Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
3-38163682-CCAGGTGCAGCCCCTTCCAACCTTCCCCAAACTGCCCACAGAGCCTGGACCCCCTGCCCAGGTGCCTCCTAACCTCAGCCCCCACATGCTCCCCA-C n.278_299+72delTGGGGAGCATGTGGGGGCTGAGGTTAGGAGGCACCTGGGCAGGGGGTCCAGGCTCTGTGGGCAGTTTGGGGAAGGTTGGAAGGGGCTGCACCTG splice_donor ACAA1 2 82878 2.41319E-5 41439 0 4.01332E-6
3-38163750-C-G n.299+5G>C splice_region ACAA1 1 83048 1.20412E-5 41524 0 8.40477E-6
3-38163867-C-T n.188-1G>A splice_acceptor ACAA1 103 83170 0.00123843 41585 1 0.00704935
3-38163871-G-A n.188-5C>T splice_region ACAA1 1 83162 1.20247E-5 41581 0 6.37633E-5
3-38164547-A-G p.Pro329Pro synonymous ACAA1 1 83270 1.20091E-5 41635 0 2.47549E-5
3-38164561-C-T p.Val325Ile missense ACAA1 8 83276 9.60661E-5 41638 0 5.96607E-5
3-38164562-G-A p.Ala324Ala synonymous ACAA1 222 83268 0.00266609 41634 2 0.00573321
3-38164562-G-T p.Ala324Ala synonymous ACAA1 3 83276 3.60248E-5 41638 0 1.64978E-5
3-38164567-C-T p.Ala323Thr missense ACAA1 4 83280 4.80307E-5 41640 0 5.03525E-4
3-38164568-G-A p.Ala322Ala synonymous ACAA1 58 83276 6.96479E-4 41638 0 5.13073E-4
3-38164569-G-A p.Ala322Val missense ACAA1 1 83284 1.20071E-5 41642 0 7.95463E-6
3-38164577-T-C p.Gly319Gly synonymous ACAA1 1 83290 1.20062E-5 41645 0 NA
3-38164578-C-G p.Gly319Ala missense ACAA1 2 83292 2.40119E-5 41646 0 9.55597E-5
3-38164585-C-T p.Gly317Arg missense ACAA1 35 83284 4.20249E-4 41642 0 3.18177E-4
3-38164586-G-T p.Ile316Ile synonymous ACAA1 1 83280 1.20077E-5 41640 0 NA
3-38164586-G-A p.Ile316Ile synonymous ACAA1 1 83280 1.20077E-5 41640 0 3.97728E-6
3-38164593-A-G p.Met314Thr missense ACAA1 1 83292 1.2006E-5 41646 0 3.97712E-6
3-38164613-C-A p.Arg307Ser missense+splice_region ACAA1 1 83260 1.20106E-5 41630 0 8.25232E-6
3-38167057-T-A p.Arg307Trp missense+splice_region ACAA1 1 83082 1.20363E-5 41541 0 NA
3-38167065-C-T p.Arg304His missense ACAA1 9 83142 1.08249E-4 41571 0 1.27518E-4
3-38167066-G-A p.Arg304Cys missense ACAA1 1 83154 1.20259E-5 41577 0 1.80151E-5
3-38167068-C-T p.Arg303His missense ACAA1 2 83176 2.40454E-5 41588 0 2.70115E-5
3-38167080-T-C p.Asn299Ser missense ACAA1 59 83262 7.08607E-4 41631 1 0.00246345
3-38167084-G-A p.Leu298Phe missense ACAA1 1 83274 1.20085E-5 41637 0 4.37963E-6
3-38167088-C-T p.Thr296Thr synonymous ACAA1 3 83280 3.60231E-5 41640 0 3.55891E-5
3-38167089-G-A p.Thr296Met missense ACAA1 45 83278 5.40359E-4 41639 0 0.00110199
3-38167095-A-G p.Val294Ala missense ACAA1 2451 83220 0.0294521 41610 48 0.0325
3-38167101-C-T p.Arg292Gln missense ACAA1 5 83310 6.00168E-5 41655 0 5.30185E-5
3-38167102-G-T p.Arg292Arg synonymous ACAA1 2 83308 2.40073E-5 41654 0 8.83252E-6
3-38167102-G-A p.Arg292* stop_gained ACAA1 2 83308 2.40073E-5 41654 0 4.41626E-5
3-38167126-G-A p.His284Tyr missense ACAA1 1 83318 1.20022E-5 41659 0 8.40435E-6
3-38167130-T-G p.Leu282Phe missense ACAA1 2 83318 2.40044E-5 41659 0 NA
3-38167133-G-A p.Ala281Ala synonymous ACAA1 1 83314 1.20028E-5 41657 0 NA
3-38167148-C-A p.Leu276Leu synonymous ACAA1 1 83298 1.20051E-5 41649 0 8.75626E-6
3-38167151-G-A p.Pro275Pro synonymous ACAA1 203 83302 0.00243692 41651 1 0.00522926
3-38167167-GG-CT p.Pro270Ser missense ACAA1 1 83240 1.20135E-5 41620 0 NA
3-38167168-G-A p.Pro270Ser missense ACAA1 3 83234 3.6043E-5 41617 0 8.37935E-6
3-38167168-G-C p.Pro270Ala missense ACAA1 8 83234 9.61146E-5 41617 0 5.03525E-4
3-38167176-C-T p.Arg267Gln missense ACAA1 1 83202 1.20189E-5 41601 0 NA
3-38167177-G-A p.Arg267* stop_gained ACAA1 1 83204 1.20187E-5 41602 0 6.37918E-5
3-38167190-A-G p.Cys262Cys synonymous ACAA1 17 83162 2.0442E-4 41581 0 0.00119378
3-38167194-T-C p.Tyr261Cys missense ACAA1 1 83152 1.20262E-5 41576 0 8.61594E-6
3-38167200-GCCTGGAAGGAGGCAGATCATCACCTATAGCCCTCTTACCCCTCCCCTGCACCACCTGCCCGCTCACTCCACCTCGGCTGTCCAGGGCAAAGGCAACATTGAGAAACAAGGGCTCA-G p.Ala259fs frameshift ACAA1 2 83166 2.40483E-5 41583 0 NA
3-38167205-G-C c.775-4C>G splice_region ACAA1 1 83130 1.20294E-5 41565 0 4.04334E-6
3-38167316-C-T c.774+1G>A splice_donor ACAA1 1 83174 1.2023E-5 41587 0 NA
3-38167319-G-A p.Gln258* stop_gained ACAA1 1 83164 1.20244E-5 41582 0 NA
3-38167323-T-G p.Ala256Ala synonymous ACAA1 1 83116 1.20314E-5 41558 0 0.00125
3-38167327-A-T p.Phe255Tyr missense ACAA1 1 83088 1.20354E-5 41544 0 NA
3-38167343-C-T p.Glu250Lys missense ACAA1 3 82720 3.62669E-5 41360 0 1.65166E-5
3-38167353-C-T p.Val246Val synonymous ACAA1 2 82416 2.42671E-5 41208 0 NA
3-38167355-C-T p.Val246Met missense ACAA1 1 82276 1.21542E-5 41138 0 2.47938E-5
3-38167356-G-A p.Asp245Asp synonymous ACAA1 1 82190 1.21669E-5 41095 0 9.56206E-5
3-38167360-C-T p.Ser244Asn missense ACAA1 1 82016 1.21927E-5 41008 0 NA
3-38167365-T-C p.Thr242Thr synonymous ACAA1 1 81746 1.2233E-5 40873 0 NA
3-38167372-C-T p.Gly240Glu missense+splice_region ACAA1 2 81142 2.46481E-5 40571 0 1.99628E-5
3-38167645-C-G c.997+8G>C splice_region ACAA1 2 83000 2.40964E-5 41500 0 NA
3-38167656-C-G p.Ala332Pro missense ACAA1 1 83124 1.20302E-5 41562 0 NA
3-38167661-T-G p.Gln330Pro missense ACAA1 1 83126 1.20299E-5 41563 0 6.37389E-5
3-38167662-G-C p.Gln330Glu missense ACAA1 1 83124 1.20302E-5 41562 0 NA
3-38167673-G-A p.Pro326Leu missense ACAA1 1 83186 1.20213E-5 41593 0 8.29394E-6
3-38167682-T-A p.Tyr323Phe missense ACAA1 1 83196 1.20198E-5 41598 0 NA
3-38167694-A-G p.Ile319Thr missense ACAA1 62 83168 7.45479E-4 41584 0 0.00165711
3-38167704-T-C p.Ile316Val missense ACAA1 1 83176 1.20227E-5 41588 0 3.98E-6
3-38167712-G-C p.Pro313Arg missense ACAA1 1 83166 1.20241E-5 41583 0 NA
3-38167712-GGGACCCCAACCACTGCATAAGACCTCA-G p.Leu304_Val312del disruptive_inframe_deletion ACAA1 1 83166 1.20241E-5 41583 0 8.24565E-6
3-38167716-C-A p.Val312Phe missense ACAA1 2 83164 2.40489E-5 41582 0 3.97918E-6
3-38167717-C-T p.Gly311Gly synonymous ACAA1 24 83160 2.886E-4 41580 0 5.03525E-4
3-38167730-T-G p.Tyr307Ser missense ACAA1 3 83140 3.60837E-5 41570 0 4.37623E-5
3-38167731-A-G p.Tyr307His missense ACAA1 1 83132 1.20291E-5 41566 0 NA
3-38167738-C-T p.Leu304Leu synonymous ACAA1 1 83104 1.20331E-5 41552 0 NA
3-38167743-C-T p.Val303Ile missense ACAA1 40 83094 4.81383E-4 41547 0 8.32591E-4
3-38167761-C-T p.Gly297Ser missense ACAA1 1 83014 1.20462E-5 41507 0 3.97931E-6
3-38167778-G-A p.Ser291Phe missense ACAA1 3 82908 3.61847E-5 41454 0 NA
3-38167780-C-T p.Arg290Arg synonymous ACAA1 1 82904 1.20621E-5 41452 0 8.25396E-6
3-38167784-C-T p.Arg289Gln missense ACAA1 2 82840 2.41429E-5 41420 0 2.47709E-5
3-38167785-G-A p.Arg289Trp missense ACAA1 2 82826 2.4147E-5 41413 0 6.37349E-5
3-38167790-A-G p.Leu287Pro missense ACAA1 4 82806 4.83057E-5 41403 0 3.18593E-5
3-38167818-C-T p.Val278Met missense ACAA1 2 82486 2.42465E-5 41243 0 7.98333E-6
3-38167826-G-C p.Ser275Cys missense ACAA1 1 82408 1.21347E-5 41204 0 NA
3-38167985-C-T p.Gly126Glu missense ACAA1 9 83334 1.07999E-4 41667 0 1.91192E-4
3-38167987-C-T p.Pro125Pro synonymous ACAA1 2 83334 2.39998E-5 41667 0 1.19543E-5
3-38167988-G-A p.Pro125Leu missense ACAA1 4 83332 4.80008E-5 41666 0 6.37471E-5
3-38168000-C-G c.718+1G>C splice_donor ACAA1 1 83362 1.19959E-5 41681 0 3.98146E-6
3-38168010-T-C p.Thr237Ala missense ACAA1 3 83372 3.59833E-5 41686 0 3.18337E-5
3-38168026-G-A p.Phe231Phe synonymous ACAA1 9 83374 1.07947E-4 41687 0 0.00125
3-38168032-A-C p.Pro229Pro synonymous ACAA1 2 83382 2.3986E-5 41691 0 NA
3-38168056-C-T p.Met221Ile missense ACAA1 1 83386 1.19924E-5 41693 0 NA
3-38168073-G-A p.Arg216Cys missense ACAA1 1 83384 1.19927E-5 41692 0 3.57878E-5
3-38168080-C-T p.Glu213Glu synonymous ACAA1 2 83380 2.39866E-5 41690 0 3.29478E-5
3-38168087-TG-T p.Gln211fs frameshift ACAA1 1 83376 1.19939E-5 41688 0 3.97633E-6
3-38168107-C-A p.Lys204Asn missense ACAA1 1 83368 1.1995E-5 41684 0 NA
3-38168114-C-A p.Gly202Val missense ACAA1 3 83352 3.59919E-5 41676 0 0.00100705
3-38168125-A-C p.His198Gln missense ACAA1 4440 83286 0.0533103 41643 168 0.0981873
3-38168125-A-G p.His198His synonymous ACAA1 1 83336 1.19996E-5 41668 0 NA
3-38168131-C-T p.Thr196Thr synonymous ACAA1 1 83338 1.19993E-5 41669 0 6.25E-4
3-38168132-G-A p.Thr196Met missense ACAA1 2 83330 2.4001E-5 41665 0 3.29468E-5
3-38168149-A-G p.Ile190Ile synonymous ACAA1 40 83302 4.80181E-4 41651 1 0.00302115
3-38168176-C-G p.Gln181His missense ACAA1 1 83164 1.20244E-5 41582 0 8.23968E-6
3-38168178-G-A p.Gln181* stop_gained ACAA1 1 83144 1.20273E-5 41572 0 NA
3-38168187-C-G p.Ala178Pro missense ACAA1 1 83062 1.20392E-5 41531 0 NA
3-38168194-G-A c.528-3C>T splice_region ACAA1 1 82974 1.2052E-5 41487 0 NA
3-38168198-G-A c.528-7C>T splice_region ACAA1 1 82928 1.20587E-5 41464 0 NA
3-38169124-T-A c.*336A>T splice_region ACAA1 4 75970 5.26524E-5 37985 0 9.55962E-5
3-38169281-G-T p.Gln175Lys missense ACAA1 1 83306 1.20039E-5 41653 0 NA
3-38169293-G-C p.Leu171Val missense ACAA1 1 83350 1.19976E-5 41675 0 8.23927E-6
3-38169301-G-A p.Thr168Ile missense ACAA1 1 83336 1.19996E-5 41668 0 1.64775E-5
3-38169303-AT-A p.Asp167fs frameshift ACAA1 1 83340 1.1999E-5 41670 0 3.1841E-5
3-38169305-C-G p.Asp167His missense ACAA1 1 83342 1.19988E-5 41671 0 3.97633E-5
3-38169306-C-T p.Gln166Gln synonymous ACAA1 1 83344 1.19985E-5 41672 0 1.19292E-5
3-38169307-T-C p.Gln166Arg missense ACAA1 5 83340 5.99952E-5 41670 0 4.77164E-5
3-38169317-G-A p.Arg163Trp missense ACAA1 6 83346 7.19891E-5 41673 0 5.76711E-5
3-38169332-G-A p.Arg158Trp missense ACAA1 2 83354 2.3994E-5 41677 0 3.18512E-5
3-38169347-C-G p.Glu153Gln missense ACAA1 1 83348 1.19979E-5 41674 0 NA
3-38169351-G-A p.Thr151Thr synonymous ACAA1 2 83340 2.39981E-5 41670 0 NA
3-38170774-C-T c.545+7G>A splice_region ACAA1 6 83126 7.21796E-5 41563 0 6.37267E-5
3-38170781-C-G p.Gly182Ala missense+splice_region ACAA1 1 83172 1.20233E-5 41586 0 NA
3-38170791-T-C p.Ile179Val missense ACAA1 1 83240 1.20135E-5 41620 0 NA
3-38170796-CAA-TAT p.AspCys176GluTyr missense ACAA1 2 83266 2.40194E-5 41633 0 NA
3-38170796-C-T p.Cys177Tyr missense ACAA1 1 83266 1.20097E-5 41633 0 NA
3-38170798-A-T p.Asp176Glu missense ACAA1 1 83272 1.20088E-5 41636 0 NA
3-38170810-C-G p.Glu172Asp missense ACAA1 10578 83064 0.127348 41532 804 0.157092
3-38170822-C-G p.Ter154Serext*? stop_lost ACAA1 1 83284 1.20071E-5 41642 0 NA
3-38170826-C-T p.Arg167His missense ACAA1 1 83284 1.20071E-5 41642 0 1.59089E-5
3-38170827-G-A p.Arg167Cys missense ACAA1 4 83284 4.80284E-5 41642 0 5.17043E-5
3-38170829-G-A p.Ser166Leu missense ACAA1 11 83278 1.32088E-4 41639 0 1.47163E-4
3-38170838-T-C p.Asn163Ser missense ACAA1 3 83266 3.60291E-5 41633 0 2.55004E-4
3-38170864-G-A p.Pro140Leu missense ACAA1 76 83124 9.14297E-4 41562 1 0.00213457
3-38170884-G-C c.447-5C>G splice_region ACAA1 3 82874 3.61995E-5 41437 0 NA
3-38173086-C-T c.446+1G>A splice_donor ACAA1 1 83366 1.19953E-5 41683 0 NA
3-38173110-A-G p.Ser141Ser synonymous ACAA1 6 83400 7.19424E-5 41700 0 0.00251762
3-38173111-G-T p.Ser141Tyr missense ACAA1 2 83402 2.39802E-5 41701 0 NA
3-38173122-G-C p.Ile137Met missense ACAA1 4 83410 4.79559E-5 41705 0 8.2375E-6
3-38173124-T-C p.Ile137Val missense ACAA1 5 83410 5.99449E-5 41705 0 6.36821E-5
3-38173410-A-G c.403+7T>C splice_region ACAA1 3 83248 3.60369E-5 41624 0 1.98934E-5
3-38173412-C-T c.403+5G>A splice_region ACAA1 1 83248 1.20123E-5 41624 0 NA
3-38173413-T-G c.403+4A>C splice_region ACAA1 1 83256 1.20111E-5 41628 0 3.97852E-6
3-38173420-C-A p.Ter114Tyrext*? stop_lost ACAA1 1 83294 1.20057E-5 41647 0 2.47684E-5
3-38173421-T-A p.Ter114Leuext*? stop_lost ACAA1 4 83290 4.8025E-5 41645 0 NA
3-38173424-G-A p.Ala113Val missense ACAA1 1 83296 1.20054E-5 41648 0 NA
3-38173426-T-C p.Ser132Gly missense ACAA1 1 83298 1.20051E-5 41649 0 1.98875E-5
3-38173429-C-A p.Ala131Ser missense ACAA1 2 83296 2.40108E-5 41648 0 NA
3-38173442-C-G p.Gly107Ala missense ACAA1 5 83316 6.00125E-5 41658 0 1.1931E-5
3-38173445-C-T p.Arg106Gln missense ACAA1 3 83318 3.60066E-5 41659 0 0.00151057
3-38173449-G-A p.Ser124Leu missense ACAA1 3 83320 3.60058E-5 41660 0 1.27453E-4
3-38173456-G-C p.Gln122Glu missense ACAA1 24 83334 2.87998E-4 41667 0 6.25E-4
3-38173470-G-A p.Ser117Phe missense ACAA1 6 83338 7.1996E-5 41669 0 5.77482E-5
3-38173473-A-G p.Leu116Ser missense ACAA1 2 83324 2.40027E-5 41662 0 3.97757E-6
3-38173484-C-T p.Arg93Lys missense ACAA1 3 83316 3.60075E-5 41658 0 2.7248E-4
3-38173487-C-T p.Arg92Gln missense ACAA1 3 83308 3.60109E-5 41654 0 6.36983E-5
3-38173488-G-A p.Pro111Leu missense ACAA1 1 83310 1.20034E-5 41655 0 6.36943E-5
3-38173493-G-A p.Thr90Ile missense ACAA1 9 83306 1.08035E-4 41653 0 5.03525E-4
3-38173498-T-C c.324-2A>G splice_acceptor ACAA1 2 83292 2.40119E-5 41646 0 3.18532E-5
3-38175439-T-C c.323+4A>G splice_region ACAA1 1 83076 1.20372E-5 41538 0 7.95437E-6
3-38175440-T-A c.323+3A>T splice_region ACAA1 1 83070 1.2038E-5 41535 0 NA
3-38175456-C-T p.Ala104Thr missense ACAA1 1 83144 1.20273E-5 41572 0 8.25123E-6
3-38175461-C-T p.Arg102Gln missense ACAA1 2 83152 2.40523E-5 41576 0 3.18451E-5
3-38175462-G-A p.Arg102* stop_gained ACAA1 1 83134 1.20288E-5 41567 0 3.18451E-5
3-38175464-G-C p.Ala101Gly missense ACAA1 1 83144 1.20273E-5 41572 0 4.77323E-5
3-38175477-C-T p.Gly97Arg missense ACAA1 9 83104 1.08298E-4 41552 0 5.17508E-5
3-38175478-G-A p.Pro111Leu missense ACAA1 2 83096 2.40685E-5 41548 0 1.19406E-5
3-38175488-T-C p.Gln93Arg missense ACAA1 2 83098 2.4068E-5 41549 0 NA
3-38175503-G-A c.266-3C>T splice_region ACAA1 1 83000 1.20482E-5 41500 0 NA
3-38175992-A-G c.309+8T>C splice_region ACAA1 2 51200 3.90625E-5 25600 0 6.36902E-5
3-38175993-T-C c.309+7A>G splice_region ACAA1 1 51184 1.95374E-5 25592 0 7.4428E-6
3-38176001-G-A p.Thr103Met missense+splice_region ACAA1 28 51116 5.47774E-4 25558 0 8.59818E-4
3-38176008-T-C p.Ile101Val missense ACAA1 6 50980 1.17693E-4 25490 0 3.20179E-4
3-38176024-A-G p.Tyr95Tyr synonymous ACAA1 1 50620 1.9755E-5 25310 0 7.44502E-6
3-38176025-TAAG-T p.Ser94del disruptive_inframe_deletion ACAA1 3 50582 5.93096E-5 25291 0 8.93722E-5
3-38178077-G-A c.265+6C>T splice_region ACAA1 4 82568 4.84449E-5 41284 0 3.19048E-5
3-38178083-C-T p.Gly89Arg missense+splice_region ACAA1 1 82760 1.20831E-5 41380 0 8.32931E-6
3-38178090-G-C p.Ile86Met missense ACAA1 1 82836 1.2072E-5 41418 0 3.18593E-5
3-38178092-T-C p.Ile86Val missense ACAA1 1 82846 1.20706E-5 41423 0 6.37227E-5
3-38178093-G-A p.Asp85Asp synonymous ACAA1 16 82852 1.93115E-4 41426 0 1.66445E-4
3-38178122-C-A p.Val76Leu missense ACAA1 2 82876 2.41324E-5 41438 0 NA
3-38178123-G-C p.Asp75Glu missense ACAA1 73 82858 8.81025E-4 41429 3 0.00302115
3-38178128-T-G p.Lys74Gln missense ACAA1 2 82810 2.41517E-5 41405 0 NA
3-38178132-A-G p.Val72Val synonymous ACAA1 1 82794 1.20782E-5 41397 0 3.18695E-5
3-38178133-A-G p.Val72Ala missense ACAA1 2 82740 2.41721E-5 41370 0 NA
3-38178134-C-G p.Val72Leu missense ACAA1 4 82772 4.83255E-5 41386 0 8.39602E-6
3-38178134-C-A p.Val72Phe missense ACAA1 2 82772 2.41628E-5 41386 0 NA
3-38178135-C-T p.Ala71Ala synonymous ACAA1 1 82736 1.20866E-5 41368 0 NA
3-38178140-T-C p.Thr70Ala missense ACAA1 2 82714 2.41797E-5 41357 0 NA
3-38178142-A-G p.Met69Thr missense ACAA1 2 82700 2.41838E-5 41350 0 7.98575E-6
3-38178142-A-C p.Met69Arg missense ACAA1 1 82700 1.20919E-5 41350 0 1.69342E-5
3-38178143-T-G p.Met69Leu missense ACAA1 2 82678 2.41902E-5 41339 0 NA
3-38178149-C-T p.Ala67Thr missense ACAA1 4 82632 4.84074E-5 41316 0 NA
3-38178150-CGA-C p.Ser66fs frameshift ACAA1 2 82592 2.42154E-5 41296 0 8.58075E-6
3-38178151-G-C p.Ser66Trp missense ACAA1 2 82624 2.4206E-5 41312 0 NA
3-38178151-G-A p.Ser66Leu missense ACAA1 3 82624 3.63091E-5 41312 0 9.55962E-5
3-38178159-C-T p.Glu63Glu synonymous ACAA1 1 82504 1.21206E-5 41252 0 1.77677E-5
3-38178162-G-A c.-272C>T 5_prime_UTR_premature_start_codon_gain ACAA1 1 82364 1.21412E-5 41182 0 3.62582E-5
3-38178165-G-C p.Pro61Pro synonymous ACAA1 1 82376 1.21395E-5 41188 0 5.03525E-4
3-38178166-G-C p.Pro61Arg missense ACAA1 2 82388 2.42754E-5 41194 1 NA
3-38178176-C-A p.Asp58Tyr missense+splice_region ACAA1 1 82266 1.21557E-5 41133 0 NA
3-38178178-TGCAGC-T c.172-7_172-3delGCTGC splice_region ACAA1 1 82246 1.21586E-5 41123 0 NA
3-38178179-G-A c.172-3C>T splice_region ACAA1 1 82214 1.21634E-5 41107 0 NA
3-38178366-C-A p.Gly54Val missense ACAA1 3 71316 4.20663E-5 35658 0 3.18695E-5
3-38178379-G-C p.Arg50Gly missense ACAA1 1 70064 1.42727E-5 35032 0 NA
3-38178393-C-A p.Arg45Leu missense ACAA1 1 68890 1.45159E-5 34445 0 7.82669E-6
3-38178396-C-T p.Arg44Gln missense ACAA1 1 68752 1.4545E-5 34376 0 NA
3-38178401-G-A c.-332C>T 5_prime_UTR_premature_start_codon_gain ACAA1 1 68960 1.45012E-5 34480 0 7.67554E-6
3-38178403-G-GCAC p.Val41dup conservative_inframe_insertion ACAA1 1 68984 1.44961E-5 34492 0 7.65896E-6
3-38178404-C-A p.Val41Val synonymous ACAA1 1 69018 1.4489E-5 34509 0 NA
3-38178407-C-T p.Val40Val synonymous ACAA1 14 69206 2.02295E-4 34603 0 0.00126743
3-38178430-C-G p.Ala33Pro missense ACAA1 2 69460 2.87936E-5 34730 0 NA
3-38178442-C-A p.Gly29Cys missense ACAA1 1 69996 1.42865E-5 34998 0 NA
3-38178450-C-A p.Cys26Phe missense ACAA1 1 70832 1.41179E-5 35416 0 1.54847E-4
3-38178455-C-G p.Ala24Ala synonymous ACAA1 1 70846 1.41151E-5 35423 0 6.69228E-6
3-38178456-G-A p.Ala24Val missense ACAA1 1 70742 1.41359E-5 35371 0 1.49701E-4
3-38178463-G-A p.Gln22* stop_gained ACAA1 2 71662 2.79088E-5 35831 0 NA
3-38178465-G-A p.Pro21Leu missense ACAA1 1 71792 1.39291E-5 35896 0 6.8306E-5
3-38178472-A-T p.Trp19Arg missense ACAA1 3 72802 4.12077E-5 36401 0 6.16888E-6
3-38178473-G-A c.-404C>T 5_prime_UTR_premature_start_codon_gain ACAA1 2 72812 2.7468E-5 36406 0 NA
3-38178477-G-A p.Ser17Phe missense ACAA1 2 73170 2.73336E-5 36585 0 1.84158E-5
3-38178478-A-C p.Ser17Ala missense ACAA1 1 73218 1.36578E-5 36609 0 2.42395E-4
3-38178485-C-T p.Pro14Pro synonymous ACAA1 1 73508 1.3604E-5 36754 0 3.18735E-5
3-38178487-GAC-G p.Gly13fs frameshift ACAA1 5 73708 6.78352E-5 36854 0 1.13237E-4
3-38178489-C-A p.Gly13Val missense ACAA1 1 73742 1.35608E-5 36871 0 NA
3-38178490-C-A p.Gly13Cys missense ACAA1 1 73936 1.35252E-5 36968 0 NA
3-38178492-C-T p.Arg12Lys missense ACAA1 2 74220 2.69469E-5 37110 0 1.09541E-4
3-38178493-T-A p.Arg12Trp missense ACAA1 5 74042 6.75292E-5 37021 0 0.00102249
3-38178494-C-T p.Leu11Leu synonymous ACAA1 19 74276 2.55803E-4 37138 1 0.00204082
3-38178499-G-A p.His10Tyr missense ACAA1 8 74326 1.07634E-4 37163 0 1.5692E-4
3-38178502-C-A p.Gly9Cys missense ACAA1 1 74538 1.3416E-5 37269 0 NA
3-38178502-C-G p.Gly9Arg missense ACAA1 1 74538 1.3416E-5 37269 0 5.15305E-5
3-38178502-C-T p.Gly9Ser missense ACAA1 2 74538 2.6832E-5 37269 0 1.27518E-4
3-38178505-G-A c.-436C>T 5_prime_UTR_premature_start_codon_gain ACAA1 1 74660 1.33941E-5 37330 0 NA
3-38178521-C-T p.Gln2Gln synonymous ACAA1 5 75184 6.65035E-5 37592 0 9.68711E-5
3-38178533-G-A c.-7C>T 5_prime_UTR_premature_start_codon_gain ACAA1 7 74476 9.399E-5 37238 0 3.37154E-4
3-38178555-C-A c.-29G>T 5_prime_UTR_premature_start_codon_gain ACAA1 1 72482 1.37965E-5 36241 0 NA
3-38178575-G-A c.-49C>T 5_prime_UTR_premature_start_codon_gain ACAA1 1 68898 1.45142E-5 34449 0 1.08319E-4
3-38178601-C-A c.-75G>T 5_prime_UTR_premature_start_codon_gain ACAA1 1 60502 1.65284E-5 30251 0 NA
3-38178626-A-C c.-100T>G 5_prime_UTR_premature_start_codon_gain ACAA1 3 49880 6.01443E-5 24940 0 3.18593E-5
3-38178654-G-A c.-128C>T 5_prime_UTR_premature_start_codon_gain ACAA1 1 40628 2.46136E-5 20314 0 NA
3-38178664-G-A c.-138C>T 5_prime_UTR_premature_start_codon_gain ACAA1 1 37622 2.65802E-5 18811 0 NA
3-38178706-A-G c.-180T>C 5_prime_UTR_premature_start_codon_gain ACAA1 4 27132 1.47427E-4 13566 0 NA
3-38178710-C-A c.-184G>T 5_prime_UTR_premature_start_codon_gain ACAA1 1 26614 3.75742E-5 13307 0 NA