 0 3.97646E-6
17-7126457-T-C p.Asp339Asp synonymous ACADVL 2 83222 2.40321E-5 41611 0 5.96464E-5
17-7126463-C-A p.Ala341Ala synonymous ACADVL 3 83256 3.60334E-5 41628 0 NA
17-7126467-A-G p.Asn343Asp missense ACADVL 3 83258 3.60326E-5 41629 0 3.9764E-6
17-7126471-G-A p.Arg344His missense ACADVL 1 83268 1.20094E-5 41634 0 3.18471E-5
17-7126475-C-T p.Thr345Thr synonymous ACADVL 2 83280 2.40154E-5 41640 0 3.18431E-5
17-7126489-A-C p.Lys350Thr missense ACADVL 1 83278 1.2008E-5 41639 0 3.9763E-6
17-7126502-T-C p.Phe354Phe synonymous ACADVL 1 83284 1.20071E-5 41642 0 8.2375E-6
17-7126507-T-C p.Leu356Pro missense ACADVL 1 83296 1.20054E-5 41648 0 NA
17-7126521-C-T p.Leu361Leu synonymous ACADVL 3 83278 3.60239E-5 41639 0 NA
17-7126521-C-G p.Leu361Val missense ACADVL 2 83278 2.40159E-5 41639 0 8.23886E-6
17-7126527-C-T p.Arg363Trp missense ACADVL 2 83252 2.40234E-5 41626 0 3.9764E-5
17-7126536-A-T p.Met366Leu missense ACADVL 3 83238 3.60412E-5 41619 0 NA
17-7126551-A-G p.Thr371Ala missense ACADVL 1 83188 1.2021E-5 41594 0 2.47357E-5
17-7126557-G-A c.*1137+1G>A splice_donor ACADVL 1 83128 1.20296E-5 41564 0 1.98836E-5
17-7126957-C-T c.*1138-6C>T splice_region ACADVL 1 83210 1.20178E-5 41605 0 3.18552E-5
17-7126975-A-C p.Met377Leu missense ACADVL 1 83288 1.20065E-5 41644 0 8.23886E-6
17-7127000-G-C p.Gly385Ala missense ACADVL 9 83290 1.08056E-4 41645 0 1.19292E-5
17-7127006-C-T p.Thr387Met missense ACADVL 2 83286 2.40136E-5 41643 0 5.16948E-5
17-7127007-G-A p.Thr387Thr synonymous ACADVL 7 83286 8.40477E-5 41643 0 9.5645E-5
17-7127016-G-C p.Gln390His missense ACADVL 2 83292 2.40119E-5 41646 0 2.47133E-5
17-7127019-A-G p.Ile391Met missense ACADVL 9 83280 1.08069E-4 41640 0 1.59065E-4
17-7127024-C-T p.Ala393Val missense ACADVL 2 83286 2.40136E-5 41643 0 NA
17-7127025-C-T p.Ala393Ala synonymous ACADVL 1 83282 1.20074E-5 41641 0 3.97662E-6
17-7127026-G-T p.Ala394Ser missense ACADVL 2 83280 2.40154E-5 41640 0 3.18634E-5
17-7127037-A-G p.Lys397Lys synonymous ACADVL 1 83284 1.20071E-5 41642 0 NA
17-7127048-CGGTGAGGTCCCAGGCATGCTGGGAGGGAGTCCAGTTTGGGTGCTCAGCTCCCAAAACCAGTCTCATCTGTTCTTTGTCCCTA-C p.Glu402fs frameshift ACADVL 10 83276 1.20083E-4 41638 2 NA
17-7127050-G-A c.*1224+1G>A splice_donor ACADVL 1 83266 1.20097E-5 41633 0 8.23845E-6
17-7127135-G-A p.Ala403Thr missense ACADVL 5 83292 6.00298E-5 41646 0 2.54939E-4
17-7127146-G-A p.Lys406Lys synonymous ACADVL 88 83298 0.00105645 41649 0 0.00755287
17-7127153-G-C p.Asp409His missense ACADVL 1 83304 1.20042E-5 41652 0 NA
17-7127176-G-A n.522G>A splice_region ACADVL 1 83280 1.20077E-5 41640 0 NA
17-7127178-G-A n.523+1G>A splice_donor ACADVL 1 83276 1.20083E-5 41638 0 3.18674E-5
17-7127184-G-A p.Gly419Asp missense ACADVL 3 83278 3.60239E-5 41639 0 2.78483E-5
17-7127185-CT-C p.Phe420fs frameshift ACADVL 1 83284 1.20071E-5 41642 0 NA
17-7127192-AAGGTACAGGACGGTCTTCTGCAGAGCCTCGGCTGGGCCAGGGGTGGGTAGGCACATCTCAGCACGGGCATATAATTTGTGTGGCCCTGTGCT-A p.Glu423fs frameshift ACADVL 1 83272 1.20088E-5 41636 0 NA
17-7127196-T-A c.*1287+2T>A splice_donor ACADVL 1 83274 1.20085E-5 41637 0 NA
17-7127199-A-G c.*1287+5A>G splice_region ACADVL 4 83268 4.80377E-5 41634 0 2.47292E-5
17-7127280-G-A c.*1288-7G>A splice_region ACADVL 2 83162 2.40494E-5 41581 0 NA
17-7127295-A-G p.Gly425Gly synonymous ACADVL 2 83198 2.4039E-5 41599 0 3.18654E-5
17-7127299-G-C p.Glu427Gln missense ACADVL 1 83208 1.20181E-5 41604 0 8.24647E-6
17-7127321-G-A p.Arg434His missense ACADVL 3 83264 3.603E-5 41632 0 NA
17-7127327-T-TC p.Arg437fs frameshift ACADVL 1 83274 1.20085E-5 41637 0 8.24565E-6
17-7127330-G-A p.Arg437Gln missense ACADVL 2 83282 2.40148E-5 41641 0 3.18573E-5
17-7127342-G-A p.Gly441Glu missense ACADVL 2 83282 2.40148E-5 41641 0 2.78412E-5
17-7127343-G-A p.Gly441Gly synonymous ACADVL 1 83284 1.20071E-5 41642 0 3.18715E-5
17-7127347-A-G p.Asn443Asp missense ACADVL 1 83288 1.20065E-5 41644 0 NA
17-7127359-C-T p.Arg447Trp missense ACADVL 1 83294 1.20057E-5 41647 0 2.78421E-5
17-7127360-G-A p.Arg447Gln missense ACADVL 1 83294 1.20057E-5 41647 0 NA
17-7127372-C-T p.Ala451Val missense ACADVL 1 83282 1.20074E-5 41641 0 8.24633E-6
17-7127387-TGGTAAGACAGAGAATTGGGTGGGGGTAGAGGTGGGGAGGACAGTGAGTCCTGACTGCTGGACCCTCTTCCCCCATA-T p.Asp457fs frameshift ACADVL 7 83270 8.40639E-5 41635 0 NA
17-7127388-G-A p.Met456Ile missense+splice_region ACADVL 2 83268 2.40188E-5 41634 0 1.91156E-4
17-7127389-G-GT c.*1389+2dupT splice_region ACADVL 1 83264 1.201E-5 41632 0 3.97848E-6
17-7127465-G-A p.Asp457Asn missense+splice_region ACADVL 3 83152 3.60785E-5 41576 0 NA
17-7127487-G-T p.Gly464Val missense ACADVL 1 83150 1.20265E-5 41575 0 NA
17-7127487-G-A p.Gly464Glu missense ACADVL 1 83150 1.20265E-5 41575 0 1.64916E-5
17-7127494-C-G p.Gly466Gly synonymous ACADVL 1 83146 1.2027E-5 41573 0 NA
17-7127503-A-G p.Leu469Leu synonymous ACADVL 80 83166 9.61932E-4 41583 0 0.00251762
17-7127509-T-A p.Asn471Lys missense ACADVL 1 83182 1.20218E-5 41591 0 NA
17-7127524-T-G p.Ala476Ala synonymous ACADVL 2 83146 2.40541E-5 41573 0 8.24797E-6
17-7127526-G-C p.Gly477Ala missense ACADVL 5 83148 6.01337E-5 41574 0 7.95944E-6
17-7127536-AG-A p.Gly481fs frameshift ACADVL 1 83148 1.20267E-5 41574 0 3.98026E-6
17-7127545-A-C p.Ala483Ala synonymous ACADVL 6 83146 7.21622E-5 41573 0 4.77669E-5
17-7127561-CGGTAGGCTTAGGGCCAGAGCCAGGGGAGGGCAGGGTGGTGTATGGCAACTAACCAGTCATTCTCCCTCTTCCTCTCA-C p.Arg490fs frameshift ACADVL 9 83110 1.0829E-4 41555 1 NA
17-7127561-C-T p.Arg489Trp missense+splice_region ACADVL 1 83110 1.20322E-5 41555 0 3.98425E-5
17-7127563-G-A c.*1487+1G>A splice_donor ACADVL 1 83136 1.20285E-5 41568 0 3.98524E-6
17-7127569-T-C c.*1487+7T>C splice_region ACADVL 2 83132 2.40581E-5 41566 0 1.15718E-4
17-7127635-C-G c.*1488-5C>G splice_region ACADVL 1 82950 1.20555E-5 41475 0 NA
17-7127636-T-A c.*1488-4T>A splice_region ACADVL 42 82936 5.06415E-4 41468 0 6.25E-4
17-7127641-C-T p.Arg490Trp missense+splice_region ACADVL 6 82886 7.23886E-5 41443 0 0.00125
17-7127643-G-A p.Gly92Ser missense ACADVL 1 82882 1.20653E-5 41441 0 3.99339E-6
17-7127658-C-T p.Arg97Trp missense ACADVL 4 82760 4.83325E-5 41380 0 3.18939E-5
17-7127659-G-A p.Gly496Ser missense ACADVL 3 82750 3.62538E-5 41375 0 7.50025E-5
17-7127664-G-A p.Glu99Lys missense ACADVL 1 82772 1.20814E-5 41386 0 NA
17-7127673-C-T p.Arg102Trp missense ACADVL 4 82654 4.83945E-5 41327 0 3.1953E-5
17-7127674-G-A p.Gly501Arg missense ACADVL 63 82638 7.62361E-4 41319 0 6.25E-4
17-7127682-C-A p.Pro105Thr missense ACADVL 8 82634 9.68125E-5 41317 0 5.03525E-4
17-7127682-C-T p.Pro105Ser missense ACADVL 1 82634 1.21016E-5 41317 0 NA
17-7127688-G-A p.Gly107Arg missense ACADVL 45 82552 5.45111E-4 41276 0 6.06138E-4
17-7127698-C-T p.Arg509Trp missense ACADVL 20 82470 2.42512E-4 41235 0 4.75952E-4
17-7127699-G-A p.Arg509Gln missense ACADVL 1 82496 1.21218E-5 41248 0 2.50497E-5
17-7127706-C-T p.Arg113* stop_gained ACADVL 9 82324 1.09324E-4 41162 0 1.67104E-5
17-7127707-G-A p.Glu512Lys missense ACADVL 275 82394 0.00333762 41197 3 0.00864268
17-7127711-TGGTAAGTGGCCAGGGGTCCAGGAGAGCCTGCATCAGGGACTGCAGCCGATGGCCCCTCTGAGCCCCGCACTGTCCCCATCTCTTAA-T p.Ala514fs frameshift ACADVL 2 82396 2.4273E-5 41198 1 NA
17-7127715-A-C c.*1560+3A>C splice_region ACADVL 1 82390 1.21374E-5 41195 0 4.17502E-5
17-7127717-G-A c.*1560+5G>A splice_region ACADVL 3 82390 3.64122E-5 41195 0 NA
17-7127718-T-C c.*1560+6T>C splice_region ACADVL 49889 81634 0.61113 40817 15581 0.733125
17-7127718-TG-CA c.*1560+6_*1560+7delTGinsCA splice_region ACADVL 3 82336 3.64361E-5 41168 0 NA
17-7127719-G-A c.*1560+7G>A splice_region ACADVL 13 82372 1.57821E-4 41186 0 6.25E-4
17-7127793-C-T c.*1561-6C>T splice_region ACADVL 1 82792 1.20785E-5 41396 0 3.18756E-5
17-7127804-A-G p.Thr181Ala missense ACADVL 1 82840 1.20715E-5 41420 0 8.33653E-6
17-7127805-C-T p.Arg116Trp missense+splice_region ACADVL 1 82844 1.20709E-5 41422 0 5.00242E-5
17-7127806-G-A p.Arg516Gln missense ACADVL 5 82844 6.03544E-5 41422 0 9.56572E-5
17-7127807-G-A p.Gly182Ser missense ACADVL 6 82834 7.2434E-5 41417 0 5.83528E-5
17-7127836-A-C p.Glu526Ala missense ACADVL 2 82936 2.4115E-5 41468 0 NA
17-7127837-G-A p.Gly192Ser missense ACADVL 1 82932 1.20581E-5 41466 0 NA
17-7127863-G-C p.Gly535Ala missense ACADVL 1 82816 1.2075E-5 41408 0 NA
17-7127866-T-C p.Ile536Thr missense ACADVL 1 82782 1.20799E-5 41391 0 3.24486E-5
17-7127954-C-T c.*1634-7C>T splice_region ACADVL 2 79224 2.52449E-5 39612 0 4.12031E-5
17-7127954-CG-C c.*1634-5delG splice_region ACADVL 1 79224 1.26224E-5 39612 0 6.1416E-6
17-7127955-G-A c.*1634-6G>A splice_region ACADVL 1 79174 1.26304E-5 39587 0 4.11963E-5
17-7127964-AAC-A p.Gln540fs frameshift ACADVL 2 80144 2.49551E-5 40072 0 NA
17-7127982-G-A p.Arg545Gln missense ACADVL 12 80858 1.48408E-4 40429 0 0.00101937
17-7127993-G-A p.Gly549Arg missense ACADVL 2 81178 2.46372E-5 40589 0 3.3389E-5
17-7128001-C-T p.Arg29* stop_gained ACADVL 2 81334 2.459E-5 40667 0 6.16067E-5
17-7128001-C-G p.Ile551Met missense ACADVL 1 81334 1.2295E-5 40667 0 6.16067E-5
17-7128003-A-G p.Asp552Gly missense ACADVL 1 81370 1.22895E-5 40685 0 4.96796E-6
17-7128011-G-T p.Ala555Ser missense ACADVL 2 81632 2.45002E-5 40816 0 NA
17-7128012-C-T p.Ala555Val missense ACADVL 1 81640 1.22489E-5 40820 0 NA
17-7128015-T-C p.Met556Thr missense ACADVL 3 81704 3.67179E-5 40852 0 9.6401E-5
17-7128030-C-T p.Ser561Leu missense ACADVL 1 81884 1.22124E-5 40942 0 8.92746E-6
17-7128031-G-A p.Glu39Lys missense+splice_region ACADVL 1 81892 1.22112E-5 40946 0 NA
17-7128045-G-A p.Gly183Ser missense ACADVL 3 82150 3.65186E-5 41075 0 NA
17-7128051-G-A p.Glu185Lys missense ACADVL 54 82182 6.57078E-4 41091 0 0.003125
17-7128054-T-C p.Cys186Arg missense ACADVL 1 82186 1.21675E-5 41093 0 NA
17-7128064-G-A p.Arg189His missense ACADVL 3 82184 3.65035E-5 41092 0 2.38311E-5
17-7128068-G-C p.Arg190Ser missense ACADVL 1 82284 1.2153E-5 41142 0 7.70925E-5
17-7128073-C-A p.Pro192His missense ACADVL 3 82232 3.64821E-5 41116 0 1.0504E-5
17-7128079-C-G p.Pro194Arg missense ACADVL 23 82180 2.79873E-4 41090 0 1.33078E-4
17-7128086-C-T p.Ser196Ser synonymous ACADVL 1 82252 1.21578E-5 41126 0 NA
17-7128091-C-T p.Pro198Leu missense ACADVL 2 82302 2.43007E-5 41151 0 3.52715E-5
17-7128092-G-A p.Pro198Pro synonymous ACADVL 62 82276 7.53561E-4 41138 0 0.00181818
17-7128093-G-A p.Ala199Thr missense ACADVL 1 82286 1.21527E-5 41143 0 NA
17-7128095-CCA-C p.Gln200fs frameshift ACADVL 5 82338 6.07253E-5 41169 0 9.56633E-5
17-7128095-C-T p.Ala199Ala synonymous ACADVL 1 82338 1.21451E-5 41169 0 1.19879E-5
17-7128098-G-T p.Gln200His missense ACADVL 2 82406 2.42701E-5 41203 0 8.49849E-6
17-7128105-T-C p.Phe203Leu missense ACADVL 2 82520 2.42365E-5 41260 0 0.00125
17-7128111-C-T p.Leu205Phe missense ACADVL 3 82550 3.63416E-5 41275 0 6.37674E-5
17-7128130-C-T p.Ala563Val missense+splice_region ACADVL 14 82734 1.69217E-4 41367 0 0.00125
17-7128140-C-T p.Pro44Ser missense ACADVL 1 82854 1.20694E-5 41427 0 7.95836E-6
17-7128143-G-A p.Glu45Lys missense ACADVL 1 82886 1.20648E-5 41443 0 8.2765E-6
17-7128145-G-A p.Ser568Asn missense ACADVL 1 82884 1.20651E-5 41442 0 NA
17-7128154-A-G p.His571Arg missense ACADVL 1 82926 1.20589E-5 41463 0 3.97867E-6
17-7128155-C-G p.His571Gln missense ACADVL 2 82942 2.41132E-5 41471 0 1.19359E-5
17-7128158-C-A p.Pro572Pro synonymous ACADVL 4 82958 4.82172E-5 41479 0 3.18796E-5
17-7128179-G-A p.Met579Ile missense ACADVL 7 83074 8.42622E-5 41537 0 7.95684E-5
17-7128182-C-G p.Leu580Leu synonymous ACADVL 1 83088 1.20354E-5 41544 0 NA
17-7128182-C-CT p.Cys581fs frameshift ACADVL 1 83088 1.20354E-5 41544 0 NA
17-7128195-T-G p.Cys585Gly missense ACADVL 1 83086 1.20357E-5 41543 0 NA
17-7128196-G-A p.Cys585Tyr missense ACADVL 3 83078 3.61106E-5 41539 0 3.18735E-5
17-7128200-C-T p.Ile586Ile synonymous ACADVL 159 83036 0.00191483 41518 0 0.01875
17-7128201-GAGGTGAGACTCGGGGCTGCCAAGCTCAGGTGAGGGCTGGAGGTGCAGGCCCAACCCCTCCTTCCCTCTCCCC-G p.Ala588fs frameshift ACADVL 9 83048 1.08371E-4 41524 1 NA
17-7128209-A-G c.*1782+6A>G splice_region ACADVL 1 83036 1.2043E-5 41518 0 7.9595E-6
17-7128210-C-T c.*1782+7C>T splice_region ACADVL 1 83042 1.20421E-5 41521 0 3.97975E-6
17-7128211-T-C c.*1782+8T>C splice_region ACADVL 1 83024 1.20447E-5 41512 0 3.18979E-5
17-7128272-C-G c.*1783-4C>G splice_region ACADVL 50 83002 6.02395E-4 41501 0 0.00172095
17-7128283-C-T p.Ala590Val missense ACADVL 3 83026 3.61333E-5 41513 0 3.18735E-5
17-7128285-C-T p.Arg591Trp missense ACADVL 6 83030 7.2263E-5 41515 0 8.25968E-5
17-7128287-G-A p.Arg591Arg synonymous ACADVL 98 83038 0.00118018 41519 0 0.00258093
17-7128292-G-A p.Arg593Gln missense ACADVL 386 83020 0.00464948 41510 4 0.0140987
17-7128305-C-T p.Ala597Ala synonymous ACADVL 4 83038 4.81707E-5 41519 0 3.18715E-5
17-7128306-G-A p.Ala598Thr missense ACADVL 1 83024 1.20447E-5 41512 0 6.37308E-5
17-7128313-A-G p.Gln600Arg missense ACADVL 1 83064 1.20389E-5 41532 0 NA
17-7128314-G-A p.Gln600Gln synonymous ACADVL 2 83070 2.40761E-5 41535 0 7.42819E-5
17-7128321-C-G p.Pro603Ala missense ACADVL 4 83078 4.81475E-5 41539 0 1.59297E-4
17-7128330-C-G p.Gln606Glu missense ACADVL 1 83080 1.20366E-5 41540 0 1.65016E-5
17-7128342-C-T p.Arg610Cys missense ACADVL 33 83122 3.97007E-4 41561 0 7.64623E-4
17-7128343-G-GC p.Asn611fs frameshift ACADVL 1 83112 1.2032E-5 41556 0 NA
17-7128349-T-G p.Phe612Cys missense ACADVL 1 83162 1.20247E-5 41581 0 NA
17-7128351-A-G p.Lys613Glu missense ACADVL 1 83172 1.20233E-5 41586 0 NA
17-7128356-C-T p.Ser614Ser synonymous ACADVL 2 83182 2.40437E-5 41591 0 1.64948E-5
17-7128378-C-T p.Arg622Trp missense ACADVL 1 83236 1.2014E-5 41618 0 1.19319E-5
17-7128379-G-A p.Arg622Gln missense ACADVL 2 83238 2.40275E-5 41619 0 1.98861E-5
17-7128389-G-A p.Val625Val synonymous ACADVL 1 83244 1.20129E-5 41622 0 NA
17-7128531-C-T c.*401C>T splice_region ACADVL 1 79288 1.26122E-5 39644 0 NA
17-7128560-AAAT-A n.1234_*2delTAA splice_region ACADVL 2 77374 2.58485E-5 38687 0 NA
17-7128577-A-AT n.900_901insT splice_region ACADVL 1 76892 1.30053E-5 38446 0 NA
17-7128578-G-C n.901G>C splice_region ACADVL 1 76764 1.30269E-5 38382 0 NA
17-7128585-A-G c.*169A>G splice_region ACADVL 11 76488 1.43813E-4 38244 0 3.18451E-5