Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
12-109569231-G-A c.-85G>A splice_region ACACB 4 41486 9.64181E-5 20743 0 6.37105E-5
12-109577195-CT-C c.-9-6delT splice_region ACACB 2 83038 2.40854E-5 41519 0 NA
12-109577199-C-G c.-9-3C>G splice_region ACACB 6 83116 7.21883E-5 41558 0 2.85724E-5
12-109577213-G-A p.Met1? start_lost ACACB 2 83230 2.40298E-5 41615 0 3.18471E-5
12-109577214-G-A p.Val2Ile missense ACACB 3 83232 3.60438E-5 41616 0 NA
12-109577215-T-G p.Val2Gly missense ACACB 1 83240 1.20135E-5 41620 0 NA
12-109577217-T-C c.-69T>C 5_prime_UTR_premature_start_codon_gain ACACB 1 83252 1.20117E-5 41626 0 4.00029E-6
12-109577217-T-A p.Leu3Met missense ACACB 1 83252 1.20117E-5 41626 0 NA
12-109577219-GC-TT p.LeuLeu3PhePhe missense ACACB 1 83272 1.20088E-5 41636 0 NA
12-109577229-C-T p.Leu7Leu synonymous ACACB 339 83290 0.00407012 41645 5 0.00917139
12-109577248-C-G p.Ser13Cys missense ACACB 2 83354 2.3994E-5 41677 0 1.27372E-4
12-109577260-T-C p.Phe17Ser missense ACACB 5 83366 5.99765E-5 41683 0 1.91266E-4
12-109577264-C-G p.Ser18Ser synonymous ACACB 1 83364 1.19956E-5 41682 0 1.64796E-5
12-109577276-C-T c.-10C>T 5_prime_UTR_premature_start_codon_gain ACACB 2 83374 2.39883E-5 41687 0 NA
12-109577284-A-G p.Lys25Arg missense ACACB 1 83376 1.19939E-5 41688 0 NA
12-109577290-C-T p.Thr27Met missense ACACB 3 83380 3.59799E-5 41690 0 1.98864E-5
12-109577290-C-A p.Thr27Lys missense ACACB 1 83380 1.19933E-5 41690 0 1.19318E-5
12-109577290-C-G p.Thr27Arg missense ACACB 1 83380 1.19933E-5 41690 0 NA
12-109577302-C-T p.Pro31Leu missense ACACB 4 83390 4.79674E-5 41695 0 3.29478E-5
12-109577303-G-T p.Pro31Pro synonymous ACACB 1 83390 1.19918E-5 41695 0 3.18715E-5
12-109577305-TCA-T p.Thr33fs frameshift ACACB 2 83392 2.39831E-5 41696 0 NA
12-109577314-G-A p.Ser35Asn missense ACACB 1 83394 1.19913E-5 41697 0 6.25E-4
12-109577330-C-A p.Asn40Lys missense ACACB 2 83384 2.39854E-5 41692 0 8.23696E-6
12-109577330-C-T p.Asn40Asn synonymous ACACB 1 83384 1.19927E-5 41692 0 8.23696E-6
12-109577338-C-T p.Pro43Leu missense ACACB 30 83382 3.5979E-4 41691 0 0.00100705
12-109577339-G-A p.Pro43Pro synonymous ACACB 2 83386 2.39848E-5 41693 0 5.1694E-5
12-109577343-C-G p.Gln45Glu missense ACACB 1 83392 1.19916E-5 41696 0 5.03525E-4
12-109577344-A-G p.Gln45Arg missense ACACB 179 83388 0.00214659 41694 0 0.00215125
12-109577350-C-A p.Pro47His missense ACACB 1 83384 1.19927E-5 41692 0 3.57901E-5
12-109577369-C-G p.Asn53Lys missense ACACB 1 83362 1.19959E-5 41681 0 NA
12-109577373-G-C p.Gly55Arg missense ACACB 1 83346 1.19982E-5 41673 0 9.14666E-5
12-109577382-C-A p.Pro58Thr missense ACACB 1 83334 1.19999E-5 41667 0 NA
12-109577383-C-T p.Pro58Leu missense ACACB 19 83330 2.28009E-4 41665 0 6.38284E-5
12-109577383-C-A p.Pro58Gln missense ACACB 1 83330 1.20005E-5 41665 0 8.23954E-6
12-109577383-C-G p.Pro58Arg missense ACACB 2 83330 2.4001E-5 41665 0 7.95494E-6
12-109577384-G-A p.Pro58Pro synonymous ACACB 1 83322 1.20016E-5 41661 0 3.19101E-5
12-109577409-C-G p.Leu67Val missense ACACB 2 83250 2.4024E-5 41625 0 3.18817E-5
12-109577421-C-T p.Pro71Ser missense ACACB 1 83244 1.20129E-5 41622 0 NA
12-109577431-C-G p.Ala74Gly missense ACACB 1 83228 1.20152E-5 41614 0 NA
12-109577432-C-T p.Ala74Ala synonymous ACACB 2 83228 2.40304E-5 41614 0 1.64978E-5
12-109577436-C-T p.Pro76Ser missense ACACB 1 83262 1.20103E-5 41631 0 3.98076E-6
12-109577446-AC-A p.His79fs frameshift ACACB 2 83262 2.40206E-5 41631 0 1.65027E-5
12-109577463-G-A p.Ala85Thr missense ACACB 1 83286 1.20068E-5 41643 0 NA
12-109577465-C-T p.Ala85Ala synonymous ACACB 2328 83248 0.0279646 41624 196 0.0572458
12-109577466-G-A p.Gly86Ser missense ACACB 2 83276 2.40165E-5 41638 0 3.18756E-5
12-109577469-C-T p.Arg87Trp missense ACACB 3 83272 3.60265E-5 41636 0 2.47647E-5
12-109577469-C-G p.Arg87Gly missense ACACB 1 83272 1.20088E-5 41636 0 NA
12-109577470-G-A p.Arg87Gln missense ACACB 4 83270 4.80365E-5 41635 0 1.19454E-5
12-109577470-G-C p.Arg87Pro missense ACACB 1 83270 1.20091E-5 41635 0 NA
12-109577472-C-T p.Arg88Trp missense ACACB 1 83268 1.20094E-5 41634 0 3.30256E-5
12-109577473-G-A p.Arg88Gln missense ACACB 4 83282 4.80296E-5 41641 0 5.03525E-4
12-109577476-G-T p.Arg89Ile missense ACACB 1 83280 1.20077E-5 41640 0 8.25532E-6
12-109577490-C-T p.Pro94Ser missense ACACB 1 83298 1.20051E-5 41649 0 NA
12-109577516-C-A p.Asn102Lys missense ACACB 12 83318 1.44027E-4 41659 0 3.18654E-4
12-109577535-G-A p.Ala109Thr missense ACACB 1 83310 1.20034E-5 41655 0 8.2481E-6
12-109577540-A-G p.Ala110Ala synonymous ACACB 2 83306 2.40079E-5 41653 0 3.97716E-6
12-109577542-C-T p.Pro111Leu missense ACACB 1 83314 1.20028E-5 41657 0 NA
12-109577545-C-T p.Ser112Phe missense ACACB 1 83314 1.20028E-5 41657 0 NA
12-109577565-G-A p.Gly119Arg missense ACACB 3 83284 3.60213E-5 41642 0 2.23044E-4
12-109577578-A-G p.Gln123Arg missense ACACB 1 83282 1.20074E-5 41641 0 NA
12-109577599-C-G p.Thr130Ser missense ACACB 11 83254 1.32126E-4 41627 0 9.55231E-5
12-109577610-T-C p.Ser134Pro missense ACACB 1 83230 1.20149E-5 41615 0 NA
12-109577615-C-T p.Ser135Ser synonymous ACACB 1 83238 1.20137E-5 41619 0 NA
12-109577620-C-G p.Ala137Gly missense ACACB 8 83214 9.61377E-5 41607 0 2.86661E-4
12-109577620-C-T p.Ala137Val missense ACACB 2 83214 2.40344E-5 41607 0 NA
12-109577629-A-G p.Gln140Arg missense ACACB 2 83174 2.4046E-5 41587 0 4.95942E-5
12-109577633-C-G p.Gly141Gly synonymous ACACB 1 83140 1.20279E-5 41570 0 8.26638E-6
12-109577641-C-T p.Ala144Val missense ACACB 1 83112 1.2032E-5 41556 0 NA
12-109577645-C-A p.Gly145Gly synonymous ACACB 2 83072 2.40755E-5 41536 0 NA
12-109577683-AG-A p.Arg159fs frameshift ACACB 1 82744 1.20855E-5 41372 0 8.27445E-6
12-109577695-T-A p.Met162Lys missense ACACB 1 82570 1.21109E-5 41285 0 3.18552E-5
12-109577701-A-G p.Asn164Ser missense ACACB 2 82526 2.42348E-5 41263 0 1.65473E-5
12-109577727-T-A p.Tyr173Asn missense ACACB 2 82190 2.43339E-5 41095 0 3.18492E-5
12-109577735-C-T p.Ser175Ser synonymous ACACB 47718 80874 0.590029 40437 14913 0.671875
12-109577738-C-T p.Asp176Asp synonymous ACACB 6 81964 7.32029E-5 40982 0 6.61759E-5
12-109577741-G-A p.Glu177Glu synonymous ACACB 2 81992 2.43926E-5 40996 0 8.27185E-6
12-109577760-T-C p.Ser184Pro missense ACACB 1 81964 1.22005E-5 40982 0 NA
12-109577763-C-T p.Arg185Cys missense ACACB 1 81964 1.22005E-5 40982 0 8.28144E-6
12-109577764-G-A p.Arg185His missense ACACB 11 81966 1.34202E-4 40983 0 1.59276E-4
12-109577764-G-C p.Arg185Pro missense ACACB 1 81964 1.22005E-5 40982 0 NA
12-109577766-G-A p.Glu186Lys missense ACACB 1 81984 1.21975E-5 40992 0 NA
12-109577776-G-A p.Arg189Gln missense ACACB 151 81968 0.00184218 40984 0 0.0030583
12-109577781-G-C p.Gly191Arg missense ACACB 1 81994 1.2196E-5 40997 0 NA
12-109577782-G-A p.Gly191Asp missense ACACB 2 81946 2.44063E-5 40973 0 9.55292E-5
12-109577788-G-A p.Arg193Gln missense ACACB 2 81960 2.44021E-5 40980 0 6.25E-4
12-109577791-C-T p.Ala194Val missense ACACB 1 82000 1.21951E-5 41000 0 1.66431E-5
12-109577799-G-T p.Gly197Trp missense ACACB 1 82056 1.21868E-5 41028 0 NA
12-109577827-C-A p.Thr206Asn missense ACACB 2 82418 2.42665E-5 41209 0 NA
12-109577838-G-A p.Ala210Thr missense ACACB 1 82434 1.21309E-5 41217 0 NA
12-109577841-G-C p.Glu211Gln missense ACACB 3 82440 3.63901E-5 41220 0 0.00125
12-109577847-C-T p.Arg213Cys missense ACACB 6 82448 7.27731E-5 41224 0 5.05051E-4
12-109577848-G-A p.Arg213His missense ACACB 1 82424 1.21324E-5 41212 0 6.37064E-5
12-109577849-C-T p.Arg213Arg synonymous ACACB 3 82434 3.63928E-5 41217 0 8.71414E-6
12-109577850-G-A p.Val214Ile missense ACACB 2 82434 2.42618E-5 41217 0 2.61689E-5
12-109577864-G-A c.653+1G>A splice_donor ACACB 2 82456 2.42554E-5 41228 0 NA
12-109577869-G-A c.653+6G>A splice_region ACACB 3 82450 3.63857E-5 41225 0 9.00285E-6
12-109592528-C-T c.-171C>T 5_prime_UTR_premature_start_codon_gain ACACB 3 32968 9.09973E-5 16484 0 3.18878E-5
12-109592558-C-G c.-141C>G 5_prime_UTR_premature_start_codon_gain ACACB 6166 36868 0.167245 18434 120 0.177139
12-109592699-A-G p.Met1? start_lost ACACB 5 42576 1.17437E-4 21288 0 1.60927E-4
12-109592717-A-G p.Lys7Glu missense ACACB 1 42646 2.34489E-5 21323 0 1.60772E-4
12-109592747-TA-T c.47+3delA splice_region ACACB 1 42602 2.34731E-5 21301 0 NA
12-109604664-A-C c.654-2A>C splice_acceptor ACACB 4 82130 4.87033E-5 41065 0 NA
12-109604666-G-T p.Arg218Ser missense+splice_region ACACB 1 82170 1.21699E-5 41085 0 NA
12-109604667-C-A p.Pro219Thr missense+splice_region ACACB 1 82200 1.21655E-5 41100 0 5.03525E-4
12-109604668-C-T p.Pro219Leu missense+splice_region ACACB 14 82290 1.7013E-4 41145 0 4.857E-4
12-109604669-G-A p.Pro219Pro synonymous ACACB 16 82416 1.94137E-4 41208 0 2.23214E-4
12-109604678-G-A p.Ser222Ser synonymous ACACB 4 82634 4.84062E-5 41317 0 4.95033E-5
12-109604704-G-A p.Arg231Gln missense ACACB 1 83028 1.20441E-5 41514 0 3.18837E-5
12-109604707-A-G p.Glu232Gly missense ACACB 1 83070 1.2038E-5 41535 0 NA
12-109604711-C-G p.His233Gln missense ACACB 1 83106 1.20328E-5 41553 0 NA
12-109604714-G-T p.Lys234Asn missense ACACB 3 83136 3.60855E-5 41568 0 1.59368E-4
12-109604729-C-T p.His239His synonymous ACACB 1 83166 1.20241E-5 41583 0 8.23981E-6
12-109604741-C-T p.Thr243Thr synonymous ACACB 2 83136 2.4057E-5 41568 0 9.06454E-5
12-109604742-G-A p.Val244Met missense ACACB 1 83126 1.20299E-5 41563 0 2.78501E-5
12-109604753-C-T p.Pro247Pro synonymous ACACB 4 83024 4.81788E-5 41512 0 3.58263E-5
12-109604754-G-A p.Ala248Thr missense ACACB 2 82974 2.41039E-5 41487 0 3.29636E-5
12-109604770-G-A p.Arg253His missense ACACB 6 82580 7.26568E-5 41290 0 2.55619E-4
12-109604774-T-TG p.Asp257fs frameshift ACACB 2 82430 2.4263E-5 41215 0 3.19109E-5
12-109604776-G-T p.Gly255Val missense ACACB 34 82366 4.12792E-4 41183 0 8.61079E-4
12-109604776-G-C p.Gly255Ala missense ACACB 7 82366 8.49865E-5 41183 0 1.32007E-4
12-109604777-G-A p.Gly255Gly synonymous ACACB 1 82378 1.21392E-5 41189 0 NA
12-109604784-C-T p.Arg258Trp missense ACACB 1 82054 1.21871E-5 41027 0 4.12855E-5
12-109604785-G-A p.Arg258Gln missense ACACB 5 81946 6.10158E-5 40973 0 3.5964E-5
12-109604793-G-A p.Glu261Lys missense ACACB 41 81520 5.02944E-4 40760 0 5.07992E-4
12-109604793-G-C p.Glu261Gln missense ACACB 1 81520 1.22669E-5 40760 0 NA
12-109605711-C-T p.Ala266Val missense ACACB 2 82974 2.41039E-5 41487 0 NA
12-109605714-A-G p.Asn267Ser missense ACACB 1 82992 1.20494E-5 41496 0 NA
12-109605718-C-T p.Asn268Asn synonymous ACACB 6 82982 7.23048E-5 41491 0 6.76176E-5
12-109605727-C-T p.Ala271Ala synonymous ACACB 3 82970 3.61576E-5 41485 0 6.38447E-5
12-109605728-G-A p.Ala272Thr missense ACACB 2 82954 2.41097E-5 41477 0 3.19305E-5
12-109605730-C-T p.Ala272Ala synonymous ACACB 15283 82428 0.18541 41214 1676 0.232896
12-109605741-T-C p.Met276Thr missense ACACB 1 82942 1.20566E-5 41471 0 1.59101E-5
12-109605741-TGCGCTCCATCCGCAG-T p.Arg277_Arg281del conservative_inframe_deletion ACACB 1 82942 1.20566E-5 41471 0 3.97753E-6
12-109605744-G-A p.Arg277His missense ACACB 2 82872 2.41336E-5 41436 0 6.3857E-5
12-109605754-C-T p.Arg280Arg synonymous ACACB 14 82822 1.69037E-4 41411 0 0.0020141
12-109605756-G-C p.Arg281Thr missense ACACB 2 82804 2.41534E-5 41402 0 NA
12-109605757-G-A p.Arg281Arg synonymous ACACB 1 82784 1.20796E-5 41392 0 NA
12-109605776-C-T p.Arg288Cys missense ACACB 3 82448 3.63866E-5 41224 0 1.59332E-5
12-109605777-G-A p.Arg288His missense ACACB 1 82402 1.21356E-5 41201 0 1.65169E-5
12-109605781-C-T p.Asn289Asn synonymous ACACB 2 82304 2.43002E-5 41152 0 6.37755E-5
12-109605786-G-A p.Arg291Gln missense ACACB 3 82030 3.6572E-5 41015 0 1.59415E-5
12-109605788-G-T p.Ala292Ser missense ACACB 1 81910 1.22085E-5 40955 0 1.65525E-5
12-109605789-C-A p.Ala292Asp missense ACACB 1 81856 1.22166E-5 40928 0 NA
12-109605794-C-T p.Arg294Trp missense ACACB 1 81576 1.22585E-5 40788 0 6.63405E-5
12-109605815-C-A p.Pro301Thr missense ACACB 1 80380 1.24409E-5 40190 0 NA
12-109605818-G-A p.Glu302Lys missense ACACB 1 79974 1.25041E-5 39987 0 8.42559E-6
12-109605822-A-G p.Asp303Gly missense ACACB 5 79520 6.28773E-5 39760 0 NA
12-109605828-A-T p.Lys305Met missense ACACB 1 78910 1.26727E-5 39455 0 NA
12-109605836-G-A p.Ala308Thr missense ACACB 2 77626 2.57646E-5 38813 0 3.18898E-5
12-109605838-A-G p.Ala308Ala splice_region+synonymous ACACB 1 77380 1.29232E-5 38690 0 4.1213E-6
12-109605839-G-GA c.925_925+1insA splice_donor ACACB 2 77272 2.58826E-5 38636 0 NA
12-109609626-G-A p.Ala314Ala synonymous ACACB 1 83364 1.19956E-5 41682 0 8.28212E-6
12-109609635-C-T p.Tyr317Tyr synonymous ACACB 1 83366 1.19953E-5 41683 0 1.07418E-4
12-109609636-G-A p.Val318Ile missense ACACB 15 83366 1.79929E-4 41683 0 0.00125
12-109609641-C-T p.Pro319Pro synonymous ACACB 3 83376 3.59816E-5 41688 0 5.56948E-5
12-109609642-G-A p.Val320Ile missense ACACB 9 83370 1.07953E-4 41685 0 5.03525E-4
12-109609647-A-C p.Pro321Pro synonymous ACACB 1 83376 1.19939E-5 41688 0 8.2496E-6
12-109609653-G-A p.Gly323Gly synonymous ACACB 1 83382 1.1993E-5 41691 0 3.18471E-5
12-109609658-A-G p.Asn325Ser missense ACACB 1 83384 1.19927E-5 41692 0 8.24552E-6
12-109609659-TAAC-T p.Asn328del conservative_inframe_deletion ACACB 1 83384 1.19927E-5 41692 0 3.18492E-5
12-109609665-C-T p.Asn327Asn synonymous ACACB 1 83388 1.19921E-5 41694 0 NA
12-109609668-C-T p.Asn328Asn synonymous ACACB 2 83378 2.39871E-5 41689 0 1.19304E-5
12-109609677-C-T p.Asn331Asn synonymous ACACB 33 83382 3.95769E-4 41691 0 8.51016E-4
12-109609678-G-A p.Val332Met missense ACACB 5 83376 5.99693E-5 41688 0 3.29848E-5
12-109609692-G-A p.Val336Val synonymous ACACB 3 83362 3.59876E-5 41681 0 3.18695E-5
12-109609694-A-G p.Asp337Gly missense ACACB 2 83362 2.39917E-5 41681 0 NA
12-109609695-C-G p.Asp337Glu missense ACACB 4 83354 4.79881E-5 41677 0 0.00100705
12-109609696-A-G p.Ile338Val missense ACACB 1 83350 1.19976E-5 41675 0 3.18715E-5
12-109609709-TC-T p.Val344fs frameshift ACACB 1 83348 1.19979E-5 41674 0 5.56815E-5
12-109609710-C-A p.Ile342Ile synonymous ACACB 1 83348 1.19979E-5 41674 0 NA
12-109609713-C-T p.Pro343Pro synonymous ACACB 62 83334 7.43994E-4 41667 0 0.00375
12-109609714-G-A p.Val344Met missense ACACB 2 83328 2.40015E-5 41664 0 3.58007E-5
12-109609715-T-A p.Val344Glu missense ACACB 1 83316 1.20025E-5 41658 0 3.18512E-5
12-109609725-T-G c.1035+6T>G splice_region ACACB 1 83262 1.20103E-5 41631 0 3.98051E-6
12-109610081-C-T p.Ala346Val missense+splice_region ACACB 5 83298 6.00254E-5 41649 0 1.59337E-5
12-109610081-C-A p.Ala346Glu missense+splice_region ACACB 6 83298 7.20305E-5 41649 0 1.19503E-5
12-109610082-G-A p.Ala346Ala splice_region+synonymous ACACB 1 83312 1.20031E-5 41656 0 3.30213E-5
12-109610111-A-G p.Glu356Gly missense ACACB 1 83344 1.19985E-5 41672 0 7.95501E-6
12-109610117-C-G p.Pro358Arg missense ACACB 21 83340 2.5198E-4 41670 0 3.18471E-5
12-109610126-C-T p.Pro361Leu missense ACACB 2 83330 2.4001E-5 41665 0 3.18552E-5
12-109610127-G-A p.Pro361Pro synonymous ACACB 5 83328 6.00038E-5 41664 0 6.25E-4
12-109610131-C-T p.Leu363Leu synonymous ACACB 1 83318 1.20022E-5 41659 0 NA
12-109610138-G-T p.Cys365Phe missense ACACB 2 83326 2.40021E-5 41663 0 1.6488E-5
12-109610162-G-GCCCTCCCAGTGAGGCCATGTGGGCCT c.1117+1_1117+2insCCCTCCCAGTGAGGCCATGTGGGCCT splice_donor ACACB 1 83274 1.20085E-5 41637 0 NA
12-109610164-A-G c.1117+3A>G splice_region ACACB 9 83268 1.08085E-4 41634 0 7.4331E-5
12-109611939-C-A p.Pro374Thr missense+splice_region ACACB 3 81512 3.68044E-5 40756 0 3.18552E-5
12-109611953-C-T p.Ala378Ala synonymous ACACB 2 81774 2.44577E-5 40887 0 2.13785E-5
12-109611962-C-T p.Ala381Ala synonymous ACACB 7 81866 8.55056E-5 40933 0 4.82921E-5
12-109611973-A-C p.Lys385Thr missense ACACB 1 81894 1.22109E-5 40947 0 NA
12-109611977-C-T p.Ile386Ile synonymous ACACB 2 81834 2.44397E-5 40917 0 5.03525E-4
12-109611978-G-A p.Ala387Thr missense ACACB 1 81754 1.22318E-5 40877 0 2.87356E-5
12-109611983-C-T p.Ser388Ser synonymous ACACB 2 81852 2.44343E-5 40926 0 9.54198E-6
12-109611986-C-T p.Thr389Thr synonymous ACACB 11 81766 1.3453E-4 40883 0 2.8677E-4
12-109611990-G-A p.Val391Ile missense ACACB 2 81752 2.44642E-5 40876 0 NA
12-109611992-C-T p.Val391Val synonymous ACACB 3 81702 3.67188E-5 40851 0 3.50519E-4
12-109611995-C-T p.Ala392Ala synonymous ACACB 3 81688 3.67251E-5 40844 0 NA
12-109612000-C-T p.Thr394Met missense ACACB 5 81524 6.13316E-5 40762 0 6.82128E-5
12-109612004-A-G p.Leu395Leu synonymous ACACB 4 81506 4.90761E-5 40753 0 5.91005E-4
12-109612005-C-T p.Gln396* stop_gained ACACB 1 81496 1.22705E-5 40748 0 3.94089E-5
12-109612034-C-T p.Ser405Ser splice_region+synonymous ACACB 3 80702 3.71738E-5 40351 0 7.0335E-5
12-109612035-G-A p.Gly406Ser missense+splice_region ACACB 2 80656 2.47967E-5 40328 0 3.52941E-5
12-109612039-AG-A c.1216+5delG splice_region ACACB 2 80608 2.48114E-5 40304 0 2.50476E-5
12-109613737-C-A p.Gly406Gly splice_region+synonymous ACACB 4 83142 4.81105E-5 41571 0 6.37024E-5
12-109613745-T-C p.Val409Ala missense ACACB 1 83182 1.20218E-5 41591 0 8.25505E-6
12-109613757-A-G p.Glu413Gly missense ACACB 1 83248 1.20123E-5 41624 0 NA
12-109613767-G-A p.Leu416Leu synonymous ACACB 1 83258 1.20109E-5 41629 0 3.97779E-6
12-109613774-G-A p.Gly419Arg missense ACACB 7 83290 8.40437E-5 41645 0 2.55443E-4
12-109613775-G-A p.Gly419Glu missense ACACB 1 83292 1.2006E-5 41646 0 3.19E-5
12-109613788-T-C p.Ser423Ser synonymous ACACB 11 83310 1.32037E-4 41655 0 4.77707E-4
12-109613797-A-G p.Glu426Glu synonymous ACACB 2 83334 2.39998E-5 41667 0 NA
12-109613799-A-G p.Asp427Gly missense ACACB 1 83334 1.19999E-5 41667 0 NA
12-109613807-G-A p.Asp430Asn missense ACACB 2 83342 2.39975E-5 41671 0 7.95482E-6
12-109613809-C-T p.Asp430Asp synonymous ACACB 1 83344 1.19985E-5 41672 0 3.97747E-6
12-109613818-C-T p.Cys433Cys synonymous ACACB 1 83344 1.19985E-5 41672 0 6.37064E-5
12-109613823-AAGACGT-A p.Val437_Asp438del disruptive_inframe_deletion ACACB 1 83352 1.19973E-5 41676 0 NA
12-109613824-A-G p.Lys435Lys synonymous ACACB 1 83358 1.19964E-5 41679 0 NA
12-109613826-A-G p.Asp436Gly missense ACACB 3 83358 3.59893E-5 41679 0 3.54189E-4
12-109613828-G-A p.Val437Ile missense ACACB 1 83362 1.19959E-5 41681 0 8.23737E-6
12-109613836-G-A p.Glu439Glu synonymous ACACB 2 83372 2.39889E-5 41686 0 3.97725E-6
12-109613843-GAGGTAAATGCAGAGCCTGTGGGGGCCAGGGGAGCCAGAACCGAACTGCCTCTGTCCTGGTAGCAGTTGGCAACTGGCTAACCTCTAAAGAGGTCTGTTTGTCCTTTGCACCC-G p.Glu442fs frameshift ACACB 7 83360 8.39731E-5 41680 2 NA
12-109613953-C-A c.1327-5C>A splice_region ACACB 1 83344 1.19985E-5 41672 0 NA
12-109613982-T-C p.Leu451Leu synonymous ACACB 1 83364 1.19956E-5 41682 0 3.97684E-6
12-109613985-A-G p.Met452Val missense ACACB 1 83364 1.19956E-5 41682 0 NA
12-109613989-T-C p.Ile453Thr missense ACACB 1 83366 1.19953E-5 41683 0 8.23655E-6
12-109613996-T-A p.Ala455Ala synonymous ACACB 2 83358 2.39929E-5 41679 0 1.59072E-5
12-109613999-T-C p.Ser456Ser synonymous ACACB 1 83354 1.1997E-5 41677 0 1.59072E-5
12-109614008-C-T p.Gly459Gly synonymous ACACB 2 83370 2.39894E-5 41685 0 8.23642E-6
12-109614012-G-GGCTCC p.Lys462fs frameshift ACACB 1 83376 1.19939E-5 41688 0 NA
12-109614023-C-G p.Ile464Met missense ACACB 5 83374 5.99707E-5 41687 0 1.19301E-5
12-109614025-G-A p.Arg465Gln missense ACACB 2 83378 2.39871E-5 41689 0 9.55171E-5
12-109614035-G-C p.Glu468Asp missense ACACB 2 83368 2.399E-5 41684 0 NA
12-109614035-GA-TT p.GluSer468AspCys missense ACACB 1 83368 1.1995E-5 41684 0 NA
12-109614038-T-C p.Ser469Ser synonymous ACACB 3 83360 3.59885E-5 41680 0 NA
12-109614040-C-T p.Ala470Val missense ACACB 1 83354 1.1997E-5 41677 0 3.18492E-5
12-109614041-G-A p.Ala470Ala synonymous ACACB 4 83356 4.79869E-5 41678 0 5.03525E-4
12-109614044-G-T p.Glu471Asp missense ACACB 2 83356 2.39935E-5 41678 0 8.23669E-6
12-109614052-C-T p.Pro474Leu missense ACACB 3 83348 3.59937E-5 41674 0 3.18183E-5
12-109614053-G-C p.Pro474Pro synonymous ACACB 3 83348 3.59937E-5 41674 0 NA
12-109614075-A-G c.1437+7A>G splice_region ACACB 1 83294 1.20057E-5 41647 0 NA
12-109614076-G-A c.1437+8G>A splice_region ACACB 1 83292 1.2006E-5 41646 0 NA
12-109616887-C-T c.1438-6C>T splice_region ACACB 31 82190 3.77175E-4 41095 0 2.83607E-4
12-109616888-G-A c.1438-5G>A splice_region ACACB 143 82204 0.00173957 41102 0 0.00312341
12-109616907-C-T p.Ile484Ile synonymous ACACB 1 82590 1.2108E-5 41295 0 NA
12-109616915-C-T p.Ser487Leu missense ACACB 1 82696 1.20925E-5 41348 0 3.18634E-5
12-109616916-G-A p.Ser487Ser synonymous ACACB 1 82678 1.20951E-5 41339 0 3.18674E-5
12-109616922-C-A p.Ile489Ile synonymous ACACB 38 82790 4.58993E-4 41395 0 0.00126145
12-109616946-C-T p.His497His synonymous ACACB 12 82866 1.44812E-4 41433 0 6.77874E-5
12-109616947-G-A p.Ala498Thr missense ACACB 7 82856 8.44839E-5 41428 0 1.59297E-4
12-109616951-G-A p.Arg499His missense ACACB 9 82866 1.08609E-4 41433 0 3.09683E-4
12-109616961-A-T p.Glu502Asp missense ACACB 1 82936 1.20575E-5 41468 0 NA
12-109616973-C-T p.Leu506Leu synonymous ACACB 1 82926 1.20589E-5 41463 0 5.03525E-4
12-109617001-C-T p.Leu516Leu synonymous ACACB 30 82944 3.6169E-4 41472 0 0.00151057
12-109617011-G-A p.Arg519His missense ACACB 3 82848 3.62109E-5 41424 0 7.96819E-6
12-109617012-C-T p.Arg519Arg synonymous ACACB 2 82842 2.41423E-5 41421 0 1.99171E-5
12-109617018-C-T p.Cys521Cys synonymous ACACB 1 82860 1.20685E-5 41430 0 NA
12-109617032-G-A p.Arg526Gln missense ACACB 4 82790 4.8315E-5 41395 0 2.5267E-5
12-109617043-A-G p.Ile530Val missense ACACB 1 82728 1.20878E-5 41364 0 NA
12-109617046-G-A p.Val531Ile missense ACACB 3 82732 3.62617E-5 41366 0 1.99389E-5
12-109617048-T-G p.Val531Val synonymous ACACB 384 82712 0.00464262 41356 4 0.00908174
12-109617060-G-A p.Pro535Pro synonymous ACACB 6 82566 7.26691E-5 41283 0 9.5862E-5
12-109617063-C-T p.Ala536Ala synonymous ACACB 1 82574 1.21103E-5 41287 0 NA
12-109617075-G-A p.Pro540Pro synonymous ACACB 13 82442 1.57687E-4 41221 0 6.80174E-5
12-109617079-G-T p.Ala542Ser missense ACACB 2 82482 2.42477E-5 41241 0 1.2734E-4
12-109617088-G-A p.Glu545Lys missense ACACB 2 82358 2.42842E-5 41179 0 1.20239E-5
12-109617090-G-A p.Glu545Glu synonymous ACACB 1 82308 1.21495E-5 41154 0 4.00692E-6
12-109617094-A-T p.Met547Leu missense ACACB 1 82222 1.21622E-5 41111 0 NA
12-109617101-AG-A c.1647+1delG splice_donor ACACB 1 82002 1.21948E-5 41001 0 NA
12-109617102-G-GTGTGCCATCCGCCTGGCCAAGACCGTGGGCTATGTGA c.1647_1647+1insTGTGCCATCCGCCTGGCCAAGACCGTGGGCTATGTGA splice_donor ACACB 1 81972 1.21993E-5 40986 0 NA
12-109617107-A-C c.1647+5A>C splice_region ACACB 1 81690 1.22414E-5 40845 0 NA
12-109617109-T-C c.1647+7T>C splice_region ACACB 2 81660 2.44918E-5 40830 0 1.01893E-5
12-109617175-C-T n.458C>T splice_region ACACB 1 71916 1.39051E-5 35958 0 NA
12-109617176-G-A n.459G>A splice_region ACACB 1 71598 1.39669E-5 35799 0 NA
12-109617719-C-T c.1648-3C>T splice_region ACACB 3 83142 3.60828E-5 41571 0 3.18451E-5
12-109617728-A-G p.Ile552Val missense ACACB 4069 83118 0.0489545 41559 236 0.0734676
12-109617730-C-G p.Ile552Met missense ACACB 1 83172 1.20233E-5 41586 0 NA
12-109617731-C-T p.Arg553Cys missense ACACB 4 83178 4.80896E-5 41589 0 5.03525E-4
12-109617732-G-A p.Arg553His missense ACACB 1 83178 1.20224E-5 41589 0 6.36983E-5
12-109617742-G-C p.Lys556Asn missense ACACB 1 83212 1.20175E-5 41606 0 3.1839E-5
12-109617745-C-T p.Thr557Thr synonymous ACACB 5 83216 6.00846E-5 41608 0 6.25E-4
12-109617746-G-A p.Val558Met missense ACACB 1 83222 1.20161E-5 41611 0 6.36983E-5
12-109617747-TG-T p.Gly559fs frameshift ACACB 2 83224 2.40315E-5 41612 0 NA
12-109617769-A-C p.Thr565Thr synonymous ACACB 9 83238 1.08124E-4 41619 0 2.54712E-4
12-109617769-A-G p.Thr565Thr synonymous ACACB 1 83238 1.20137E-5 41619 0 NA
12-109617779-C-T p.Leu569Phe missense ACACB 1 83218 1.20166E-5 41609 0 NA
12-109617783-A-G p.Tyr570Cys missense ACACB 29 83208 3.48524E-4 41604 0 5.09554E-4
12-109617788-C-G p.Gln572Glu missense ACACB 40 83190 4.80827E-4 41595 0 2.02854E-4
12-109617793-T-C p.Asp573Asp synonymous ACACB 1 83180 1.20221E-5 41590 0 9.55292E-5
12-109617801-T-G p.Phe576Cys missense ACACB 3 83162 3.60742E-5 41581 0 7.95526E-6
12-109617809-T-C p.Leu579Leu synonymous ACACB 7 83176 8.41589E-5 41588 0 NA
12-109617824-C-T p.Arg584Cys missense ACACB 3 83104 3.60993E-5 41552 0 0.00100705
12-109617832-G-A p.Gln586Gln synonymous ACACB 1 83046 1.20415E-5 41523 0 6.36583E-5
12-109617842-C-T p.Pro590Ser missense ACACB 2 82982 2.41016E-5 41491 0 NA
12-109617850-A-G p.Thr592Thr synonymous ACACB 1 82906 1.20619E-5 41453 0 1.19502E-5
12-109617854-A-G p.Met594Val missense ACACB 1 82858 1.20688E-5 41429 0 NA
12-109617865-T-C p.Asp597Asp synonymous ACACB 59841 77214 0.775002 38607 23556 0.813125
12-109617865-TG-CA p.AspVal597AspIle missense ACACB 1 82616 1.21042E-5 41308 0 NA
12-109617866-G-A p.Val598Ile missense ACACB 2 82592 2.42154E-5 41296 0 6.37176E-5
12-109617872-C-T p.Leu600Leu synonymous ACACB 3 82412 3.64025E-5 41206 0 1.65155E-5
12-109617876-C-T p.Pro601Leu missense ACACB 1 82178 1.21687E-5 41089 0 3.18552E-5
12-109617877-G-A p.Pro601Pro synonymous ACACB 1 82134 1.21752E-5 41067 0 3.18431E-5
12-109623377-AT-A c.1819-6delT splice_region ACACB 1 83064 1.20389E-5 41532 0 NA
12-109623386-C-T p.Ile607Ile splice_region+synonymous ACACB 3 83128 3.60889E-5 41564 0 6.25E-4
12-109623387-G-A p.Ala608Thr missense ACACB 4 83136 4.81139E-5 41568 0 3.98657E-5
12-109623395-C-T p.Gly610Gly synonymous ACACB 1 83186 1.20213E-5 41593 0 1.65237E-5
12-109623396-G-A p.Val611Met missense ACACB 6 83204 7.21119E-5 41602 0 3.18451E-5
12-109623397-T-C p.Val611Ala missense ACACB 2 83212 2.4035E-5 41606 0 1.91131E-4
12-109623408-C-T p.Arg615Trp missense ACACB 9 83254 1.08103E-4 41627 0 6.37344E-5
12-109623436-G-A p.Gly624Glu missense ACACB 55 83278 6.60439E-4 41639 0 0.003125
12-109623437-A-G p.Gly624Gly synonymous ACACB 1 83268 1.20094E-5 41634 0 3.29935E-5
12-109623476-C-G p.Thr637Thr synonymous ACACB 8 83310 9.60269E-5 41655 0 2.55021E-4
12-109623495-G-A p.Ala644Thr missense ACACB 1 83270 1.20091E-5 41635 0 7.99226E-5
12-109623495-G-C p.Ala644Pro missense ACACB 2 83270 2.40183E-5 41635 0 NA
12-109623498-C-T p.Arg645* stop_gained ACACB 3 83282 3.60222E-5 41641 0 3.18959E-5
12-109623498-C-G p.Arg645Gly missense ACACB 1 83282 1.20074E-5 41641 0 NA
12-109623499-G-A p.Arg645Gln missense ACACB 3 83268 3.60282E-5 41634 0 4.95E-5
12-109623502-G-A p.Gly646Asp missense ACACB 2 83274 2.40171E-5 41637 0 8.25069E-6
12-109623506-C-T p.His647His synonymous ACACB 1 83264 1.201E-5 41632 0 4.12616E-5
12-109623507-G-A p.Val648Ile missense ACACB 4 83250 4.8048E-5 41625 0 8.25219E-6
12-109623515-C-T p.Ala650Ala synonymous ACACB 97 83256 0.00116508 41628 0 7.17607E-4
12-109623516-G-A p.Ala651Thr missense ACACB 14070 82936 0.169649 41468 1340 0.18897
12-109623542-C-T p.Asp659Asp synonymous ACACB 8 83160 9.62001E-5 41580 0 4.43649E-5
12-109625801-C-T c.1981-3C>T splice_region ACACB 1 83324 1.20013E-5 41662 0 4.06187E-6
12-109625814-C-T p.Pro664Leu missense ACACB 1 83362 1.19959E-5 41681 0 NA
12-109625821-C-T p.Ser666Ser synonymous ACACB 4 83394 4.79651E-5 41697 0 4.95197E-5
12-109625822-G-A p.Gly667Arg missense ACACB 4 83384 4.79708E-5 41692 0 6.25E-4
12-109625823-G-A p.Gly667Glu missense ACACB 1 83390 1.19918E-5 41695 0 NA
12-109625824-G-A p.Gly667Gly synonymous ACACB 1 83388 1.19921E-5 41694 0 NA
12-109625827-T-C p.Thr668Thr synonymous ACACB 2 83396 2.3982E-5 41698 0 1.19568E-5
12-109625828-G-A p.Val669Ile missense ACACB 2 83394 2.39825E-5 41697 0 8.24402E-6
12-109625830-C-G p.Val669Val synonymous ACACB 1 83396 1.1991E-5 41698 0 9.55597E-5
12-109625836-A-G p.Glu671Glu synonymous ACACB 2 83404 2.39797E-5 41702 0 8.24117E-6
12-109625846-C-T p.Arg675Trp missense ACACB 5 83398 5.99535E-5 41699 0 2.78591E-5
12-109625853-G-A p.Ser677Asn missense ACACB 7 83400 8.39329E-5 41700 0 3.18512E-5
12-109625860-C-T p.Asn679Asn synonymous ACACB 40 83402 4.79605E-4 41701 0 0.00100705
12-109625875-C-CA p.Ser685fs frameshift ACACB 4 83400 4.79616E-5 41700 0 3.97842E-5
12-109625878-C-T p.Ser685Ser synonymous ACACB 3 83404 3.59695E-5 41702 0 6.36527E-5
12-109625884-C-T p.Ala687Ala synonymous ACACB 3 83406 3.59686E-5 41703 0 1.91168E-4
12-109625886-C-T p.Ala688Val missense ACACB 1 83416 1.19881E-5 41708 0 NA
12-109625890-T-C p.Thr689Thr synonymous ACACB 2 83410 2.39779E-5 41705 0 1.27364E-4
12-109625893-A-AG p.Leu692fs frameshift ACACB 1 83404 1.19898E-5 41702 0 3.97826E-6
12-109625901-A-C p.His693Pro missense ACACB 1 83406 1.19895E-5 41703 0 NA
12-109625903-G-A p.Glu694Lys missense ACACB 2 83406 2.39791E-5 41703 0 1.6475E-5
12-109625909-G-A p.Ala696Thr missense ACACB 1 83400 1.19904E-5 41700 0 NA
12-109625910-C-T p.Ala696Val missense ACACB 4 83396 4.79639E-5 41698 0 0.00100705
12-109625911-G-A p.Ala696Ala synonymous ACACB 1 83398 1.19907E-5 41699 0 3.97994E-6
12-109625916-C-T p.Ser698Phe missense ACACB 7 83398 8.39349E-5 41699 0 6.37024E-5
12-109625920-A-G p.Gln699Gln synonymous ACACB 3 83400 3.59712E-5 41700 0 1.64785E-5
12-109625924-G-A p.Gly701Arg missense ACACB 2 83400 2.39808E-5 41700 0 2.79461E-5
12-109625945-G-C p.Glu708Gln missense ACACB 1 83384 1.19927E-5 41692 0 4.12167E-5
12-109625953-G-C p.Arg710Arg synonymous ACACB 1 83366 1.19953E-5 41683 0 NA
12-109625959-G-A p.Glu712Glu synonymous ACACB 1 83340 1.1999E-5 41670 0 NA
12-109625968-G-A c.2144+1G>A splice_donor ACACB 11 83262 1.32113E-4 41631 0 6.15223E-5
12-109625970-CA-TG c.2144+3_2144+4delCAinsTG splice_region ACACB 1 83228 1.20152E-5 41614 0 NA
12-109629432-C-G p.Ala720Gly missense ACACB 3 83404 3.59695E-5 41702 0 1.19347E-5
12-109629457-C-T p.Gly728Gly synonymous ACACB 42373 82996 0.510543 41498 11261 0.588125
12-109629458-G-A p.Asp729Asn missense ACACB 1 83410 1.1989E-5 41705 0 NA
12-109629466-G-A p.Arg731Arg synonymous ACACB 1 83414 1.19884E-5 41707 0 NA
12-109629472-C-T p.Thr733Thr synonymous ACACB 76 83406 9.11205E-4 41703 0 0.00162379
12-109629484-C-G p.Leu737Leu synonymous ACACB 1 83400 1.19904E-5 41700 0 NA
12-109629502-C-T p.Thr743Thr synonymous ACACB 4 83394 4.79651E-5 41697 0 1.19295E-5
12-109629503-G-A p.Glu744Lys missense ACACB 1 83390 1.19918E-5 41695 0 9.55536E-5
12-109629516-A-G p.Asn748Ser missense ACACB 1 83388 1.19921E-5 41694 0 NA
12-109629520-C-T p.Asn749Asn synonymous ACACB 4 83390 4.79674E-5 41695 0 4.94756E-5
12-109629521-G-A p.Asp750Asn missense ACACB 1 83386 1.19924E-5 41693 0 3.97693E-5
12-109629526-C-T p.Ile751Ile synonymous ACACB 1 83384 1.19927E-5 41692 0 3.18573E-5
12-109629527-G-A p.Asp752Asn missense ACACB 2 83378 2.39871E-5 41689 0 8.24878E-6
12-109629532-C-T p.Thr753Thr synonymous ACACB 7 83374 8.3959E-5 41687 0 2.10809E-4
12-109629537-G-T p.Trp755Leu missense ACACB 1 83376 1.19939E-5 41688 0 NA
12-109629538-G-T p.Trp755Cys missense ACACB 3 83376 3.59816E-5 41688 0 0.00100705
12-109629560-A-T p.Lys763* stop_gained ACACB 1 83358 1.19964E-5 41679 0 NA
12-109629566-CAGGTAGGGAGTGAGCTGCCTGTGTCTCCCCTCTGGATGGCCGAGACCTCGGCTTCCTGAGGATACTGAAGTGCATTTTCTCCT-C p.Gln765fs frameshift ACACB 11 83348 1.31977E-4 41674 5 NA
12-109629569-G-A c.2295+1G>A splice_donor ACACB 2 83340 2.39981E-5 41670 0 1.3138E-4
12-109629575-A-C c.2295+7A>C splice_region ACACB 1 83322 1.20016E-5 41661 0 NA
12-109629576-G-A c.2295+8G>A splice_region ACACB 6 83318 7.20133E-5 41659 0 6.25E-4
12-109629647-C-G c.2296-5C>G splice_region ACACB 3 83354 3.59911E-5 41677 0 1.8133E-4
12-109629647-C-T c.2296-5C>T splice_region ACACB 2 83354 2.3994E-5 41677 0 7.95418E-6
12-109629653-C-T p.Ala766Val missense+splice_region ACACB 2 83364 2.39912E-5 41682 0 3.29614E-5
12-109629654-G-A p.Ala766Ala splice_region+synonymous ACACB 21 83372 2.51883E-4 41686 0 0.00100705
12-109629662-C-T p.Pro769Leu missense ACACB 1 83382 1.1993E-5 41691 0 2.78374E-5
12-109629663-G-A p.Pro769Pro synonymous ACACB 3 83380 3.59799E-5 41690 0 6.25E-4
12-109629665-A-G p.Asp770Gly missense ACACB 1 83384 1.19927E-5 41692 0 3.18471E-5
12-109629676-G-A p.Gly774Arg missense ACACB 4 83384 4.79708E-5 41692 0 1.19295E-5
12-109629679-G-A p.Val775Met missense ACACB 1 83390 1.19918E-5 41695 0 NA
12-109629682-G-A p.Val776Ile missense ACACB 2 83384 2.39854E-5 41692 0 3.29538E-5
12-109629687-C-T p.Cys777Cys synonymous ACACB 3 83380 3.59799E-5 41690 0 2.47145E-5
12-109629688-G-A p.Gly778Arg missense ACACB 2 83382 2.3986E-5 41691 0 6.25E-4
12-109629688-G-C p.Gly778Arg missense ACACB 2 83382 2.3986E-5 41691 0 NA
12-109629699-C-T p.Asn781Asn synonymous ACACB 3 83392 3.59747E-5 41696 0 6.36902E-5
12-109629706-G-A p.Asp784Asn missense ACACB 6 83388 7.19528E-5 41694 0 9.55475E-5
12-109629708-T-C p.Asp784Asp synonymous ACACB 1 83390 1.19918E-5 41695 0 NA
12-109629709-G-C p.Ala785Pro missense ACACB 16 83392 1.91865E-4 41696 0 8.23791E-6
12-109629710-C-T p.Ala785Val missense ACACB 3 83392 3.59747E-5 41696 0 4.11909E-5
12-109629711-G-A p.Ala785Ala synonymous ACACB 1 83388 1.19921E-5 41694 0 3.18512E-5
12-109629717-C-T p.Phe787Phe synonymous ACACB 1 83394 1.19913E-5 41697 0 8.23913E-6
12-109629723-G-T n.358G>T splice_region ACACB 3 83390 3.59755E-5 41695 0 1.40074E-4
12-109629723-G-A n.358G>A splice_region ACACB 1 83390 1.19918E-5 41695 0 1.27389E-4
12-109629739-T-C p.Leu795Leu synonymous ACACB 6 83376 7.19632E-5 41688 0 3.1841E-5
12-109629743-A-C p.His796Pro missense ACACB 1 83374 1.19941E-5 41687 0 NA
12-109629758-A-G c.2399+3A>G splice_region ACACB 1 83332 1.20002E-5 41666 0 8.2672E-6
12-109631446-C-G c.2400-7C>G splice_region ACACB 1 83336 1.19996E-5 41668 0 NA
12-109631448-T-C c.2400-5T>C splice_region ACACB 1 83338 1.19993E-5 41669 0 2.47296E-5
12-109631451-A-C c.2400-2A>C splice_acceptor ACACB 1 83342 1.19988E-5 41671 0 NA
12-109631463-C-A p.Leu804Ile missense ACACB 1 83376 1.19939E-5 41688 0 NA
12-109631477-A-C p.Ser808Ser synonymous ACACB 2 83376 2.39877E-5 41688 0 5.03525E-4
12-109631489-C-T p.Leu812Leu synonymous ACACB 2 83384 2.39854E-5 41692 0 1.5906E-5
12-109631490-G-A p.Val813Ile missense ACACB 2 83380 2.39866E-5 41690 0 9.55718E-5
12-109631491-T-C p.Val813Ala missense ACACB 1 83382 1.1993E-5 41691 0 3.18512E-5
12-109631492-A-G p.Val813Val synonymous ACACB 1 83382 1.1993E-5 41691 0 NA
12-109631511-G-A p.Gly820Arg missense ACACB 1 83368 1.1995E-5 41684 0 1.64823E-5
12-109631526-A-G p.Ile825Val missense ACACB 1 83332 1.20002E-5 41666 0 7.95355E-6
12-109631536-T-TGGCCCGGCAGTCTCTGACCATGTTCGTTCTC c.2481+2_2481+3insGGCCCGGCAGTCTCTGACCATGTTCGTTCTC splice_region ACACB 1 83294 1.20057E-5 41647 0 NA
12-109634806-C-T c.2482-7C>T splice_region ACACB 1 82820 1.20744E-5 41410 0 NA
12-109634819-C-T p.Arg830Trp missense ACACB 2 82932 2.41161E-5 41466 0 3.18492E-5
12-109634820-G-A p.Arg830Gln missense ACACB 4 82954 4.82195E-5 41477 0 9.55779E-5
12-109634830-G-A p.Leu833Leu synonymous ACACB 1 83072 1.20378E-5 41536 0 NA
12-109634834-A-G p.Met835Val missense ACACB 1961 83018 0.0236214 41509 33 0.0362538
12-109634839-C-T p.Phe836Phe synonymous ACACB 1 83102 1.20334E-5 41551 0 4.97694E-5
12-109634839-C-G p.Phe836Leu missense ACACB 1 83102 1.20334E-5 41551 0 NA
12-109634849-A-G p.Met840Val missense ACACB 1 83144 1.20273E-5 41572 0 NA
12-109634854-T-C p.Asn841Asn synonymous ACACB 28 83150 3.36741E-4 41575 0 0.00100705
12-109634865-T-G p.Ile845Ser missense ACACB 3 83194 3.60603E-5 41597 0 4.76178E-5
12-109634867-G-A p.Glu846Lys missense ACACB 3 83208 3.60542E-5 41604 0 1.71692E-5
12-109634871-T-C p.Ile847Thr missense ACACB 2 83238 2.40275E-5 41619 0 4.30437E-6
12-109634881-C-T p.His850His synonymous ACACB 20 83248 2.40246E-4 41624 0 2.4757E-4
12-109634882-C-T p.Arg851Trp missense ACACB 2 83246 2.40252E-5 41623 0 9.5584E-5
12-109634883-G-A p.Arg851Gln missense ACACB 1 83250 1.2012E-5 41625 0 6.25E-4
12-109634892-A-T p.Asp854Val missense ACACB 2 83256 2.40223E-5 41628 0 NA
12-109634899-G-T p.Gly856Gly synonymous ACACB 4 83236 4.80561E-5 41618 0 NA
12-109634902-C-T p.Leu857Leu synonymous ACACB 1 83238 1.20137E-5 41619 0 NA
12-109634903-C-T p.Leu858Leu synonymous ACACB 1 83236 1.2014E-5 41618 0 NA
12-109634912-T-A p.Tyr861Asn missense ACACB 1 83246 1.20126E-5 41623 0 1.25283E-5
12-109634913-A-G p.Tyr861Cys missense ACACB 1 83242 1.20132E-5 41621 0 4.16181E-6
12-109634919-G-A p.Gly863Glu missense ACACB 1 83236 1.2014E-5 41618 0 NA
12-109634932-C-T p.Thr867Thr synonymous ACACB 1 83164 1.20244E-5 41582 0 NA
12-109634935-CT-C p.Tyr869fs frameshift ACACB 1 83158 1.20253E-5 41579 0 NA
12-109634938-C-A p.Tyr869* stop_gained ACACB 1 83136 1.20285E-5 41568 0 NA
12-109634945-G-A p.Glu872Lys missense ACACB 1 83084 1.2036E-5 41542 0 NA
12-109634963-G-A c.2627+5G>A splice_region ACACB 1 82816 1.2075E-5 41408 0 1.2514E-5
12-109637205-A-T c.2628-2A>T splice_acceptor ACACB 2 81506 2.45381E-5 40753 0 NA
12-109637222-C-T p.Ile881Ile synonymous ACACB 6 81838 7.33156E-5 40919 0 1.59286E-4
12-109637223-G-A p.Gly882Ser missense ACACB 1 81812 1.22231E-5 40906 0 2.18195E-5
12-109637227-A-G p.Asn883Ser missense ACACB 4 81992 4.87852E-5 40996 0 4.41852E-5
12-109637233-C-T p.Thr885Met missense ACACB 1 82218 1.21628E-5 41109 0 1.48179E-5
12-109637234-G-A p.Thr885Thr synonymous ACACB 323 82224 0.00392829 41112 3 0.00755306
12-109637234-G-T p.Thr885Thr synonymous ACACB 246 82216 0.00299212 41108 2 0.00576837
12-109637234-G-C p.Thr885Thr synonymous ACACB 1 82224 1.21619E-5 41112 0 2.95759E-5
12-109637235-T-C p.Cys886Arg missense ACACB 1 82286 1.21527E-5 41143 0 9.80469E-6
12-109637244-G-T p.Glu889* stop_gained ACACB 1 82416 1.21336E-5 41208 0 NA
12-109637247-A-C p.Lys890Gln missense ACACB 1 82360 1.21418E-5 41180 0 NA
12-109637256-G-A p.Asp893Asn missense ACACB 1 82256 1.21572E-5 41128 0 9.63373E-6
12-109637271-A-C p.Arg898Arg synonymous ACACB 1 82806 1.20764E-5 41403 0 NA
12-109637303-C-G p.Tyr908* stop_gained ACACB 1 82830 1.20729E-5 41415 0 NA
12-109637324-C-T p.His915His synonymous ACACB 2 81816 2.44451E-5 40908 0 1.02533E-5
12-109637331-G-T p.Ala918Ser missense ACACB 1 81536 1.22645E-5 40768 0 8.69308E-6
12-109637341-G-A p.Ser921Asn missense ACACB 10 81346 1.22932E-4 40673 0 5.71109E-6
12-109637345-C-T p.Tyr922Tyr synonymous ACACB 1 81394 1.22859E-5 40697 0 6.25E-4
12-109637346-G-A p.Ala923Thr missense ACACB 1 81362 1.22908E-5 40681 0 NA
12-109637355-G-A p.Glu926Lys missense+splice_region ACACB 5 80994 6.1733E-5 40497 0 6.37024E-5
12-109637356-A-T p.Glu926Val missense+splice_region ACACB 1 80974 1.23496E-5 40487 0 NA
12-109637360-G-A c.2778+3G>A splice_region ACACB 43 80684 5.32943E-4 40342 0 3.89146E-4
12-109639365-G-A c.2779-7G>A splice_region ACACB 29 83342 3.47964E-4 41671 0 3.18573E-4
12-109639380-G-A p.Lys929Lys synonymous ACACB 4 83380 4.79731E-5 41690 0 8.24348E-6
12-109639391-C-A p.Thr933Asn missense ACACB 11 83382 1.31923E-4 41691 0 1.15359E-4
12-109639398-C-T p.Asn935Asn synonymous ACACB 2 83382 2.3986E-5 41691 0 2.78408E-5
12-109639399-G-A p.Val936Ile missense ACACB 3 83380 3.59799E-5 41690 0 5.03525E-4
12-109639406-A-G p.Glu938Gly missense ACACB 1 83374 1.19941E-5 41687 0 3.977E-6
12-109639410-A-T p.Arg939Ser missense ACACB 28 83378 3.3582E-4 41689 0 0.00100705
12-109639415-G-A p.Arg941Gln missense ACACB 1 83374 1.19941E-5 41687 0 1.64742E-5
12-109639430-A-G p.Lys946Arg missense ACACB 3 83350 3.59928E-5 41675 0 6.37267E-5
12-109639432-C-T p.Arg947Cys missense ACACB 2 83350 2.39952E-5 41675 0 3.29489E-5
12-109639436-C-T p.Pro948Leu missense ACACB 4 83348 4.79916E-5 41674 0 NA
12-109639438-G-C p.Gly949Arg missense ACACB 1 83350 1.19976E-5 41675 0 1.64742E-5
12-109639444-G-A p.Val951Met missense ACACB 1 83336 1.19996E-5 41668 0 NA
12-109639446-G-A p.Val951Val synonymous ACACB 4 83330 4.80019E-5 41665 0 0.0015121
12-109639454-C-T p.Ala954Val missense ACACB 2 83318 2.40044E-5 41659 0 8.23832E-6
12-109639462-G-A p.Val957Met missense ACACB 14 83304 1.68059E-4 41652 0 5.03525E-4
12-109639465-G-A p.Val958Met missense ACACB 98 83296 0.00117653 41648 0 0.00171975
12-109639472-G-A p.Arg960Lys missense ACACB 2 83290 2.40125E-5 41645 0 9.55657E-5
12-109639479-G-A p.Glu962Glu synonymous ACACB 1 83286 1.20068E-5 41643 0 3.97807E-6
12-109639482-C-T p.Leu963Leu synonymous ACACB 2 83262 2.40206E-5 41631 0 8.24171E-6
12-109639483-G-A p.Asp964Asn missense ACACB 5 83260 6.00528E-5 41630 0 1.31876E-4
12-109639487-A-G p.Asp965Gly missense ACACB 2 83256 2.40223E-5 41628 0 3.18939E-5
12-109639488-C-A p.Asp965Glu missense ACACB 7 83264 8.40699E-5 41632 0 5.04032E-4
12-109639488-C-T p.Asp965Asp synonymous ACACB 2 83264 2.402E-5 41632 0 6.36902E-5
12-109639503-C-A p.His970Gln missense ACACB 9 83210 1.0816E-4 41605 0 6.25E-4
12-109639503-C-G p.His970Gln missense ACACB 1 83210 1.20178E-5 41605 0 NA
12-109639505-C-T p.Pro971Leu missense+splice_region ACACB 17 83196 2.04337E-4 41598 0 0.00100908
12-109639506-G-A p.Pro971Pro splice_region+synonymous ACACB 1 83194 1.20201E-5 41597 0 8.26651E-6
12-109639507-G-GCTGAACCGTTCACAGGAGAACTCCCTGCCCAGCAGACACTGCCCATCC c.2913+1_2913+2insCTGAACCGTTCACAGGAGAACTCCCTGCCCAGCAGACACTGCCCATCC splice_donor ACACB 1 83180 1.20221E-5 41590 0 NA
12-109644515-G-C p.Ala972Pro missense+splice_region ACACB 2 83044 2.40836E-5 41522 0 NA
12-109644523-G-A p.Pro974Pro synonymous ACACB 61 83142 7.33685E-4 41571 0 5.45091E-4
12-109644539-C-G p.Pro980Ala missense ACACB 1 83254 1.20114E-5 41627 0 NA
12-109644544-C-G p.Ala981Ala synonymous ACACB 1 83260 1.20106E-5 41630 0 NA
12-109644565-C-T p.Leu988Leu synonymous ACACB 1 83338 1.19993E-5 41669 0 NA
12-109644566-G-A p.Gly989Arg missense ACACB 1 83340 1.1999E-5 41670 0 1.64731E-5
12-109644569-G-A p.Glu990Lys missense ACACB 2 83364 2.39912E-5 41682 0 3.18613E-5
12-109644584-G-A p.Val995Ile missense ACACB 2 83376 2.39877E-5 41688 0 NA
12-109644589-C-T p.Phe996Phe synonymous ACACB 1 83378 1.19936E-5 41689 0 NA
12-109644593-A-G p.Ser998Gly missense ACACB 1 83378 1.19936E-5 41689 0 NA
12-109644595-C-T p.Ser998Ser synonymous ACACB 5 83378 5.99679E-5 41689 0 5.03525E-4
12-109644596-G-A p.Val999Ile missense ACACB 5 83380 5.99664E-5 41690 0 1.78935E-4
12-109644607-C-A p.Asn1002Lys missense ACACB 3 83386 3.59773E-5 41693 0 NA
12-109644612-C-T p.Thr1004Ile missense ACACB 3 83394 3.59738E-5 41697 0 2.38578E-5
12-109644613-C-T p.Thr1004Thr synonymous ACACB 1 83394 1.19913E-5 41697 0 7.95267E-5
12-109644616-C-T p.Asn1005Asn synonymous ACACB 4389 83346 0.05266 41673 349 0.0845825
12-109644617-G-A p.Val1006Ile missense ACACB 6 83382 7.1958E-5 41691 0 5.16919E-5
12-109644629-T-A p.Phe1010Ile missense ACACB 1 83380 1.19933E-5 41690 0 NA
12-109644634-T-G p.Cys1011Trp missense ACACB 5 83372 5.99722E-5 41686 0 1.19291E-5
12-109644641-G-C p.Glu1014Gln missense ACACB 1 83366 1.19953E-5 41683 0 NA
12-109644646-C-T p.Pro1015Pro synonymous ACACB 1 83366 1.19953E-5 41683 0 NA
12-109644647-G-A p.Val1016Ile missense ACACB 5 83358 5.99822E-5 41679 0 3.18512E-5
12-109644653-A-G p.Ser1018Gly missense ACACB 2 83340 2.39981E-5 41670 0 NA
12-109644656-A-G p.Ile1019Val missense ACACB 1 83332 1.20002E-5 41666 0 NA
12-109644667-G-A c.3060+6G>A splice_region ACACB 2 83298 2.40102E-5 41649 0 2.7837E-5
12-109646963-G-A c.3061-7G>A splice_region ACACB 15 80968 1.85258E-4 40484 0 6.25E-4
12-109646990-G-A p.Lys1027Lys synonymous ACACB 2 81448 2.45555E-5 40724 0 4.27234E-6
12-109646991-C-G p.Leu1028Val missense ACACB 2 81480 2.45459E-5 40740 0 NA
12-109646995-T-C p.Met1029Thr missense ACACB 1 81502 1.22696E-5 40751 0 NA
12-109646999-G-T p.Met1030Ile missense ACACB 1 81490 1.22714E-5 40745 0 NA
12-109647005-C-A p.Leu1032Leu synonymous ACACB 3 81462 3.6827E-5 40731 0 NA
12-109647006-C-T p.Arg1033Trp missense ACACB 6 81452 7.3663E-5 40726 0 0.00302115
12-109647007-G-A p.Arg1033Gln missense ACACB 1 81482 1.22726E-5 40741 0 3.18837E-5
12-109647008-G-A p.Arg1033Arg synonymous ACACB 2 81456 2.45531E-5 40728 0 3.18898E-5
12-109647013-C-T p.Pro1035Leu missense ACACB 2 81574 2.45176E-5 40787 0 4.0546E-5
12-109647014-G-A p.Pro1035Pro synonymous ACACB 1 81558 1.22612E-5 40779 0 1.86106E-4
12-109647014-G-T p.Pro1035Pro synonymous ACACB 1 81558 1.22612E-5 40779 0 NA
12-109647017-A-G p.Ser1036Ser synonymous ACACB 10 81546 1.2263E-4 40773 0 0.00125
12-109647022-C-T p.Pro1038Leu missense ACACB 3 81648 3.67431E-5 40824 0 5.03525E-4
12-109647023-G-A p.Pro1038Pro synonymous ACACB 1 81606 1.2254E-5 40803 0 1.23635E-5
12-109647035-G-A p.Leu1042Leu synonymous ACACB 1 81686 1.2242E-5 40843 0 NA
12-109647036-C-T p.Gln1043* stop_gained ACACB 1 81686 1.2242E-5 40843 0 NA
12-109647053-C-A p.Ser1048Arg missense ACACB 1 81482 1.22726E-5 40741 0 NA
12-109647054-G-T p.Val1049Leu missense ACACB 2 81532 2.45302E-5 40766 0 3.18573E-5
12-109647058-C-A p.Ala1050Glu missense ACACB 2 81492 2.45423E-5 40746 0 3.18552E-5
12-109647063-C-T p.Arg1052Cys missense ACACB 1 81510 1.22684E-5 40755 0 1.2202E-5
12-109647064-G-A p.Arg1052His missense ACACB 1 81458 1.22763E-5 40729 0 0.00151362
12-109647071-C-T p.Pro1054Pro synonymous ACACB 10 81762 1.22306E-4 40881 0 7.65565E-5
12-109647072-G-A p.Ala1055Thr missense ACACB 2 81666 2.449E-5 40833 0 6.67837E-5
12-109647093-C-T p.Arg1062Cys missense ACACB 3 81784 3.6682E-5 40892 0 6.3743E-5
12-109647094-G-A p.Arg1062His missense ACACB 1 81726 1.2236E-5 40863 0 3.18654E-5
12-109647095-C-T p.Arg1062Arg synonymous ACACB 6 81750 7.33945E-5 40875 0 3.21141E-5
12-109647110-G-A p.Gln1067Gln synonymous ACACB 3 81616 3.67575E-5 40808 0 NA
12-109647123-A-G p.Ile1072Val missense ACACB 2 81460 2.45519E-5 40730 0 2.81104E-5
12-109647139-G-C p.Cys1077Ser missense ACACB 1 80962 1.23515E-5 40481 0 NA
12-109647146-C-T p.Phe1079Phe synonymous ACACB 1 80926 1.2357E-5 40463 0 NA
12-109647157-A-AG p.Pro1080fs frameshift ACACB 1 80518 1.24196E-5 40259 0 NA
12-109647161-G-A c.3249+3G>A splice_region ACACB 1 80238 1.24629E-5 40119 0 4.09839E-6
12-109647162-C-T c.3249+4C>T splice_region ACACB 26 80148 3.244E-4 40074 0 1.51423E-4
12-109647163-G-C c.3249+5G>C splice_region ACACB 1 80106 1.24835E-5 40053 0 NA
12-109650653-C-T p.Leu1088Leu synonymous ACACB 5 83220 6.00817E-5 41610 0 5.96735E-5
12-109650654-T-C p.Leu1088Pro missense ACACB 1 83228 1.20152E-5 41614 0 NA
12-109650663-A-G p.His1091Arg missense ACACB 35 83254 4.204E-4 41627 0 9.14775E-5
12-109650672-C-G p.Thr1094Ser missense ACACB 1 83284 1.20071E-5 41642 0 NA
12-109650680-C-T p.Arg1097Trp missense ACACB 6 83294 7.2034E-5 41647 0 5.03525E-4
12-109650681-G-A p.Arg1097Gln missense ACACB 4 83300 4.80192E-5 41650 0 5.96502E-5
12-109650685-G-A p.Lys1098Lys synonymous ACACB 1 83310 1.20034E-5 41655 0 NA
12-109650687-C-T p.Ala1099Val missense ACACB 2 83312 2.40061E-5 41656 0 NA
12-109650692-C-T p.Arg1101* stop_gained ACACB 1 83322 1.20016E-5 41661 0 3.18492E-5
12-109650694-A-G p.Arg1101Arg synonymous ACACB 1 83324 1.20013E-5 41662 0 7.95317E-6
12-109650704-T-A p.Phe1105Ile missense ACACB 2 83312 2.40061E-5 41656 0 NA
12-109650724-C-T p.Ile1111Ile synonymous ACACB 1 83264 1.201E-5 41632 0 3.18431E-5
12-109650725-G-A p.Val1112Met missense ACACB 12 83268 1.44113E-4 41634 0 5.96521E-5
12-109650731-T-C p.Leu1114Leu synonymous ACACB 1 83242 1.20132E-5 41621 0 3.97684E-6
12-109650741-G-GATACC c.3350_3350+1insATACC splice_donor ACACB 1 83204 1.20187E-5 41602 0 NA
12-109654417-C-T c.3351-6C>T splice_region ACACB 1 83296 1.20054E-5 41648 0 NA
12-109654427-C-T p.Arg1119Cys missense ACACB 2 83320 2.40038E-5 41660 0 1.98831E-5
12-109654428-G-A p.Arg1119His missense ACACB 3 83318 3.60066E-5 41659 0 9.56145E-5
12-109654432-C-T p.Ser1120Ser synonymous ACACB 2 83332 2.40004E-5 41666 0 5.76587E-5
12-109654436-A-G p.Ile1122Val missense ACACB 4 83338 4.79973E-5 41669 0 9.55901E-5
12-109654440-G-A p.Arg1123His missense ACACB 3 83338 3.5998E-5 41669 0 2.7835E-5
12-109654441-C-T p.Arg1123Arg synonymous ACACB 1 83352 1.19973E-5 41676 0 3.29478E-5
12-109654443-G-A p.Gly1124Asp missense ACACB 1 83362 1.19959E-5 41681 0 3.18512E-5
12-109654457-G-A p.Val1129Met missense ACACB 1 83382 1.1993E-5 41691 0 NA
12-109654474-G-A p.Leu1134Leu synonymous ACACB 1 83382 1.1993E-5 41691 0 8.23642E-6
12-109654509-AAGGCAAGAGATGCTGATGCCAACACCAGTGGGATGGTGGGGGGCGTGAGGAGCCTGAGCTTTACCTCTGTGTGGTGTTTTGTCTCCCCC-A p.Gln1146fs frameshift ACACB 2 83366 2.39906E-5 41683 0 NA
12-109654513-C-T c.3439+2C>T splice_donor ACACB 1 83364 1.19956E-5 41682 0 NA
12-109654514-A-G c.3439+3A>G splice_region ACACB 1 83368 1.1995E-5 41684 0 NA
12-109654516-G-C c.3439+5G>C splice_region ACACB 1 83372 1.19944E-5 41686 0 NA
12-109654597-C-T c.3440-4C>T splice_region ACACB 2 83348 2.39958E-5 41674 0 3.97766E-6
12-109654598-C-T c.3440-3C>T splice_region ACACB 11 83342 1.31986E-4 41671 0 8.75058E-5
12-109654606-T-G p.Tyr1149Asp missense ACACB 1 83346 1.19982E-5 41673 0 3.97722E-6
12-109654608-C-T p.Tyr1149Tyr synonymous ACACB 2 83340 2.39981E-5 41670 0 9.55962E-5
12-109654609-G-A p.Asp1150Asn missense ACACB 3 83328 3.60023E-5 41664 0 3.18471E-5
12-109654609-G-T p.Asp1150Tyr missense ACACB 2 83328 2.40015E-5 41664 0 3.97735E-6
12-109654623-A-G p.Ile1154Met missense ACACB 3 83328 3.60023E-5 41664 0 3.57935E-5
12-109654632-G-A p.Arg1157Arg synonymous ACACB 3 83308 3.60109E-5 41654 0 NA
12-109654643-A-C p.Lys1161Thr missense ACACB 1 83272 1.20088E-5 41636 0 3.97678E-6
12-109654645-C-T p.Pro1162Ser missense ACACB 1 83252 1.20117E-5 41626 0 7.95368E-6
12-109654649-A-C p.Asp1163Ala missense ACACB 2 83232 2.40292E-5 41616 0 4.94299E-5
12-109654659-G-C p.Gln1166His missense ACACB 3 83194 3.60603E-5 41597 0 NA
12-109654668-C-G p.Asp1169Glu missense ACACB 1 83142 1.20276E-5 41571 0 8.24389E-6
12-109654675-T-G p.Phe1172Val missense ACACB 1 83066 1.20386E-5 41533 0 1.31996E-4
12-109654681-C-T p.His1174Tyr missense ACACB 1 82956 1.20546E-5 41478 0 NA
12-109654683-C-T p.His1174His synonymous ACACB 3 82930 3.61751E-5 41465 0 5.03525E-4
12-109654684-G-T p.Ala1175Ser missense ACACB 1 82908 1.20616E-5 41454 0 NA
12-109654684-G-A p.Ala1175Thr missense ACACB 1 82908 1.20616E-5 41454 0 3.1841E-5
12-109654685-C-T p.Ala1175Val missense ACACB 3 82876 3.61987E-5 41438 0 NA
12-109654690-G-T p.Val1177Leu missense ACACB 6 82786 7.2476E-5 41393 0 2.22831E-4
12-109654699-A-C p.Lys1180Gln missense ACACB 2 82568 2.42225E-5 41284 0 1.59226E-4
12-109654718-T-A p.Met1186Lys missense ACACB 1 82112 1.21785E-5 41056 0 NA
12-109654723-A-T p.Ile1188Phe missense+splice_region ACACB 2 81978 2.43968E-5 40989 0 NA
12-109654724-T-C p.Ile1188Thr missense+splice_region ACACB 2 81936 2.44093E-5 40968 0 NA
12-109654726-G-A c.3564+1G>A splice_donor ACACB 2 81806 2.44481E-5 40903 0 3.1837E-5
12-109660304-C-T c.3565-8C>T splice_region ACACB 1 83122 1.20305E-5 41561 0 7.96952E-6
12-109660307-C-T c.3565-5C>T splice_region ACACB 1 83164 1.20244E-5 41582 0 3.98159E-6
12-109660321-T-C p.Cys1192Arg missense ACACB 2 83222 2.40321E-5 41611 0 3.29669E-5
12-109660325-G-GC p.Asp1195fs frameshift ACACB 12 83214 1.44206E-4 41607 0 1.31242E-4
12-109660330-G-A p.Asp1195Asn missense ACACB 3 83250 3.6036E-5 41625 0 8.24022E-6
12-109660341-G-A p.Leu1198Leu synonymous ACACB 3 83264 3.603E-5 41632 0 NA
12-109660343-C-T p.Ser1199Leu missense ACACB 1 83264 1.201E-5 41632 0 3.18878E-5
12-109660344-G-A p.Ser1199Ser synonymous ACACB 33 83276 3.96273E-4 41638 0 0.00151057
12-109660347-C-T p.Asp1200Asp synonymous ACACB 5 83272 6.00442E-5 41636 0 1.2747E-4
12-109660348-G-A p.Glu1201Lys missense ACACB 16 83284 1.92114E-4 41642 0 1.11348E-4
12-109660354-A-T p.Ile1203Phe missense ACACB 1 83284 1.20071E-5 41642 0 NA
12-109660355-T-C p.Ile1203Thr missense ACACB 1 83280 1.20077E-5 41640 0 3.18837E-5
12-109660363-C-G p.Leu1206Val missense ACACB 1 83288 1.20065E-5 41644 0 3.18715E-5
12-109660365-C-T p.Leu1206Leu synonymous ACACB 1 83286 1.20068E-5 41643 0 NA
12-109660369-G-A p.Glu1208Lys missense ACACB 12 83276 1.44099E-4 41638 0 0.0015121
12-109660371-G-A p.Glu1208Glu synonymous ACACB 3 83276 3.60248E-5 41638 0 8.24049E-6
12-109660375-A-T p.Thr1210Ser missense ACACB 1 83274 1.20085E-5 41637 0 3.97652E-6
12-109660392-C-T p.Ser1215Ser synonymous ACACB 2 83262 2.40206E-5 41631 0 1.64848E-5
12-109660393-G-A p.Glu1216Lys missense ACACB 4 83256 4.80446E-5 41628 0 5.03525E-4
12-109660399-T-A p.Cys1218Ser missense ACACB 1 83256 1.20111E-5 41628 0 NA
12-109660406-T-C p.Val1220Ala missense ACACB 3 83212 3.60525E-5 41606 0 3.57938E-5
12-109660414-A-C p.Arg1223Arg synonymous ACACB 2 83198 2.4039E-5 41599 0 3.18817E-5
12-109660415-G-C p.Arg1223Thr missense ACACB 2 83198 2.4039E-5 41599 1 8.25655E-6
12-109660598-C-T c.3679-6C>T splice_region ACACB 3030 82318 0.0368085 41159 59 0.035
12-109660607-C-A p.Leu1228Met missense ACACB 4 82412 4.85366E-5 41206 0 3.18878E-5
12-109660609-G-C p.Leu1228Leu synonymous ACACB 2 82422 2.42654E-5 41211 0 NA
12-109660615-C-T p.Ala1230Ala synonymous ACACB 4 82432 4.85248E-5 41216 0 NA
12-109660621-C-T p.His1232His synonymous ACACB 1 82416 1.21336E-5 41208 0 3.18776E-5
12-109660624-C-T p.Leu1233Leu synonymous ACACB 2 82452 2.42565E-5 41226 0 6.37592E-5
12-109660628-T-G p.Ser1235Ala missense ACACB 1 82426 1.21321E-5 41213 0 8.46124E-6
12-109660640-C-T p.Arg1239Trp missense ACACB 4 82426 4.85284E-5 41213 0 6.77642E-5
12-109660643-C-A p.His1240Asn missense ACACB 8 82416 9.70685E-5 41208 0 1.27624E-4
12-109660651-G-C p.Gln1242His missense ACACB 3 82400 3.64078E-5 41200 0 NA
12-109660653-T-G p.Val1243Gly missense ACACB 2 82360 2.42836E-5 41180 0 8.54613E-6
12-109660654-G-A p.Val1243Val synonymous ACACB 19 82378 2.30644E-4 41189 0 3.02854E-4
12-109660663-T-G p.Ile1246Met missense ACACB 14 82352 1.70002E-4 41176 0 3.98613E-6
12-109660685-T-A p.Tyr1254Asn missense ACACB 2 82192 2.43333E-5 41096 0 8.01032E-6
12-109660687-C-G p.Tyr1254* stop_gained ACACB 2 82166 2.4341E-5 41083 0 8.02942E-6
12-109660687-C-T p.Tyr1254Tyr synonymous ACACB 1 82166 1.21705E-5 41083 0 1.92097E-5
12-109660688-G-T p.Gly1255Cys missense ACACB 1 82118 1.21776E-5 41059 0 3.18857E-5
12-109660688-G-A p.Gly1255Ser missense ACACB 2 82118 2.43552E-5 41059 0 4.82821E-5
12-109660689-G-A p.Gly1255Asp missense ACACB 1 82090 1.21818E-5 41045 0 NA
12-109660692-A-G p.His1256Arg missense ACACB 1 82060 1.21862E-5 41030 0 NA
12-109660694-C-G p.Gln1257Glu missense ACACB 94 82056 0.00114556 41028 0 0.00283638
12-109660696-G-T p.Gln1257His missense ACACB 1 82010 1.21936E-5 41005 0 NA
12-109660701-G-A p.Cys1259Tyr missense ACACB 1 81910 1.22085E-5 40955 0 NA
12-109660702-C-A p.Cys1259* stop_gained ACACB 1 81872 1.22142E-5 40936 0 5.60299E-5
12-109660714-C-T p.Leu1263Leu synonymous ACACB 3 81620 3.67557E-5 40810 0 NA
12-109660722-G-A c.3792+5G>A splice_region ACACB 1 81238 1.23095E-5 40619 0 NA
12-109660725-C-G c.3792+8C>G splice_region ACACB 2 81154 2.46445E-5 40577 0 7.49985E-5
12-109661612-T-C c.3793-8T>C splice_region ACACB 2 83358 2.39929E-5 41679 0 NA
12-109661633-C-T p.Ser1269Leu missense ACACB 4 83404 4.79593E-5 41702 0 3.29462E-5
12-109661634-G-A p.Ser1269Ser synonymous ACACB 36 83404 4.31634E-4 41702 0 0.0015121
12-109661640-A-G p.Thr1271Thr synonymous ACACB 8 83410 9.59118E-5 41705 0 4.374E-5
12-109661649-C-T p.Phe1274Phe synonymous ACACB 8 83416 9.59049E-5 41708 0 4.11821E-5
12-109661659-CCTA-C p.Thr1279del conservative_inframe_deletion ACACB 1 83406 1.19895E-5 41703 0 NA
12-109661662-A-G p.Thr1279Ala missense ACACB 7 83406 8.39268E-5 41703 0 1.64728E-5
12-109661671-T-C p.Tyr1282His missense ACACB 1 83404 1.19898E-5 41702 0 3.97627E-6
12-109661672-A-G p.Tyr1282Cys missense ACACB 73 83404 8.75258E-4 41702 0 8.27973E-4
12-109661676-C-T p.His1283His synonymous ACACB 2 83404 2.39797E-5 41702 0 6.58913E-5
12-109661677-GCAAA-G p.Asn1285fs frameshift ACACB 8 83406 9.59164E-5 41703 0 3.18552E-5
12-109661677-G-T p.Ala1284Ser missense ACACB 5 83406 5.99477E-5 41703 0 5.76549E-5
12-109661688-C-T p.Val1287Val synonymous ACACB 2 83394 2.39825E-5 41697 0 5.76559E-5
12-109661689-G-A p.Val1288Met missense ACACB 1 83392 1.19916E-5 41696 0 3.29462E-5
12-109661695-A-G p.Met1290Val missense ACACB 1 83386 1.19924E-5 41693 0 4.11828E-5
12-109661700-G-T p.Ala1291Ala synonymous ACACB 1 83382 1.1993E-5 41691 0 3.29473E-5
12-109665173-C-T c.3883-3C>T splice_region ACACB 1 82786 1.20793E-5 41393 0 1.22838E-5
12-109665181-C-T p.Tyr1296Tyr synonymous ACACB 11 82832 1.32799E-4 41416 0 1.63178E-4
12-109665186-G-A p.Arg1298Gln missense ACACB 4 82846 4.82824E-5 41423 0 5.54533E-5
12-109665192-G-A p.Gly1300Asp missense ACACB 3 82858 3.62065E-5 41429 0 3.18471E-5
12-109665194-T-C p.Tyr1301His missense ACACB 5 82882 6.03267E-5 41441 1 NA
12-109665199-C-T p.Ile1302Ile synonymous ACACB 1 82894 1.20636E-5 41447 0 3.18552E-5
12-109665200-G-A p.Ala1303Thr missense ACACB 2 82882 2.41307E-5 41441 0 0.00100806
12-109665203-TA-T p.Tyr1304fs frameshift ACACB 1 82908 1.20616E-5 41454 0 NA
12-109665205-T-C p.Tyr1304Tyr synonymous ACACB 1 82918 1.20601E-5 41459 0 4.84393E-5
12-109665211-A-C p.Leu1306Phe missense ACACB 1 82938 1.20572E-5 41469 0 NA
12-109665227-C-T p.Arg1312Trp missense ACACB 4 83008 4.81881E-5 41504 0 9.56084E-5
12-109665228-G-A p.Arg1312Gln missense ACACB 7 83002 8.43353E-5 41501 0 6.38896E-5
12-109665237-C-T p.Pro1315Leu missense ACACB 1 82886 1.20648E-5 41443 0 3.18695E-5
12-109665241-C-T p.Asp1316Asp synonymous ACACB 63 82810 7.60778E-4 41405 0 5.22207E-4
12-109665242-G-A p.Gly1317Ser missense ACACB 5146 82756 0.0621828 41378 181 0.0663031
12-109665244-C-T p.Gly1317Gly synonymous ACACB 3 82818 3.6224E-5 41409 0 6.12391E-5
12-109665250-C-T p.Cys1319Cys synonymous ACACB 24 82890 2.8954E-4 41445 1 0.0015121
12-109665257-G-T p.Glu1322* stop_gained ACACB 1 82930 1.20584E-5 41465 0 NA
12-109665265-G-A p.Gln1324Gln synonymous ACACB 1 82922 1.20595E-5 41461 0 NA
12-109665276-C-T p.Pro1328Leu missense ACACB 1 82872 1.20668E-5 41436 0 1.59527E-5
12-109665292-C-T p.Asn1333Asn splice_region+synonymous ACACB 7 82754 8.45881E-5 41377 0 3.18512E-5
12-109665293-C-T p.Arg1334Trp missense+splice_region ACACB 13 82736 1.57126E-4 41368 0 6.25E-4
12-109665294-G-A p.Arg1334Gln missense+splice_region ACACB 1 82680 1.20948E-5 41340 0 8.40661E-6
12-109670468-T-C c.4002-6T>C splice_region ACACB 71977 79676 0.903371 39838 32584 0.915886
12-109670470-A-G c.4002-4A>G splice_region ACACB 2 82332 2.42919E-5 41166 0 1.64995E-5
12-109670481-G-A p.Val1337Met missense ACACB 1 82542 1.2115E-5 41271 0 9.55414E-5
12-109670484-C-G p.Pro1338Ala missense ACACB 1 82604 1.2106E-5 41302 0 NA
12-109670517-C-T p.His1349Tyr missense ACACB 2 82924 2.41185E-5 41462 0 3.98153E-6
12-109670518-A-G p.His1349Arg missense ACACB 4 82930 4.82335E-5 41465 0 1.99064E-5
12-109670525-A-G p.Thr1351Thr synonymous ACACB 1 82978 1.20514E-5 41489 0 3.29717E-5
12-109670535-A-G p.Met1355Val missense ACACB 1 82984 1.20505E-5 41492 0 NA
12-109670538-G-A p.Asp1356Asn missense ACACB 1 82980 1.20511E-5 41490 0 NA
12-109670543-C-T p.Ser1357Ser synonymous ACACB 2 82956 2.41092E-5 41478 0 6.25E-4
12-109670544-G-A p.Gly1358Ser missense ACACB 26 82968 3.13374E-4 41484 0 1.98984E-4
12-109670565-C-T p.Arg1365Cys missense ACACB 12 83022 1.4454E-4 41511 0 3.22385E-4
12-109670568-A-G p.Met1366Val missense ACACB 8 83064 9.63113E-5 41532 0 1.27453E-4
12-109670580-G-A p.Val1370Ile missense ACACB 1 83068 1.20383E-5 41534 0 3.18654E-5
12-109670581-T-G p.Val1370Gly missense ACACB 1 83068 1.20383E-5 41534 0 6.3743E-5
12-109670592-A-G p.Arg1374Gly missense ACACB 3 83078 3.61106E-5 41539 0 3.98099E-6
12-109670597-C-T p.Phe1375Phe synonymous ACACB 23 83056 2.76922E-4 41528 0 6.05173E-4
12-109670598-G-A p.Glu1376Lys missense ACACB 1 83048 1.20412E-5 41524 0 3.98197E-6
12-109671565-A-G p.Glu1384Glu synonymous ACACB 4 83282 4.80296E-5 41641 0 4.1308E-5
12-109671578-T-G p.Phe1389Val missense ACACB 2 83314 2.40056E-5 41657 0 2.78396E-5
12-109671580-C-T p.Phe1389Phe synonymous ACACB 7 83306 8.40276E-5 41653 0 3.29951E-5
12-109671581-G-A p.Ala1390Thr missense ACACB 1 83310 1.20034E-5 41655 0 8.24756E-6
12-109671585-A-T p.Asn1391Ile missense ACACB 2 83324 2.40027E-5 41662 0 3.97703E-6
12-109671586-C-T p.Asn1391Asn synonymous ACACB 21 83326 2.52022E-4 41663 0 0.00100705
12-109671587-G-A p.Val1392Met missense ACACB 6 83316 7.2015E-5 41658 0 5.77044E-5
12-109671591-C-A p.Pro1393His missense ACACB 1 83318 1.20022E-5 41659 0 NA
12-109671600-C-A p.Thr1396Asn missense ACACB 1 83314 1.20028E-5 41657 0 3.97779E-6
12-109671603-C-G p.Pro1397Arg missense ACACB 2 83328 2.40015E-5 41664 0 NA
12-109671605-C-A p.Leu1398Ile missense ACACB 3 83318 3.60066E-5 41659 0 NA
12-109671605-C-T p.Leu1398Phe missense ACACB 1 83318 1.20022E-5 41659 0 NA
12-109671613-C-T p.Ser1400Ser synonymous ACACB 1 83304 1.20042E-5 41652 0 6.25E-4
12-109671623-A-G p.Thr1404Ala missense ACACB 1 83300 1.20048E-5 41650 0 1.64796E-5
12-109671630-T-C p.Leu1406Pro missense ACACB 4 83322 4.80065E-5 41661 0 NA
12-109671637-C-T p.Ser1408Ser synonymous ACACB 3 83296 3.60161E-5 41648 0 8.24008E-6
12-109671638-G-A p.Glu1409Lys missense ACACB 3 83294 3.6017E-5 41647 0 1.03453E-4
12-109671643-T-C p.Asp1410Asp synonymous ACACB 1 83298 1.20051E-5 41649 0 1.59201E-5
12-109671649-C-T p.Cys1412Cys synonymous ACACB 1 83260 1.20106E-5 41630 0 NA
12-109671650-AAGGTAAGCGTCTAAGCCCAGGGAGCAACCTGGGGAGCAGGTGGGCCGTGGCCCCCAGGCTTTCCAGCCCTACCCCTTGCTTCTCCCTCTC-A p.Ser1414fs frameshift ACACB 4 83266 4.80388E-5 41633 2 NA
12-109671658-C-T c.4239+6C>T splice_region ACACB 3 83266 3.60291E-5 41633 0 4.1212E-5
12-109671659-G-A c.4239+7G>A splice_region ACACB 8 83260 9.60846E-5 41630 0 6.25E-4
12-109671738-C-A c.4240-5C>A splice_region ACACB 16976 82880 0.204826 41440 1740 0.203989
12-109671747-T-C p.Leu1415Pro missense ACACB 1 83202 1.20189E-5 41601 0 NA
12-109671767-A-T p.Ile1422Phe missense ACACB 1 83220 1.20163E-5 41610 0 NA
12-109671769-T-G p.Ile1422Met missense ACACB 1 83216 1.20169E-5 41608 0 3.98019E-6
12-109671789-G-C p.Cys1429Ser missense ACACB 2 83180 2.40442E-5 41590 0 NA
12-109671791-G-A p.Ala1430Thr missense ACACB 1 83174 1.2023E-5 41587 0 NA
12-109671803-G-A p.Glu1434Lys missense ACACB 1 83150 1.20265E-5 41575 0 NA
12-109671808-T-C p.Asp1435Asp synonymous ACACB 1 83128 1.20296E-5 41564 0 NA
12-109671822-C-T p.Pro1440Leu missense ACACB 8 83070 9.63043E-5 41535 0 4.75484E-5
12-109671823-G-A p.Pro1440Pro synonymous ACACB 1 83070 1.2038E-5 41535 0 9.62946E-6
12-109671838-C-T p.Phe1445Phe synonymous ACACB 190 82920 0.00229137 41460 0 0.00554995
12-109673127-CT-C p.Val1454fs frameshift ACACB 1 83090 1.20351E-5 41545 0 NA
12-109673133-GAT-G p.Asp1455fs frameshift ACACB 2 83128 2.40593E-5 41564 0 3.18471E-5
12-109673141-A-G p.Gly1457Gly synonymous ACACB 1 83158 1.20253E-5 41579 0 3.18492E-5
12-109673145-C-T p.Arg1459* stop_gained ACACB 3 83170 3.60707E-5 41585 0 2.47145E-5
12-109673146-G-A p.Arg1459Gln missense ACACB 7 83160 8.41751E-5 41580 0 1.59226E-4
12-109673147-A-C p.Arg1459Arg synonymous ACACB 1 83182 1.20218E-5 41591 0 NA
12-109673160-T-C p.Leu1464Leu synonymous ACACB 1 83206 1.20184E-5 41603 0 NA
12-109673163-A-G p.Ile1465Val missense ACACB 1 83194 1.20201E-5 41597 0 3.9769E-6
12-109673164-T-C p.Ile1465Thr missense ACACB 3 83194 3.60603E-5 41597 0 3.1841E-5
12-109673167-C-A p.Ala1466Asp missense ACACB 2 83178 2.40448E-5 41589 0 3.97709E-6
12-109673407-G-A c.4405-4G>A splice_region ACACB 2 83322 2.40033E-5 41661 0 NA
12-109673409-A-C c.4405-2A>C splice_acceptor ACACB 1 83324 1.20013E-5 41662 0 3.98632E-6
12-109673432-A-T p.Thr1476Ser missense ACACB 4 83322 4.80065E-5 41661 0 3.98603E-6
12-109673448-A-T p.Asp1481Val missense ACACB 609 83300 0.00731092 41650 1 0.009375
12-109673450-G-A p.Glu1482Lys missense+splice_region ACACB 4 83312 4.80123E-5 41656 0 6.36983E-5
12-109673460-C-T c.4446+8C>T splice_region ACACB 27 83284 3.24192E-4 41642 0 4.76278E-4
12-109674962-G-A c.4447-8G>A splice_region ACACB 30 82700 3.62757E-4 41350 0 6.25E-4
12-109674962-G-T c.4447-8G>T splice_region ACACB 1 82700 1.20919E-5 41350 0 NA
12-109674971-T-G p.Phe1483Cys missense+splice_region ACACB 1 82998 1.20485E-5 41499 0 NA
12-109674976-G-T p.Glu1485* stop_gained ACACB 1 83066 1.20386E-5 41533 0 NA
12-109674981-T-A p.Asp1486Glu missense ACACB 1 83134 1.20288E-5 41567 0 NA
12-109674983-G-A p.Arg1487His missense ACACB 2 83160 2.405E-5 41580 0 1.19312E-5
12-109674984-C-T p.Arg1487Arg synonymous ACACB 1 83202 1.20189E-5 41601 0 3.18593E-5
12-109674991-C-T p.Arg1490Cys missense ACACB 2 83276 2.40165E-5 41638 0 8.23927E-6
12-109674992-G-A p.Arg1490His missense ACACB 10 83290 1.20062E-4 41645 0 8.74877E-5
12-109674998-T-A p.Leu1492* stop_gained ACACB 2 83302 2.4009E-5 41651 0 3.57878E-5
12-109675009-C-T p.Leu1496Leu synonymous ACACB 2 83346 2.39964E-5 41673 0 8.2371E-6
12-109675014-C-T p.Ala1497Ala synonymous ACACB 1 83348 1.19979E-5 41674 0 NA
12-109675027-C-G p.Leu1502Val missense ACACB 1 83358 1.19964E-5 41679 0 NA
12-109675029-T-C p.Leu1502Leu synonymous ACACB 68808 82900 0.830012 41450 28600 0.829139