Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
1-76190093-C-T c.-380C>T 5_prime_UTR_premature_start_codon_gain ACADM 1 814 0.0012285 407 0 3.2002E-5
1-76190140-C-T c.-333C>T 5_prime_UTR_premature_start_codon_gain ACADM 1 4662 2.145E-4 2331 0 NA
1-76190165-G-A c.-308G>A 5_prime_UTR_premature_start_codon_gain ACADM 1 14408 6.94059E-5 7204 0 NA
1-76190207-C-T c.-266C>T 5_prime_UTR_premature_start_codon_gain ACADM 8 39538 2.02337E-4 19769 0 6.37918E-5
1-76190244-C-T c.-229C>T 5_prime_UTR_premature_start_codon_gain ACADM 1 53410 1.87231E-5 26705 0 NA
1-76190251-C-T c.-222C>T 5_prime_UTR_premature_start_codon_gain ACADM 2 55088 3.63055E-5 27544 0 NA
1-76190311-A-G c.-162A>G 5_prime_UTR_premature_start_codon_gain ACADM 1 69260 1.44383E-5 34630 0 NA
1-76190323-C-T c.-150C>T 5_prime_UTR_premature_start_codon_gain ACADM 1 72020 1.3885E-5 36010 0 0.0012987
1-76190342-C-T c.-131C>T 5_prime_UTR_premature_start_codon_gain ACADM 2 75002 2.6666E-5 37501 0 NA
1-76190347-C-G c.-126C>G 5_prime_UTR_premature_start_codon_gain ACADM 2 75914 2.63456E-5 37957 0 NA
1-76190374-G-T c.-99G>T 5_prime_UTR_premature_start_codon_gain ACADM 1 78230 1.27828E-5 39115 0 NA
1-76190404-C-T c.-69C>T 5_prime_UTR_premature_start_codon_gain ACADM 3 80890 3.70874E-5 40445 0 3.18918E-5
1-76190410-C-T c.-63C>T 5_prime_UTR_premature_start_codon_gain ACADM 1 80964 1.23512E-5 40482 0 3.1904E-5
1-76190435-C-T c.-38C>T 5_prime_UTR_premature_start_codon_gain ACADM 5 81928 6.10292E-5 40964 0 6.37959E-5
1-76190444-T-C c.-29T>C 5_prime_UTR_premature_start_codon_gain ACADM 1 82122 1.2177E-5 41061 0 6.37714E-5
1-76190457-C-T c.-16C>T 5_prime_UTR_premature_start_codon_gain ACADM 5 81826 6.11053E-5 40913 0 6.25E-4
1-76190478-A-G p.Ala2Ala synonymous ACADM 2 81584 2.45146E-5 40792 0 NA
1-76190484-G-C p.Gly4Gly synonymous ACADM 1 81366 1.22901E-5 40683 0 1.77189E-5
1-76190489-G-A p.Gly6Glu missense ACADM 1 81358 1.22914E-5 40679 0 8.87469E-6
1-76190493-A-G p.Met1? start_lost ACADM 3 81080 3.70005E-5 40540 0 6.25E-4
1-76190494-T-C p.Met1? start_lost ACADM 1 81170 1.23198E-5 40585 0 8.89616E-6
1-76190504-T-C c.30+2T>C splice_donor ACADM 2 80460 2.48571E-5 40230 0 8.93447E-6
1-76190505-G-A c.30+3G>A splice_region ACADM 1 80672 1.23959E-5 40336 0 NA
1-76190510-G-A c.30+8G>A splice_region ACADM 1 80348 1.24459E-5 40174 0 NA
1-76194074-T-G p.Cys11Gly missense+splice_region ACADM 3 83212 3.60525E-5 41606 0 NA
1-76194081-T-C p.Leu13Ser missense ACADM 1 83270 1.20091E-5 41635 0 NA
1-76194104-C-A p.Arg17Ser missense ACADM 1 83342 1.19988E-5 41671 0 NA
1-76194104-C-T p.Arg17Cys missense ACADM 1 83342 1.19988E-5 41671 0 1.59233E-5
1-76194112-T-C p.His19His synonymous ACADM 2 83340 2.39981E-5 41670 0 3.1841E-5
1-76194126-A-G p.His24Arg missense ACADM 2 83356 2.39935E-5 41678 0 1.19325E-5
1-76194128-A-G p.Thr25Ala missense ACADM 2 83356 2.39935E-5 41678 0 NA
1-76194138-A-G p.Asn28Ser missense ACADM 2 83358 2.39929E-5 41679 0 2.47145E-5
1-76194141-G-A p.Arg29Gln missense ACADM 1 83356 1.19967E-5 41678 0 3.29527E-5
1-76194145-A-G p.Gln30Gln synonymous ACADM 1 83356 1.19967E-5 41678 0 1.19322E-5
1-76194147-G-A p.Arg31His missense ACADM 2 83348 2.39958E-5 41674 0 6.59087E-5
1-76194150-A-G p.Glu32Gly missense ACADM 1 83342 1.19988E-5 41671 0 1.64769E-5
1-76194153-C-G p.Pro33Arg missense ACADM 1 83342 1.19988E-5 41671 0 NA
1-76194157-A-ATTAGGAT p.Ser38fs frameshift ACADM 1 83342 1.19988E-5 41671 0 NA
1-76198317-A-ATTT c.119-10_119-8dupTTT splice_region ACADM 2 83056 2.40801E-5 41528 0 2.79207E-5
1-76198336-C-T p.Pro13Leu missense ACADM 1 83252 1.20117E-5 41626 0 3.98115E-5
1-76198337-G-A p.Glu43Lys missense ACADM 217 83244 0.00260679 41622 1 0.00403633
1-76198341-A-G p.Gln44Arg missense ACADM 5 83254 6.00572E-5 41627 1 4.96311E-5
1-76198344-A-G p.Gln45Arg missense ACADM 6 83276 7.20496E-5 41638 0 1.59194E-5
1-76198367-C-T p.Arg53Cys missense ACADM 2 83310 2.40067E-5 41655 0 3.18291E-5
1-76198376-GC-G p.Arg57fs frameshift ACADM 1 83310 1.20034E-5 41655 0 NA
1-76198377-C-A p.Ala56Asp missense ACADM 1 83312 1.20031E-5 41656 0 3.97867E-6
1-76198396-A-G p.Gln33Arg missense ACADM 1 83322 1.20016E-5 41661 0 3.1835E-5
1-76198397-G-C p.Val63Leu missense ACADM 10 83320 1.20019E-4 41660 0 1.59215E-4
1-76198405-A-C p.Gln36Pro missense ACADM 2 83332 2.40004E-5 41666 0 1.98957E-5
1-76198408-A-G p.Asn37Ser missense ACADM 1 83330 1.20005E-5 41665 0 5.04541E-4
1-76198409-T-C p.Tyr67His missense ACADM 33 83328 3.96025E-4 41664 0 6.11065E-4
1-76198411-T-A p.Tyr67* stop_gained ACADM 1 83332 1.20002E-5 41666 0 NA
1-76198420-T-G p.Leu41Arg missense ACADM 13 83324 1.56017E-4 41662 0 8.25982E-5
1-76198424-G-A p.Glu72Lys missense+splice_region ACADM 12 83328 1.44009E-4 41664 0 3.50296E-4
1-76198426-AGTAGGTATATACATTTTAAAGAGGGAAAAATCTTTTACATTTTTTACAAGATTATGTAATCAAACTATCTGGATTTCAAAATATATTTTAACTCAGTTCTTTTTCTTCTAG-A c.216+1_217-1del splice_acceptor ACADM 14 83320 1.68027E-4 41660 7 NA
1-76198427-G-T c.216+1G>T splice_donor ACADM 1 83308 1.20036E-5 41654 0 NA
1-76198433-A-G c.216+7A>G splice_region ACADM 3 83298 3.60153E-5 41649 0 6.3674E-5
1-76198522-G-A c.217-1G>A splice_acceptor ACADM 1 83226 1.20155E-5 41613 0 NA
1-76198550-C-G p.Leu77Val missense ACADM 1 83264 1.201E-5 41632 0 NA
1-76198554-T-C p.Ile78Thr missense ACADM 1 83268 1.20094E-5 41634 0 3.18431E-5
1-76198555-T-G p.Ter46Gluext*? stop_lost ACADM 1 83268 1.20094E-5 41634 0 3.98276E-6
1-76198564-C-CT p.Trp82fs frameshift ACADM 7 83262 8.4072E-5 41631 0 2.4809E-5
1-76198571-C-T p.Leu84Phe missense ACADM 6 83254 7.20686E-5 41627 0 7.16658E-5
1-76198574-G-T p.Gly85Cys missense ACADM 1 83252 1.20117E-5 41626 0 3.18654E-5
1-76198574-G-C p.Gly85Arg missense ACADM 1 83252 1.20117E-5 41626 0 NA
1-76198575-G-A p.Gly85Asp missense ACADM 1 83248 1.20123E-5 41624 0 NA
1-76198586-A-G p.Thr89Ala missense ACADM 2 83234 2.40286E-5 41617 0 2.48057E-5
1-76198587-C-T p.Thr89Ile missense ACADM 1 83230 1.20149E-5 41615 0 NA
1-76198598-G-A p.Glu93Lys missense ACADM 2 83228 2.40304E-5 41614 0 1.65429E-5
1-76198600-G-A p.Glu93Glu synonymous ACADM 1 83234 1.20143E-5 41617 0 NA
1-76198601-A-G p.Asn94Asp missense ACADM 1 83230 1.20149E-5 41615 0 3.9826E-6
1-76198606-T-TGGA c.286+1_286+2insAGG splice_donor ACADM 1 83202 1.20189E-5 41601 0 NA
1-76198607-G-C p.Asp96His missense+splice_region ACADM 1 83204 1.20187E-5 41602 0 NA
1-76198608-G-GAGGTCTTGGACTTGGAACTTTTGATGCTTGTTTAAT c.286+1_286+2insAGGTCTTGGACTTGGAACTTTTGATGCTTGTTTAAT splice_donor ACADM 2 83206 2.40367E-5 41603 1 NA
1-76198613-C-T c.286+6C>T splice_region ACADM 1 83156 1.20256E-5 41578 0 3.98635E-6
1-76198740-C-T p.Tyr97Tyr synonymous ACADM 4 77850 5.13809E-5 38925 0 4.26738E-5
1-76198758-G-C p.Leu103Phe missense ACADM 1 76286 1.31086E-5 38143 0 NA
1-76198765-T-C p.Cys106Arg missense ACADM 5 75778 6.59822E-5 37889 0 5.99633E-5
1-76198766-G-C p.Cys106Ser missense ACADM 1 75606 1.32265E-5 37803 0 NA
1-76198779-A-G p.Leu110Leu synonymous ACADM 2 74124 2.69818E-5 37062 0 NA
1-76198784-C-T p.Ala112Val missense ACADM 4 73092 5.47256E-5 36546 0 5.72869E-5
1-76198785-G-A p.Ala112Ala synonymous ACADM 20624 71516 0.288383 35758 2788 0.295879
1-76198791-CCTT-C p.Leu117del disruptive_inframe_deletion ACADM 2 72690 2.75141E-5 36345 0 3.18674E-5
1-76198797-T-C p.Leu116Leu synonymous ACADM 3 71962 4.16887E-5 35981 0 2.07501E-4
1-76198800-A-C p.Leu117Leu synonymous ACADM 4 71516 5.59315E-5 35758 0 1.73034E-5
1-76198830-C-A p.Asn127Lys missense ACADM 3 68254 4.39535E-5 34127 0 NA
1-76198831-C-A p.Leu128Ile missense ACADM 8 68138 1.17409E-4 34069 0 1.27356E-4
1-76198831-C-T p.Leu128Phe missense ACADM 2 68138 2.93522E-5 34069 0 8.71232E-6
1-76198839-C-T c.385+5C>T splice_region ACADM 1 67202 1.48805E-5 33601 0 NA
1-76199205-T-TA c.386-7dupA splice_region ACADM 1 83226 1.20155E-5 41613 0 NA
1-76199229-A-T p.Gly134Gly synonymous ACADM 1 83308 1.20036E-5 41654 0 NA
1-76199246-T-C p.Leu140Ser missense ACADM 1 83338 1.19993E-5 41669 0 1.19318E-5
1-76199273-G-A p.Cys149Tyr missense ACADM 7 83334 8.39993E-5 41667 0 7.95418E-6
1-76199277-A-C p.Thr150Thr synonymous ACADM 2921 83286 0.0350719 41643 97 0.0491208
1-76199288-C-T p.Thr154Ile missense ACADM 1 83328 1.20008E-5 41664 0 6.25E-4
1-76199289-T-C p.Thr154Thr synonymous ACADM 1 83332 1.20002E-5 41666 0 1.19319E-5
1-76199292-T-A p.Ala155Ala synonymous ACADM 1 83328 1.20008E-5 41664 0 NA
1-76199309-TG-T p.Asn159fs frameshift ACADM 1 83286 1.20068E-5 41643 0 1.64802E-5
1-76199313-G-GCAAATGCCTATTATTATTGCTGGAAATGATCAACAAAAGAAGAA c.486_486+1insCAAATGCCTATTATTATTGCTGGAAATGATCAACAAAAGAAGAA splice_donor ACADM 1 83274 1.20085E-5 41637 0 NA
1-76199313-G-A p.Gly162Gly splice_region+synonymous ACADM 1 83278 1.2008E-5 41639 0 NA
1-76200470-C-T c.487-6C>T splice_region ACADM 2 83136 2.4057E-5 41568 0 3.18857E-5
1-76200481-G-A p.Met164Ile missense ACADM 7 83210 8.41245E-5 41605 0 8.81228E-6
1-76200483-C-CTAG p.Ala98_Tyr99insTer stop_gained ACADM 2 83222 2.40321E-5 41611 0 NA
1-76200483-CTAT-C p.Tyr101del disruptive_inframe_deletion ACADM 1 83222 1.20161E-5 41611 0 NA
1-76200490-T-A p.Tyr101Asn missense ACADM 1 83244 1.20129E-5 41622 0 8.62039E-6
1-76200492-T-C p.Ile168Thr missense ACADM 1 83254 1.20114E-5 41627 0 3.43843E-5
1-76200501-A-G p.Asn171Ser missense ACADM 1 83284 1.20071E-5 41642 0 NA
1-76200504-A-G p.Ter105Trpext*? stop_lost ACADM 2 83272 2.40177E-5 41636 0 8.45866E-6
1-76200513-AG-A p.Lys176fs frameshift ACADM 1 83280 1.20077E-5 41640 0 9.55597E-5
1-76200514-G-A p.Lys175Lys synonymous ACADM 2 83282 2.40148E-5 41641 0 6.36983E-5
1-76200517-GAAGT-G p.Lys177fs frameshift ACADM 1 83300 1.20048E-5 41650 0 NA
1-76200518-A-T p.Lys177* stop_gained ACADM 1 83302 1.20045E-5 41651 0 NA
1-76200521-T-C p.Tyr178His missense ACADM 1 83310 1.20034E-5 41655 0 NA
1-76200522-AT-A p.Leu179fs frameshift ACADM 1 83304 1.20042E-5 41652 0 8.411E-6
1-76200526-G-A p.Leu179Leu synonymous ACADM 1 83314 1.20028E-5 41657 0 NA
1-76200529-G-T p.Gly180Gly synonymous ACADM 1 83318 1.20022E-5 41659 0 NA
1-76200531-G-A p.Arg181Lys missense ACADM 3 83318 3.60066E-5 41659 0 1.39265E-4
1-76200533-ATGAC-A p.Thr183fs frameshift ACADM 2 83312 2.40061E-5 41656 0 0.00100705
1-76200535-G-T p.Met182Ile missense ACADM 1 83310 1.20034E-5 41655 0 8.4364E-6
1-76200544-G-A p.Glu185Glu synonymous ACADM 2 83302 2.4009E-5 41651 0 1.592E-5
1-76200548-T-C p.Leu187Leu synonymous ACADM 1 83302 1.20045E-5 41651 0 NA
1-76200552-T-C p.Met188Thr missense ACADM 2 83302 2.4009E-5 41651 0 3.18492E-5
1-76200557-G-A c.567+1G>A splice_donor ACADM 1 83288 1.20065E-5 41644 0 8.59166E-6
1-76200557-G-GC c.567+1_567+2insC splice_donor ACADM 2 83288 2.40131E-5 41644 1 NA
1-76200558-T-G c.567+2T>G splice_donor ACADM 2 83264 2.402E-5 41632 0 NA
1-76205665-G-A p.Ala190Thr missense+splice_region ACADM 2 83228 2.40304E-5 41614 0 NA
1-76205670-T-C c.-94T>C 5_prime_UTR_premature_start_codon_gain ACADM 1 83242 1.20132E-5 41621 0 3.18451E-5
1-76205684-C-A p.Pro196His missense ACADM 1 83268 1.20094E-5 41634 0 NA
1-76205685-T-G p.Trp47Gly missense ACADM 811 83256 0.00974104 41628 15 0.0203438
1-76205689-G-A p.Ala198Thr missense ACADM 2 83266 2.40194E-5 41633 0 7.96724E-6
1-76205696-C-G p.Ser200Cys missense ACADM 1 83284 1.20071E-5 41642 0 NA
1-76205699-A-C p.Ter51Cysext*? stop_lost ACADM 2 83286 2.40136E-5 41643 0 1.59175E-5
1-76205700-T-C p.Asp201Asp synonymous ACADM 1 83292 1.2006E-5 41646 0 NA
1-76205704-G-T p.Ala203Ser missense ACADM 2 83288 2.40131E-5 41644 0 1.27348E-4
1-76205710-A-G p.Ile205Val missense ACADM 1 83298 1.20051E-5 41649 0 3.9781E-6
1-76205722-G-T p.Ala209Ser missense ACADM 17 83310 2.04057E-4 41655 0 3.82239E-4
1-76205722-G-A p.Ala209Thr missense ACADM 1 83310 1.20034E-5 41655 0 3.18532E-5
1-76205728-A-C p.Lys211Gln missense ACADM 1 83306 1.20039E-5 41653 0 1.98883E-5
1-76205738-A-G p.Asp214Gly missense ACADM 1 83296 1.20054E-5 41648 0 NA
1-76205749-A-G p.Ile218Val missense ACADM 1 83284 1.20071E-5 41642 0 1.98872E-5
1-76205754-T-A p.Asn219Lys missense ACADM 4 83282 4.80296E-5 41641 0 7.95488E-6
1-76205775-C-T p.Thr226Thr synonymous ACADM 2 83230 2.40298E-5 41615 0 0.00100705
1-76205776-A-G p.Asn227Asp missense ACADM 1 83222 1.20161E-5 41611 0 1.98893E-5
1-76205778-C-T p.Asn227Asn synonymous ACADM 4 83220 4.80654E-5 41610 0 1.5912E-4
1-76205779-G-A p.Gly228Arg missense ACADM 6 83216 7.21015E-5 41608 0 3.97785E-5
1-76205785-A-G p.Lys230Glu missense ACADM 1 83210 1.20178E-5 41605 0 3.97804E-6
1-76205798-A-G c.698+3A>G splice_region ACADM 3 83132 3.60872E-5 41566 0 1.4852E-4
1-76205799-T-TTTTTTATTGGCAC c.698+4_698+5insTTTTTATTGGCAC splice_region ACADM 3 83132 3.60872E-5 41566 1 NA
1-76205800-G-A c.698+5G>A splice_region ACADM 1 83098 1.2034E-5 41549 0 3.18674E-5
1-76211485-T-C c.699-6T>C splice_region ACADM 7 83088 8.4248E-5 41544 0 6.59381E-5
1-76211487-T-A c.699-4T>A splice_region ACADM 2 83092 2.40697E-5 41546 0 NA
1-76211501-T-C p.Leu237Leu synonymous ACADM 1 83204 1.20187E-5 41602 0 3.1835E-5
1-76211505-C-T p.Ala238Val missense ACADM 1 83206 1.20184E-5 41603 0 NA
1-76211508-G-T p.Arg239Leu missense ACADM 5 83210 6.00889E-5 41605 0 NA
1-76211508-G-A p.Arg239His missense ACADM 2 83210 2.40356E-5 41605 0 6.25E-4
1-76211516-C-G p.Pro242Ala missense ACADM 1 83230 1.20149E-5 41615 0 8.23845E-6
1-76211518-A-G p.Pro242Pro synonymous ACADM 1 83236 1.2014E-5 41618 0 3.97763E-6
1-76211528-G-GC p.Pro247fs frameshift ACADM 1 83252 1.20117E-5 41626 0 NA
1-76211536-T-A p.Ala248Ala synonymous ACADM 76 83264 9.12759E-4 41632 0 4.45803E-4
1-76211544-C-G p.Ala251Gly missense ACADM 1 83266 1.20097E-5 41633 0 2.38671E-5
1-76211548-T-C p.Phe252Phe synonymous ACADM 3 83268 3.60282E-5 41634 0 3.1839E-5
1-76211552-G-A p.Gly254Arg missense ACADM 2 83256 2.40223E-5 41628 0 3.18552E-5
1-76211557-C-A p.Phe255Leu missense ACADM 15 83252 1.80176E-4 41626 0 4.46002E-4
1-76211557-C-T p.Phe255Phe synonymous ACADM 1 83252 1.20117E-5 41626 0 NA
1-76211558-A-G p.Ile256Val missense ACADM 1 83250 1.2012E-5 41625 0 8.24212E-6
1-76211569-A-G p.Ala259Ala synonymous ACADM 70 83244 8.40901E-4 41622 0 0.00423358
1-76211572-T-A p.Asp260Glu missense ACADM 1 83240 1.20135E-5 41620 0 NA
1-76211574-C-A p.Thr261Asn missense ACADM 15 83240 1.80202E-4 41620 0 2.94492E-4
1-76211578-A-C p.Pro262Pro synonymous ACADM 4 83234 4.80573E-5 41617 0 1.65123E-5
1-76211589-T-C p.Ile266Thr missense ACADM 1 83204 1.20187E-5 41602 0 8.27116E-6
1-76211594-A-G p.Arg268Gly missense ACADM 1 83182 1.20218E-5 41591 0 NA
1-76211600-G-GAAT c.807+1_807+2insAAT splice_donor ACADM 7 83132 8.42034E-5 41566 3 NA
1-76211605-G-T c.807+6G>T splice_region ACADM 1 83088 1.20354E-5 41544 0 NA
1-76211607-A-C c.807+8A>C splice_region ACADM 1 83068 1.20383E-5 41534 0 8.33611E-6
1-76215118-C-T p.Gly274Gly synonymous ACADM 1 83198 1.20195E-5 41599 0 1.65254E-5
1-76215122-C-T p.Arg276* stop_gained ACADM 1 83212 1.20175E-5 41606 0 6.25E-4
1-76215129-C-T p.Ser278Leu missense ACADM 5 83240 6.00673E-5 41620 0 2.47639E-5
1-76215146-G-A p.Val284Ile missense ACADM 3 83274 3.60256E-5 41637 0 NA
1-76215154-A-T p.Glu286Asp missense ACADM 3 83300 3.60144E-5 41650 0 NA
1-76215166-G-A p.Val290Val synonymous ACADM 2 83310 2.40067E-5 41655 0 1.64959E-5
1-76215168-C-T p.Pro291Leu missense ACADM 2 83310 2.40067E-5 41655 0 3.97798E-6
1-76215170-A-G p.Lys292Glu missense ACADM 1 83308 1.20036E-5 41654 0 6.37146E-5
1-76215182-T-G p.Leu296Val missense ACADM 1 83308 1.20036E-5 41654 0 NA
1-76215192-A-G p.Asp299Gly missense ACADM 30 83290 3.60187E-4 41645 0 4.37229E-4
1-76215193-C-T p.Asp299Asp synonymous ACADM 10 83296 1.20054E-4 41648 0 2.38679E-5
1-76215194-G-A p.Gly300Arg missense ACADM 15 83290 1.80094E-4 41645 0 5.03525E-4
1-76215212-G-A p.Ala306Thr missense ACADM 1 83236 1.2014E-5 41618 0 3.97874E-6
1-76215246-T-C c.948+2T>C splice_donor ACADM 1 82982 1.20508E-5 41491 0 1.65281E-5
1-76215247-A-AGCTGCTGGTGCTGTTGGATTAGCACAAAGAGCTTTGGATGAAGCT c.948+3_948+4insGCTGCTGGTGCTGTTGGATTAGCACAAAGAGCTTTGGATGAAGCT splice_region ACADM 2 82966 2.41063E-5 41483 1 NA
1-76215248-A-G c.948+4A>G splice_region ACADM 1 82938 1.20572E-5 41469 0 8.26528E-6
1-76216143-C-T p.Ala319Val missense ACADM 1 83196 1.20198E-5 41598 0 2.24861E-5
1-76216152-T-C p.Val322Ala missense ACADM 1 83234 1.20143E-5 41617 0 NA
1-76216176-A-G p.Asp330Gly missense ACADM 2 83276 2.40165E-5 41638 0 2.39231E-5
1-76216186-C-T p.Thr333Thr synonymous ACADM 512 83266 0.00614897 41633 7 0.0113115
1-76216204-G-A p.Arg339Arg synonymous ACADM 2 83272 2.40177E-5 41636 0 2.77968E-5
1-76216213-C-T p.Phe342Phe synonymous ACADM 2 83260 2.40211E-5 41630 0 1.5987E-5
1-76216214-G-A p.Gly343Arg missense ACADM 3 83258 3.60326E-5 41629 0 3.80641E-5
1-76216222-A-T p.Leu345Leu synonymous ACADM 2 83242 2.40263E-5 41621 0 9.83052E-6
1-76216580-C-T n.218+4C>T splice_region ACADM 2 8194 2.44081E-4 4097 0 3.24486E-5
1-76216581-G-A n.218+5G>A splice_region ACADM 1 8082 1.23732E-4 4041 0 NA
1-76226801-T-G c.1045-6T>G splice_region ACADM 1 83126 1.20299E-5 41563 0 1.04838E-4
1-76226820-C-T p.Ser353Leu missense ACADM 3 83278 3.60239E-5 41639 0 3.98483E-6
1-76226820-C-A p.Ser353* stop_gained ACADM 2 83278 2.40159E-5 41639 0 NA
1-76226821-A-G p.Ser353Ser synonymous ACADM 5 83272 6.00442E-5 41636 0 3.1835E-5
1-76226825-A-G p.Met355Val missense ACADM 2 83276 2.40165E-5 41638 0 3.1841E-5
1-76226844-TG-T p.Met361fs frameshift ACADM 1 83308 1.20036E-5 41654 0 2.38698E-5
1-76226846-A-G p.Lys362Glu missense ACADM 292 83312 0.0035049 41656 0 0.00334267
1-76226855-C-T p.Leu365Leu synonymous ACADM 168 83308 0.00201661 41654 0 0.005625
1-76226858-G-C p.Ala366Pro missense ACADM 1 83312 1.20031E-5 41656 0 NA
1-76226868-G-A p.Ser369Asn missense ACADM 1 83322 1.20016E-5 41661 0 NA
1-76226880-C-A p.Ala373Glu missense ACADM 1 83304 1.20042E-5 41652 0 5.03525E-4
1-76226893-T-A n.762T>A splice_region ACADM 2 83288 2.40131E-5 41644 0 3.1839E-5
1-76226894-G-T p.Asp378Tyr missense ACADM 1 83284 1.20071E-5 41642 0 NA
1-76226894-G-C p.Asp378His missense ACADM 1 83284 1.20071E-5 41642 0 8.23791E-6
1-76226903-C-T p.Arg381Cys missense ACADM 2 83264 2.402E-5 41632 0 NA
1-76226904-G-A p.Arg381His missense ACADM 2 83258 2.40217E-5 41629 0 6.3678E-5
1-76226906-C-T p.Arg382* stop_gained ACADM 1 83260 1.20106E-5 41630 0 3.18451E-5
1-76226913-C-T p.Thr384Ile missense ACADM 1 83244 1.20129E-5 41622 0 8.23669E-6
1-76226934-A-T p.Lys391Met missense ACADM 1 83168 1.20239E-5 41584 0 NA
1-76226938-A-G p.Ala392Ala synonymous ACADM 2 83142 2.40552E-5 41571 0 8.23696E-6
1-76226951-A-G p.Ile397Val missense ACADM 3 83112 3.60959E-5 41556 0 8.2375E-6
1-76226952-T-C p.Ile397Thr missense ACADM 49 83110 5.8958E-4 41555 0 0.001875
1-76226956-A-G p.Ala398Ala synonymous ACADM 2 83084 2.4072E-5 41542 0 NA
1-76226998-T-C p.Asn412Asn synonymous ACADM 1 82802 1.2077E-5 41401 0 NA
1-76227010-A-G p.Thr416Thr synonymous ACADM 1 82674 1.20957E-5 41337 0 NA
1-76227013-ATATCC-A p.Tyr418fs frameshift ACADM 2 82626 2.42055E-5 41313 1 NA
1-76227022-A-G p.Val420Val synonymous ACADM 18980 80302 0.236358 40151 1885 0.286002
1-76227028-A-G p.Lys422Lys synonymous ACADM 1 82342 1.21445E-5 41171 0 7.97811E-6
1-76227045-A-G p.Lys428Arg missense ACADM 1 81998 1.21954E-5 40999 0 8.30192E-6
1-76227047-A-G p.Ile429Val missense ACADM 4 81980 4.87924E-5 40990 0 3.1841E-5
1-76227059-A-G c.1293+4A>G splice_region ACADM 2 81560 2.45218E-5 40780 0 NA
1-76227061-G-A c.1293+6G>A splice_region ACADM 1 81454 1.22769E-5 40727 0 4.01197E-6
1-76228389-A-G p.Thr436Ala missense ACADM 1 81760 1.22309E-5 40880 0 NA
1-76228411-T-C p.Ile443Thr missense ACADM 1 81954 1.2202E-5 40977 0 NA
1-76228419-C-T p.Arg446Cys missense ACADM 3 81940 3.66122E-5 40970 0 3.18857E-5
1-76228419-C-A p.Arg446Ser missense ACADM 1 81940 1.22041E-5 40970 0 1.71462E-5
1-76228420-G-A p.Arg446His missense ACADM 1 81958 1.22014E-5 40979 0 2.00058E-5
1-76228421-T-C p.Arg446Arg synonymous ACADM 2 81990 2.43932E-5 40995 0 5.16262E-5
1-76228429-T-C p.Ile449Thr missense ACADM 3 82038 3.65684E-5 41019 0 2.00478E-5
1-76228439-C-A p.Tyr452* stop_gained ACADM 5 81888 6.1059E-5 40944 0 3.63628E-5
1-76228443-A-T p.Asn454Tyr missense ACADM 1 81924 1.22064E-5 40962 0 NA
1-76228447-A-T p.Ter455Leuext*? stop_lost ACADM 9 81816 1.10003E-4 40908 0 0.00100908
1-76228492-T-C c.*44T>C splice_region ACADM 19 79390 2.39325E-4 39695 0 1.27551E-4
1-76234862-G-A p.Val54Ile missense+splice_region ACADM 18 8734 0.00206091 4367 0 0.001875
1-76234886-A-G p.Thr62Ala missense ACADM 7922 8590 0.922235 4295 3683 0.924838
1-76251712-T-C c.*22-6T>C splice_region ACADM 1 58640 1.70532E-5 29320 0 NA
1-76251960-G-A c.*263+1G>A splice_donor ACADM 2 82796 2.41558E-5 41398 0 NA
1-76251962-A-G c.*263+3A>G splice_region ACADM 2 82744 2.41709E-5 41372 0 3.18124E-5
1-76251966-G-T c.*263+7G>T splice_region ACADM 3 82808 3.62284E-5 41404 0 NA
1-76253183-G-T c.*265G>T splice_region ACADM 1 82632 1.21018E-5 41316 0 3.18573E-5
1-76253183-G-A c.*265G>A splice_region ACADM 1 82632 1.21018E-5 41316 0 7.95874E-6