Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
3-132277668-T-A n.3276A>T splice_region ACAD11 2 71566 2.79462E-5 35783 0 NA
3-132277669-C-G n.3275G>C splice_region ACAD11 6 72032 8.32963E-5 36016 0 NA
3-132277828-G-A p.Thr777Ile missense ACAD11 1 83206 1.20184E-5 41603 0 NA
3-132277849-C-T p.Arg770Gln missense ACAD11 1 83160 1.2025E-5 41580 0 6.25E-4
3-132277850-G-A p.Arg770Trp missense ACAD11 1 83154 1.20259E-5 41577 0 4.95025E-5
3-132277856-C-G p.Glu768Gln missense ACAD11 2 83128 2.40593E-5 41564 0 1.59397E-5
3-132277860-T-C p.Thr766Thr synonymous ACAD11 5 83122 6.01525E-5 41561 0 1.6497E-5
3-132277865-C-T p.Ala765Thr missense ACAD11 2 83086 2.40714E-5 41543 0 9.55597E-5
3-132277866-G-A p.Ile764Ile synonymous ACAD11 9038 82890 0.109036 41445 607 0.168125
3-132277880-G-T p.His760Asn missense ACAD11 1 83058 1.20398E-5 41529 0 NA
3-132277885-T-C p.Glu758Gly missense ACAD11 1 83044 1.20418E-5 41522 0 0.00125
3-132277890-A-G p.Pro756Pro synonymous ACAD11 7 83016 8.43211E-5 41508 1 0.00100705
3-132277895-C-A p.Gly755* stop_gained ACAD11 1 83010 1.20467E-5 41505 0 NA
3-132277898-C-A p.Asp754Tyr missense ACAD11 3 82992 3.61481E-5 41496 0 7.97168E-6
3-132277906-C-T p.Arg751His missense ACAD11 3 82958 3.61629E-5 41479 0 0.00100705
3-132277907-G-A p.Arg751Cys missense ACAD11 369 82928 0.00444964 41464 7 0.0115654
3-132277915-C-T p.Arg748Gln missense ACAD11 1 82910 1.20613E-5 41455 0 3.99163E-6
3-132277916-G-A p.Arg748* stop_gained ACAD11 4 82910 4.82451E-5 41455 0 3.18817E-5
3-132277922-T-C p.Ile746Val missense ACAD11 1 82894 1.20636E-5 41447 0 3.18593E-5
3-132277929-C-CATGTTAGCCAGAGGGTAATCCTGGGAAACACCAGCACCT c.2229-1_2229insAGGTGCTGGTGTTTCCCAGGATTACCCTCTGGCTAACAT splice_acceptor ACAD11 1 82800 1.20773E-5 41400 0 NA
3-132277932-G-A c.2229-3C>T splice_region ACAD11 6 82762 7.2497E-5 41381 0 NA
3-132277937-A-G c.2229-8T>C splice_region ACAD11 2 82730 2.4175E-5 41365 0 3.18573E-5
3-132278684-C-T p.Ala741Thr missense ACAD11 1 82862 1.20683E-5 41431 0 NA
3-132278699-G-A p.Gln736* stop_gained ACAD11 1 83032 1.20435E-5 41516 0 NA
3-132278717-C-T p.Gly730Arg missense ACAD11 1 83020 1.20453E-5 41510 0 3.18654E-5
3-132278718-G-A p.Cys729Cys synonymous ACAD11 4 83004 4.81904E-5 41502 0 1.27527E-4
3-132278727-G-T p.Ile726Ile synonymous ACAD11 1 82974 1.2052E-5 41487 0 3.18674E-5
3-132278728-A-G p.Ile726Thr missense ACAD11 1 82982 1.20508E-5 41491 0 9.5584E-5
3-132278733-C-T p.Trp724* stop_gained ACAD11 1 82936 1.20575E-5 41468 0 2.59359E-5
3-132278740-A-G p.Val722Ala missense ACAD11 1 82862 1.20683E-5 41431 0 2.60403E-5
3-132278741-C-T p.Val722Ile missense ACAD11 2 82842 2.41423E-5 41421 0 3.99269E-6
3-132278742-G-A p.Ile721Ile synonymous ACAD11 2 82844 2.41418E-5 41422 0 3.48189E-5
3-132278753-C-G p.Val718Leu missense ACAD11 1 82736 1.20866E-5 41368 0 3.18695E-5
3-132278758-C-T p.Arg716Gln missense ACAD11 2 82648 2.4199E-5 41324 0 9.56511E-5
3-132278764-G-A p.Ala714Val missense ACAD11 1 82594 1.21074E-5 41297 0 4.03522E-6
3-132278780-T-C p.Met709Val missense ACAD11 3 82438 3.6391E-5 41219 0 3.63114E-5
3-132278787-C-CTCTTTCT c.2119-2_2119-1insAGAAAGA splice_acceptor ACAD11 2 82282 2.43067E-5 41141 1 NA
3-132278787-CTATATAAGCAAAATATGAAAAGAATGCT-C c.2119-29_2119-2delAGCATTCTTTTCATATTTTGCTTATATA splice_acceptor ACAD11 3 82280 3.64609E-5 41140 0 NA
3-132278790-T-G c.2119-4A>C splice_region ACAD11 2 82214 2.43268E-5 41107 0 8.18003E-6
3-132278791-A-G c.2119-5T>C splice_region ACAD11 2 82204 2.43297E-5 41102 0 NA
3-132279945-C-T p.Glu706Glu splice_region+synonymous ACAD11 1 82242 1.21592E-5 41121 0 3.18837E-5
3-132279956-C-T p.Ala703Thr missense ACAD11 2 82338 2.42901E-5 41169 0 4.14567E-4
3-132279958-C-A p.Gly702Val missense ACAD11 1 82388 1.21377E-5 41194 0 3.18878E-5
3-132279959-C-T p.Gly702Ser missense ACAD11 1 82416 1.21336E-5 41208 0 NA
3-132279970-A-G p.Leu698Pro missense ACAD11 4 82532 4.8466E-5 41266 0 NA
3-132279974-T-C p.Thr697Ala missense ACAD11 1 82552 1.21136E-5 41276 0 NA
3-132279976-T-A p.Asp696Val missense ACAD11 3 82586 3.63258E-5 41293 0 6.60001E-5
3-132279986-G-GA p.His693fs frameshift ACAD11 1 82628 1.21024E-5 41314 0 3.18776E-5
3-132279988-G-A p.Ala692Val missense ACAD11 1 82624 1.2103E-5 41312 0 NA
3-132279996-C-T p.Leu689Leu synonymous ACAD11 1 82686 1.20939E-5 41343 0 NA
3-132279998-G-C p.Leu689Val missense ACAD11 3 82702 3.62748E-5 41351 0 3.98441E-6
3-132280009-C-T p.Arg685His missense ACAD11 3 82740 3.62582E-5 41370 0 6.37796E-5
3-132280010-G-A p.Arg685Cys missense ACAD11 2 82762 2.41657E-5 41381 0 4.95295E-5
3-132280014-C-A p.Lys683Asn missense ACAD11 1 82768 1.2082E-5 41384 0 7.968E-6
3-132280017-C-G p.Glu682Asp missense ACAD11 1 82780 1.20802E-5 41390 0 NA
3-132280021-A-G p.Ile681Thr missense ACAD11 1 82802 1.2077E-5 41401 0 NA
3-132280022-T-C p.Ile681Val missense ACAD11 1 82820 1.20744E-5 41410 0 3.30426E-5
3-132280026-A-G p.Ile679Ile synonymous ACAD11 1 82848 1.20703E-5 41424 0 NA
3-132280027-A-G p.Ile679Thr missense ACAD11 1 82852 1.20697E-5 41426 0 7.96737E-6
3-132280031-G-A p.Arg678Cys missense ACAD11 6 82830 7.24375E-5 41415 0 2.47999E-5
3-132280057-A-G p.Val669Ala missense ACAD11 4 82880 4.82625E-5 41440 0 NA
3-132280061-C-CATGTGCATACAACTTCTTCTTGAAAGCTATCCTTTGTGTTGCCCG c.2002-1_2002insCGGGCAACACAAAGGATAGCTTTCAAGAAGAAGTTGTATGCACAT splice_acceptor ACAD11 2 82874 2.4133E-5 41437 1 NA
3-132280061-C-T p.Glu668Lys missense+splice_region ACAD11 1 82874 1.20665E-5 41437 0 3.98584E-6
3-132280064-A-G c.2002-3T>C splice_region ACAD11 1 82810 1.20758E-5 41405 0 NA
3-132280065-T-C c.2002-4A>G splice_region ACAD11 230 82798 0.00277784 41399 1 0.0022649
3-132280066-A-AG c.2002-6_2002-5insC splice_region ACAD11 1 82816 1.2075E-5 41408 0 3.18939E-5
3-132280152-ACT-A c.1689_1689+1delAG exon_loss ACAD11 138 76804 0.00179678 38402 1 0.00222724
3-132280157-C-T c.1689-3G>A splice_region ACAD11 1 76120 1.31372E-5 38060 0 NA
3-132280159-A-AAG c.1689-6_1689-5insCT splice_region ACAD11 18 75782 2.37523E-4 37891 0 2.56312E-4
3-132280161-G-C c.1689-7C>G splice_region ACAD11 1 75442 1.32552E-5 37721 0 3.35154E-5
3-132294608-G-A c.2001+8C>T splice_region ACAD11 1 82214 1.21634E-5 41107 0 4.15614E-5
3-132294609-T-C c.2001+7A>G splice_region ACAD11 1 82250 1.21581E-5 41125 0 7.98537E-6
3-132294611-C-T c.2001+5G>A splice_region ACAD11 1 82302 1.21504E-5 41151 0 3.99224E-6
3-132294614-A-C c.2001+2T>G splice_donor ACAD11 1 82338 1.21451E-5 41169 0 NA
3-132294617-T-C p.His667Arg missense+splice_region ACAD11 3 82362 3.64246E-5 41181 0 NA
3-132294617-T-A p.His667Leu missense+splice_region ACAD11 2 82362 2.4283E-5 41181 0 7.97906E-6
3-132294627-A-G p.Leu664Leu synonymous ACAD11 15 82472 1.8188E-4 41236 1 0.00151057
3-132294627-ACTT-A p.Lys663del conservative_inframe_deletion ACAD11 3 82472 3.6376E-5 41236 0 6.37186E-5
3-132294650-T-C p.Gln656Arg missense ACAD11 1 82680 1.20948E-5 41340 0 NA
3-132294653-G-A p.Thr655Ile missense ACAD11 44 82688 5.32121E-4 41344 0 0.00105122
3-132294656-G-T p.Ala654Glu missense ACAD11 1 82692 1.20931E-5 41346 0 NA
3-132294659-C-T p.Arg653Gln missense ACAD11 2 82692 2.41861E-5 41346 0 4.95319E-5
3-132294660-G-T p.Arg653Arg synonymous ACAD11 4 82698 4.83688E-5 41349 0 3.18634E-5
3-132294660-G-A p.Arg653Trp missense ACAD11 2 82698 2.41844E-5 41349 0 3.30196E-5
3-132294663-C-T p.Glu652Lys missense ACAD11 2 82720 2.41779E-5 41360 0 NA
3-132294670-G-A p.Ile649Ile synonymous ACAD11 5 82766 6.04113E-5 41383 0 1.91107E-4
3-132294680-G-T p.Ala646Asp missense ACAD11 263 82778 0.00317717 41389 0 0.00208725
3-132294680-G-C p.Ala646Gly missense ACAD11 17 82782 2.05359E-4 41391 1 6.69195E-4
3-132294682-G-A p.Arg645Arg synonymous ACAD11 26 82788 3.14055E-4 41394 0 3.26626E-4
3-132294683-C-T p.Arg645His missense ACAD11 1 82794 1.20782E-5 41397 0 3.18654E-5
3-132294688-C-T p.Ala643Ala synonymous ACAD11 3 82798 3.62328E-5 41399 0 1.99156E-5
3-132294689-GC-TT p.Ala643Lys missense ACAD11 1 82786 1.20793E-5 41393 0 NA
3-132294693-A-G p.Leu642Leu synonymous ACAD11 1 82792 1.20785E-5 41396 0 6.37186E-5
3-132294704-C-G p.Arg638Thr missense ACAD11 1 82808 1.20761E-5 41404 0 0.00100705
3-132294704-C-A p.Arg638Ile missense ACAD11 2 82808 2.41523E-5 41404 0 NA
3-132294712-G-C p.His635Gln missense ACAD11 2 82796 2.41558E-5 41398 0 NA
3-132294726-C-T p.Gly631Ser missense ACAD11 1 82762 1.20828E-5 41381 0 3.98371E-6
3-132294729-G-T p.Pro630Thr missense ACAD11 1 82744 1.20855E-5 41372 0 NA
3-132294737-C-T p.Arg627His missense ACAD11 9 82706 1.08819E-4 41353 0 6.25E-4
3-132294738-G-A p.Arg627Cys missense ACAD11 7 82686 8.46576E-5 41343 0 3.3036E-5
3-132294751-T-C p.Glu622Glu synonymous ACAD11 1 82624 1.2103E-5 41312 0 3.98626E-6
3-132294762-T-G p.Arg619Arg synonymous ACAD11 1 82526 1.21174E-5 41263 0 3.99068E-6
3-132294772-T-TA c.1847-3_1847-2insT splice_region ACAD11 1 82400 1.21359E-5 41200 0 NA
3-132295780-C-G c.1846+8G>C splice_region ACAD11 1 81924 1.22064E-5 40962 0 5.2255E-5
3-132295794-T-G p.Ile614Leu missense ACAD11 1 82124 1.21767E-5 41062 0 NA
3-132295809-G-A p.Pro609Ser missense ACAD11 2 82210 2.43279E-5 41105 0 2.48914E-4
3-132295814-C-T p.Arg607Gln missense ACAD11 1 82142 1.2174E-5 41071 0 3.43909E-5
3-132295815-G-A p.Arg607* stop_gained ACAD11 10 82150 1.21729E-4 41075 0 9.5584E-5
3-132295819-T-C p.Gln605Gln synonymous ACAD11 9 82148 1.09558E-4 41074 0 1.72488E-5
3-132295848-C-A p.Gly596* stop_gained ACAD11 1 81756 1.22315E-5 40878 0 NA
3-132295850-T-A p.His595Leu missense ACAD11 4 81668 4.89788E-5 40834 0 NA
3-132295862-A-G c.1775-3T>C splice_region ACAD11 1 81098 1.23308E-5 40549 0 NA
3-132297393-C-A n.740G>T splice_region ACAD11 1 26196 3.81738E-5 13098 0 NA
3-132297646-A-T p.Tyr590Asn missense ACAD11 1 82552 1.21136E-5 41276 0 NA
3-132297668-T-C p.Ile582Met missense ACAD11 4 82808 4.83045E-5 41404 0 NA
3-132297680-T-G p.Gly578Gly synonymous ACAD11 1 82870 1.20671E-5 41435 0 NA
3-132297686-T-C p.Thr576Thr synonymous ACAD11 2 82890 2.41284E-5 41445 0 7.97277E-6
3-132297687-G-A p.Thr576Ile missense ACAD11 24 82902 2.89498E-4 41451 0 5.73358E-4
3-132297687-G-T p.Thr576Lys missense ACAD11 2 82902 2.41249E-5 41451 0 2.47292E-5
3-132297700-C-G p.Val572Leu missense ACAD11 1 82922 1.20595E-5 41461 0 NA
3-132297706-T-C p.Ile570Val missense ACAD11 1 82948 1.20557E-5 41474 0 NA
3-132297710-G-A p.Ser568Ser synonymous ACAD11 6 82954 7.23292E-5 41477 0 6.37592E-5
3-132297725-T-C p.Arg563Arg splice_region+synonymous ACAD11 46 82928 5.54698E-4 41464 0 3.55133E-4
3-132297795-T-C p.Ter156Trpext*? stop_lost ACAD11 4 81006 4.93791E-5 40503 0 1.28916E-5
3-132297801-T-C p.Gln154Gln synonymous ACAD11 1 80716 1.23891E-5 40358 0 3.1841E-5
3-132297803-G-A p.Gln154* stop_gained ACAD11 5 80590 6.20424E-5 40295 0 1.91071E-4
3-132297809-T-C p.Lys152Glu missense ACAD11 8 80286 9.96438E-5 40143 0 4.65862E-6
3-132297820-A-G p.Met148Thr missense ACAD11 32 79608 4.0197E-4 39804 0 1.2738E-4
3-132297821-T-C p.Met148Val missense ACAD11 1 79516 1.25761E-5 39758 0 2.32775E-5
3-132297829-T-C p.His145Arg missense ACAD11 4 78850 5.07292E-5 39425 0 1.59185E-4
3-132297840-A-T p.His141Gln missense ACAD11 4 77566 5.1569E-5 38783 0 5.20003E-4
3-132297862-A-G p.Leu134Ser missense ACAD11 7 74818 9.35604E-5 37409 0 1.27356E-4
3-132297868-C-T p.Arg132His missense ACAD11 1 73698 1.35689E-5 36849 0 NA
3-132297869-G-A p.Arg132Cys missense ACAD11 16 73284 2.18329E-4 36642 0 3.6523E-4
3-132297871-A-G p.Val131Ala missense ACAD11 3 73080 4.10509E-5 36540 0 6.96816E-6
3-132297874-C-A p.Gly130Val missense ACAD11 1 72338 1.3824E-5 36169 0 NA
3-132297877-A-G p.Val129Ala missense ACAD11 3 71864 4.17455E-5 35932 0 5.63761E-5
3-132297894-C-T p.Gln123Gln synonymous ACAD11 1 68304 1.46404E-5 34152 0 1.91571E-4
3-132297900-T-C p.Arg121Arg splice_region+synonymous ACAD11 1 67480 1.48192E-5 33740 0 7.31818E-6
3-132297904-G-A n.233-4C>T splice_region ACAD11 1 66854 1.4958E-5 33427 0 7.39492E-6
3-132298332-T-C c.1688+4A>G splice_region ACAD11 1 82408 1.21347E-5 41204 0 3.9991E-6
3-132298344-A-G p.Ser560Ser synonymous ACAD11 1 82528 1.21171E-5 41264 0 NA
3-132298373-T-C p.Ile551Val missense ACAD11 146 82570 0.0017682 41285 0 0.00808898
3-132298378-A-G p.Ile549Thr missense ACAD11 1 82572 1.21106E-5 41286 0 8.2802E-6
3-132298379-T-G p.Ile549Leu missense ACAD11 3 82552 3.63407E-5 41276 0 NA
3-132298388-T-G p.Lys546Gln missense ACAD11 1 82558 1.21127E-5 41279 0 NA
3-132298390-G-T p.Pro545His missense ACAD11 2 82550 2.42277E-5 41275 0 3.99454E-6
3-132298403-C-CACTGCTCCACCATTTTTTGCCGTTAATTACATAGCTA c.1622-2_1622-1insTAGCTATGTAATTAACGGCAAAAAATGGTGGAGCAGT splice_acceptor ACAD11 2 82502 2.42418E-5 41251 1 NA
3-132298403-C-CACTGCTCCACCATTTTTTGCCGTTAATTACATAGCTATCT c.1622-2_1622-1insAGATAGCTATGTAATTAACGGCAAAAAATGGTGGAGCAGT splice_acceptor ACAD11 2 82502 2.42418E-5 41251 1 NA
3-132298403-C-CACTGCTCCACCATTTTTTGCCGT c.1622-2_1622-1insACGGCAAAAAATGGTGGAGCAGT splice_acceptor ACAD11 1 82502 1.21209E-5 41251 0 NA
3-132298403-C-CACTGCTCCACCATTTTTTGCCGTTAATTACA c.1622-2_1622-1insTGTAATTAACGGCAAAAAATGGTGGAGCAGT splice_acceptor ACAD11 2 82502 2.42418E-5 41251 1 NA
3-132298403-C-CACTGCTCCACCATTTTT c.1622-2_1622-1insAAAAATGGTGGAGCAGT splice_acceptor ACAD11 1 82502 1.21209E-5 41251 0 NA
3-132322084-C-G p.Trp537Ser missense ACAD11 1 83234 1.20143E-5 41617 0 NA
3-132322085-A-T p.Trp537Arg missense ACAD11 1 83234 1.20143E-5 41617 0 8.24321E-6
3-132322086-T-A p.Lys536Asn missense ACAD11 2 83244 2.40258E-5 41622 0 3.1841E-5
3-132322092-G-C p.Gly534Gly synonymous ACAD11 3 83252 3.60352E-5 41626 0 7.96591E-6
3-132322092-G-GC p.Lys535fs frameshift ACAD11 2 83252 2.40234E-5 41626 0 NA
3-132322095-G-A p.Asn533Asn synonymous ACAD11 11 83238 1.32151E-4 41619 0 5.03525E-4
3-132322098-A-C p.Ile532Met missense ACAD11 1 83240 1.20135E-5 41620 0 NA
3-132322103-C-A p.Val531Leu missense ACAD11 2 83240 2.40269E-5 41620 0 2.22887E-4
3-132322104-A-G p.Tyr530Tyr synonymous ACAD11 2 83250 2.4024E-5 41625 0 1.64796E-5
3-132322105-T-C p.Tyr530Cys missense ACAD11 1 83256 1.20111E-5 41628 0 1.59167E-5
3-132322113-T-A p.Glu527Asp missense ACAD11 2 83242 2.40263E-5 41621 0 8.23968E-6
3-132322116-A-G p.Asp526Asp synonymous ACAD11 16 83228 1.92243E-4 41614 0 3.18451E-4
3-132322120-C-T p.Arg525Gln missense ACAD11 5 83204 6.00933E-5 41602 0 2.38762E-5
3-132322127-T-A p.Ile523Phe missense ACAD11 1 83192 1.20204E-5 41596 0 3.1839E-5
3-132322143-C-T p.Thr517Thr synonymous ACAD11 27 83120 3.24832E-4 41560 0 0.00150803
3-132322144-G-A p.Thr517Met missense ACAD11 2 83102 2.40668E-5 41551 0 0.00100705
3-132322164-A-C p.Asp510Glu missense ACAD11 3 82972 3.61568E-5 41486 0 3.1839E-5
3-132322176-A-G c.1523-5T>C splice_region ACAD11 1 82754 1.2084E-5 41377 0 1.65003E-5
3-132323937-T-C c.1522+5A>G splice_region ACAD11 1 82760 1.20831E-5 41380 0 NA
3-132323940-A-C c.1522+2T>G splice_donor ACAD11 1 82772 1.20814E-5 41386 0 NA
3-132323955-G-A p.Ala431Val missense ACAD11 1 82948 1.20557E-5 41474 0 NA
3-132323959-G-GAGGTA p.Ser502fs frameshift ACAD11 3 82948 3.61672E-5 41474 0 3.18431E-5
3-132323994-C-T p.Ser418Asn missense ACAD11 1 83096 1.20343E-5 41548 0 NA
3-132324000-C-A p.Lys488Asn missense ACAD11 13 83106 1.56427E-4 41553 0 5.09522E-4
3-132324005-G-C p.Gln487Glu missense ACAD11 1 83104 1.20331E-5 41552 0 3.98E-6
3-132324011-C-T p.Glu485Lys missense ACAD11 5 83102 6.0167E-5 41551 0 9.55536E-5
3-132324018-A-C p.Tyr482* stop_gained ACAD11 1 83116 1.20314E-5 41558 0 8.24511E-6
3-132324018-A-G p.Met410Thr missense ACAD11 7 83116 8.42196E-5 41558 0 2.47353E-4
3-132324021-C-T p.Cys409Tyr missense ACAD11 31 83102 3.73036E-4 41551 0 3.78164E-4
3-132324023-G-C p.Leu481Val missense ACAD11 3 83094 3.61037E-5 41547 0 3.1837E-5
3-132324024-G-A p.Thr408Ile missense ACAD11 1 83082 1.20363E-5 41541 0 4.65857E-4
3-132324029-G-T p.Leu479Met missense ACAD11 5 83074 6.01873E-5 41537 0 3.98165E-6
3-132324038-T-C p.Met1? start_lost ACAD11 1 83012 1.20465E-5 41506 0 8.25423E-6
3-132324051-T-TGGTGCTTGGCAGTTAA c.1415-3_1415-2insTTAACTGCCAAGCACC splice_region ACAD11 1 82854 1.20694E-5 41427 0 NA
3-132324051-T-TGGTGCTTGGCAGTTAAAG c.1415-3_1415-2insCTTTAACTGCCAAGCACC splice_region ACAD11 1 82854 1.20694E-5 41427 0 NA
3-132324052-A-T c.1415-3T>A splice_region ACAD11 1 82834 1.20723E-5 41417 0 1.65574E-5
3-132324055-C-T c.1415-6G>A splice_region ACAD11 476 82768 0.00575101 41384 9 0.0118145
3-132337477-C-A c.1414+1G>T splice_donor ACAD11 1517 82364 0.0184182 41182 19 0.0260303
3-132337477-C-T c.1414+1G>A splice_donor ACAD11 6 82428 7.27908E-5 41214 0 4.01417E-5
3-132337484-C-A p.Ala470Ser missense ACAD11 3 82638 3.63029E-5 41319 0 6.37105E-5
3-132337487-G-A p.Gln469* stop_gained ACAD11 1 82690 1.20934E-5 41345 0 NA
3-132337490-A-G p.Cys468Arg missense ACAD11 2 82776 2.41616E-5 41388 0 NA
3-132337494-A-G p.Phe466Phe synonymous ACAD11 1 82934 1.20578E-5 41467 0 NA
3-132337506-A-G p.Ala462Ala synonymous ACAD11 1 83054 1.20404E-5 41527 0 NA
3-132337545-A-G p.Tyr449Tyr synonymous ACAD11 1 83102 1.20334E-5 41551 0 NA
3-132337554-G-A p.His446His synonymous ACAD11 129 83024 0.00155377 41512 0 0.0105847
3-132337563-T-A p.Gly443Gly synonymous ACAD11 1 82936 1.20575E-5 41468 0 NA
3-132337564-C-T p.Gly443Glu missense ACAD11 1 82920 1.20598E-5 41460 0 8.27185E-6
3-132337565-C-T p.Gly443Arg missense ACAD11 5 82918 6.03005E-5 41459 0 1.57199E-4
3-132337575-T-C p.Pro439Pro synonymous ACAD11 3 82802 3.6231E-5 41401 0 8.48918E-6
3-132337577-G-A p.Pro439Ser missense ACAD11 1 82760 1.20831E-5 41380 0 3.18634E-5
3-132337581-A-G p.Phe437Phe synonymous ACAD11 1 82820 1.20744E-5 41410 0 NA
3-132337584-C-T p.Leu436Leu synonymous ACAD11 3 82808 3.62284E-5 41404 0 NA
3-132337586-A-G p.Leu436Leu synonymous ACAD11 2 82792 2.41569E-5 41396 0 NA
3-132337601-C-G p.Glu431Gln missense ACAD11 1 82620 1.21036E-5 41310 0 NA
3-132337602-G-C p.Val430Val synonymous ACAD11 1 82612 1.21048E-5 41306 0 4.29823E-6
3-132337602-G-A p.Val430Val synonymous ACAD11 1 82612 1.21048E-5 41306 0 8.59646E-6
3-132337614-T-C p.Glu426Glu splice_region+synonymous ACAD11 1 82416 1.21336E-5 41208 0 8.364E-6
3-132337615-TC-T p.Glu426fs frameshift ACAD11 1 82376 1.21395E-5 41188 0 8.36568E-6
3-132337617-C-CTTGAGTTTATCAATCACTAAAGGTTTTCCCCACT c.1276-2_1276-1insAGTGGGGAAAACCTTTAGTGATTGATAAACTCAA splice_acceptor ACAD11 2 82370 2.42807E-5 41185 1 NA
3-132337617-C-T c.1276-1G>A splice_acceptor ACAD11 1 82370 1.21403E-5 41185 0 NA
3-132337621-C-A c.1276-5G>T splice_region ACAD11 4 82116 4.87116E-5 41058 0 6.25E-4
3-132337621-C-T c.1276-5G>A splice_region ACAD11 2 82116 2.43558E-5 41058 0 NA
3-132338313-T-G p.Lys425Thr missense+splice_region ACAD11 1 81188 1.23171E-5 40594 0 NA
3-132338316-A-G p.Leu424Pro missense ACAD11 1 81300 1.23001E-5 40650 0 NA
3-132338328-A-C p.Val420Gly missense ACAD11 1 81678 1.22432E-5 40839 0 NA
3-132338334-G-C p.Pro418Arg missense ACAD11 89 81762 0.00108853 40881 2 0.014375
3-132338337-T-C p.Lys417Arg missense ACAD11 1 81814 1.22228E-5 40907 0 NA
3-132338340-C-T p.Gly416Glu missense ACAD11 3 81818 3.66667E-5 40909 0 1.27462E-4
3-132338346-T-G p.Lys414Thr missense ACAD11 8474 81346 0.104172 40673 536 0.165625
3-132338346-TT-GC p.Lys414Ala missense ACAD11 2 81826 2.44421E-5 40913 0 NA
3-132338350-C-G p.Asp413His missense ACAD11 1 81754 1.22318E-5 40877 0 1.20234E-4
3-132338364-T-C p.Asn408Ser missense ACAD11 5 81784 6.11367E-5 40892 0 5.79365E-5
3-132338373-T-C p.Tyr405Cys missense ACAD11 1 81604 1.22543E-5 40802 0 6.04773E-5
3-132345531-TC-T c.1197+3delG splice_region ACAD11 3 82926 3.61768E-5 41463 0 NA
3-132345535-C-T p.Lys399Lys splice_region+synonymous ACAD11 4 82978 4.82055E-5 41489 0 9.55657E-5
3-132345542-G-C p.Ala397Gly missense ACAD11 2 82998 2.4097E-5 41499 0 3.98724E-6
3-132345569-T-C p.His388Arg missense ACAD11 1 83060 1.20395E-5 41530 0 3.98232E-6
3-132345577-C-T p.Lys385Lys synonymous ACAD11 3 83076 3.61115E-5 41538 0 NA
3-132345581-A-C p.Ile384Ser missense ACAD11 12 83080 1.44439E-4 41540 0 2.47782E-5
3-132345582-T-G p.Ile384Leu missense ACAD11 1 83080 1.20366E-5 41540 0 NA
3-132345585-G-C p.Leu383Val missense ACAD11 2 83076 2.40743E-5 41538 0 NA
3-132345591-C-T p.Glu381Lys missense ACAD11 153 83064 0.00184195 41532 0 0.00159266
3-132345593-T-A p.Gln380Leu missense ACAD11 1 83054 1.20404E-5 41527 0 2.78729E-5
3-132345602-C-T p.Arg377Gln missense ACAD11 2 83038 2.40854E-5 41519 0 3.98349E-6
3-132345603-G-A p.Arg377Trp missense ACAD11 14 83026 1.68622E-4 41513 0 3.58577E-5
3-132345613-A-G p.Phe373Phe synonymous ACAD11 6 83004 7.22857E-5 41502 0 NA
3-132345633-C-T p.Asp367Asn missense ACAD11 1 82930 1.20584E-5 41465 0 NA
3-132345644-A-G p.Leu363Pro missense ACAD11 1 82856 1.20691E-5 41428 0 8.33042E-6
3-132345645-G-A p.Leu363Leu synonymous ACAD11 1 82852 1.20697E-5 41426 0 NA
3-132345646-T-C p.Val362Val synonymous ACAD11 3 82846 3.62118E-5 41423 0 NA
3-132345648-C-A p.Val362Leu missense ACAD11 2422 82746 0.0292703 41373 166 0.061347
3-132345648-C-G p.Val362Leu missense ACAD11 5 82820 6.03719E-5 41410 0 5.84483E-5
3-132345650-G-T p.Thr361Asn missense ACAD11 1 82788 1.2079E-5 41394 0 4.11161E-6
3-132345655-G-A p.Phe359Phe synonymous ACAD11 1 82722 1.20887E-5 41361 0 NA
3-132345656-AAAGTTCTTTGCCAAAAGAAAAAAGGAAAAAAAGGT-A p.Thr358fs frameshift ACAD11 2 82704 2.41826E-5 41352 0 3.36819E-5
3-132345656-A-G p.Phe359Ser missense ACAD11 1 82704 1.20913E-5 41352 0 NA
3-132345662-C-CG c.1071-2_1071-1insC splice_acceptor ACAD11 4 82576 4.84402E-5 41288 2 NA
3-132345662-C-CGTTTGGAGAGTTGTAGTCCAG c.1071-2_1071-1insCTGGACTACAACTCTCCAAAC splice_acceptor ACAD11 2 82578 2.42195E-5 41289 1 NA
3-132345664-T-C c.1071-3A>G splice_region ACAD11 1 82536 1.21159E-5 41268 0 8.525E-6
3-132347183-C-T c.1070+1G>A splice_donor ACAD11 1 83018 1.20456E-5 41509 0 NA
3-132347185-G-A p.Arg357* stop_gained ACAD11 10 83038 1.20427E-4 41519 0 6.44647E-5
3-132347195-T-C p.Gln353Gln synonymous ACAD11 6 83110 7.21935E-5 41555 0 0.00151057
3-132347196-T-G p.Gln353Pro missense ACAD11 1 83108 1.20325E-5 41554 0 NA
3-132347198-T-C c.-153A>G 5_prime_UTR_premature_start_codon_gain ACAD11 1 83112 1.2032E-5 41556 0 NA
3-132347218-G-A p.Pro346Ser missense ACAD11 1 83148 1.20267E-5 41574 0 3.9909E-6
3-132347239-A-G p.Leu339Leu synonymous ACAD11 1 83162 1.20247E-5 41581 0 8.24606E-6
3-132347242-A-C p.Phe338Val missense ACAD11 1 83162 1.20247E-5 41581 0 3.99004E-6
3-132347243-G-A p.Ser337Ser synonymous ACAD11 13 83142 1.56359E-4 41571 0 5.93814E-4
3-132347258-A-G p.Asn332Asn synonymous ACAD11 635 83036 0.00764729 41518 7 0.0154777
3-132347274-T-C p.Tyr327Cys missense ACAD11 1 82888 1.20645E-5 41444 0 4.03428E-6
3-132347277-C-T p.Arg326Lys missense ACAD11 2 82838 2.41435E-5 41419 0 3.18471E-5
3-132347287-CT-C p.Val323fs frameshift ACAD11 1 82620 1.21036E-5 41310 0 NA
3-132347294-T-C c.964-4A>G splice_region ACAD11 5 82154 6.08613E-5 41077 0 2.24056E-5
3-132349300-TTAAAATA-T p.Tyr313fs frameshift ACAD11 13 83254 1.56149E-4 41627 0 2.06635E-4
3-132349316-C-T p.Ala310Thr missense ACAD11 1 83250 1.2012E-5 41625 0 NA
3-132349334-T-C p.Asn304Asp missense ACAD11 1 83244 1.20129E-5 41622 0 NA
3-132349346-A-G p.Ser300Pro missense ACAD11 1 83252 1.20117E-5 41626 0 NA
3-132349363-C-T p.Arg294His missense ACAD11 5 83186 6.01063E-5 41593 0 3.99814E-5
3-132349365-G-A p.Cys293Cys synonymous ACAD11 11 83190 1.32227E-4 41595 0 0.00151362
3-132349384-TC-T p.Glu287fs frameshift ACAD11 2 83100 2.40674E-5 41550 0 NA
3-132349385-C-T p.Glu287Lys missense ACAD11 2 83086 2.40714E-5 41543 0 8.3033E-6
3-132349386-T-TTTGTATAA p.Glu286fs frameshift ACAD11 1 83072 1.20378E-5 41536 0 NA
3-132349387-TCCA-T p.Met285_Glu286delinsLys disruptive_inframe_deletion ACAD11 1 83078 1.20369E-5 41539 0 NA
3-132349387-T-C p.Glu286Gly missense ACAD11 1 83078 1.20369E-5 41539 0 4.05071E-6
3-132349391-T-C p.Met285Val missense ACAD11 1 83050 1.20409E-5 41525 0 8.32238E-6
3-132349393-GAT-G p.Ser284fs frameshift ACAD11 1 83026 1.20444E-5 41513 0 2.44936E-5
3-132349398-T-C p.Ile282Met missense ACAD11 3 83004 3.61428E-5 41502 0 3.1841E-5
3-132349400-T-C p.Ile282Val missense+splice_region ACAD11 1 82990 1.20496E-5 41495 0 4.099E-6
3-132349400-T-A p.Ile282Leu missense+splice_region ACAD11 2 82990 2.40993E-5 41495 0 3.18431E-5
3-132349402-C-CCTGAGTTTTCA c.842-1_842insTGAAAACTCAG splice_acceptor ACAD11 1 82962 1.20537E-5 41481 0 NA
3-132350185-C-T p.Gly281Arg missense+splice_region ACAD11 10 77340 1.29299E-4 38670 0 2.5582E-4
3-132350191-T-C p.Asn279Asp missense ACAD11 2 77534 2.57951E-5 38767 0 1.05598E-5
3-132350193-T-G p.Glu278Ala missense ACAD11 1 77536 1.28972E-5 38768 0 6.37674E-5
3-132350196-C-G p.Ser277Thr missense ACAD11 2 78302 2.55421E-5 39151 0 NA
3-132350196-C-T p.Ser277Asn missense ACAD11 2 78302 2.55421E-5 39151 0 3.1902E-5
3-132350204-AC-A p.Gly274fs frameshift ACAD11 1 79236 1.26205E-5 39618 0 NA
3-132350206-C-G p.Gly274Arg missense ACAD11 1 79228 1.26218E-5 39614 0 NA
3-132350214-ATCATTGGAACTG-A p.Thr267_Met270del disruptive_inframe_deletion ACAD11 1 79446 1.25872E-5 39723 0 NA
3-132350214-A-T p.Ile271Lys missense ACAD11 1 79446 1.25872E-5 39723 0 NA
3-132350218-T-C p.Met270Val missense ACAD11 4 79862 5.00864E-5 39931 0 NA
3-132350231-T-C p.Pro265Pro synonymous ACAD11 1 81148 1.23232E-5 40574 0 NA
3-132350232-G-A p.Pro265Leu missense ACAD11 4 81124 4.93072E-5 40562 0 6.37796E-5
3-132350240-G-A p.Tyr262Tyr synonymous ACAD11 2 81300 2.46002E-5 40650 0 3.18756E-5
3-132350241-T-G p.Tyr262Ser missense ACAD11 2 81304 2.4599E-5 40652 0 4.29247E-6
3-132350246-C-A p.Leu260Leu synonymous ACAD11 1 81294 1.2301E-5 40647 0 1.71767E-5
3-132350257-G-A p.His257Tyr missense ACAD11 1 81536 1.22645E-5 40768 0 3.18837E-5
3-132350265-T-C p.Asp254Gly missense ACAD11 1 81494 1.22708E-5 40747 0 4.26356E-6
3-132350279-AC-A p.Gly249fs frameshift ACAD11 2 81256 2.46136E-5 40628 0 NA
3-132350283-A-G p.Ile248Thr missense ACAD11 9 81010 1.11097E-4 40505 0 7.00949E-4
3-132350293-G-A c.-476C>T 5_prime_UTR_premature_start_codon_gain ACAD11 1 80294 1.24542E-5 40147 0 NA
3-132350319-C-T p.Arg236Gln missense ACAD11 8 78594 1.01789E-4 39297 0 0.00100705
3-132350322-C-T p.Cys235Tyr missense+splice_region ACAD11 1 78538 1.27327E-5 39269 0 NA
3-132350324-C-T c.703-1G>A splice_acceptor ACAD11 1 78460 1.27453E-5 39230 0 3.18776E-5
3-132350324-C-A c.703-1G>T splice_acceptor ACAD11 3 78460 3.8236E-5 39230 0 5.48029E-6
3-132358331-T-A c.702+5A>T splice_region ACAD11 1 83204 1.20187E-5 41602 0 NA
3-132358341-T-C p.Lys233Glu missense ACAD11 1 83238 1.20137E-5 41619 0 1.65678E-5
3-132358357-G-A p.Asn227Asn synonymous ACAD11 1 83282 1.20074E-5 41641 0 6.60066E-5
3-132358376-C-G p.Gly221Ala missense ACAD11 1 83310 1.20034E-5 41655 0 1.19484E-5
3-132358377-C-T p.Gly221Arg missense ACAD11 1 83310 1.20034E-5 41655 0 NA
3-132358378-A-G p.His220His synonymous ACAD11 1 83312 1.20031E-5 41656 0 NA
3-132358407-C-T p.Asp211Asn missense ACAD11 1 83330 1.20005E-5 41665 0 4.37909E-5
3-132358408-G-A c.-579C>T 5_prime_UTR_premature_start_codon_gain ACAD11 1 83336 1.19996E-5 41668 0 3.1837E-5
3-132358432-C-T p.Ser202Ser synonymous ACAD11 2 83322 2.40033E-5 41661 0 1.64908E-5
3-132358433-G-C p.Ser202Trp missense ACAD11 1 83320 1.20019E-5 41660 0 6.37186E-5
3-132358433-G-A p.Ser202Leu missense ACAD11 1 83320 1.20019E-5 41660 0 NA
3-132358437-G-A p.Leu201Leu synonymous ACAD11 2 83318 2.40044E-5 41659 0 NA
3-132358445-A-G p.Met198Thr missense ACAD11 1 83318 1.20022E-5 41659 0 NA
3-132358452-G-A p.Pro196Ser missense ACAD11 1 83300 1.20048E-5 41650 0 1.65044E-5
3-132358460-T-A p.Gln193Leu missense ACAD11 2 83310 2.40067E-5 41655 0 8.25696E-6
3-132358465-A-T p.Ala191Ala synonymous ACAD11 2 83298 2.40102E-5 41649 0 8.26433E-6
3-132358469-G-A p.Ala190Val missense ACAD11 1 83286 1.20068E-5 41643 0 8.27198E-6
3-132358480-T-C p.Gln186Gln synonymous ACAD11 2 83246 2.40252E-5 41623 0 3.32336E-5
3-132358498-T-C p.Val180Val splice_region+synonymous ACAD11 2 83118 2.40622E-5 41559 0 4.24412E-5
3-132358502-T-TGTCTTTTGCAGTACCCAGCACCTATACC c.538-3_538-2insGGTATAGGTGCTGGGTACTGCAAAAGAC splice_region ACAD11 4 83088 4.81417E-5 41544 2 NA
3-132358502-T-TGTCTTTTGCAGTACCCAGCACCTATACCATATCCTTCCAGCTGC c.538-3_538-2insGCAGCTGGAAGGATATGGTATAGGTGCTGGGTACTGCAAAAGAC splice_region ACAD11 2 83088 2.40709E-5 41544 1 NA
3-132358505-A-G c.538-5T>C splice_region ACAD11 1 83058 1.20398E-5 41529 0 8.64723E-6
3-132358506-G-A c.538-6C>T splice_region ACAD11 1 83048 1.20412E-5 41524 0 4.1667E-6
3-132360808-T-G c.537+8A>C splice_region ACAD11 1 82502 1.21209E-5 41251 0 NA
3-132360827-A-G p.Cys176Arg missense ACAD11 1 82780 1.20802E-5 41390 0 6.37227E-5
3-132360829-T-C p.Tyr175Cys missense ACAD11 1 82808 1.20761E-5 41404 0 NA
3-132360830-A-AT p.Tyr175fs frameshift ACAD11 1 83166 1.20241E-5 41583 0 NA
3-132360831-C-A p.Gly174Gly synonymous ACAD11 1 83154 1.20259E-5 41577 0 NA
3-132360831-C-T p.Gly174Gly synonymous ACAD11 1 83154 1.20259E-5 41577 0 3.9853E-6
3-132360837-A-T p.Gly172Gly synonymous ACAD11 3 83194 3.60603E-5 41597 0 6.37592E-5
3-132360837-A-G p.Gly172Gly synonymous ACAD11 1 83194 1.20201E-5 41597 0 1.19404E-5
3-132360844-C-T p.Gly170Asp missense ACAD11 1 83194 1.20201E-5 41597 0 NA
3-132360851-C-T p.Gly168Arg missense ACAD11 1 83204 1.20187E-5 41602 0 NA
3-132360866-A-G p.Ser163Pro missense ACAD11 9 83226 1.08139E-4 41613 0 2.22916E-4
3-132360876-C-T p.Leu159Leu synonymous ACAD11 20 83214 2.40344E-4 41607 0 0.00151057
3-132360883-C-T p.Arg157His missense ACAD11 83106 83110 0.999952 41555 41553 1.0
3-132360887-A-G p.Leu156Leu synonymous ACAD11 1 83206 1.20184E-5 41603 0 NA
3-132360890-G-A p.Gln155* stop_gained ACAD11 1 83192 1.20204E-5 41596 0 NA
3-132360895-A-C p.Leu153Trp missense ACAD11 1 83196 1.20198E-5 41598 0 NA
3-132360896-A-G c.-752T>C 5_prime_UTR_premature_start_codon_gain ACAD11 1 83188 1.2021E-5 41594 0 8.24117E-6
3-132360906-C-T p.Thr149Thr synonymous ACAD11 48 83174 5.77103E-4 41587 0 0.00133809
3-132360915-A-T p.Tyr146* stop_gained ACAD11 3 83152 3.60785E-5 41576 0 3.9781E-6
3-132360940-C-T p.Ser138Asn missense ACAD11 2 83170 2.40471E-5 41585 0 1.64984E-5
3-132360958-A-C p.Leu132* stop_gained ACAD11 1 83132 1.20291E-5 41566 0 NA
3-132360964-C-T p.Arg130His missense ACAD11 2 83124 2.40604E-5 41562 0 2.48492E-5
3-132360965-G-A p.Arg130Cys missense ACAD11 40 83112 4.81278E-4 41556 0 0.00100705
3-132360966-G-A p.Phe129Phe synonymous ACAD11 2 83126 2.40599E-5 41563 0 3.98321E-6
3-132360972-TC-T p.Arg127fs frameshift ACAD11 1 83104 1.20331E-5 41552 0 3.18532E-5
3-132360973-C-T p.Arg127Gln missense ACAD11 95 83080 0.00114348 41540 2 0.00100705
3-132360973-C-G p.Arg127Pro missense ACAD11 1 83086 1.20357E-5 41543 0 5.18321E-5
3-132360974-G-T p.Arg127Arg synonymous ACAD11 1 83084 1.2036E-5 41542 0 3.18552E-5
3-132361515-A-C c.375+6T>G splice_region ACAD11 1 82856 1.20691E-5 41428 0 4.21574E-6
3-132361528-T-A p.His123Leu missense ACAD11 1 83002 1.20479E-5 41501 0 NA
3-132361534-A-T p.Met121Lys missense ACAD11 1 83026 1.20444E-5 41513 0 3.29685E-5
3-132361538-C-T p.Val120Ile missense ACAD11 2 83010 2.40935E-5 41505 0 1.59286E-4
3-132361539-G-A c.-852C>T 5_prime_UTR_premature_start_codon_gain ACAD11 20 83020 2.40906E-4 41510 0 2.88441E-4
3-132361564-G-T p.Thr111Asn missense ACAD11 9 83114 1.08285E-4 41557 0 1.07116E-4
3-132361575-G-A c.-888C>T 5_prime_UTR_premature_start_codon_gain ACAD11 1 83186 1.20213E-5 41593 0 3.18451E-5
3-132361577-A-G p.Tyr107His missense ACAD11 1 83180 1.20221E-5 41590 0 9.55353E-5
3-132361578-C-T p.Leu106Leu synonymous ACAD11 112 83178 0.00134651 41589 0 0.00293031
3-132361580-G-C p.Leu106Val missense ACAD11 1 83190 1.20207E-5 41595 0 9.55475E-5
3-132361596-G-A c.-909C>T 5_prime_UTR_premature_start_codon_gain ACAD11 4619 83090 0.0555903 41545 141 0.0548842
3-132361606-A-G p.Ile97Thr missense ACAD11 14 83182 1.68306E-4 41591 0 6.25E-4
3-132361622-T-C p.Lys92Glu missense ACAD11 1 83160 1.2025E-5 41580 0 NA
3-132361632-A-G p.Phe88Phe synonymous ACAD11 1 83136 1.20285E-5 41568 0 3.1839E-5
3-132361633-A-C p.Phe88Cys missense ACAD11 2 83140 2.40558E-5 41570 0 9.55475E-5
3-132361642-T-C p.Asp85Gly missense ACAD11 1 83120 1.20308E-5 41560 0 NA
3-132363633-T-A c.249+8A>T splice_region ACAD11 2 82380 2.42777E-5 41190 0 NA
3-132363635-C-T c.249+6G>A splice_region ACAD11 2 82458 2.42548E-5 41229 0 8.28967E-6
3-132363654-GGAA-G p.Leu78del disruptive_inframe_deletion ACAD11 2 82920 2.41196E-5 41460 0 8.25982E-6
3-132363673-G-T p.Pro73Thr missense ACAD11 1 82998 1.20485E-5 41499 0 8.25205E-6
3-132363689-A-G p.Tyr67Tyr synonymous ACAD11 2 82992 2.40987E-5 41496 0 8.25355E-6
3-132363704-C-T p.Lys62Lys synonymous ACAD11 3 82950 3.61664E-5 41475 0 NA
3-132363707-CTGGAGATAAAAGGTTGGAT-C p.Asn55fs frameshift ACAD11 2 82928 2.41173E-5 41464 0 4.12834E-5
3-132363714-T-C p.Tyr59Cys missense ACAD11 1 82796 1.20779E-5 41398 0 3.2256E-5
3-132363720-G-T p.Thr57Asn missense ACAD11 2 82780 2.41604E-5 41390 0 3.19857E-5
3-132363726-T-C p.Asn55Ser missense ACAD11 10 82708 1.20907E-4 41354 0 1.59847E-4
3-132363734-T-C p.Gly52Gly synonymous ACAD11 1 82572 1.21106E-5 41286 0 2.08997E-5
3-132363744-G-C c.150-4C>G splice_region ACAD11 1 82112 1.21785E-5 41056 0 NA
3-132378449-G-A p.Tyr49Tyr splice_region+synonymous ACAD11 1 83060 1.20395E-5 41530 0 3.1839E-5
3-132378453-T-A p.Gln48Leu missense ACAD11 1 83068 1.20383E-5 41534 0 4.06676E-6
3-132378456-G-A p.Ala47Val missense ACAD11 1 83068 1.20383E-5 41534 0 NA
3-132378459-A-G p.Ile46Thr missense ACAD11 47 83098 5.65597E-4 41549 0 6.3678E-4
3-132378461-G-A p.Thr45Thr synonymous ACAD11 1 83124 1.20302E-5 41562 0 4.05416E-6
3-132378488-A-G p.Phe36Phe synonymous ACAD11 3 83164 3.60733E-5 41582 0 1.20925E-5
3-132378491-G-A p.Gly35Gly synonymous ACAD11 2 83160 2.405E-5 41580 0 NA
3-132378511-G-C p.Leu29Val missense ACAD11 2 83148 2.40535E-5 41574 0 8.24484E-6
3-132378515-G-A p.Ala27Ala synonymous ACAD11 3 83140 3.60837E-5 41570 0 1.27389E-4
3-132378532-T-C p.Ser22Gly missense ACAD11 3 83090 3.61054E-5 41545 0 4.12432E-5
3-132378532-T-G p.Ser22Arg missense ACAD11 1 83092 1.20349E-5 41546 0 NA
3-132378535-C-A p.Asp21Tyr missense ACAD11 1 83096 1.20343E-5 41548 0 NA
3-132378547-G-A p.Gln17* stop_gained ACAD11 1 83060 1.20395E-5 41530 0 4.12773E-5
3-132378548-G-A p.Pro16Pro synonymous ACAD11 1 83056 1.20401E-5 41528 0 8.25587E-6
3-132378548-G-T p.Pro16Pro synonymous ACAD11 1 83056 1.20401E-5 41528 0 NA
3-132378550-G-A p.Pro16Ser missense ACAD11 5 83042 6.02105E-5 41521 0 1.59246E-4
3-132378550-G-T p.Pro16Thr missense ACAD11 1 83042 1.20421E-5 41521 0 NA
3-132378559-C-A p.Glu13* stop_gained ACAD11 91 82968 0.00109681 41484 2 0.0022293
3-132378560-G-A c.-1173C>T 5_prime_UTR_premature_start_codon_gain ACAD11 1 82986 1.20502E-5 41493 0 NA
3-132378562-C-T p.Ala12Thr missense ACAD11 1 82982 1.20508E-5 41491 0 NA
3-132378568-C-T p.Asp10Asn missense ACAD11 3 82950 3.61664E-5 41475 0 1.21001E-5
3-132378589-G-C p.Pro3Ala missense ACAD11 4 82872 4.82672E-5 41436 0 8.39786E-5
3-132378590-C-G p.Lys2Asn missense ACAD11 1 82862 1.20683E-5 41431 0 NA
3-132378595-T-C p.Met1? start_lost ACAD11 1 82780 1.20802E-5 41390 0 NA
3-132378631-C-T c.-36G>A 5_prime_UTR_premature_start_codon_gain ACAD11 1 81960 1.22011E-5 40980 0 NA
3-132378670-G-A c.-75C>T 5_prime_UTR_premature_start_codon_gain ACAD11 3 78652 3.81427E-5 39326 0 NA
3-132378678-T-C c.-83A>G 5_prime_UTR_premature_start_codon_gain ACAD11 3 77946 3.84882E-5 38973 0 NA
3-132378697-G-A c.-102C>T 5_prime_UTR_premature_start_codon_gain ACAD11 1 73786 1.35527E-5 36893 0 NA
3-132378726-C-T c.-131G>A 5_prime_UTR_premature_start_codon_gain ACAD11 1 66538 1.5029E-5 33269 0 NA
3-132378772-G-A c.-177C>T 5_prime_UTR_premature_start_codon_gain ACAD11 1 45958 2.1759E-5 22979 0 6.37024E-5
3-132378808-A-G c.-213T>C 5_prime_UTR_premature_start_codon_gain ACAD11 17 29380 5.78625E-4 14690 0 6.37349E-4
3-132378995-G-C c.-400C>G 5_prime_UTR_premature_start_codon_gain ACAD11 1 7464 1.33976E-4 3732 0 3.18654E-5
3-132379074-C-T c.-479G>A 5_prime_UTR_premature_start_codon_gain ACAD11 4 16518 2.4216E-4 8259 0 3.18492E-5
3-132379213-G-C c.-618C>G 5_prime_UTR_premature_start_codon_gain ACAD11 1 41986 2.38175E-5 20993 0 3.18674E-5
3-132379267-G-C c.-672C>G 5_prime_UTR_premature_start_codon_gain ACAD11 1 57430 1.74125E-5 28715 0 NA
3-132379294-G-A c.-699C>T 5_prime_UTR_premature_start_codon_gain ACAD11 1 64548 1.54923E-5 32274 0 NA
3-132379314-C-A c.-719G>T 5_prime_UTR_premature_start_codon_gain ACAD11 1951 69362 0.0281278 34681 25 0.0307398
3-132379335-G-A c.-740C>T 5_prime_UTR_premature_start_codon_gain ACAD11 1 73792 1.35516E-5 36896 0 NA
3-132379370-G-A c.-775C>T 5_prime_UTR_premature_start_codon_gain ACAD11 3 78240 3.83436E-5 39120 0 5.10204E-4
3-132379478-G-A c.-883C>T 5_prime_UTR_premature_start_codon_gain ACAD11 1 81164 1.23207E-5 40582 0 NA
3-132379491-G-A c.-896C>T 5_prime_UTR_premature_start_codon_gain ACAD11 1 81162 1.2321E-5 40581 0 5.46317E-6