Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
12-112123904-C-T c.-153C>T 5_prime_UTR_premature_start_codon_gain ACAD10 1 3618 2.76396E-4 1809 0 NA
12-112123926-G-A c.-131G>A 5_prime_UTR_premature_start_codon_gain ACAD10 1 3280 3.04878E-4 1640 0 3.18695E-5
12-112124043-G-GCCTCAGCCTCACCATGTGTGTCAGGAGCTGTTTCCAGTCCCCCC c.-14_-14+1insCCTCAGCCTCACCATGTGTGTCAGGAGCTGTTTCCAGTCCCCCC splice_donor ACAD10 1 2996 3.33778E-4 1498 0 NA
12-112130496-C-G c.-13-5C>G splice_region ACAD10 17 82840 2.05215E-4 41420 0 1.2142E-4
12-112130497-A-G c.-13-4A>G splice_region ACAD10 2 82870 2.41342E-5 41435 0 NA
12-112130498-C-T c.-13-3C>T splice_region ACAD10 1 82878 1.20659E-5 41439 0 NA
12-112130514-A-G p.Met1? start_lost ACAD10 2 83098 2.4068E-5 41549 0 1.19804E-5
12-112130516-G-A p.Met1? start_lost ACAD10 1 83122 1.20305E-5 41561 0 NA
12-112130528-C-G p.Ser5Arg missense ACAD10 1 83158 1.20253E-5 41579 0 3.98839E-6
12-112130538-T-TC p.Arg11fs frameshift ACAD10 1 83192 1.20204E-5 41596 0 NA
12-112130539-C-A p.Ser9Tyr missense ACAD10 1 83206 1.20184E-5 41603 0 3.98511E-6
12-112130543-C-G p.Pro10Pro synonymous ACAD10 1 83236 1.2014E-5 41618 0 NA
12-112130544-C-T p.Arg11Cys missense ACAD10 1 83228 1.20152E-5 41614 0 9.55657E-5
12-112130545-G-A p.Arg11His missense ACAD10 21 83222 2.52337E-4 41611 0 1.59297E-4
12-112130549-C-G c.-977C>G 5_prime_UTR_premature_start_codon_gain ACAD10 2 83240 2.40269E-5 41620 0 NA
12-112130556-G-C p.Val15Leu missense ACAD10 2 83230 2.40298E-5 41615 0 1.64818E-5
12-112130561-G-A p.Trp16* stop_gained ACAD10 1 83250 1.2012E-5 41625 0 3.97842E-6
12-112130564-A-G p.Arg17Arg synonymous ACAD10 668 83226 0.00802634 41613 8 0.0163428
12-112130570-C-G p.Ala19Ala synonymous ACAD10 12 83264 1.4412E-4 41632 0 1.27397E-4
12-112130578-AAC-A p.Thr24fs frameshift ACAD10 1 83260 1.20106E-5 41630 0 5.05051E-4
12-112130579-A-T p.Lys22Asn missense ACAD10 1 83268 1.20094E-5 41634 0 8.239E-6
12-112130587-A-G p.Gln25Arg missense ACAD10 2 83274 2.40171E-5 41637 0 NA
12-112130589-C-T p.Arg26Cys missense ACAD10 3 83278 3.60239E-5 41639 0 3.18208E-5
12-112130590-G-A p.Arg26His missense ACAD10 4 83284 4.80284E-5 41642 0 1.27389E-4
12-112130591-C-T p.Arg26Arg synonymous ACAD10 1 83286 1.20068E-5 41643 0 8.23832E-6
12-112130595-C-T p.His28Tyr missense ACAD10 5 83282 6.0037E-5 41641 0 6.25E-4
12-112130599-AG-A p.Ser31fs frameshift ACAD10 1 83302 1.20045E-5 41651 0 NA
12-112130610-C-T p.Arg33* stop_gained ACAD10 16 83314 1.92045E-4 41657 0 5.25005E-4
12-112130611-G-A p.Arg33Gln missense ACAD10 29 83316 3.48072E-4 41658 0 2.30707E-4
12-112130613-T-C p.Trp34Arg missense ACAD10 1 83318 1.20022E-5 41659 0 1.98851E-5
12-112130624-T-C p.Leu37Leu synonymous ACAD10 2 83326 2.40021E-5 41663 0 NA
12-112130635-C-G p.Thr41Ser missense ACAD10 2 83302 2.4009E-5 41651 0 3.18512E-5
12-112130640-A-G p.Arg43Gly missense ACAD10 1 83290 1.20062E-5 41645 0 1.98932E-5
12-112130645-G-A p.Ala44Ala synonymous ACAD10 22 83276 2.64182E-4 41638 0 7.00771E-4
12-112130647-TG-T p.Ile46fs frameshift ACAD10 1 83276 1.20083E-5 41638 0 8.24348E-6
12-112130652-T-C p.Phe47Leu missense ACAD10 3 83274 3.60256E-5 41637 0 3.18512E-5
12-112130654-C-T c.-872C>T 5_prime_UTR_premature_start_codon_gain ACAD10 11 83268 1.32104E-4 41634 0 1.91107E-4
12-112130655-G-A p.Asp48Asn missense ACAD10 1 83264 1.201E-5 41632 0 1.59212E-5
12-112130659-T-G p.Met49Arg missense ACAD10 8 83262 9.60822E-5 41631 0 3.98013E-5
12-112130666-A-T p.Gly51Gly synonymous ACAD10 661 83202 0.00794452 41601 8 0.0162143
12-112130674-T-G p.Ile54Ser missense ACAD10 11 83176 1.3225E-4 41588 0 2.54793E-4
12-112130694-G-A p.Ala61Thr missense ACAD10 1 82802 1.2077E-5 41401 0 2.49617E-5
12-112130700-G-T p.Glu63* stop_gained ACAD10 1 82648 1.20995E-5 41324 0 NA
12-112130702-T-C c.187+2T>C splice_donor ACAD10 2 82544 2.42295E-5 41272 0 8.36092E-6
12-112130708-A-G c.187+8A>G splice_region ACAD10 3682 81786 0.0450199 40893 359 0.0971112
12-112139970-G-C p.Trp64Cys missense ACAD10 1 83282 1.20074E-5 41641 0 8.02536E-6
12-112139983-C-T p.Arg69Cys missense ACAD10 1 83264 1.201E-5 41632 0 2.47211E-5
12-112139983-C-A p.Arg69Ser missense ACAD10 1 83264 1.201E-5 41632 0 NA
12-112139984-G-T p.Arg69Leu missense ACAD10 2 83262 2.40206E-5 41631 0 NA
12-112139985-TA-T p.Ile70fs frameshift ACAD10 2 83270 2.40183E-5 41635 0 NA
12-112139992-T-G p.Ser72Ala missense ACAD10 1 83276 1.20083E-5 41638 0 NA
12-112139997-A-G p.Gly73Gly synonymous ACAD10 1 83274 1.20085E-5 41637 0 NA
12-112140001-A-G p.Ile75Val missense ACAD10 7 83268 8.40659E-5 41634 0 5.03525E-4
12-112140032-A-G p.Asn85Ser missense ACAD10 3 83328 3.60023E-5 41664 0 3.18573E-5
12-112140052-A-G p.Met92Val missense ACAD10 1 83344 1.19985E-5 41672 0 NA
12-112140060-A-G p.Ala94Ala synonymous ACAD10 1 83344 1.19985E-5 41672 0 6.36659E-5
12-112140068-C-T p.Thr97Ile missense ACAD10 3 83340 3.59971E-5 41670 0 5.96668E-5
12-112140077-GT-G p.Leu102fs frameshift ACAD10 6 83346 7.19891E-5 41673 0 3.97864E-6
12-112140093-T-C p.Phe105Phe synonymous ACAD10 1 83350 1.19976E-5 41675 0 NA
12-112140114-G-GTTAAAGACCTCCGTGCCTGTGGACTCATTTTTCTCTCTGTTGACCA c.336_336+1insTTAAAGACCTCCGTGCCTGTGGACTCATTTTTCTCTCTGTTGACCA splice_donor ACAD10 2 83338 2.39987E-5 41669 1 NA
12-112140114-G-GTTAAAGACCTCC c.336_336+1insTTAAAGACCTCC splice_donor ACAD10 1 83338 1.19993E-5 41669 0 NA
12-112143536-TCTTA-T c.337-5_337-2delCTTA splice_acceptor ACAD10 4 83130 4.81174E-5 41565 0 2.47782E-5
12-112143553-C-T c.-665C>T 5_prime_UTR_premature_start_codon_gain ACAD10 1 83240 1.20135E-5 41620 0 9.07037E-5
12-112143554-G-A p.Val117Met missense ACAD10 5 83248 6.00615E-5 41624 0 6.37552E-5
12-112143562-G-GGACTCATTTTTCTCTCTGTT p.Ser128fs frameshift ACAD10 1 83274 1.20085E-5 41637 0 3.97871E-6
12-112143568-A-AT p.Ser124fs frameshift ACAD10 1 83298 1.20051E-5 41649 0 7.95754E-6
12-112143586-C-T p.Thr127Thr synonymous ACAD10 1 83328 1.20008E-5 41664 0 NA
12-112143587-A-G p.Ser128Gly missense ACAD10 1 83326 1.20011E-5 41663 0 5.03525E-4
12-112143594-G-A p.Arg130Gln missense ACAD10 1 83336 1.19996E-5 41668 0 5.03525E-4
12-112143610-C-A p.Phe135Leu missense ACAD10 1 83352 1.19973E-5 41676 0 1.64742E-5
12-112143610-C-T p.Phe135Phe synonymous ACAD10 4 83352 4.79893E-5 41676 0 3.57927E-5
12-112143613-A-C p.Pro136Pro synonymous ACAD10 1 83356 1.19967E-5 41678 0 8.23696E-6
12-112143626-G-T p.Ala141Ser missense ACAD10 1 83350 1.19976E-5 41675 0 7.95431E-6
12-112143641-C-T p.Arg146Trp missense ACAD10 2 83356 2.39935E-5 41678 0 2.78383E-5
12-112143660-C-A p.Thr152Asn missense ACAD10 1 83352 1.19973E-5 41676 0 NA
12-112143660-C-T p.Thr152Ile missense ACAD10 1 83352 1.19973E-5 41676 0 3.97693E-6
12-112143667-C-T p.Val154Val synonymous ACAD10 2 83356 2.39935E-5 41678 0 3.18512E-5
12-112143671-A-C p.Ser156Arg missense ACAD10 2 83364 2.39912E-5 41682 0 1.64739E-5
12-112143687-T-C p.Leu161Pro missense ACAD10 2 83338 2.39987E-5 41669 0 3.97735E-6
12-112143702-G-C p.Ser166Thr missense ACAD10 1 83316 1.20025E-5 41658 0 3.97791E-6
12-112143710-C-T p.Pro169Ser missense ACAD10 1 83312 1.20031E-5 41656 0 7.95697E-6
12-112143719-C-T p.Arg172Trp missense ACAD10 4 83298 4.80204E-5 41649 0 3.18634E-5
12-112143732-A-G p.Asp176Gly missense ACAD10 1 83266 1.20097E-5 41633 0 3.97975E-6
12-112147324-C-T c.532-6C>T splice_region ACAD10 4 81806 4.88962E-5 40903 0 2.39443E-5
12-112147330-A-G p.Ile178Val missense+splice_region ACAD10 1 82104 1.21797E-5 41052 0 1.59276E-4
12-112147341-C-T c.-470C>T 5_prime_UTR_premature_start_codon_gain ACAD10 1 82532 1.21165E-5 41266 0 4.24903E-6
12-112147341-C-G p.Ser181Ser synonymous ACAD10 1 82532 1.21165E-5 41266 0 NA
12-112147362-G-A p.Lys188Lys synonymous ACAD10 2 82728 2.41756E-5 41364 0 1.67372E-5
12-112147378-T-C p.Tyr194His missense ACAD10 1 82706 1.2091E-5 41353 0 3.1841E-5
12-112147379-A-G p.Tyr194Cys missense ACAD10 1 82704 1.20913E-5 41352 0 3.99568E-6
12-112147397-A-G p.Gln200Arg missense ACAD10 633 82538 0.00766919 41269 7 0.0163334
12-112147401-C-T c.-410C>T 5_prime_UTR_premature_start_codon_gain ACAD10 11 82534 1.33278E-4 41267 0 1.65851E-4
12-112147423-A-G p.Ile209Val missense ACAD10 1 82174 1.21693E-5 41087 0 3.18431E-5
12-112147424-T-C p.Ile209Thr missense ACAD10 4 82160 4.86855E-5 41080 0 NA
12-112147433-A-G p.Asp212Gly missense ACAD10 2 81888 2.44236E-5 40944 0 8.31172E-6
12-112147438-C-T p.Leu214Phe missense ACAD10 9 81728 1.10121E-4 40864 0 4.24088E-4
12-112147443-A-G p.Gly215Gly synonymous ACAD10 2 81474 2.45477E-5 40737 0 1.66428E-5
12-112147444-A-C p.Thr216Pro missense ACAD10 621 81368 0.00763199 40684 6 0.0164002
12-112147457-A-G p.Glu220Gly missense ACAD10 1 80758 1.23827E-5 40379 0 NA
12-112147472-G-T p.Gly225Val missense ACAD10 2 79434 2.51781E-5 39717 0 8.39729E-6
12-112147472-G-C p.Gly225Ala missense ACAD10 2 79434 2.51781E-5 39717 0 8.0861E-6
12-112147488-G-GAGACAGGGTTTTGCCGTGTTGCCCAAGCTGGTGTCGAACTCCT c.690_690+1insAGACAGGGTTTTGCCGTGTTGCCCAAGCTGGTGTCGAACTCCT splice_donor ACAD10 1 77308 1.29353E-5 38654 0 NA
12-112147493-T-C c.690+5T>C splice_region ACAD10 2 76230 2.62364E-5 38115 0 3.1839E-5
12-112148100-C-T p.Pro238Pro synonymous ACAD10 11 16498 6.66748E-4 8249 0 3.70481E-4
12-112148111-C-T p.Ser242Leu missense ACAD10 2 16590 1.20555E-4 8295 0 3.52768E-4
12-112148112-G-A p.Ser242Ser synonymous ACAD10 6 16580 3.61882E-4 8290 0 0.00125088
12-112148115-C-A p.Asn243Lys missense ACAD10 2 16626 1.20294E-4 8313 0 NA
12-112148143-T-TAA p.Tyr253fs frameshift ACAD10 3 16688 1.7977E-4 8344 0 1.60576E-5
12-112150298-C-T c.691-4C>T splice_region ACAD10 5 83180 6.01106E-5 41590 0 3.18492E-5
12-112150299-C-G c.691-3C>G splice_region ACAD10 1 83200 1.20192E-5 41600 0 4.0493E-6
12-112150310-C-T p.Asp233Asp synonymous ACAD10 1 83250 1.2012E-5 41625 0 NA
12-112150312-C-T p.Pro234Leu missense ACAD10 1 83248 1.20123E-5 41624 0 2.47325E-5
12-112150319-T-C p.Thr236Thr synonymous ACAD10 1 83272 1.20088E-5 41636 0 3.1841E-5
12-112150333-TAGA-T p.Glu242del disruptive_inframe_deletion ACAD10 1 83304 1.20042E-5 41652 0 1.19327E-5
12-112150341-C-G p.Leu244Val missense ACAD10 1 83304 1.20042E-5 41652 0 NA
12-112150348-G-A p.Gly246Asp missense ACAD10 1 83312 1.20031E-5 41656 0 NA
12-112150363-T-C p.Val251Ala missense ACAD10 3 83310 3.60101E-5 41655 0 6.37267E-5
12-112150365-G-T p.Gly252Cys missense ACAD10 4 83310 4.80134E-5 41655 0 1.27348E-4
12-112150369-T-A p.Val253Asp missense ACAD10 2 83318 2.40044E-5 41659 0 3.97662E-6
12-112150379-T-C p.Thr256Thr synonymous ACAD10 2 83300 2.40096E-5 41650 0 NA
12-112150380-C-T p.Arg257Trp missense ACAD10 2 83296 2.40108E-5 41648 0 0.00100806
12-112150381-G-A p.Arg257Gln missense ACAD10 5 83296 6.00269E-5 41648 0 5.04032E-4
12-112150397-G-A p.Thr262Thr synonymous ACAD10 1 83288 1.20065E-5 41644 0 1.9884E-5
12-112150408-C-T p.Pro266Leu missense ACAD10 50 83272 6.00442E-4 41636 0 0.008125
12-112150420-T-C p.Leu270Ser missense ACAD10 2 83270 2.40183E-5 41635 0 NA
12-112150429-A-G p.Tyr273Cys missense ACAD10 1 83256 1.20111E-5 41628 0 3.977E-6
12-112150446-G-C p.Gly279Arg missense ACAD10 1 83232 1.20146E-5 41616 0 1.64796E-5
12-112150452-C-T p.Gln281* stop_gained ACAD10 1 83190 1.20207E-5 41595 0 6.25E-4
12-112150453-A-G p.Gln281Arg missense ACAD10 1 83184 1.20215E-5 41592 0 NA
12-112150464-A-T c.850+3A>T splice_region ACAD10 1 83076 1.20372E-5 41538 0 NA
12-112150465-T-C c.850+4T>C splice_region ACAD10 6 83080 7.22195E-5 41540 0 9.55292E-5
12-112150466-G-A c.850+5G>A splice_region ACAD10 1 83074 1.20375E-5 41537 0 1.59964E-5
12-112153628-C-T p.Pro285Leu missense ACAD10 2 83392 2.39831E-5 41696 0 1.64756E-5
12-112153629-A-G p.Pro285Pro synonymous ACAD10 1 83394 1.19913E-5 41697 0 NA
12-112153630-T-C c.-157T>C 5_prime_UTR_premature_start_codon_gain ACAD10 44 83394 5.27616E-4 41697 0 0.00855992
12-112153632-G-A p.Leu286Leu synonymous ACAD10 1 83404 1.19898E-5 41702 0 8.23737E-6
12-112153633-G-C p.Glu287Gln missense ACAD10 3 83408 3.59678E-5 41704 0 NA
12-112153644-G-A p.Gln290Gln synonymous ACAD10 1 83412 1.19887E-5 41706 0 3.9763E-6
12-112153653-C-T c.-134C>T 5_prime_UTR_premature_start_codon_gain ACAD10 4 83408 4.7957E-5 41704 0 7.9526E-6
12-112153654-G-C p.Gly294Arg missense ACAD10 1 83404 1.19898E-5 41702 0 NA
12-112153654-G-A p.Gly294Arg missense ACAD10 5 83404 5.99492E-5 41702 0 7.41314E-5
12-112153655-G-A p.Gly294Glu missense ACAD10 1 83408 1.19893E-5 41704 0 NA
12-112153660-T-C p.Ser296Pro missense ACAD10 1 83410 1.1989E-5 41705 0 NA
12-112153663-A-C p.Asn297His missense ACAD10 2 83410 2.39779E-5 41705 0 6.37064E-5
12-112153674-C-T p.Tyr300Tyr synonymous ACAD10 12 83410 1.43868E-4 41705 0 1.91083E-4
12-112153678-A-G p.Ile302Val missense ACAD10 3 83416 3.59643E-5 41708 0 8.23655E-6
12-112153690-A-G p.Asn306Asp missense ACAD10 2 83408 2.39785E-5 41704 0 NA
12-112153692-T-C p.Asn306Asn synonymous ACAD10 1 83404 1.19898E-5 41702 0 1.64728E-5
12-112153693-C-T p.Arg307Cys missense ACAD10 4 83404 4.79593E-5 41702 0 6.37389E-5
12-112153694-G-A p.Arg307His missense ACAD10 1 83406 1.19895E-5 41703 0 3.97633E-6
12-112153716-G-GC p.Gly317fs frameshift ACAD10 2 83362 2.39917E-5 41681 0 NA
12-112153719-C-T p.Pro315Pro synonymous ACAD10 4 83350 4.79904E-5 41675 0 3.977E-6
12-112153720-C-T p.Pro316Ser missense ACAD10 4 83348 4.79916E-5 41674 0 3.18796E-5
12-112153723-G-A p.Gly317Arg missense ACAD10 1 83346 1.19982E-5 41673 0 0.00125
12-112153727-C-T p.Thr318Ile missense ACAD10 5 83330 6.00024E-5 41665 0 8.23642E-6
12-112153731-C-T p.Leu319Leu synonymous ACAD10 1 83322 1.20016E-5 41661 0 NA
12-112153742-C-T p.Ala323Val missense ACAD10 2 83254 2.40229E-5 41627 0 1.19372E-5
12-112153748-C-A p.Ala325Asp missense ACAD10 3 83222 3.60482E-5 41611 0 NA
12-112153750-A-G p.Ile326Val missense ACAD10 1 83200 1.20192E-5 41600 0 NA
12-112153761-G-A p.Glu329Glu synonymous ACAD10 151 83056 0.00181805 41528 3 0.00357143
12-112153767-G-GATTATGAAAGCCCTTGCAAATGCTGGAGTACCTGTCCC c.992+1_992+2insATTATGAAAGCCCTTGCAAATGCTGGAGTACCTGTCCC splice_donor ACAD10 4 83002 4.81916E-5 41501 1 NA
12-112159473-A-G c.993-2A>G splice_acceptor ACAD10 4 82934 4.82311E-5 41467 0 1.27348E-4
12-112159491-G-T p.Ala337Ser missense ACAD10 21 83070 2.52799E-4 41535 0 5.68941E-4
12-112159493-A-C p.Ala337Ala synonymous ACAD10 1 83064 1.20389E-5 41532 0 NA
12-112159495-A-G p.Met1? start_lost ACAD10 1 83082 1.20363E-5 41541 0 8.24484E-6
12-112159501-G-T p.Glu3* stop_gained ACAD10 1 83054 1.20404E-5 41527 0 NA
12-112159508-T-A p.Leu5Gln missense ACAD10 4 82974 4.82079E-5 41487 0 2.39475E-5
12-112159517-C-T p.Thr8Met missense ACAD10 1 82902 1.20624E-5 41451 0 NA
12-112159543-G-GT c.1061_1061+1insT splice_donor ACAD10 4 82662 4.83898E-5 41331 0 NA
12-112159794-A-G n.1342A>G splice_region ACAD10 1 24184 4.13497E-5 12092 0 NA
12-112165777-C-CATTGG p.Pro359fs frameshift ACAD10 2 83370 2.39894E-5 41685 0 NA
12-112165779-C-A p.Pro359Thr missense ACAD10 2 83376 2.39877E-5 41688 0 NA
12-112165780-CCT-C p.Phe360fs frameshift ACAD10 2 83380 2.39866E-5 41690 0 NA
12-112165793-G-A p.Met363Ile missense ACAD10 1 83382 1.1993E-5 41691 0 3.18654E-5
12-112165796-G-A p.Glu364Glu synonymous ACAD10 1 83384 1.19927E-5 41692 0 NA
12-112165819-A-G p.Lys372Arg missense ACAD10 31 83380 3.71792E-4 41690 0 5.09944E-4
12-112165834-C-T p.Pro377Leu missense ACAD10 1 83366 1.19953E-5 41683 0 3.97928E-6
12-112165851-C-T p.His383Tyr missense ACAD10 1 83350 1.19976E-5 41675 0 NA
12-112165855-G-A p.Arg384Lys missense ACAD10 3 83352 3.59919E-5 41676 0 5.77044E-5
12-112165856-A-G p.Arg384Arg synonymous ACAD10 668 83332 0.00801613 41666 8 0.0163386
12-112165857-C-T p.Arg385* stop_gained ACAD10 2 83346 2.39964E-5 41673 0 3.18532E-5
12-112165858-G-A p.Arg385Gln missense ACAD10 3 83368 3.5985E-5 41684 0 1.98897E-5
12-112165863-A-G p.Ile387Val missense ACAD10 1 83372 1.19944E-5 41686 0 6.3674E-5
12-112165873-C-G p.Ala390Gly missense ACAD10 1 83370 1.19947E-5 41685 0 6.36943E-5
12-112165882-C-G p.Thr393Arg missense ACAD10 1 83372 1.19944E-5 41686 0 NA
12-112165892-C-A p.Cys396* stop_gained ACAD10 1 83360 1.19962E-5 41680 0 NA
12-112165894-A-G p.Lys397Arg missense ACAD10 1 83366 1.19953E-5 41683 0 NA
12-112165903-G-C p.Ser400Thr missense ACAD10 2 83368 2.399E-5 41684 0 0.00100705
12-112165936-A-G p.Tyr411Cys missense ACAD10 1 83306 1.20039E-5 41653 0 1.69632E-5
12-112165941-A-C p.Lys413Gln missense ACAD10 18 83278 2.16144E-4 41639 0 3.50385E-4
12-112165948-G-GGGACTATATTCCACGCCAGGTACGAACC c.1243+1_1243+2insGGACTATATTCCACGCCAGGTACGAACC splice_donor ACAD10 2 83194 2.40402E-5 41597 0 NA
12-112165948-G-T c.1243+1G>T splice_donor ACAD10 1 83194 1.20201E-5 41597 0 NA
12-112167603-C-T c.1244-7C>T splice_region ACAD10 1 83308 1.20036E-5 41654 0 NA
12-112167605-C-T c.1244-5C>T splice_region ACAD10 1 83318 1.20022E-5 41659 0 3.18674E-5
12-112167606-G-A c.1244-4G>A splice_region ACAD10 2 83322 2.40033E-5 41661 0 8.29944E-6
12-112167606-G-T c.1244-4G>T splice_region ACAD10 5 83322 6.00082E-5 41661 0 4.0085E-6
12-112167607-C-T c.1244-3C>T splice_region ACAD10 1 83328 1.20008E-5 41664 0 NA
12-112167616-A-G p.Tyr417Cys missense ACAD10 1 83346 1.19982E-5 41673 0 2.78842E-5
12-112167624-C-T p.Arg420Cys missense ACAD10 3 83344 3.59954E-5 41672 0 7.43568E-5
12-112167625-G-A p.Arg420His missense ACAD10 1 83348 1.19979E-5 41674 0 3.18796E-5
12-112167630-G-T p.Val422Leu missense ACAD10 3 83354 3.59911E-5 41677 0 NA
12-112167634-G-A p.Arg423Gln missense ACAD10 2 83352 2.39946E-5 41676 0 6.37308E-5
12-112167640-G-A p.Trp425* stop_gained ACAD10 11 83358 1.31961E-4 41679 0 5.03525E-4
12-112167654-C-T p.Arg430* stop_gained ACAD10 34 83358 4.07879E-4 41679 0 2.4261E-4
12-112167662-C-T p.Ser432Ser synonymous ACAD10 2 83356 2.39935E-5 41678 0 5.03525E-4
12-112167663-G-A p.Glu433Lys missense ACAD10 10 83360 1.19962E-4 41680 0 2.54939E-4
12-112167681-G-A p.Ala439Thr missense ACAD10 1 83348 1.19979E-5 41674 0 NA
12-112167683-C-T p.Ala439Ala synonymous ACAD10 6 83348 7.19873E-5 41674 0 0.00481045
12-112167685-T-C p.Met440Thr missense ACAD10 1 83350 1.19976E-5 41675 0 8.25941E-6
12-112167688-A-G p.Glu441Gly missense ACAD10 2 83350 2.39952E-5 41675 0 1.19336E-5
12-112167689-G-C p.Glu441Asp missense ACAD10 1 83354 1.1997E-5 41677 0 NA
12-112167690-A-G p.Arg442Gly missense ACAD10 1 83348 1.19979E-5 41674 0 NA
12-112167695-G-C p.Leu443Leu synonymous ACAD10 1 83334 1.19999E-5 41667 0 NA
12-112167698-C-T p.Ile444Ile synonymous ACAD10 2 83332 2.40004E-5 41666 0 3.97899E-6
12-112167698-C-A p.Ile444Ile synonymous ACAD10 1 83332 1.20002E-5 41666 0 1.65571E-5
12-112167699-G-A p.Glu445Lys missense ACAD10 3 83326 3.60032E-5 41663 0 6.25E-4
12-112167705-C-T p.Leu447Leu synonymous ACAD10 25 83308 3.00091E-4 41654 0 1.23367E-4
12-112167709-C-A p.Pro448His missense ACAD10 89 83298 0.00106845 41649 2 0.00625
12-112167711-C-T p.Leu449Phe missense ACAD10 3 83298 3.60153E-5 41649 0 1.59203E-5
12-112167715-A-C p.His450Pro missense ACAD10 2 83290 2.40125E-5 41645 0 NA
12-112167718-T-G p.Leu451Arg missense ACAD10 1 83278 1.2008E-5 41639 0 8.33278E-6
12-112167723-C-T p.Arg453Cys missense ACAD10 1 83284 1.20071E-5 41642 0 1.67165E-4
12-112167724-G-A p.Arg453His missense ACAD10 4 83262 4.80411E-5 41631 0 1.33826E-4
12-112167736-C-A p.Thr457Asn missense ACAD10 4 83246 4.80504E-5 41623 0 2.53109E-5
12-112167741-G-A p.Val459Met missense ACAD10 1 83236 1.2014E-5 41618 0 3.98498E-6
12-112167749-C-T p.His461His synonymous ACAD10 10 83188 1.2021E-4 41594 0 5.04032E-4
12-112167753-G-A p.Asp463Asn missense ACAD10 235 83144 0.00282642 41572 1 0.00472238
12-112167761-G-GC c.1394+1_1394+2insC splice_donor ACAD10 3 83102 3.61002E-5 41551 0 NA
12-112167763-A-G c.1394+3A>G splice_region ACAD10 10 83076 1.20372E-4 41538 0 6.25E-4
12-112167767-G-A c.1394+7G>A splice_region ACAD10 2 83048 2.40825E-5 41524 0 NA
12-112171731-G-A p.Asp467Asn missense ACAD10 2 83358 2.39929E-5 41679 0 1.19319E-5
12-112171732-ACAAC-A p.Asn468fs frameshift ACAD10 1 83354 1.1997E-5 41677 0 NA
12-112171737-C-G p.Leu469Val missense ACAD10 5 83364 5.99779E-5 41682 0 6.58979E-5
12-112171739-G-GAAAA p.Val470fs frameshift ACAD10 1 83364 1.19956E-5 41682 0 NA
12-112171740-G-A p.Trp189* stop_gained ACAD10 19 83362 2.27922E-4 41681 0 0.00251762
12-112171748-T-C p.Ile192Thr missense ACAD10 6 83376 7.19632E-5 41688 0 2.38591E-5
12-112171763-G-A p.Arg197Lys missense ACAD10 1 83392 1.19916E-5 41696 0 NA
12-112171765-T-G p.Val478Gly missense ACAD10 1 83394 1.19913E-5 41697 0 3.97643E-6
12-112171773-G-A p.Val481Ile missense ACAD10 4 83400 4.79616E-5 41700 0 8.23696E-6
12-112171775-C-T p.Ser201Phe missense ACAD10 1 83400 1.19904E-5 41700 0 NA
12-112171781-C-G p.Asp483Glu missense ACAD10 1 83400 1.19904E-5 41700 0 3.97643E-6
12-112171784-G-A p.Trp484* stop_gained ACAD10 25 83400 2.9976E-4 41700 0 5.03525E-4
12-112171785-G-C p.Glu485Gln missense ACAD10 2 83396 2.3982E-5 41698 0 NA
12-112171798-TG-T p.Gly490fs frameshift ACAD10 1 83396 1.1991E-5 41698 0 NA
12-112171802-C-T p.Ala210Val missense ACAD10 1 83394 1.19913E-5 41697 0 7.95292E-6
12-112171803-G-A p.Asp491Asn missense ACAD10 3 83394 3.59738E-5 41697 0 8.2375E-6
12-112171809-CT-C p.Ala494fs frameshift ACAD10 3 83400 3.59712E-5 41700 0 2.47129E-5
12-112171826-C-T p.Thr218Ile missense ACAD10 16 83386 1.91879E-4 41693 0 3.18431E-4
12-112171830-T-C p.Cys500Arg missense ACAD10 7 83378 8.3955E-5 41689 0 3.1835E-5
12-112171841-T-C p.Ile223Thr missense ACAD10 1 83358 1.19964E-5 41679 0 3.97697E-6
12-112171843-AC-A p.Leu505fs frameshift ACAD10 1 83358 1.19964E-5 41679 0 NA
12-112171852-C-T p.Ser507Phe missense ACAD10 1 83348 1.19979E-5 41674 0 NA
12-112171863-G-A p.Val511Met missense ACAD10 8 83342 9.599E-5 41671 0 5.03525E-4
12-112171865-G-T p.Val511Val synonymous ACAD10 27 83322 3.24044E-4 41661 0 6.36862E-4
12-112174631-G-A c.1541-4G>A splice_region ACAD10 5 83004 6.02381E-5 41502 0 4.86582E-5
12-112174632-C-G c.1541-3C>G splice_region ACAD10 1 83050 1.20409E-5 41525 0 3.1839E-5
12-112174647-G-C p.Cys518Ser missense ACAD10 1 83224 1.20158E-5 41612 0 NA
12-112174659-A-T p.Gln522Leu missense ACAD10 1 83242 1.20132E-5 41621 0 NA
12-112174662-TG-T p.Gly524fs frameshift ACAD10 1 83274 1.20085E-5 41637 0 NA
12-112174669-C-T p.Ile525Ile synonymous ACAD10 1 83296 1.20054E-5 41648 0 NA
12-112174670-C-T p.Pro526Ser missense ACAD10 1 83296 1.20054E-5 41648 0 3.18451E-5
12-112174671-C-G p.Pro526Arg missense ACAD10 3 83298 3.60153E-5 41649 0 3.1841E-5
12-112174678-A-G p.Ala528Ala synonymous ACAD10 3 83290 3.60187E-5 41645 0 8.24402E-6
12-112174682-G-A p.Glu530Lys missense ACAD10 1 83306 1.20039E-5 41653 0 NA
12-112174690-C-T p.Phe532Phe synonymous ACAD10 2 83314 2.40056E-5 41657 0 3.97817E-5
12-112174694-A-G p.Met534Val missense ACAD10 6 83318 7.20133E-5 41659 0 6.37146E-5
12-112174705-C-T p.Leu537Leu synonymous ACAD10 4 83314 4.80111E-5 41657 0 5.96559E-5
12-112174731-A-C p.Asn546Thr missense ACAD10 1 83322 1.20016E-5 41661 0 3.97662E-6
12-112174743-A-G p.Tyr550Cys missense ACAD10 1 83304 1.20042E-5 41652 0 2.47109E-5
12-112174744-T-C p.Tyr550Tyr synonymous ACAD10 1 83310 1.20034E-5 41655 0 3.97671E-6
12-112174749-CT-C p.Ser554fs frameshift ACAD10 1 83304 1.20042E-5 41652 0 NA
12-112174755-C-G p.Ser554Cys missense ACAD10 3 83276 3.60248E-5 41638 0 6.38733E-5
12-112174761-T-C p.Phe556Ser missense ACAD10 1 83248 1.20123E-5 41624 0 6.37146E-5
12-112174762-C-T p.Phe556Phe synonymous ACAD10 1 83248 1.20123E-5 41624 0 NA
12-112174763-C-T p.Arg557Cys missense ACAD10 2 83228 2.40304E-5 41614 0 3.20307E-5
12-112174764-G-A p.Arg557His missense ACAD10 6 83216 7.21015E-5 41608 0 7.41473E-5
12-112174765-T-A p.Arg557Arg synonymous ACAD10 672 83208 0.00807615 41604 7 0.0161969
12-112174772-G-A p.Ala560Thr missense ACAD10 2 83162 2.40494E-5 41581 0 5.05561E-4
12-112174773-C-G p.Ala560Gly missense ACAD10 668 83142 0.00803445 41571 7 0.0161969
12-112174782-A-G p.Gln563Arg missense ACAD10 2 83062 2.40784E-5 41531 0 6.59794E-5
12-112174799-T-A p.Ser569Thr missense ACAD10 1 82634 1.21016E-5 41317 0 8.27308E-6
12-112174809-G-GGCAAGCAAGCTCCACA c.1714+1_1714+2insGCAAGCAAGCTCCACA splice_donor ACAD10 4 82342 4.85779E-5 41171 1 NA
12-112174809-G-GGCAAGCAAGC c.1714+1_1714+2insGCAAGCAAGC splice_donor ACAD10 1 82346 1.21439E-5 41173 0 NA
12-112174811-A-G c.1714+3A>G splice_region ACAD10 2 82264 2.4312E-5 41132 0 1.60563E-5
12-112174815-G-T c.1714+7G>T splice_region ACAD10 2 82132 2.4351E-5 41066 0 1.66351E-5
12-112182449-C-A p.Gln573Lys missense+splice_region ACAD10 2 83318 2.40044E-5 41659 0 NA
12-112182450-A-G p.Gln573Arg missense ACAD10 3 83328 3.60023E-5 41664 0 1.2001E-5
12-112182451-A-G p.Gln573Gln synonymous ACAD10 1 83332 1.20002E-5 41666 0 NA
12-112182452-G-T p.Ala574Ser missense ACAD10 1 83328 1.20008E-5 41664 0 8.57501E-6
12-112182456-G-A p.Ser575Asn missense ACAD10 1 83342 1.19988E-5 41671 0 NA
12-112182465-A-G p.Tyr578Cys missense ACAD10 2 83364 2.39912E-5 41682 0 1.00737E-4
12-112182466-T-C p.Tyr578Tyr synonymous ACAD10 3 83366 3.59859E-5 41683 0 7.96305E-6
12-112182468-C-G p.Ala579Gly missense ACAD10 1 83368 1.1995E-5 41684 0 3.98502E-6
12-112182468-C-T p.Ala579Val missense ACAD10 1 83368 1.1995E-5 41684 0 6.77453E-5
12-112182481-A-G p.Gly583Gly synonymous ACAD10 1 83382 1.1993E-5 41691 0 NA
12-112182486-T-C p.Leu585Pro missense ACAD10 1 83386 1.19924E-5 41693 0 3.1841E-5
12-112182490-C-A p.Thr586Thr synonymous ACAD10 1 83380 1.19933E-5 41690 0 3.97763E-6
12-112182491-G-A p.Glu587Lys missense ACAD10 1 83378 1.19936E-5 41689 0 3.18471E-5
12-112182493-A-G p.Glu587Glu synonymous ACAD10 2 83388 2.39843E-5 41694 0 7.95437E-6
12-112182499-G-T p.Val589Val synonymous ACAD10 1 83388 1.19921E-5 41694 0 3.97684E-6
12-112182509-G-A p.Ala593Thr missense ACAD10 9 83392 1.07924E-4 41696 0 1.15405E-4
12-112182510-C-T p.Ala593Val missense ACAD10 1 83390 1.19918E-5 41695 0 7.95387E-6
12-112182511-G-A c.-43G>A 5_prime_UTR_premature_start_codon_gain ACAD10 3 83386 3.59773E-5 41693 0 6.36902E-5
12-112182520-C-T c.-34C>T 5_prime_UTR_premature_start_codon_gain ACAD10 1 83380 1.19933E-5 41690 0 3.18492E-5
12-112182521-G-A p.Ala597Thr missense ACAD10 5 83374 5.99707E-5 41687 0 0.00100705
12-112182539-C-T p.Arg603Trp missense ACAD10 1 83380 1.19933E-5 41690 0 8.23845E-6
12-112182540-G-A p.Arg603Gln missense ACAD10 1 83374 1.19941E-5 41687 0 3.18117E-5
12-112182541-G-A p.Arg603Arg synonymous ACAD10 1 83376 1.19939E-5 41688 0 NA
12-112182547-CAA-C p.Lys606fs frameshift ACAD10 2 83376 2.39877E-5 41688 0 1.27437E-4
12-112182569-C-A p.Pro613Thr missense ACAD10 1 83376 1.19939E-5 41688 0 7.95286E-6
12-112182571-G-A p.Pro613Pro synonymous ACAD10 1 83378 1.19936E-5 41689 0 3.18593E-5
12-112182576-C-G p.Thr615Arg missense ACAD10 1 83370 1.19947E-5 41685 0 NA
12-112182579-G-C p.Arg616Thr missense ACAD10 1 83366 1.19953E-5 41683 0 8.23845E-6
12-112182583-C-T p.Ser617Ser synonymous ACAD10 22 83366 2.63897E-4 41683 0 2.42591E-4
12-112182585-A-G p.Tyr618Cys missense ACAD10 90 83360 0.00107965 41680 3 0.00375
12-112182591-C-A p.Thr620Lys missense ACAD10 1 83356 1.19967E-5 41678 0 NA
12-112182592-G-T p.Thr620Thr synonymous ACAD10 1 83352 1.19973E-5 41676 0 NA
12-112182592-G-A p.Thr620Thr synonymous ACAD10 5 83352 5.99866E-5 41676 0 3.18162E-5
12-112182596-G-A p.Ala622Thr missense ACAD10 1 83336 1.19996E-5 41668 0 9.06409E-5
12-112182610-C-G p.Ser626Ser synonymous ACAD10 1 83338 1.19993E-5 41669 0 NA
12-112182612-A-T p.Gln627Leu missense ACAD10 11 83328 1.32008E-4 41664 0 0.00125
12-112182627-G-T p.Gly632Val missense ACAD10 1 83286 1.20068E-5 41643 0 8.24226E-6
12-112182630-G-A p.Ser633Asn missense ACAD10 4 83284 4.80284E-5 41642 0 NA
12-112182640-T-C p.Tyr636Tyr synonymous ACAD10 3 83272 3.60265E-5 41636 0 1.64867E-5
12-112182646-C-T p.Ser638Ser synonymous ACAD10 2 83246 2.40252E-5 41623 0 3.29761E-5
12-112182647-G-A p.Val639Ile missense ACAD10 6 83234 7.20859E-5 41617 0 5.03525E-4
12-112182648-T-G p.Val639Gly missense ACAD10 1 83236 1.2014E-5 41618 0 7.9571E-6
12-112182648-T-C p.Val639Ala missense ACAD10 1 83236 1.2014E-5 41618 0 3.97855E-6
12-112182654-A-G p.Glu641Gly missense ACAD10 19 83226 2.28294E-4 41613 0 5.03525E-4
12-112182675-C-G p.Ser648* stop_gained ACAD10 8 83134 9.62302E-5 41567 0 1.59286E-4
12-112182675-C-T p.Ser648Leu missense ACAD10 2 83134 2.40575E-5 41567 0 NA
12-112182680-G-A p.Gly650Arg missense ACAD10 11 83058 1.32438E-4 41529 2 6.25E-4
12-112182692-A-G p.Ile654Val missense ACAD10 12 82944 1.44676E-4 41472 0 0.00100705
12-112182692-A-T p.Ile654Phe missense ACAD10 1 82944 1.20563E-5 41472 0 3.30246E-5
12-112182703-G-C p.Glu657Asp missense ACAD10 1 82844 1.20709E-5 41422 0 NA
12-112182710-T-C p.Ser660Pro missense ACAD10 2 82764 2.41651E-5 41382 0 9.56572E-5
12-112182714-C-T p.Pro661Leu missense ACAD10 1 82752 1.20843E-5 41376 0 9.5584E-5
12-112182737-C-T p.Arg669Trp missense ACAD10 5 82534 6.05811E-5 41267 0 6.37389E-5
12-112182739-G-A p.Arg669Arg synonymous ACAD10 1 82504 1.21206E-5 41252 0 NA
12-112182760-A-G p.Gln676Gln synonymous ACAD10 12 82478 1.45493E-4 41239 0 0.0020141
12-112182762-G-A p.Arg677His missense ACAD10 1 82496 1.21218E-5 41248 0 3.31307E-5
12-112182770-C-G p.Pro680Ala missense ACAD10 1 82568 1.21112E-5 41284 0 8.28569E-6
12-112182771-C-T p.Pro680Leu missense ACAD10 1 82602 1.21062E-5 41301 0 3.18532E-5
12-112182776-G-C p.Glu682Gln missense ACAD10 1 82618 1.21039E-5 41309 0 NA
12-112182784-G-A p.Glu684Glu synonymous ACAD10 5 82666 6.04844E-5 41333 0 8.29504E-5
12-112182785-C-G p.Leu685Val missense ACAD10 2 82670 2.41926E-5 41335 0 5.80682E-5
12-112182787-G-T p.Leu685Leu synonymous ACAD10 1 82670 1.20963E-5 41335 0 NA
12-112182796-C-T p.His688His synonymous ACAD10 1 82724 1.20884E-5 41362 0 NA
12-112182807-C-G p.Ala692Gly missense ACAD10 1 82814 1.20753E-5 41407 0 1.27709E-4
12-112182810-C-G p.Ala693Gly missense ACAD10 1 82804 1.20767E-5 41402 0 NA
12-112182820-C-G p.Ser696Arg missense ACAD10 2 82858 2.41377E-5 41429 0 1.27445E-4
12-112182828-CAC-AAA p.ProLeu699GlnMet missense ACAD10 1 82910 1.20613E-5 41455 0 NA
12-112182835-C-T p.Ile701Ile synonymous ACAD10 1 82856 1.20691E-5 41428 0 8.41114E-6
12-112182836-G-A p.Glu702Lys missense ACAD10 1 82852 1.20697E-5 41426 0 2.52504E-5
12-112182859-A-G p.Pro709Pro synonymous ACAD10 1 82568 1.21112E-5 41284 0 4.07714E-6
12-112183940-C-G c.2116-8C>G splice_region ACAD10 1 83290 1.20062E-5 41645 0 NA
12-112183947-G-A c.2116-1G>A splice_acceptor ACAD10 1 83316 1.20025E-5 41658 0 NA
12-112183953-A-T p.Lys707Asn missense ACAD10 2 83312 2.40061E-5 41656 0 1.91253E-4
12-112183964-A-ACTT p.Glu711delinsAspLeu disruptive_inframe_insertion ACAD10 2 83306 2.40079E-5 41653 0 1.64891E-5
12-112183965-A-T p.Glu711Asp missense ACAD10 26 83308 3.12095E-4 41654 0 1.35712E-4
12-112183967-GA-G p.Leu713fs frameshift ACAD10 2 83304 2.40085E-5 41652 0 1.64886E-5
12-112183969-C-T p.Leu713Phe missense ACAD10 1 83314 1.20028E-5 41657 0 NA
12-112183975-A-G p.Asn715Asp missense ACAD10 2 83322 2.40033E-5 41661 0 NA
12-112183977-C-A p.Asn715Lys missense ACAD10 2 83320 2.40038E-5 41660 0 3.98121E-6
12-112183986-A-G p.Leu718Leu synonymous ACAD10 1 83316 1.20025E-5 41658 0 7.95773E-6
12-112183986-A-C p.Leu718Leu synonymous ACAD10 2 83316 2.4005E-5 41658 0 3.97886E-6
12-112183993-G-C p.Glu721Gln missense ACAD10 1 83318 1.20022E-5 41659 0 5.56846E-5
12-112184004-C-T p.Pro724Pro synonymous ACAD10 2 83290 2.40125E-5 41645 0 6.38284E-5
12-112184005-G-A p.Glu725Lys missense ACAD10 4 83288 4.80261E-5 41644 0 3.2969E-5
12-112184007-G-A p.Glu725Glu synonymous ACAD10 2 83292 2.40119E-5 41646 0 NA
12-112184012-A-G p.Lys727Arg missense ACAD10 3 83286 3.60205E-5 41643 0 NA
12-112184013-A-T p.Lys727Asn missense ACAD10 1 83290 1.20062E-5 41645 0 NA
12-112184013-A-G p.Lys727Lys synonymous ACAD10 1 83290 1.20062E-5 41645 0 NA
12-112184016-C-T p.Tyr728Tyr synonymous ACAD10 6 83278 7.20478E-5 41639 0 0.00100908
12-112184017-G-A p.Gly729Arg missense ACAD10 2 83272 2.40177E-5 41636 0 1.59101E-5
12-112184027-T-C p.Leu732Pro missense ACAD10 7 83270 8.40639E-5 41635 0 6.5937E-5
12-112184033-A-G p.Asn734Ser missense ACAD10 3 83260 3.60317E-5 41630 0 9.56389E-5
12-112184051-T-C p.Leu740Pro missense ACAD10 1 83228 1.20152E-5 41614 0 3.18715E-5
12-112184053-T-TG p.Cys741fs frameshift ACAD10 1 83226 1.20155E-5 41613 0 3.98298E-6
12-112184061-C-G p.Leu743Leu synonymous ACAD10 2 83226 2.4031E-5 41613 0 8.24511E-6
12-112184069-C-A p.Thr746Lys missense ACAD10 1 83198 1.20195E-5 41599 0 NA
12-112184069-C-T p.Thr746Met missense ACAD10 1 83198 1.20195E-5 41599 0 2.00022E-5
12-112184070-G-A p.Thr746Thr synonymous ACAD10 1 83192 1.20204E-5 41596 0 3.18634E-5
12-112184077-T-C p.Tyr749His missense ACAD10 1 83190 1.20207E-5 41595 0 9.5584E-5
12-112184079-T-G p.Tyr749* stop_gained ACAD10 2 83190 2.40414E-5 41595 0 NA
12-112184082-C-T p.Ala750Ala synonymous ACAD10 2 83174 2.4046E-5 41587 0 NA
12-112184084-C-T p.Pro751Leu missense ACAD10 1 83172 1.20233E-5 41586 0 3.18837E-5
12-112184085-C-T p.Pro751Pro synonymous ACAD10 4 83168 4.80954E-5 41584 0 6.37633E-5
12-112184086-G-A p.Glu752Lys missense+splice_region ACAD10 164 83166 0.00197196 41583 2 0.00224894
12-112184092-CCTT-C c.2256+5_2256+7delCTT splice_region ACAD10 1 83130 1.20294E-5 41565 0 2.48361E-5
12-112184848-C-T c.2257-5C>T splice_region ACAD10 1 80534 1.24171E-5 40267 0 NA
12-112184865-T-C p.Ser757Pro missense ACAD10 193 82112 0.00235045 41056 3 0.00525746
12-112184869-C-T p.Ala758Val missense ACAD10 3 82324 3.64414E-5 41162 0 4.46334E-5
12-112184878-C-T p.Thr761Met missense ACAD10 3 82694 3.62783E-5 41347 0 3.39991E-5
12-112184879-G-A p.Thr761Thr synonymous ACAD10 2 82694 2.41856E-5 41347 0 5.0888E-5
12-112184884-A-G p.Asn763Ser missense ACAD10 2 82838 2.41435E-5 41419 0 8.42915E-6
12-112184885-C-CA p.Met764fs frameshift ACAD10 1 82836 1.2072E-5 41418 0 NA
12-112184886-A-C p.Met764Leu missense ACAD10 2 82854 2.41388E-5 41427 0 3.99549E-6
12-112184900-G-T p.Val768Val synonymous ACAD10 2 83050 2.40819E-5 41525 0 9.55292E-5
12-112184912-C-T p.Thr772Thr synonymous ACAD10 1 83110 1.20322E-5 41555 0 1.66497E-5
12-112184913-G-A p.Glu773Lys missense ACAD10 7 83114 8.42217E-5 41557 0 9.56267E-5
12-112184920-A-T p.Gln775Leu missense ACAD10 3 83158 3.60759E-5 41579 0 7.96768E-6
12-112184928-C-T p.Arg778Cys missense ACAD10 3 83168 3.60716E-5 41584 0 2.07658E-4
12-112184931-TG-T p.Trp779fs frameshift ACAD10 1 83178 1.20224E-5 41589 0 3.98435E-6
12-112184939-T-A p.Ile781Ile synonymous ACAD10 1 83196 1.20198E-5 41598 0 NA
12-112184945-G-A p.Leu783Leu synonymous ACAD10 1 83180 1.20221E-5 41590 0 NA
12-112184951-G-A p.Glu785Glu synonymous ACAD10 1 83198 1.20195E-5 41599 0 6.37146E-5
12-112184962-G-A p.Arg789His missense ACAD10 2 83178 2.40448E-5 41589 0 1.49512E-4
12-112184968-G-A p.Cys791Tyr missense ACAD10 1 83206 1.20184E-5 41603 0 NA
12-112184981-C-T p.Thr795Thr synonymous ACAD10 6 83174 7.21379E-5 41587 0 2.23157E-4
12-112184982-G-A p.Glu796Lys missense ACAD10 1 83184 1.20215E-5 41592 0 6.25E-4
12-112184987-CCAGGTACGTCGCCTGGGCTGCCACCCACTTGCCTGGCCCTGTTGTTGTCGGCCCCACAGGGAACACGGGCTGTCTGCTGGCGTCTCTGACTGGAATATGCTCCCCACT-C p.Gln798del splice_donor ACAD10 8 83190 9.61654E-5 41595 3 NA
12-112184994-C-T c.2394+4C>T splice_region ACAD10 1 83198 1.20195E-5 41599 0 1.66257E-5
12-112184995-G-A c.2394+5G>A splice_region ACAD10 2 83204 2.40373E-5 41602 0 8.30551E-6
12-112184997-C-T c.2394+7C>T splice_region ACAD10 1 83206 1.20184E-5 41603 0 1.66193E-4
12-112184998-G-T c.2394+8G>T splice_region ACAD10 1 83196 1.20198E-5 41598 0 1.6611E-5
12-112184998-G-A c.2394+8G>A splice_region ACAD10 5 83196 6.0099E-5 41598 1 2.0034E-5
12-112185157-A-G p.Tyr818Cys missense ACAD10 1 83360 1.19962E-5 41680 0 3.97649E-5
12-112185166-A-T p.Asn821Ile missense ACAD10 18 83356 2.15941E-4 41678 0 1.91205E-4
12-112185167-C-T p.Asn821Asn synonymous ACAD10 6 83356 7.19804E-5 41678 0 9.88403E-5
12-112185168-G-A p.Gly822Ser missense ACAD10 5 83348 5.99894E-5 41674 0 4.37445E-5
12-112185177-T-C p.Trp825Arg missense ACAD10 1 83344 1.19985E-5 41672 0 8.23683E-6
12-112185181-G-A p.Trp826* stop_gained ACAD10 2 83336 2.39992E-5 41668 0 6.37186E-5
12-112185197-GCC-CCT c.2485+8_2485+10delGCCinsCCT splice_region ACAD10 1 83292 1.2006E-5 41646 0 NA
12-112186117-G-A c.2486-4G>A splice_region ACAD10 1 83312 1.20031E-5 41656 0 NA
12-112186131-T-A p.Asp832Glu missense ACAD10 1 83330 1.20005E-5 41665 0 NA
12-112186135-C-T p.Arg834Cys missense ACAD10 1 83340 1.1999E-5 41670 0 3.18552E-5
12-112186136-G-A p.Arg834His missense ACAD10 2 83346 2.39964E-5 41673 0 6.37064E-5
12-112186139-GC-TT p.Cys835Phe missense ACAD10 1 83344 1.19985E-5 41672 0 NA
12-112186143-A-G p.Gln836Gln synonymous ACAD10 2 83346 2.39964E-5 41673 0 1.19299E-5
12-112186146-CTG-C p.Phe840fs frameshift ACAD10 2 83346 2.39964E-5 41673 0 3.18471E-5
12-112186148-G-T p.Cys838Phe missense ACAD10 1 83348 1.19979E-5 41674 0 3.29489E-5
12-112186159-G-C p.Gly842Arg missense ACAD10 2 83352 2.39946E-5 41676 0 8.23655E-6
12-112186165-A-G p.Thr844Ala missense ACAD10 3 83354 3.59911E-5 41677 0 3.29462E-5
12-112186165-A-C p.Thr844Pro missense ACAD10 1 83354 1.1997E-5 41677 0 NA
12-112186171-C-G p.Pro846Ala missense ACAD10 2 83344 2.39969E-5 41672 0 NA
12-112186175-A-G p.His847Arg missense ACAD10 1 83354 1.1997E-5 41677 0 6.37146E-5
12-112186177-G-A p.Ala848Thr missense ACAD10 1 83354 1.1997E-5 41677 0 3.18593E-5
12-112186178-CACCAAGACACCG-C p.Pro849_Arg852del disruptive_inframe_deletion ACAD10 2 83354 2.3994E-5 41677 0 NA
12-112186189-C-A p.Arg852Arg synonymous ACAD10 1 83340 1.1999E-5 41670 0 NA
12-112186189-C-T p.Arg852Trp missense ACAD10 1 83340 1.1999E-5 41670 0 6.37146E-5
12-112186190-G-A p.Arg852Gln missense ACAD10 3 83344 3.59954E-5 41672 0 2.47097E-5
12-112186192-CAG-C p.Gln853fs frameshift ACAD10 2 83340 2.39981E-5 41670 0 NA
12-112186193-A-T p.Gln853Leu missense ACAD10 2 83342 2.39975E-5 41671 0 1.98818E-5
12-112186199-CTGTGCTCTTGGT-C p.Val856_Val859del conservative_inframe_deletion ACAD10 1 83330 1.20005E-5 41665 0 NA
12-112186211-T-C p.Val859Ala missense ACAD10 20 83332 2.40004E-4 41666 0 6.25E-4
12-112186212-T-C p.Val859Val synonymous ACAD10 1 83332 1.20002E-5 41666 0 1.64737E-5
12-112186216-A-G p.Met861Val missense ACAD10 1 83336 1.19996E-5 41668 0 8.23696E-6
12-112186218-G-C p.Met861Ile missense ACAD10 1 83334 1.19999E-5 41667 0 1.19294E-5
12-112186224-C-A p.Thr863Thr synonymous ACAD10 1 83332 1.20002E-5 41666 0 NA
12-112186243-C-T p.Arg870Trp missense ACAD10 1 83308 1.20036E-5 41654 0 4.12025E-5
12-112186244-G-A p.Arg870Gln missense ACAD10 1 83306 1.20039E-5 41653 0 3.18573E-5
12-112186253-C-T p.Thr873Met missense ACAD10 20 83284 2.40142E-4 41642 0 1.27413E-4
12-112186254-G-A p.Thr873Thr synonymous ACAD10 7 83274 8.40599E-5 41637 0 2.38626E-5
12-112186260-T-C p.Tyr875Tyr synonymous ACAD10 1 83244 1.20129E-5 41622 0 NA
12-112186265-T-G p.Leu877Arg missense ACAD10 1 83204 1.20187E-5 41602 0 NA
12-112186267-G-A p.Glu878Lys missense ACAD10 1 83192 1.20204E-5 41596 0 7.95583E-6
12-112186274-C-T p.Ala880Val missense ACAD10 2322 83054 0.0279577 41527 53 0.0327869
12-112186279-G-C p.Gly882Arg missense+splice_region ACAD10 5 83088 6.01772E-5 41544 0 4.96631E-5
12-112186282-G-GTTTCCTGCCGTCCTTTTCCCTTTAACCATGTCCCAGTA c.2644+3_2644+4insTTTCCTGCCGTCCTTTTCCCTTTAACCATGTCCCAGTA splice_region ACAD10 1 83036 1.2043E-5 41518 0 NA
12-112186282-G-GGCCATGGTGAAGTCCGATTTGAGCACGTGCGTGTGCCCAA c.2644+3_2644+4insGCCATGGTGAAGTCCGATTTGAGCACGTGCGTGTGCCCAA splice_region ACAD10 1 83036 1.2043E-5 41518 0 NA
12-112186827-C-T p.Pro488Leu missense ACAD10 1 83052 1.20406E-5 41526 0 8.72022E-6
12-112186828-G-A p.Pro488Pro synonymous ACAD10 16 83058 1.92636E-4 41529 0 1.20347E-4
12-112186830-C-G p.Ser489Cys missense ACAD10 4 83096 4.81371E-5 41548 0 1.20253E-5
12-112186839-T-C p.Leu492Pro missense ACAD10 1 83118 1.20311E-5 41559 0 1.20074E-5
12-112186912-G-A n.1887+5G>A splice_region ACAD10 10 83296 1.20054E-4 41648 0 2.22987E-4
12-112186982-C-T p.His884Tyr missense ACAD10 21 83282 2.52155E-4 41641 0 4.77768E-4
12-112186983-A-G p.His884Arg missense ACAD10 3 83276 3.60248E-5 41638 0 8.24525E-6
12-112186994-C-T p.Arg888* stop_gained ACAD10 1 83234 1.20143E-5 41617 0 7.4228E-5
12-112186995-G-A p.Arg888Gln missense ACAD10 5 83248 6.00615E-5 41624 0 4.12351E-5
12-112186997-T-C p.Phe889Leu missense ACAD10 1 83238 1.20137E-5 41619 0 1.64924E-5
12-112187006-G-A p.Val892Met missense ACAD10 3 83206 3.60551E-5 41603 0 3.29897E-5
12-112187018-A-G p.Lys896Glu missense ACAD10 4 83210 4.80711E-5 41605 0 NA
12-112187025-A-G p.Asn898Ser missense ACAD10 6 83214 7.21032E-5 41607 0 8.24538E-5
12-112187029-G-C p.Met899Ile missense ACAD10 10 83206 1.20184E-4 41603 0 4.94698E-5
12-112187045-C-T p.Arg905* stop_gained ACAD10 5 83110 6.01612E-5 41555 0 6.25E-4
12-112187046-G-A p.Arg905Gln missense ACAD10 1 83102 1.20334E-5 41551 0 9.55536E-5
12-112187060-G-A p.Ala910Thr missense ACAD10 1 83012 1.20465E-5 41506 0 1.19397E-5
12-112187061-C-T p.Ala910Val missense ACAD10 2 83024 2.40894E-5 41512 0 1.63145E-4
12-112187073-T-C p.Leu914Pro missense ACAD10 2 82950 2.41109E-5 41475 0 6.36983E-5
12-112187080-C-T p.Pro916Pro synonymous ACAD10 1 82854 1.20694E-5 41427 0 0.001875
12-112187081-G-A p.Gly917Ser missense ACAD10 5 82838 6.03588E-5 41419 0 6.25E-4
12-112187081-G-C p.Gly917Arg missense ACAD10 1 82840 1.20715E-5 41420 0 1.65093E-5
12-112187084-A-G p.Arg918Gly missense ACAD10 3 82828 3.62196E-5 41414 0 7.56827E-5
12-112187110-C-T p.Ile926Ile synonymous ACAD10 6 82614 7.26269E-5 41307 0 6.25E-4
12-112187111-G-A p.Gly927Arg missense ACAD10 7 82562 8.47848E-5 41281 0 2.48595E-5
12-112187112-G-A p.Gly927Glu missense ACAD10 1 82552 1.21136E-5 41276 0 NA
12-112187119-A-T p.Ser929Ser synonymous ACAD10 2 82576 2.42201E-5 41288 0 3.18837E-5
12-112187120-GAGAGGGCCCTGGCACTC-G p.Glu930fs frameshift ACAD10 2 82548 2.42283E-5 41274 0 5.03903E-4
12-112187138-A-G p.Met936Val missense ACAD10 12 82430 1.45578E-4 41215 0 2.84343E-4
12-112187139-T-A p.Met936Lys missense ACAD10 1 82440 1.213E-5 41220 0 8.03607E-6
12-112187140-G-A p.Met936Ile missense ACAD10 199 82406 0.00241487 41203 3 0.00512902
12-112187147-C-T p.Arg939Cys missense+splice_region ACAD10 3 82122 3.6531E-5 41061 0 1.61642E-5
12-112187148-G-T p.Arg939Leu missense+splice_region ACAD10 643 81990 0.00784242 40995 8 0.016312
12-112187148-G-A p.Arg939His missense+splice_region ACAD10 6 82034 7.31404E-5 41017 0 3.2335E-5
12-112187149-C-T p.Arg939Arg splice_region+synonymous ACAD10 24 81978 2.92761E-4 40989 0 6.69216E-4
12-112187150-G-A c.2817+1G>A splice_donor ACAD10 6 81956 7.321E-5 40978 0 1.59327E-4
12-112187150-G-T c.2817+1G>T splice_donor ACAD10 2 81956 2.44033E-5 40978 0 NA
12-112191570-C-T c.2818-6C>T splice_region ACAD10 2 81318 2.45948E-5 40659 0 1.9938E-5
12-112191571-G-A c.2818-5G>A splice_region ACAD10 1 81382 1.22877E-5 40691 0 1.59509E-5
12-112191580-A-C p.Lys941Thr missense ACAD10 7 81770 8.5606E-5 40885 0 7.97041E-5
12-112191583-C-T p.Ser942Phe missense ACAD10 1 81860 1.2216E-5 40930 0 6.36943E-5
12-112191585-C-T p.Arg943Cys missense ACAD10 2 81878 2.44266E-5 40939 0 5.02344E-5
12-112191586-G-A p.Arg943His missense ACAD10 1 81888 1.22118E-5 40944 0 1.1957E-5
12-112191590-G-A p.Leu944Leu synonymous ACAD10 1 82066 1.21853E-5 41033 0 8.36792E-6
12-112191598-G-A p.Gly947Glu missense ACAD10 3 82194 3.6499E-5 41097 0 8.36764E-6
12-112191603-C-T p.Pro949Ser missense ACAD10 2 82220 2.4325E-5 41110 0 8.36316E-6
12-112191614-G-A p.Glu952Glu synonymous ACAD10 1 82350 1.21433E-5 41175 0 3.98432E-6
12-112191624-G-A p.Val956Met missense ACAD10 1 82388 1.21377E-5 41194 0 3.1839E-5
12-112191628-T-A p.Leu957Gln missense ACAD10 1 82380 1.21389E-5 41190 0 NA
12-112191631-C-A p.Ala958Glu missense ACAD10 1 82348 1.21436E-5 41174 0 6.36821E-5
12-112191633-G-A p.Asp959Asn missense ACAD10 2 82358 2.42842E-5 41179 0 8.37409E-6
12-112191638-C-T p.Ile960Ile synonymous ACAD10 1 82296 1.21513E-5 41148 0 8.39729E-6
12-112191639-GCG-TCA p.Ala961Ser missense ACAD10 1 82238 1.21598E-5 41119 0 NA
12-112191640-C-T p.Ala961Val missense ACAD10 3 82204 3.64946E-5 41102 0 1.19679E-5
12-112191641-G-A p.Ala961Ala synonymous ACAD10 3937 82058 0.0479783 41029 462 0.0962274
12-112191647-G-A p.Ser963Ser synonymous ACAD10 4 82040 4.87567E-5 41020 0 5.88413E-5
12-112191648-C-T p.Arg964Cys missense ACAD10 3 82002 3.65845E-5 41001 0 6.36902E-5
12-112191649-G-A p.Arg964His missense ACAD10 1 81992 1.21963E-5 40996 0 1.19757E-5
12-112191650-C-T p.Arg964Arg synonymous ACAD10 1 81970 1.21996E-5 40985 0 3.18451E-5
12-112191651-G-T p.Val965Leu missense ACAD10 4 81964 4.88019E-5 40982 0 3.18471E-5
12-112191663-C-T p.Gln969* stop_gained ACAD10 9 81722 1.10129E-4 40861 0 1.23913E-4
12-112191669-C-T p.Arg971Trp missense ACAD10 647 81510 0.00793768 40755 7 0.0163355
12-112191670-G-A p.Arg971Gln missense ACAD10 3 81536 3.67936E-5 40768 0 3.1837E-5
12-112191688-C-A p.Ala977Asp missense ACAD10 1 80960 1.23518E-5 40480 0 NA
12-112191717-A-G p.Lys987Glu missense+splice_region ACAD10 2 80222 2.49308E-5 40111 0 6.36862E-5
12-112191718-A-C p.Lys987Thr missense+splice_region ACAD10 13 80196 1.62103E-4 40098 0 3.50318E-4
12-112193467-T-C c.2962-5T>C splice_region ACAD10 1 82912 1.2061E-5 41456 0 3.98295E-6
12-112193474-T-G p.Ala988Ala splice_region+synonymous ACAD10 1 83014 1.20462E-5 41507 0 NA
12-112193487-A-G p.Ile993Val missense ACAD10 1 83154 1.20259E-5 41577 0 8.24389E-6
12-112193490-G-A p.Ala994Thr missense ACAD10 1 83176 1.20227E-5 41588 0 3.97807E-6
12-112193508-G-T p.Ala1000Ser missense ACAD10 1 83212 1.20175E-5 41606 0 7.95627E-6
12-112193512-C-T p.Pro1001Leu missense ACAD10 1 83238 1.20137E-5 41619 0 4.37532E-5
12-112193513-G-A p.Pro1001Pro synonymous ACAD10 3 83226 3.60464E-5 41613 0 1.98864E-5
12-112193518-T-C p.Met1003Thr missense ACAD10 14 83234 1.682E-4 41617 0 0.00125
12-112193525-C-T p.Ser1005Ser synonymous ACAD10 2 83226 2.4031E-5 41613 0 8.23723E-6
12-112193526-C-T p.Arg1006* stop_gained ACAD10 42 83208 5.04759E-4 41604 0 0.00133937
12-112193530-T-C p.Val1007Ala missense ACAD10 1 83200 1.20192E-5 41600 0 NA
12-112193531-G-A p.Val1007Val synonymous ACAD10 13 83210 1.56231E-4 41605 0 2.5535E-4
12-112193538-C-T p.Arg1010Cys missense ACAD10 1 83192 1.20204E-5 41596 0 8.23737E-6
12-112193539-G-A p.Arg1010His missense ACAD10 2 83190 2.40414E-5 41595 0 3.18796E-5
12-112193542-C-T p.Ala1011Val missense ACAD10 8 83172 9.61862E-5 41586 0 6.37755E-5
12-112193543-G-A p.Ala1011Ala synonymous ACAD10 1 83160 1.2025E-5 41580 0 3.18939E-5
12-112193544-A-C p.Ile1012Leu missense ACAD10 1 83170 1.20236E-5 41585 0 NA
12-112193545-T-C p.Ile1012Thr missense ACAD10 1 83160 1.2025E-5 41580 0 8.23764E-6
12-112193550-G-T c.3039+1G>T splice_donor ACAD10 1 83144 1.20273E-5 41572 0 8.23805E-6
12-112193550-G-GCC c.3039+1_3039+2insCC splice_donor ACAD10 1 83144 1.20273E-5 41572 0 NA
12-112193551-T-TTTG c.3039+2_3039+3insTTG splice_region ACAD10 1 83136 1.20285E-5 41568 0 NA
12-112193556-A-AG c.3039+7_3039+8insG splice_region ACAD10 1 83112 1.2032E-5 41556 0 NA
12-112194132-G-A c.3040-5G>A splice_region ACAD10 2 82000 2.43902E-5 41000 0 1.9115E-5
12-112194133-C-T c.3040-4C>T splice_region ACAD10 1 81972 1.21993E-5 40986 0 5.55086E-5
12-112194134-C-T c.3040-3C>T splice_region ACAD10 1 82022 1.21919E-5 41011 0 NA
12-112194147-C-T p.Ala1017Val missense ACAD10 1 82132 1.21755E-5 41066 0 9.32818E-6
12-112194162-G-A p.Ser1022Asn missense ACAD10 1 82372 1.214E-5 41186 0 3.18512E-5
12-112194165-A-G p.Asp1023Gly missense ACAD10 1 82380 1.21389E-5 41190 0 NA
12-112194170-C-T p.Pro1025Ser missense ACAD10 4 82528 4.84684E-5 41264 1 2.03899E-5
12-112194189-C-T p.Thr1031Ile missense ACAD10 1 82524 1.21177E-5 41262 0 3.18451E-5
12-112194197-C-T p.Arg1034* stop_gained ACAD10 7 82442 8.49082E-5 41221 0 9.55962E-5
12-112194198-G-A p.Arg1034Gln missense ACAD10 2 82450 2.42571E-5 41225 0 1.80704E-5
12-112194201-C-T p.Ala1035Val missense ACAD10 1 82464 1.21265E-5 41232 0 NA
12-112194205-G-A p.Leu1036Leu synonymous ACAD10 1 82480 1.21242E-5 41240 0 9.55353E-5
12-112194206-C-T p.Arg1037Cys missense ACAD10 1 82464 1.21265E-5 41232 0 9.01616E-6
12-112194214-C-T p.Ala1039Ala synonymous ACAD10 1 82448 1.21289E-5 41224 0 7.18481E-5
12-112194215-G-A p.Asp1040Asn missense ACAD10 61 82426 7.40058E-4 41213 0 0.00125
12-112194217-C-T p.Asp1040Asp synonymous ACAD10 12 82418 1.45599E-4 41209 0 1.2738E-4
12-112194226-C-T p.Asp1043Asp synonymous ACAD10 2 82306 2.42996E-5 41153 0 3.57117E-5
12-112194227-G-A p.Glu1044Lys missense ACAD10 5 82274 6.07725E-5 41137 0 1.60674E-4
12-112194231-T-G p.Val1045Gly missense ACAD10 1 82196 1.2166E-5 41098 0 NA
12-112194234-A-G p.His1046Arg missense ACAD10 7 82158 8.52017E-5 41079 0 4.03597E-6
12-112194236-C-T p.Arg1047Trp missense ACAD10 1 82168 1.21702E-5 41084 0 3.2276E-5
12-112194237-G-A p.Arg1047Gln missense ACAD10 664 82122 0.00808553 41061 8 0.0163726
12-112194243-C-T p.Thr1049Met missense ACAD10 18 82046 2.19389E-4 41023 0 4.45775E-4
12-112194244-G-T p.Thr1049Thr synonymous ACAD10 3 82036 3.65693E-5 41018 0 2.67256E-5
12-112194252-A-C p.Lys1052Thr missense ACAD10 1 81930 1.22055E-5 40965 0 8.90107E-6
12-112194269-C-T p.Arg1058Cys missense ACAD10 3 81512 3.68044E-5 40756 0 9.55901E-5
12-112194270-G-GC p.Ile1059fs frameshift ACAD10 1 81490 1.22714E-5 40745 0 9.03163E-6
12-112194675-T-C n.2103-5T>C splice_region ACAD10 2 11172 1.79019E-4 5586 0 3.71264E-4