Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
12-121163577-C-T c.-112C>T 5_prime_UTR_premature_start_codon_gain ACADS 12 35426 3.38734E-4 17713 0 0.00319285
12-121163583-C-T c.-106C>T 5_prime_UTR_premature_start_codon_gain ACADS 1 36280 2.75634E-5 18140 0 NA
12-121163592-A-G c.-97A>G 5_prime_UTR_premature_start_codon_gain ACADS 1 37570 2.6617E-5 18785 0 NA
12-121163593-C-T c.-96C>T 5_prime_UTR_premature_start_codon_gain ACADS 1 37880 2.63992E-5 18940 0 NA
12-121163633-C-T c.-56C>T 5_prime_UTR_premature_start_codon_gain ACADS 9 42124 2.13655E-4 21062 2 0.00253968
12-121163690-T-C p.Met1? start_lost ACADS 3 45632 6.57433E-5 22816 0 1.28007E-5
12-121163699-C-T p.Ala4Val missense ACADS 1 45416 2.20187E-5 22708 0 NA
12-121163705-T-C p.Leu6Pro missense ACADS 2 45500 4.3956E-5 22750 0 NA
12-121163710-C-T p.Arg8Trp missense ACADS 2 45568 4.38904E-5 22784 1 0.00155602
12-121163720-G-A p.Gly11Asp missense ACADS 1 45266 2.20916E-5 22633 0 NA
12-121163726-C-T p.Ala13Val missense ACADS 1 45132 2.21572E-5 22566 0 0.00155602
12-121163728-C-G p.Arg14Gly missense ACADS 2 45086 4.43597E-5 22543 0 2.75204E-4
12-121163729-G-T p.Arg14Leu missense ACADS 1 44992 2.22262E-5 22496 0 NA
12-121163729-G-A p.Arg14His missense ACADS 1 44994 2.22252E-5 22497 0 3.19754E-5
12-121163731-A-G p.Arg15Gly missense ACADS 1 44906 2.22687E-5 22453 0 6.51279E-6
12-121163734-G-GCTCTCTGTCCTAGGGCCTGGCGGCAGTTACACACCATCTACCAGTCT c.46_46+1insCTCTCTGTCCTAGGGCCTGGCGGCAGTTACACACCATCTACCAGTCT splice_donor ACADS 2 45072 4.43734E-5 22536 1 NA
12-121163734-G-GCTCTCTGTCCTAGGGCCTGGCGGCAGTTACACACCATCTACCA c.46_46+1insCTCTCTGTCCTAGGGCCTGGCGGCAGTTACACACCATCTACCA splice_donor ACADS 2 45074 4.43715E-5 22537 1 NA
12-121164823-C-A c.47-6C>A splice_region ACADS 1 83164 1.20244E-5 41582 0 7.95665E-6
12-121164829-C-T p.Ala16Val missense+splice_region ACADS 14 83194 1.68281E-4 41597 0 1.59256E-4
12-121164840-A-G p.Arg20Gly missense ACADS 1 83226 1.20155E-5 41613 0 6.37308E-5
12-121164847-G-T p.Trp22Leu missense ACADS 5 83220 6.00817E-5 41610 0 5.04032E-4
12-121164849-C-A p.Arg23Arg synonymous ACADS 7 83202 8.41326E-5 41601 0 3.18715E-5
12-121164850-G-C p.Arg23Pro missense ACADS 1 83222 1.20161E-5 41611 0 3.18796E-5
12-121164853-A-G p.Gln24Arg missense ACADS 1 83228 1.20152E-5 41614 0 NA
12-121164863-C-A p.Thr27Thr synonymous ACADS 1 83266 1.20097E-5 41633 0 NA
12-121164888-G-A p.Glu36Lys missense ACADS 4 83332 4.80008E-5 41666 1 3.97652E-6
12-121164894-C-T p.His38Tyr missense ACADS 2 83354 2.3994E-5 41677 0 3.97621E-6
12-121164899-G-T p.Gln39His missense ACADS 1 83350 1.19976E-5 41675 0 NA
12-121164900-A-T p.Met40Leu missense ACADS 2 83350 2.39952E-5 41675 0 3.18654E-5
12-121164903-TTGCTCCAGACA-T p.Leu42fs frameshift ACADS 3 83358 3.59893E-5 41679 0 3.18573E-5
12-121164906-C-T p.Leu42Phe missense ACADS 1 83352 1.19973E-5 41676 0 3.29457E-5
12-121164918-C-T p.Arg46Trp missense ACADS 13 83364 1.55943E-4 41682 0 1.59048E-4
12-121164919-G-A p.Arg46Gln missense ACADS 2 83368 2.399E-5 41684 0 2.47093E-5
12-121164927-G-A p.Ala49Thr missense ACADS 2 83370 2.39894E-5 41685 0 NA
12-121164929-C-G p.Ala49Ala synonymous ACADS 5 83374 5.99707E-5 41687 0 2.47093E-4
12-121164938-G-C p.Glu52Asp missense ACADS 1 83370 1.19947E-5 41685 0 NA
12-121164941-G-A p.Leu53Leu synonymous ACADS 1 83366 1.19953E-5 41683 0 8.23642E-6
12-121164943-T-C p.Phe54Ser missense ACADS 2 83372 2.39889E-5 41686 0 1.9881E-5
12-121164945-C-T p.Pro55Ser missense ACADS 1 83370 1.19947E-5 41685 0 7.95241E-6
12-121164962-G-C p.Val60Val synonymous ACADS 2 83366 2.39906E-5 41683 0 7.95248E-6
12-121164964-A-T p.Asp61Val missense ACADS 1 83360 1.19962E-5 41680 0 NA
12-121164971-A-T p.Glu63Asp missense ACADS 1 83368 1.1995E-5 41684 0 6.37349E-5
12-121164973-A-G p.His64Arg missense ACADS 1 83366 1.19953E-5 41683 0 NA
12-121164985-C-A p.Ala68Glu missense ACADS 1 83340 1.1999E-5 41670 0 3.18715E-5
12-121164985-C-T p.Ala68Val missense ACADS 5 83340 5.99952E-5 41670 0 6.3743E-5
12-121174796-A-T p.Lys73Met missense ACADS 3 81048 3.70151E-5 40524 0 2.75512E-5
12-121174803-C-A p.Gly75Gly synonymous ACADS 2 81166 2.46409E-5 40583 0 NA
12-121174803-C-T p.Gly75Gly synonymous ACADS 2 81164 2.46415E-5 40582 0 3.89914E-5
12-121174804-G-A p.Gly76Arg missense ACADS 1 81266 1.23053E-5 40633 0 3.18573E-5
12-121174808-T-C p.Leu77Pro missense ACADS 1 81322 1.22968E-5 40661 0 NA
12-121174827-C-T p.Asp83Asp synonymous ACADS 13 81598 1.59318E-4 40799 0 2.86679E-4
12-121174828-G-A p.Val84Met missense ACADS 4 81606 4.9016E-5 40803 0 9.5584E-5
12-121174831-C-T p.Pro85Ser missense ACADS 1 81594 1.22558E-5 40797 0 4.12109E-6
12-121174833-C-T p.Pro85Pro synonymous ACADS 7 81610 8.57738E-5 40805 0 1.07247E-4
12-121174834-G-A p.Glu86Lys missense ACADS 4 81644 4.89932E-5 40822 0 8.4968E-5
12-121174841-T-G p.Leu88Arg missense ACADS 1 81726 1.2236E-5 40863 0 NA
12-121174844-G-A p.Gly89Asp missense ACADS 2 81744 2.44666E-5 40872 0 NA
12-121174845-C-T p.Gly89Gly synonymous ACADS 3 81730 3.67062E-5 40865 0 6.37064E-5
12-121174846-G-A p.Gly90Ser missense ACADS 1 81744 1.22333E-5 40872 0 3.70911E-5
12-121174855-C-G p.Leu93Val missense ACADS 1 81734 1.22348E-5 40867 0 4.23155E-6
12-121174857-C-T p.Leu93Leu synonymous ACADS 2 81692 2.44822E-5 40846 0 6.37105E-5
12-121174858-G-A p.Asp94Asn missense ACADS 1 81704 1.22393E-5 40852 0 2.54576E-5
12-121174862-A-G p.Tyr95Cys missense ACADS 5 81684 6.12115E-5 40842 0 1.27429E-4
12-121174862-A-T p.Tyr95Phe missense ACADS 1 81684 1.22423E-5 40842 0 NA
12-121174872-C-T p.Tyr98Tyr synonymous ACADS 2 81678 2.44864E-5 40839 0 6.61253E-5
12-121174880-C-T p.Ala101Val missense ACADS 1 81648 1.22477E-5 40824 0 NA
12-121174882-A-G p.Met102Val missense ACADS 4 81630 4.90016E-5 40815 0 1.33883E-5
12-121174883-TGGA-T p.Glu104del conservative_inframe_deletion ACADS 3 81636 3.67485E-5 40818 0 2.20585E-5
12-121174883-T-C p.Met102Thr missense ACADS 1 81636 1.22495E-5 40818 0 8.8234E-6
12-121174886-A-G p.Glu103Gly missense ACADS 1 81646 1.2248E-5 40823 0 1.34742E-5
12-121174892-T-A p.Ile105Asn missense ACADS 2 81596 2.4511E-5 40798 0 NA
12-121174897-C-T p.Arg107Cys missense ACADS 122 81568 0.00149568 40784 1 0.00106187
12-121174898-G-A p.Arg107His missense ACADS 2 81552 2.45242E-5 40776 0 3.63088E-5
12-121174899-T-C p.Arg107Arg synonymous ACADS 41230 81078 0.508523 40539 10765 0.663125
12-121174899-T-G p.Arg107Arg synonymous ACADS 2 81558 2.45224E-5 40779 0 NA
12-121174905-C-T p.Cys109Cys synonymous ACADS 20 81568 2.45194E-4 40784 0 5.07614E-4
12-121174906-G-A p.Ala110Thr missense ACADS 6 81562 7.35637E-5 40781 0 5.71254E-5
12-121174910-C-G p.Ser111Cys missense ACADS 2 81584 2.45146E-5 40792 0 NA
12-121174913-C-A p.Thr112Asn missense ACADS 1 81584 1.22573E-5 40792 0 NA
12-121174914-C-T p.Thr112Thr synonymous ACADS 1 81556 1.22615E-5 40778 0 1.60591E-4
12-121174928-G-A p.Ser117Asn missense ACADS 1 81600 1.22549E-5 40800 0 4.91265E-6
12-121174935-C-T p.Asn119Asn synonymous ACADS 1 81568 1.22597E-5 40784 0 NA
12-121174938-C-T p.Asn120Asn splice_region+synonymous ACADS 1277 81506 0.0156676 40753 62 0.05625
12-121175185-G-A p.Lys129Lys synonymous ACADS 1 82898 1.2063E-5 41449 0 NA
12-121175194-C-T p.Ser132Ser synonymous ACADS 1 82964 1.20534E-5 41482 0 8.30979E-6
12-121175200-G-A p.Glu134Glu synonymous ACADS 1 82998 1.20485E-5 41499 0 NA
12-121175207-C-G p.Gln137Glu missense ACADS 3 83020 3.61359E-5 41510 0 3.18573E-5
12-121175211-C-T p.Ala138Val missense ACADS 10 83012 1.20465E-4 41506 0 1.27437E-4
12-121175212-G-A p.Ala138Ala synonymous ACADS 1 83036 1.2043E-5 41518 0 1.65799E-5
12-121175214-G-T p.Trp139Leu missense ACADS 2 83062 2.40784E-5 41531 0 3.97931E-6
12-121175215-G-C p.Trp139Cys missense ACADS 5 83044 6.0209E-5 41522 0 6.37267E-5
12-121175220-C-T p.Thr141Met missense ACADS 1 83044 1.20418E-5 41522 0 3.58126E-5
12-121175221-G-A p.Thr141Thr synonymous ACADS 172 83042 0.00207124 41521 3 0.00783839
12-121175223-C-G p.Pro142Arg missense ACADS 3 83046 3.61246E-5 41523 0 1.19364E-5
12-121175233-T-C p.Ser145Ser synonymous ACADS 2 83070 2.40761E-5 41535 0 3.18634E-5
12-121175234-G-A p.Gly146Ser missense ACADS 1 83064 1.20389E-5 41532 0 3.97899E-6
12-121175235-G-A p.Gly146Asp missense ACADS 1 83062 1.20392E-5 41531 0 1.1937E-5
12-121175237-G-A p.Asp147Asn missense ACADS 1 83074 1.20375E-5 41537 0 NA
12-121175247-G-A p.Gly150Asp missense ACADS 2 83036 2.40859E-5 41518 0 NA
12-121175258-C-T p.Leu154Phe missense ACADS 1 82932 1.20581E-5 41466 0 3.18593E-5
12-121175263-C-T p.Ser155Ser synonymous ACADS 16 82838 1.93148E-4 41419 0 4.46172E-4
12-121175264-G-A p.Glu156Lys missense ACADS 1 82832 1.20726E-5 41416 0 NA
12-121175267-C-T p.Pro157Ser missense ACADS 1 82802 1.2077E-5 41401 0 NA
12-121175270-G-GGGAACGGCA c.472+1_472+2insGAACGGCAG splice_donor ACADS 3 82758 3.62503E-5 41379 0 NA
12-121175272-T-TGATGCAGG c.472+2_472+3insGATGCAGG splice_region ACADS 1 82712 1.20901E-5 41356 0 NA
12-121175274-C-G c.472+4C>G splice_region ACADS 1 82694 1.20928E-5 41347 0 NA
12-121175608-G-T n.1142G>T splice_region ACADS 1 80696 1.23922E-5 40348 0 3.18878E-5
12-121175633-T-C c.473-7T>C splice_region ACADS 15 81674 1.83657E-4 40837 0 NA
12-121175636-G-T c.473-4G>T splice_region ACADS 1 81732 1.22351E-5 40866 0 NA
12-121175644-C-T p.Asn159Asn synonymous ACADS 1 81778 1.22282E-5 40889 0 8.31241E-6
12-121175645-G-A p.Gly160Ser missense ACADS 1 81848 1.22178E-5 40924 0 3.98915E-6
12-121175656-A-C p.Ala163Ala synonymous ACADS 6 82008 7.31636E-5 41004 0 5.03525E-4
12-121175656-AGGAGCTGCGTCCACCACCGCCC-A p.Ala165fs frameshift ACADS 1 82008 1.21939E-5 41004 0 8.30261E-6
12-121175671-C-T p.Thr168Thr synonymous ACADS 2 82194 2.43327E-5 41097 0 NA
12-121175674-CGCCCGGGCCGAGGGCG-C p.Ala170fs frameshift ACADS 1 82218 1.21628E-5 41109 0 NA
12-121175674-C-T p.Thr169Thr synonymous ACADS 2 82218 2.43256E-5 41109 0 1.19532E-5
12-121175675-G-T p.Ala170Ser missense ACADS 1 82246 1.21586E-5 41123 0 6.3804E-5
12-121175675-G-A p.Ala170Thr missense ACADS 1 82246 1.21586E-5 41123 0 8.28555E-6
12-121175678-C-T p.Arg171Trp missense ACADS 2641 82228 0.032118 41114 55 0.0328565
12-121175679-G-A p.Arg171Gln missense ACADS 6 82326 7.2881E-5 41163 0 1.65607E-5
12-121175683-C-T p.Ala172Ala synonymous ACADS 5 82362 6.07076E-5 41181 0 5.03525E-4
12-121175689-C-T p.Gly174Gly synonymous ACADS 72 82446 8.73299E-4 41223 0 0.00169091
12-121175690-G-A p.Asp175Asn missense ACADS 2 82478 2.42489E-5 41239 0 1.19439E-5
12-121175692-CT-C p.Ser176fs frameshift ACADS 1 82510 1.21197E-5 41255 0 NA
12-121175696-T-C p.Trp177Arg missense ACADS 74 82570 8.96209E-4 41285 0 0.00191522
12-121175697-G-T p.Trp177Leu missense ACADS 1 82596 1.21071E-5 41298 0 NA
12-121175728-C-T p.Thr187Thr synonymous ACADS 1 82704 1.20913E-5 41352 0 NA
12-121175737-G-A p.Trp190* stop_gained ACADS 1 82756 1.20837E-5 41378 0 NA
12-121175742-C-T p.Ala192Val missense ACADS 3 82734 3.62608E-5 41367 0 9.55779E-5
12-121175752-C-T p.Ala195Ala synonymous ACADS 2 82762 2.41657E-5 41381 0 4.13175E-5
12-121175753-G-A p.Val196Met missense ACADS 1 82762 1.20828E-5 41381 0 0.00151057
12-121175763-C-T p.Ala199Val missense ACADS 3 82774 3.62433E-5 41387 0 0.00125
12-121175769-C-T p.Thr201Met missense ACADS 3 82774 3.62433E-5 41387 0 1.65546E-5
12-121175791-G-GGGCATCA c.624_624+1insGGCATCA splice_donor ACADS 1 82688 1.20937E-5 41344 0 NA
12-121175797-C-T c.624+6C>T splice_region ACADS 1 82618 1.21039E-5 41309 0 NA
12-121175799-C-T c.624+8C>T splice_region ACADS 52 82646 6.2919E-4 41323 0 5.42775E-4
12-121175844-G-T c.473-8G>T splice_region ACADS 1 82274 1.21545E-5 41137 0 NA
12-121175855-C-T p.Pro159Leu missense ACADS 3 81948 3.66086E-5 40974 0 2.99475E-4
12-121175870-C-T p.Pro164Leu missense ACADS 7 81336 8.60628E-5 40668 0 3.00913E-4
12-121175873-C-G p.Thr165Ser missense ACADS 1 81234 1.23101E-5 40617 0 NA
12-121175877-A-C p.Gly166Gly synonymous ACADS 3 81054 3.70124E-5 40527 0 3.19468E-5
12-121175878-C-A p.Pro167Thr missense ACADS 10 81074 1.23344E-4 40537 0 6.25E-4
12-121175881-A-G p.Ile168Val missense ACADS 1 80984 1.23481E-5 40492 0 1.54488E-5
12-121175886-T-C p.Phe169Phe synonymous ACADS 2 80778 2.47592E-5 40389 1 NA
12-121175888-C-T p.Ala170Val missense ACADS 9 80634 1.11615E-4 40317 0 9.58222E-5
12-121175891-TG-T p.Gln173fs frameshift ACADS 2 80562 2.48256E-5 40281 0 1.54667E-4
12-121175935-G-A p.Ala186Thr missense ACADS 2 79602 2.5125E-5 39801 0 5.68925E-6
12-121175936-C-A p.Ala186Asp missense ACADS 2 79604 2.51244E-5 39802 0 2.93307E-5
12-121175939-G-T p.Cys187Phe missense ACADS 1 79620 1.25597E-5 39810 0 5.68434E-6
12-121175942-C-T p.Thr188Ile missense ACADS 1 79642 1.25562E-5 39821 0 3.18654E-5
12-121175950-AG-TT p.Arg191Leu missense ACADS 2 79618 2.51199E-5 39809 0 NA
12-121175950-A-T p.Arg191* stop_gained ACADS 1 79618 1.256E-5 39809 0 1.69841E-5
12-121175951-G-T p.Arg191Ile missense ACADS 1 79604 1.25622E-5 39802 0 1.68936E-5
12-121175956-C-T p.Arg193Trp missense ACADS 3 79570 3.77027E-5 39785 0 6.37674E-5
12-121175957-G-A p.Arg193Gln missense ACADS 1 79586 1.2565E-5 39793 0 NA
12-121175984-T-C p.Leu202Pro missense ACADS 40262 79608 0.505753 39804 10532 0.663125
12-121175984-TG-CA p.Leu202Pro missense ACADS 75 80438 9.32395E-4 40219 2 NA
12-121175985-G-A p.Leu202Leu synonymous ACADS 91 80556 0.00112965 40278 0 0.00551342
12-121175994-G-A c.612+3G>A splice_region ACADS 7 80790 8.66444E-5 40395 0 1.63124E-4
12-121175997-G-T c.612+6G>T splice_region ACADS 1 80848 1.23689E-5 40424 0 NA
12-121176076-C-T c.625-7C>T splice_region ACADS 9 82940 1.08512E-4 41470 0 3.30579E-5
12-121176083-G-A p.Gly209Ser missense+splice_region ACADS 21679 82726 0.262058 41363 3158 0.344375
12-121176112-AA-CT p.ProThr218ProSer missense ACADS 20 83104 2.40662E-4 41552 0 NA
12-121176114-C-T p.Thr219Met missense ACADS 4 83108 4.81301E-5 41554 0 1.91131E-4
12-121176115-G-A p.Thr219Thr synonymous ACADS 1 83100 1.20337E-5 41550 0 1.64891E-5
12-121176121-G-T p.Gly221Gly synonymous ACADS 8 83120 9.62464E-5 41560 1 4.137E-4
12-121176126-C-T p.Thr223Met missense ACADS 6 83128 7.21778E-5 41564 0 6.37552E-5
12-121176127-G-A p.Thr223Thr synonymous ACADS 12 83132 1.44349E-4 41566 0 0.00151057
12-121176128-T-C p.Leu224Leu synonymous ACADS 1 83118 1.20311E-5 41559 0 1.1932E-5
12-121176130-G-A p.Leu224Leu synonymous ACADS 12 83130 1.44352E-4 41565 0 9.56389E-5
12-121176138-AAG-A p.Glu228fs frameshift ACADS 5 83148 6.01337E-5 41574 0 NA
12-121176140-G-A p.Glu228Lys missense ACADS 3 83146 3.60811E-5 41573 0 1.98878E-5
12-121176155-A-C p.Ile233Leu missense ACADS 1 83076 1.20372E-5 41538 0 3.97741E-6
12-121176158-C-T p.Arg234Trp missense ACADS 1 83074 1.20375E-5 41537 0 6.37471E-5
12-121176161-G-T p.Gly235Cys missense ACADS 2 83056 2.40801E-5 41528 0 NA
12-121176198-G-C p.Arg247Pro missense ACADS 1 83024 1.20447E-5 41512 0 3.31115E-5
12-121176220-G-C p.Leu254Leu synonymous ACADS 1 82902 1.20624E-5 41451 0 1.66528E-5
12-121176232-G-A p.Gly258Gly synonymous ACADS 1 82822 1.20741E-5 41411 0 NA
12-121176241-C-T p.Phe261Phe synonymous ACADS 2 82690 2.41867E-5 41345 0 2.01342E-4
12-121176252-TGGTGAGCCCGGCAGTGGGGGTGGCACCTTGAGGCCAGGCCCGCGCCCCGGCTGGCGGGCCACTGACCAGGGCGGTCCCCACA-T p.Met265fs frameshift ACADS 9 82552 1.09022E-4 41276 1 NA
12-121176259-C-T c.795+6C>T splice_region ACADS 4 82382 4.85543E-5 41191 0 1.91424E-4
12-121176261-C-T c.795+8C>T splice_region ACADS 3 82308 3.64485E-5 41154 0 4.24845E-5
12-121176341-C-A p.Thr267Thr synonymous ACADS 4 81960 4.88043E-5 40980 0 1.21813E-5
12-121176347-C-T p.Asp269Asp synonymous ACADS 1 81990 1.21966E-5 40995 0 NA
12-121176352-G-T p.Gly271Val missense ACADS 2 81894 2.44218E-5 40947 0 1.21293E-5
12-121176354-C-T p.Arg272Cys missense ACADS 3 81856 3.66497E-5 40928 0 4.19294E-5
12-121176355-G-A p.Arg272His missense ACADS 4 81812 4.88926E-5 40906 0 3.35216E-5
12-121176357-AT-A p.Ile273fs frameshift ACADS 1 81890 1.22115E-5 40945 0 NA
12-121176359-C-T p.Ile273Ile synonymous ACADS 5 81876 6.1068E-5 40938 0 1.276E-4
12-121176360-G-A p.Gly274Ser missense ACADS 2 81880 2.4426E-5 40940 0 3.33767E-5
12-121176362-C-T p.Gly274Gly synonymous ACADS 1 81902 1.22097E-5 40951 0 4.02483E-6
12-121176365-C-T p.Ile275Ile synonymous ACADS 13 81906 1.58719E-4 40953 0 6.0318E-5
12-121176366-G-A p.Ala276Thr missense ACADS 4 81800 4.88998E-5 40900 0 2.49675E-5
12-121176382-G-C p.Gly281Ala missense ACADS 2 81816 2.44451E-5 40908 0 6.37796E-5
12-121176388-C-A p.Ala283Asp missense ACADS 1 81820 1.2222E-5 40910 0 NA
12-121176395-C-T p.Thr285Thr synonymous ACADS 5 81772 6.11456E-5 40886 0 1.59388E-4
12-121176396-G-A p.Ala286Thr missense ACADS 2 81726 2.4472E-5 40863 0 8.26747E-6
12-121176401-C-T p.Leu287Leu synonymous ACADS 1 81788 1.22267E-5 40894 0 5.03525E-4
12-121176411-G-A p.Val291Met missense ACADS 1 81868 1.22148E-5 40934 0 NA
12-121176419-C-T p.Tyr293Tyr synonymous ACADS 3 81832 3.66605E-5 40916 0 3.18634E-5
12-121176428-T-C p.Asn296Asn synonymous ACADS 1 81814 1.22228E-5 40907 0 3.18654E-5
12-121176440-C-T p.Phe300Phe synonymous ACADS 2 81714 2.44756E-5 40857 0 4.12596E-5
12-121176445-C-T p.Ala302Val missense ACADS 1 81552 1.22621E-5 40776 0 9.90148E-5
12-121176446-G-A p.Ala302Ala synonymous ACADS 4 81566 4.904E-5 40783 0 6.25E-4
12-121176455-C-G p.Thr305Thr synonymous ACADS 1 81882 1.22127E-5 40941 0 NA
12-121176473-G-GTTCAA c.933_933+1insTTCAA splice_donor ACADS 1 82156 1.2172E-5 41078 0 NA
12-121176477-ATGG-A c.933+5_933+7delTGG splice_region ACADS 1 82192 1.21666E-5 41096 0 NA
12-121176478-T-C c.933+5T>C splice_region ACADS 3 82192 3.64999E-5 41096 0 8.25369E-5
12-121176616-A-G c.934-7A>G splice_region ACADS 1 82496 1.21218E-5 41248 0 2.48773E-5
12-121176617-T-C c.934-6T>C splice_region ACADS 2 82506 2.42407E-5 41253 0 8.29105E-6
12-121176631-GGCA-G p.Ala315del disruptive_inframe_deletion ACADS 1 82506 1.21203E-5 41253 0 NA
12-121176659-G-A p.Ala324Thr missense ACADS 1 82232 1.21607E-5 41116 0 NA
12-121176662-C-T p.Arg325Trp missense ACADS 4 82208 4.86571E-5 41104 0 2.48913E-5
12-121176667-G-A p.Leu326Leu synonymous ACADS 1 82102 1.218E-5 41051 0 NA
12-121176677-C-T p.Arg330Cys missense ACADS 24 81780 2.9347E-4 40890 0 5.03525E-4
12-121176677-CGC-TGT p.Arg330Cys missense ACADS 6 81782 7.33658E-5 40891 0 NA
12-121176678-G-A p.Arg330His missense ACADS 11 81790 1.34491E-4 40895 0 1.27445E-4
12-121176679-C-T p.Arg330Arg synonymous ACADS 43747 80934 0.540527 40467 12668 0.664375
12-121176679-CG-TT p.ArgAla330ArgSer missense ACADS 1 81772 1.22291E-5 40886 0 NA
12-121176680-G-A p.Ala331Thr missense ACADS 1 81712 1.22381E-5 40856 0 3.18593E-5
12-121176681-C-T p.Ala331Val missense ACADS 1 81686 1.2242E-5 40843 0 3.18674E-5
12-121176726-C-A c.1029+8C>A splice_region ACADS 1 79854 1.25229E-5 39927 0 4.03548E-6
12-121176937-GT-G c.1030-5delT splice_region ACADS 1 81520 1.22669E-5 40760 0 NA
12-121176944-A-G p.Glu344Gly missense+splice_region ACADS 2 81522 2.45333E-5 40761 0 1.03324E-4
12-121176963-G-T p.Leu350Leu synonymous ACADS 2 81548 2.45254E-5 40774 1 5.25898E-5
12-121176965-C-A p.Ala351Asp missense ACADS 1 81502 1.22696E-5 40751 0 NA
12-121176966-C-T p.Ala351Ala synonymous ACADS 12 81496 1.47246E-4 40748 0 4.46457E-4
12-121176967-G-T p.Ala352Ser missense ACADS 2 81484 2.45447E-5 40742 0 3.18979E-5
12-121176967-G-A p.Ala352Thr missense ACADS 2 81484 2.45447E-5 40742 0 5.03525E-4
12-121176971-C-T p.Ser353Leu missense ACADS 10 81502 1.22696E-4 40751 0 2.23385E-4
12-121176978-C-T p.Ala355Ala synonymous ACADS 3 81478 3.68198E-5 40739 0 3.1904E-5
12-121176980-C-T p.Ala356Val missense ACADS 6 81436 7.36775E-5 40718 0 4.05331E-6
12-121176981-G-A p.Ala356Ala synonymous ACADS 1 81444 1.22784E-5 40722 0 4.05173E-6
12-121176991-A-G p.Ser360Gly missense ACADS 25 81454 3.06922E-4 40727 0 3.19E-5
12-121176996-CCAGGTGAGTGTCCACAGTGAGCTCTGAGGGGGCCAGCTGCCCCTTCTCCAGCTTTCCCCACGCCGGGGTCTTCTCCCTCCTGAGCCACTGTTCTCATCT-C p.Gln362del splice_donor ACADS 10 81394 1.22859E-4 40697 2 NA
12-121177004-G-A c.1086+5G>A splice_region ACADS 1 81292 1.23013E-5 40646 0 6.25E-4
12-121177107-G-T p.Gln365His missense ACADS 8 81096 9.86485E-5 40548 0 9.56023E-5
12-121177110-C-T p.Ile366Ile synonymous ACADS 1 81138 1.23247E-5 40569 0 NA
12-121177116-C-T p.Gly368Gly synonymous ACADS 4 81250 4.92308E-5 40625 0 1.55229E-4
12-121177117-G-A p.Gly369Ser missense ACADS 1 81322 1.22968E-5 40661 0 3.18776E-5
12-121177120-A-G p.Met370Val missense ACADS 44 81454 5.40182E-4 40727 1 0.00625
12-121177141-C-T p.Pro377Ser missense ACADS 1 81786 1.2227E-5 40893 0 NA
12-121177142-C-T p.Pro377Leu missense ACADS 2 81810 2.44469E-5 40905 0 6.90131E-5
12-121177143-G-A p.Pro377Pro synonymous ACADS 2 81864 2.44308E-5 40932 0 3.18837E-5
12-121177150-C-T p.Arg380Trp missense ACADS 3 81896 3.66318E-5 40948 0 9.26553E-5
12-121177155-C-T p.His381His synonymous ACADS 1 81896 1.22106E-5 40948 0 NA
12-121177159-C-T p.Arg383Cys missense ACADS 19 81906 2.31973E-4 40953 0 0.00151057
12-121177160-G-A p.Arg383His missense ACADS 3 81866 3.66452E-5 40933 0 NA
12-121177161-C-T p.Arg383Arg synonymous ACADS 3 81858 3.66488E-5 40929 0 3.18898E-5
12-121177164-C-T p.Asp384Asp synonymous ACADS 5 81812 6.11157E-5 40906 0 9.56511E-5
12-121177165-G-T p.Ala385Ser missense ACADS 6 81756 7.33891E-5 40878 0 4.32728E-5
12-121177165-G-A p.Ala385Thr missense ACADS 2 81756 2.4463E-5 40878 0 3.18878E-5
12-121177168-C-T p.Arg386Cys missense ACADS 4 81884 4.88496E-5 40942 0 0.001875
12-121177169-G-A p.Arg386His missense ACADS 4 81830 4.88818E-5 40915 0 5.03525E-4
12-121177185-C-T p.Tyr391Tyr synonymous ACADS 1 81442 1.22787E-5 40721 0 3.47729E-5
12-121177197-C-T p.Ser395Ser synonymous ACADS 1 80870 1.23655E-5 40435 0 2.87008E-4
12-121177204-C-T p.Gln398* stop_gained ACADS 3 80534 3.72513E-5 40267 0 6.37592E-5
12-121177206-G-A p.Gln398Gln synonymous ACADS 2 80254 2.49209E-5 40127 0 NA
12-121177207-C-T p.Arg399Trp missense ACADS 4 80084 4.99476E-5 40042 0 8.82659E-6
12-121177207-C-A p.Arg399Arg synonymous ACADS 2 80084 2.49738E-5 40042 0 3.19E-5
12-121177208-G-A p.Arg399Gln missense ACADS 4 80038 4.99763E-5 40019 0 8.1361E-6
12-121177208-GGC-AGA p.ArgLeu399GlnMet missense ACADS 1 80038 1.24941E-5 40019 0 NA
12-121177210-C-G p.Leu400Val missense ACADS 1 79868 1.25207E-5 39934 0 1.14166E-4
12-121177218-C-T p.Ile402Ile synonymous ACADS 3 78752 3.80943E-5 39376 0 1.78814E-5
12-121177219-G-A p.Ala403Thr missense ACADS 6 78356 7.65736E-5 39178 0 1.60399E-4
12-121177222-G-A p.Gly404Arg missense ACADS 2 78014 2.56364E-5 39007 0 2.15123E-4
12-121177243-C-T p.Arg411Trp missense ACADS 5 74248 6.73419E-5 37124 0 2.08931E-5
12-121177244-G-A p.Arg411Gln missense ACADS 2 74092 2.69935E-5 37046 0 3.75814E-5
12-121177395-C-T c.*144C>T splice_region ACADS 1 40448 2.47231E-5 20224 0 NA