Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
11-34172536-A-ATTG c.*1395_*1397dupCAA splice_region ABTB2 226 43294 0.00522012 21647 5 0.00735669
11-34172536-A-G c.*1398T>C splice_region ABTB2 1 43296 2.30968E-5 21648 0 NA
11-34173937-C-T p.Val839Val synonymous ABTB2 1 73008 1.36971E-5 36504 0 1.5949E-4
11-34173942-G-A p.Arg838Trp missense ABTB2 1 73522 1.36014E-5 36761 0 0.0010101
11-34173951-T-G p.Ile835Leu missense ABTB2 1 74760 1.33761E-5 37380 0 3.65577E-5
11-34173952-G-A p.Tyr834Tyr synonymous ABTB2 1 74914 1.33486E-5 37457 0 NA
11-34173966-C-T p.Val830Met missense ABTB2 1 76042 1.31506E-5 38021 0 1.45826E-5
11-34173967-G-A p.Arg829Arg synonymous ABTB2 191 76122 0.00250913 38061 1 0.00504541
11-34173968-C-T p.Arg829His missense ABTB2 5 76214 6.56047E-5 38107 0 1.13244E-4
11-34173969-G-T p.Arg829Ser missense ABTB2 1 76392 1.30904E-5 38196 0 NA
11-34173982-G-A p.Asn824Asn synonymous ABTB2 45 77338 5.81861E-4 38669 1 9.49102E-4
11-34173987-G-GCAGGTCCTGCAGTGGATC p.Leu822_Gln823insAspProLeuGlnAspLeu conservative_inframe_insertion ABTB2 1 77540 1.28966E-5 38770 0 6.37918E-5
11-34173999-G-A p.Leu819Leu synonymous ABTB2 5 78074 6.40418E-5 39037 0 1.10705E-4
11-34174001-G-T p.Pro818Gln missense ABTB2 1 78078 1.28077E-5 39039 0 4.38416E-6
11-34174009-G-C p.Gly815Gly synonymous ABTB2 2 78136 2.55964E-5 39068 0 1.67994E-5
11-34174018-T-G p.Lys812Asn missense ABTB2 3 78630 3.81534E-5 39315 0 1.53407E-5
11-34174028-C-T p.Arg809His missense ABTB2 2 78644 2.54311E-5 39322 0 5.03525E-4
11-34174032-C-T p.Gly808Ser missense ABTB2 214 78840 0.00271436 39420 4 0.00583658
11-34174033-G-A p.Tyr807Tyr synonymous ABTB2 1 79132 1.26371E-5 39566 0 3.91942E-5
11-34174043-T-G p.Gln804Pro missense ABTB2 1 79438 1.25884E-5 39719 0 NA
11-34174046-C-T p.Arg803Gln missense ABTB2 44 79434 5.53919E-4 39717 0 0.00100705
11-34174047-G-A p.Arg803Trp missense ABTB2 9 79566 1.13114E-4 39783 0 1.11607E-4
11-34174056-C-T p.Asp800Asn missense ABTB2 1 79824 1.25276E-5 39912 0 1.12651E-5
11-34174063-C-T p.Leu797Leu synonymous ABTB2 1 79992 1.25013E-5 39996 0 NA
11-34174070-G-A p.Ala795Val missense ABTB2 1 80006 1.24991E-5 40003 0 NA
11-34174076-A-G p.Met793Thr missense ABTB2 1 80126 1.24803E-5 40063 0 3.18979E-5
11-34174096-C-G p.Glu786Asp missense ABTB2 5 79882 6.25923E-5 39941 0 4.89841E-5
11-34174097-T-C p.Glu786Gly missense ABTB2 2 79826 2.50545E-5 39913 0 NA
11-34174105-C-T p.Leu783Leu synonymous ABTB2 4 79664 5.02109E-5 39832 0 2.437E-5
11-34174106-A-ATGGT p.Leu783fs frameshift ABTB2 3 79516 3.77283E-5 39758 0 3.08863E-4
11-34174108-G-A p.Ala782Ala synonymous ABTB2 1 79480 1.25818E-5 39740 0 NA
11-34174109-G-GCTGTGCCATTTGGGGATGTGCCTCTGAAGACAACCC p.Leu781_Ala782insGlyValValPheArgGlyThrSerProAsnGlyThr conservative_inframe_insertion ABTB2 1 79288 1.26122E-5 39644 0 9.80277E-5
11-34174109-G-GCTGTGCCATTTGGGGATGTGCCTCTGAAGACAA p.Leu781_Ala782insValValPheArgGlyThrSerProAsnGlyThr conservative_inframe_insertion ABTB2 1 79300 1.26103E-5 39650 0 1.96055E-5
11-34174117-T-G p.Pro779Pro synonymous ABTB2 1 78974 1.26624E-5 39487 0 NA
11-34175824-G-T p.Tyr770* stop_gained ABTB2 1 80352 1.24452E-5 40176 0 NA
11-34175833-C-A p.Val767Val synonymous ABTB2 2 80532 2.48348E-5 40266 0 NA
11-34175835-C-T p.Val767Met missense ABTB2 4 80542 4.96635E-5 40271 0 3.18593E-5
11-34175836-G-A p.Ala766Ala synonymous ABTB2 77 80496 9.56569E-4 40248 1 0.00242162
11-34175854-G-A p.Thr760Thr synonymous ABTB2 97 80562 0.00120404 40281 0 0.00328005
11-34175859-G-A p.Gln759* stop_gained ABTB2 1 80576 1.24106E-5 40288 0 NA
11-34175869-G-A p.Ile755Ile synonymous ABTB2 2 80490 2.48478E-5 40245 0 1.27332E-4
11-34175882-C-T p.Arg751Lys missense ABTB2 1 79908 1.25144E-5 39954 0 3.18573E-5
11-34175890-G-A p.Ala748Ala synonymous ABTB2 1 79414 1.25922E-5 39707 0 2.58911E-5
11-34175893-A-T p.Asp747Glu missense ABTB2 1 79204 1.26256E-5 39602 0 3.99329E-6
11-34175910-T-C p.Ser742Gly missense ABTB2 1 78176 1.27916E-5 39088 0 NA
11-34175922-G-T p.Leu738Met missense ABTB2 1 76540 1.30651E-5 38270 0 6.97976E-5
11-34175932-G-T c.2209-7C>A splice_region ABTB2 1 74976 1.33376E-5 37488 0 NA
11-34176248-C-T p.Glu736Glu splice_region+synonymous ABTB2 1 82344 1.21442E-5 41172 0 NA
11-34176262-T-C p.Thr732Ala missense ABTB2 938 82426 0.0113799 41213 36 0.0227287
11-34176292-C-T p.Gly722Arg missense ABTB2 2 82482 2.42477E-5 41241 0 3.29717E-5
11-34176293-G-A p.Tyr721Tyr synonymous ABTB2 5 82496 6.0609E-5 41248 0 5.03525E-4
11-34176296-G-A p.Tyr720Tyr synonymous ABTB2 1 82502 1.21209E-5 41251 0 7.9552E-6
11-34176308-C-G p.Met716Ile missense ABTB2 4 82282 4.86133E-5 41141 0 3.18654E-5
11-34176317-C-CTGAAAAA c.2140-2_2140-1insTTTTTCA splice_acceptor ABTB2 3 82114 3.65346E-5 41057 0 NA
11-34176322-G-GTACTTCATGTCGCTGATCTCGATGGTCTTGCTGC c.2140-7_2140-6insGCAGCAAGACCATCGAGATCAGCGACATGAAGTA splice_region ABTB2 1 81988 1.21969E-5 40994 0 NA
11-34180835-CCA-C c.2139+6_2139+7delTG splice_region ABTB2 1 81740 1.22339E-5 40870 0 NA
11-34180836-C-T c.2139+7G>A splice_region ABTB2 2 81818 2.44445E-5 40909 0 1.19511E-5
11-34180843-C-A p.Gln713His missense+splice_region ABTB2 1 82078 1.21835E-5 41039 0 3.98073E-6
11-34180850-A-G p.Ile711Thr missense ABTB2 1 82422 1.21327E-5 41211 0 3.31225E-5
11-34180858-C-G p.Lys708Asn missense ABTB2 1 82656 1.20983E-5 41328 0 3.18735E-5
11-34180859-T-G p.Lys708Thr missense ABTB2 1 82672 1.2096E-5 41336 0 NA
11-34180861-C-T p.Met707Ile missense ABTB2 36 82702 4.35298E-4 41351 0 2.58585E-4
11-34180866-C-T p.Asp706Asn missense ABTB2 1 82762 1.20828E-5 41381 0 3.97829E-6
11-34180867-G-A p.Ser705Ser synonymous ABTB2 55 82764 6.6454E-4 41382 0 5.25122E-4
11-34180873-C-A p.Glu703Asp missense ABTB2 2 82870 2.41342E-5 41435 0 4.12705E-5
11-34180875-C-G p.Glu703Gln missense ABTB2 3 82874 3.61995E-5 41437 0 1.98885E-5
11-34180876-G-A p.Ile702Ile synonymous ABTB2 11 82886 1.32712E-4 41443 0 9.56145E-5
11-34180887-T-G p.Ser699Arg missense ABTB2 3 82958 3.61629E-5 41479 0 NA
11-34180894-C-T p.Gly696Gly synonymous ABTB2 1 82942 1.20566E-5 41471 0 NA
11-34180896-C-T p.Gly696Arg missense ABTB2 1 82940 1.20569E-5 41470 0 NA
11-34180901-T-A p.Gln694Leu missense ABTB2 1 82928 1.20587E-5 41464 0 NA
11-34180906-T-C p.Ser692Ser synonymous ABTB2 1 82870 1.20671E-5 41435 0 NA
11-34180920-T-G p.Met688Leu missense ABTB2 4 82746 4.83407E-5 41373 0 NA
11-34180924-T-C p.Thr686Thr synonymous ABTB2 4 82722 4.83547E-5 41361 0 1.59276E-4
11-34180936-G-GTTA c.2049-4_2049-3insTAA splice_region ABTB2 1 82518 1.21186E-5 41259 0 NA
11-34180939-G-A c.2049-6C>T splice_region ABTB2 7 82434 8.49164E-5 41217 0 1.27413E-4
11-34180940-C-G c.2049-7G>C splice_region ABTB2 4 82402 4.85425E-5 41201 0 6.36983E-5
11-34181449-C-T c.2048+4G>A splice_region ABTB2 3 82172 3.65088E-5 41086 0 6.36821E-5
11-34181473-C-T p.Leu676Leu synonymous ABTB2 9 82692 1.08838E-4 41346 1 2.22873E-4
11-34181478-C-CT p.Val675fs frameshift ABTB2 1 82734 1.20869E-5 41367 0 NA
11-34181509-C-G p.Leu664Leu synonymous ABTB2 1 82912 1.2061E-5 41456 0 NA
11-34181509-C-T p.Leu664Leu synonymous ABTB2 1 82912 1.2061E-5 41456 0 NA
11-34181536-A-G p.Asn655Asn synonymous ABTB2 1 82728 1.20878E-5 41364 0 NA
11-34181548-G-A p.His651His synonymous ABTB2 2 82604 2.42119E-5 41302 0 1.66886E-5
11-34181557-T-TAGCCTGGCCGGCAGGGTCTTCCGGATCTCTGGGATGCTG c.1946-3_1946-2insCAGCATCCCAGAGATCCGGAAGACCCTGCCGGCCAGGCT splice_region ABTB2 2 82434 2.42618E-5 41217 1 NA
11-34181563-A-T c.1946-8T>A splice_region ABTB2 4 82308 4.8598E-5 41154 0 1.69425E-5
11-34181789-C-A c.1945+6G>T splice_region ABTB2 3 79550 3.77121E-5 39775 0 3.18674E-5
11-34181789-C-T c.1945+6G>A splice_region ABTB2 1 79550 1.25707E-5 39775 0 NA
11-34181805-C-T p.Pro645Pro synonymous ABTB2 13 80052 1.62394E-4 40026 0 6.25E-4
11-34181806-G-A p.Pro645Leu missense ABTB2 5 80176 6.23628E-5 40088 1 4.17279E-5
11-34181807-G-A p.Pro645Ser missense ABTB2 3 80216 3.7399E-5 40108 0 0.00100705
11-34181811-G-A p.Thr643Thr synonymous ABTB2 2 80272 2.49153E-5 40136 0 7.9769E-6
11-34181818-C-T p.Arg641Gln missense ABTB2 2 80274 2.49147E-5 40137 0 7.17841E-5
11-34181818-C-G p.Arg641Pro missense ABTB2 1 80274 1.24573E-5 40137 0 NA
11-34181819-G-A p.Arg641Trp missense ABTB2 4 80380 4.97636E-5 40190 0 0.00100705
11-34181820-G-A p.Ile640Ile synonymous ABTB2 1 80462 1.24282E-5 40231 0 NA
11-34181835-G-A p.Pro635Pro synonymous ABTB2 1 80638 1.24011E-5 40319 0 NA
11-34181849-T-C p.Ser631Gly missense ABTB2 1 80742 1.23851E-5 40371 0 8.3131E-6
11-34181853-A-G p.Tyr629Tyr synonymous ABTB2 253 80740 0.00313351 40370 0 0.00713558
11-34181888-T-G p.Ile618Leu missense ABTB2 1 79982 1.25028E-5 39991 0 NA
11-34181891-C-T p.Val617Ile missense ABTB2 3 79728 3.76279E-5 39864 0 1.59565E-4
11-34181892-G-A p.Ser616Ser synonymous ABTB2 1 79690 1.25486E-5 39845 0 3.98746E-6
11-34181896-T-C p.Asp615Gly missense ABTB2 3 79328 3.78177E-5 39664 0 3.19244E-5
11-34181898-G-A p.Asn614Asn splice_region+synonymous ABTB2 6 79036 7.59148E-5 39518 0 6.37674E-5
11-34181907-GGA-G c.1840-9_1840-8delTC splice_region ABTB2 1 78482 1.27418E-5 39241 0 NA
11-34182457-G-T p.Thr611Asn missense ABTB2 86 82018 0.00104855 41009 0 7.97448E-4
11-34182461-T-G p.Lys610Gln missense ABTB2 2 82112 2.4357E-5 41056 0 9.57182E-5
11-34182471-G-A p.Phe606Phe synonymous ABTB2 2 82100 2.43605E-5 41050 0 1.20855E-5
11-34182476-T-G p.Met605Leu missense ABTB2 6 82180 7.30105E-5 41090 0 3.61109E-5
11-34182491-C-T p.Glu600Lys missense ABTB2 6 82068 7.31101E-5 41034 0 9.56999E-5
11-34182493-G-T p.Thr599Asn missense ABTB2 1 82070 1.21847E-5 41035 0 NA
11-34182497-C-G p.Val598Leu missense ABTB2 13 82070 1.58401E-4 41035 0 3.18837E-4
11-34182500-G-A p.Leu597Leu synonymous ABTB2 1 82042 1.21889E-5 41021 0 NA
11-34182504-C-G p.Glu595Asp missense ABTB2 1 81994 1.2196E-5 40997 0 NA
11-34182507-G-A p.Asn594Asn synonymous ABTB2 8 81886 9.76968E-5 40943 0 7.65355E-4
11-34182517-T-C p.Glu591Gly missense ABTB2 2 81824 2.44427E-5 40912 0 NA
11-34182532-C-G p.Ser586Thr missense ABTB2 2 81620 2.45038E-5 40810 0 8.30882E-6
11-34182561-C-T p.Ser576Ser synonymous ABTB2 5 81530 6.13271E-5 40765 0 0.00125
11-34182567-C-T p.Arg574Arg synonymous ABTB2 1 81522 1.22666E-5 40761 0 7.99297E-6
11-34182569-G-A p.Arg574Trp missense ABTB2 3 81554 3.67854E-5 40777 0 6.25E-4
11-34182570-C-T p.Ser573Ser synonymous ABTB2 6 81536 7.35871E-5 40768 0 5.03525E-4
11-34182570-C-G p.Ser573Ser synonymous ABTB2 1 81538 1.22642E-5 40769 0 NA
11-34182571-G-A p.Ser573Leu missense ABTB2 1 81532 1.22651E-5 40766 0 NA
11-34182576-C-T p.Ser571Ser synonymous ABTB2 3 81566 3.678E-5 40783 0 6.80604E-5
11-34182582-C-T p.Ser569Ser synonymous ABTB2 4 81580 4.90316E-5 40790 0 3.51562E-5
11-34182583-G-A p.Ser569Leu missense ABTB2 4 81548 4.90509E-5 40774 0 1.77311E-5
11-34182599-C-T p.Glu564Lys missense ABTB2 1 81406 1.22841E-5 40703 0 1.84057E-5
11-34182600-G-A p.Ile563Ile synonymous ABTB2 9 81400 1.10565E-4 40700 0 9.67531E-5
11-34182606-G-A p.Ile561Ile synonymous ABTB2 1 81352 1.22923E-5 40676 0 NA
11-34182609-G-A p.His560His synonymous ABTB2 1 81268 1.2305E-5 40634 0 3.81745E-5
11-34182624-G-C p.Val555Val synonymous ABTB2 2 80774 2.47604E-5 40387 0 6.25782E-4
11-34182625-A-G p.Val555Ala missense ABTB2 1 80710 1.239E-5 40355 0 3.20904E-5
11-34182629-C-CCAGTGCCCTCAGCTCCATGGTGATG c.1661-2_1661-1insCATCACCATGGAGCTGAGGGCACTG splice_acceptor ABTB2 1 80682 1.23943E-5 40341 0 NA
11-34182630-T-C c.1661-2A>G splice_acceptor ABTB2 2 80642 2.4801E-5 40321 0 NA
11-34184128-G-C p.Ala552Gly missense ABTB2 4 81928 4.88234E-5 40964 0 8.3149E-6
11-34184129-C-A p.Ala552Ser missense ABTB2 7 81936 8.54325E-5 40968 0 6.37389E-5
11-34184140-A-G p.Met548Thr missense ABTB2 1 82194 1.21663E-5 41097 0 7.98187E-6
11-34184141-T-C p.Met548Val missense ABTB2 1 82220 1.21625E-5 41110 0 NA
11-34184153-C-T p.Val544Met missense ABTB2 5 82338 6.07253E-5 41169 0 3.18715E-5
11-34184154-G-A p.Tyr543Tyr synonymous ABTB2 4 82348 4.85743E-5 41174 0 3.31516E-5
11-34184159-C-T p.Gly542Ser missense ABTB2 1 82382 1.21386E-5 41191 0 4.14346E-5
11-34184160-G-A p.His541His synonymous ABTB2 6 82392 7.28226E-5 41196 0 8.2872E-6
11-34184164-T-C p.Glu540Gly missense ABTB2 1 82418 1.21333E-5 41209 0 NA
11-34184173-T-A p.Tyr537Phe missense ABTB2 5 82412 6.06708E-5 41206 0 0.00100705
11-34184173-T-C p.Tyr537Cys missense ABTB2 2 82412 2.42683E-5 41206 0 NA
11-34184177-A-G p.Tyr536His missense ABTB2 3 82434 3.63928E-5 41217 0 NA
11-34184209-C-T p.Arg525Gln missense ABTB2 4 81948 4.88114E-5 40974 0 6.37836E-5
11-34184218-C-T p.Arg522Gln missense ABTB2 7 81834 8.5539E-5 40917 0 9.56755E-5
11-34184222-C-T p.Val521Met missense ABTB2 7 81742 8.56353E-5 40871 0 8.79803E-5
11-34184222-C-G p.Val521Leu missense ABTB2 1 81742 1.22336E-5 40871 0 3.18898E-5
11-34184223-G-A p.Pro520Pro synonymous ABTB2 2 81772 2.44582E-5 40886 0 4.79666E-5
11-34184225-G-C p.Pro520Ala missense ABTB2 1 81732 1.22351E-5 40866 0 8.33375E-6
11-34184232-G-A p.Ser517Ser synonymous ABTB2 1 81738 1.22342E-5 40869 0 0.00125
11-34184241-G-A p.Gly514Gly synonymous ABTB2 2 81804 2.44487E-5 40902 0 8.33208E-6
11-34184250-C-T p.Ser511Ser synonymous ABTB2 1 81668 1.22447E-5 40834 0 9.5584E-5
11-34184253-C-T p.Ala510Ala synonymous ABTB2 3 81630 3.67512E-5 40815 0 6.37308E-5
11-34184255-C-T p.Ala510Thr missense ABTB2 1 81620 1.22519E-5 40810 0 NA
11-34184258-C-T p.Asp509Asn missense ABTB2 1 81640 1.22489E-5 40820 0 8.33917E-6
11-34184263-T-C p.Glu507Gly missense ABTB2 1 81602 1.22546E-5 40801 0 NA
11-34184264-C-T p.Glu507Lys missense ABTB2 1 81608 1.22537E-5 40804 0 8.3485E-6
11-34184265-CT-C p.Glu506fs frameshift ABTB2 1 81614 1.22528E-5 40807 0 NA
11-34184272-C-T p.Gly504Asp missense ABTB2 3 81498 3.68107E-5 40749 0 4.00744E-6
11-34184274-C-G p.Glu503Asp missense ABTB2 1 81486 1.2272E-5 40743 0 NA
11-34184289-C-T p.Glu498Glu synonymous ABTB2 1 81206 1.23144E-5 40603 0 8.03245E-6
11-34184299-A-G p.Leu495Pro missense ABTB2 2 80880 2.4728E-5 40440 0 NA
11-34184300-G-A p.Leu495Leu synonymous ABTB2 3 80818 3.71204E-5 40409 0 5.03525E-4
11-34184303-C-T p.Val494Met missense ABTB2 1 80726 1.23876E-5 40363 0 4.03506E-6
11-34184307-C-T p.Ala492Ala synonymous ABTB2 227 80556 0.00281792 40278 2 0.00494134
11-34184313-AGCCTGCTGTG-A p.Pro487fs frameshift ABTB2 1 80404 1.24372E-5 40202 0 NA
11-34184321-G-T p.Gln488Lys missense ABTB2 1 80220 1.24657E-5 40110 0 4.07405E-6
11-34184328-C-T p.Thr485Thr synonymous ABTB2 3 79706 3.76383E-5 39853 0 6.37227E-5
11-34184329-G-A p.Thr485Met missense ABTB2 2 79708 2.50916E-5 39854 0 7.51272E-5
11-34184348-C-T p.Val479Ile missense ABTB2 3 78800 3.80711E-5 39400 0 4.60564E-5
11-34186228-G-T c.1430+5C>A splice_region ABTB2 6 80994 7.40796E-5 40497 0 3.18451E-5
11-34186235-G-A p.His476His splice_region+synonymous ABTB2 2 81028 2.46828E-5 40514 0 4.25758E-4
11-34186240-C-T p.Gly475Ser missense ABTB2 3 81070 3.70051E-5 40535 0 1.63404E-5
11-34186241-G-A p.His474His synonymous ABTB2 2 81118 2.46554E-5 40559 0 0.00203874
11-34186256-G-A p.Ser469Ser synonymous ABTB2 1 81356 1.22917E-5 40678 0 6.36983E-5
11-34186267-T-C p.Asn466Asp missense ABTB2 1 81398 1.22853E-5 40699 0 5.35045E-6
11-34186276-C-T p.Glu463Lys missense ABTB2 2 81430 2.4561E-5 40715 0 NA
11-34186277-G-A p.His462His synonymous ABTB2 1 81442 1.22787E-5 40721 0 1.01057E-4
11-34186285-A-G p.Ser460Pro missense ABTB2 2 81402 2.45694E-5 40701 0 9.49632E-5
11-34186289-G-A p.Gly458Gly synonymous ABTB2 1 81478 1.22733E-5 40739 0 2.7946E-5
11-34186297-C-T p.Gly456Ser missense ABTB2 3 81514 3.68035E-5 40757 0 3.18756E-5
11-34186298-G-A p.His455His synonymous ABTB2 4 81536 4.90581E-5 40768 0 1.78939E-5
11-34186320-A-G p.Leu448Pro missense ABTB2 1 81834 1.22199E-5 40917 0 4.77884E-6
11-34186324-G-T p.Pro447Thr missense ABTB2 2 81832 2.44403E-5 40916 0 NA
11-34186327-C-T p.Asp446Asn missense ABTB2 1 81760 1.22309E-5 40880 0 6.37877E-5
11-34186330-C-T p.Ala445Thr missense ABTB2 7 81764 8.56122E-5 40882 0 0.00254323
11-34186331-G-A p.Gly444Gly synonymous ABTB2 201 81786 0.00245763 40893 0 0.00503698
11-34186333-C-T p.Gly444Ser missense ABTB2 1 81848 1.22178E-5 40924 0 NA
11-34186335-C-T p.Arg443Gln missense ABTB2 2 81878 2.44266E-5 40939 0 3.18837E-5
11-34186335-C-G p.Arg443Pro missense ABTB2 1 81878 1.22133E-5 40939 0 NA
11-34186336-G-A p.Arg443* stop_gained ABTB2 1 81864 1.22154E-5 40932 0 NA
11-34186340-C-T p.Leu441Leu synonymous ABTB2 1 81908 1.22088E-5 40954 0 9.27068E-6
11-34186374-A-G c.1295-6T>C splice_region ABTB2 1 81792 1.22261E-5 40896 0 NA
11-34186811-C-T p.Ala430Ala synonymous ABTB2 13 79058 1.64436E-4 39529 0 2.82247E-4
11-34186817-G-A p.Ala428Ala synonymous ABTB2 1 79624 1.2559E-5 39812 0 NA
11-34186832-C-T p.Thr423Thr synonymous ABTB2 2 80060 2.49813E-5 40030 0 5.46687E-5
11-34186833-G-A p.Thr423Met missense ABTB2 3 80172 3.74195E-5 40086 0 1.0725E-4
11-34186838-C-T p.Ala421Ala synonymous ABTB2 2 80336 2.48954E-5 40168 0 6.25E-4
11-34186839-G-A p.Ala421Val missense ABTB2 1 80360 1.2444E-5 40180 0 NA
11-34186841-A-G p.Tyr420Tyr synonymous ABTB2 1 80508 1.24211E-5 40254 0 3.18837E-5
11-34186841-A-C p.Tyr420* stop_gained ABTB2 1 80508 1.24211E-5 40254 0 NA
11-34186852-C-T p.Glu417Lys missense ABTB2 1 80618 1.24042E-5 40309 0 8.84956E-5
11-34186853-G-A p.Gly416Gly synonymous ABTB2 10 80612 1.24051E-4 40306 0 6.25E-4
11-34186856-G-A p.Gly415Gly synonymous ABTB2 1 80784 1.23787E-5 40392 0 1.24327E-4
11-34186858-C-T p.Gly415Ser missense ABTB2 1 80834 1.2371E-5 40417 0 1.51728E-5
11-34186859-G-A p.Asn414Asn synonymous ABTB2 2 80864 2.47329E-5 40432 0 6.3743E-5
11-34186872-C-T p.Gly410Asp missense ABTB2 3 80936 3.70663E-5 40468 0 1.05574E-4
11-34186876-C-T p.Glu409Lys missense ABTB2 2 81008 2.46889E-5 40504 0 6.89275E-5
11-34186877-G-A p.Val408Val synonymous ABTB2 14 80974 1.72895E-4 40487 0 1.02466E-4
11-34186881-T-G p.His407Pro missense ABTB2 2 80954 2.47054E-5 40477 0 NA
11-34188798-G-A c.1197+8C>T splice_region ABTB2 1 76060 1.31475E-5 38030 0 NA
11-34188799-A-T c.1197+7T>A splice_region ABTB2 1 76130 1.31354E-5 38065 0 NA
11-34188800-G-T c.1197+6C>A splice_region ABTB2 1 76304 1.31055E-5 38152 0 NA
11-34188820-T-A p.Ile395Phe missense ABTB2 1 78872 1.26788E-5 39436 0 NA
11-34188821-G-A p.His394His synonymous ABTB2 1 78934 1.26688E-5 39467 0 1.09357E-5
11-34188826-C-T p.Gly393Arg missense ABTB2 1 79374 1.25986E-5 39687 0 4.03864E-6
11-34188827-A-G p.His392His synonymous ABTB2 3 79480 3.77453E-5 39740 0 3.629E-5
11-34188829-G-T p.His392Asn missense ABTB2 1 79562 1.25688E-5 39781 0 4.02943E-6
11-34188832-G-A p.Leu391Leu synonymous ABTB2 1 79662 1.2553E-5 39831 0 4.02732E-6
11-34188838-C-A p.Ala389Ser missense ABTB2 1 79756 1.25382E-5 39878 0 4.01752E-6
11-34188839-G-A p.Phe388Phe synonymous ABTB2 7 79908 8.76007E-5 39954 0 4.01545E-5
11-34188862-G-A p.Arg381Trp missense ABTB2 7 79968 8.7535E-5 39984 0 9.55353E-5
11-34188868-C-T p.Asp379Asn missense ABTB2 14 79808 1.75421E-4 39904 0 1.27453E-4
11-34188869-G-A p.Pro378Pro synonymous ABTB2 3 79712 3.76355E-5 39856 0 0.0010101
11-34188877-T-C p.Ile376Val missense ABTB2 2 79632 2.51155E-5 39816 0 8.09964E-5
11-34188897-T-A p.Asn369Ile missense ABTB2 1 78884 1.26768E-5 39442 0 9.44733E-6
11-34188905-A-C p.Val366Val splice_region+synonymous ABTB2 3 78294 3.83171E-5 39147 0 5.04032E-4
11-34189447-C-T c.1095+3G>A splice_region ABTB2 10 82918 1.20601E-4 41459 0 3.50229E-4
11-34189451-T-C p.Gln365Arg missense+splice_region ABTB2 4 82958 4.82172E-5 41479 2 2.49983E-5
11-34189467-C-T p.Ala360Thr missense ABTB2 1 83046 1.20415E-5 41523 0 8.28926E-6
11-34189472-G-C p.Ala358Gly missense ABTB2 1 83070 1.2038E-5 41535 0 3.9782E-6
11-34189479-T-C p.Ile356Val missense ABTB2 1 83100 1.20337E-5 41550 0 NA
11-34189483-CA-C p.Met354fs frameshift ABTB2 1 83126 1.20299E-5 41563 0 NA
11-34189486-C-A p.Gln353His missense ABTB2 2 83150 2.40529E-5 41575 0 NA
11-34189489-G-A p.Val352Val synonymous ABTB2 1 83128 1.20296E-5 41564 0 8.27691E-6
11-34189495-C-T p.Ala350Ala synonymous ABTB2 6 83114 7.219E-5 41557 0 6.3678E-5
11-34189495-C-A p.Ala350Ala synonymous ABTB2 1 83114 1.20317E-5 41557 0 3.97833E-6
11-34189501-G-A p.Asp348Asp synonymous ABTB2 104 83100 0.0012515 41550 0 0.00337472
11-34189512-C-T p.Ala345Thr missense ABTB2 34 83096 4.09165E-4 41548 0 6.25E-4
11-34189513-G-A p.Cys344Cys synonymous ABTB2 6 83088 7.22126E-5 41544 0 6.76455E-5
11-34189514-C-T p.Cys344Tyr missense ABTB2 1 83092 1.20349E-5 41546 0 NA
11-34189518-C-T p.Ala343Thr missense ABTB2 4 83066 4.81545E-5 41533 0 2.22859E-4
11-34189518-C-A p.Ala343Ser missense ABTB2 3 83066 3.61159E-5 41533 0 3.32474E-5
11-34189519-G-A p.Tyr342Tyr synonymous ABTB2 7 83046 8.42906E-5 41523 0 3.32696E-5
11-34189530-G-T p.Pro339Thr missense ABTB2 1 83000 1.20482E-5 41500 0 5.03525E-4
11-34189532-G-A p.Thr338Met missense ABTB2 2 82970 2.41051E-5 41485 0 3.33923E-5
11-34189536-T-C p.Met337Val missense ABTB2 2 82950 2.41109E-5 41475 0 9.55414E-5
11-34189541-T-TGGTCATCCATGGTGTTAACCCCATCCG c.1006-3_1006-2insCGGATGGGGTTAACACCATGGATGACC splice_region ABTB2 2 82874 2.4133E-5 41437 1 NA
11-34189543-A-G c.1006-4T>C splice_region ABTB2 12 82818 1.44896E-4 41409 0 6.25E-4
11-34189546-A-G c.1006-7T>C splice_region ABTB2 3 82734 3.62608E-5 41367 0 2.39563E-5
11-34192446-G-A c.1005+7C>T splice_region ABTB2 2 81420 2.4564E-5 40710 0 NA
11-34192448-C-T c.1005+5G>A splice_region ABTB2 2 81454 2.45537E-5 40727 0 8.45867E-5
11-34192459-A-C p.Asp333Glu missense ABTB2 2 81788 2.44535E-5 40894 0 1.20244E-5
11-34192473-C-G p.Val329Leu missense ABTB2 1 82054 1.21871E-5 41027 0 8.26747E-6
11-34192480-C-T p.Pro326Pro synonymous ABTB2 72 82166 8.76275E-4 41083 0 0.00143285
11-34192481-G-A p.Pro326Leu missense ABTB2 2 82230 2.4322E-5 41115 0 3.98648E-6
11-34192484-C-T p.Gly325Asp missense ABTB2 1 82230 1.2161E-5 41115 0 7.97264E-6
11-34192495-G-A p.Ile321Ile synonymous ABTB2 1 82500 1.21212E-5 41250 0 3.18552E-5
11-34192504-G-A p.Asn318Asn synonymous ABTB2 2 82668 2.41932E-5 41334 0 1.64851E-5
11-34192508-A-T p.Ile317Asn missense ABTB2 2 82734 2.41739E-5 41367 0 3.98054E-6
11-34192516-C-T p.Thr314Thr synonymous ABTB2 4 82834 4.82893E-5 41417 0 5.57205E-5
11-34192517-G-A p.Thr314Met missense ABTB2 2 82880 2.41313E-5 41440 0 8.24198E-6
11-34192531-G-A p.Leu309Leu synonymous ABTB2 2 82984 2.4101E-5 41492 0 6.76423E-5
11-34192538-C-T p.Arg307His missense ABTB2 1 83006 1.20473E-5 41503 0 1.31872E-4
11-34192539-G-A p.Arg307Cys missense ABTB2 3 83010 3.61402E-5 41505 0 3.18512E-5
11-34192554-G-C p.Gln302Glu missense ABTB2 1 83036 1.2043E-5 41518 0 5.57041E-5
11-34192578-G-A p.Arg294* stop_gained ABTB2 1 82846 1.20706E-5 41423 0 3.18552E-5
11-34192584-C-T p.Asp292Asn missense ABTB2 1 82886 1.20648E-5 41443 0 3.18471E-5
11-34192593-G-A p.Arg289Trp missense ABTB2 1 82822 1.20741E-5 41411 0 2.3893E-5
11-34192609-G-C p.His283Gln missense ABTB2 1 82594 1.21074E-5 41297 0 NA
11-34192614-C-T p.Glu282Lys missense ABTB2 1 82516 1.21189E-5 41258 0 1.66412E-5
11-34194707-C-T p.Gln278Gln synonymous ABTB2 1 82000 1.21951E-5 41000 0 3.18715E-5
11-34194721-A-C p.Cys274Gly missense ABTB2 2 82358 2.42842E-5 41179 0 NA
11-34194722-G-A n.565C>T splice_region ABTB2 1 82356 1.21424E-5 41178 0 3.18634E-5
11-34194724-C-T p.Asp273Asn missense ABTB2 2 82384 2.42766E-5 41192 0 NA
11-34194741-A-T p.Leu267Gln missense ABTB2 1 82276 1.21542E-5 41138 0 NA
11-34194744-C-T p.Arg266Gln missense ABTB2 2 82300 2.43013E-5 41150 0 6.06817E-5
11-34194753-T-A p.Gln263Leu missense ABTB2 2 82312 2.42978E-5 41156 0 3.18735E-5
11-34194764-G-A p.Gly259Gly synonymous ABTB2 1 82192 1.21666E-5 41096 0 1.78126E-5
11-34194766-C-T p.Gly259Ser missense ABTB2 2 82188 2.43345E-5 41094 0 0.001875
11-34194767-G-A p.Ser258Ser synonymous ABTB2 4 82150 4.86914E-5 41075 0 2.01563E-5
11-34194772-C-A p.Asp257Tyr missense ABTB2 4 82146 4.86938E-5 41073 0 5.05051E-4
11-34194775-C-T p.Val256Met missense ABTB2 8 82102 9.74398E-5 41051 0 3.6331E-5
11-34194776-G-A p.Thr255Thr synonymous ABTB2 1 82112 1.21785E-5 41056 0 3.18552E-5
11-34194787-G-A p.Arg252Cys missense ABTB2 1 81934 1.22049E-5 40967 0 NA
11-34194789-C-T p.Arg251His missense ABTB2 6 81838 7.33156E-5 40919 0 1.02474E-4
11-34194790-G-A p.Arg251Cys missense ABTB2 1 81860 1.2216E-5 40930 0 5.06586E-4
11-34194799-C-A p.Ala248Ser missense ABTB2 1 81656 1.22465E-5 40828 0 NA
11-34194801-T-C p.Tyr247Cys missense ABTB2 1 81660 1.22459E-5 40830 0 NA
11-34194803-G-A p.Thr246Thr synonymous ABTB2 1 81672 1.22441E-5 40836 0 NA
11-34194808-T-A p.Ile245Phe missense ABTB2 3 81596 3.67665E-5 40798 0 1.19446E-5
11-34194810-G-A p.Ala244Val missense ABTB2 1 81512 1.22681E-5 40756 0 4.19231E-6
11-34194814-C-T p.Val243Met missense ABTB2 2 81354 2.45839E-5 40677 0 6.37267E-5
11-34194816-C-T p.Arg242His missense ABTB2 1 81240 1.23092E-5 40620 0 2.58491E-5
11-34194817-G-A p.Arg242Cys missense ABTB2 2 81212 2.46269E-5 40606 0 NA
11-34194828-A-G p.Met238Thr missense ABTB2 1 81152 1.23226E-5 40576 0 4.35859E-6
11-34194833-G-A p.Pro236Pro synonymous ABTB2 1 81080 1.23335E-5 40540 0 8.8581E-6
11-34194836-C-T p.Pro235Pro synonymous ABTB2 1 80964 1.23512E-5 40482 0 3.21264E-5
11-34194851-G-C p.Pro230Pro synonymous ABTB2 1 80854 1.2368E-5 40427 0 0.00202429
11-34194854-C-T p.Arg229Arg splice_region+synonymous ABTB2 1 80688 1.23934E-5 40344 0 NA
11-34194859-GGGGCAGCAGAGAGAGGGTCAGGCCTGGGGTGGGGTCCCTGCA-G c.687-47_687-6delTGCAGGGACCCCACCCCAGGCCTGACCCTCTCTCTGCTGCCC splice_region ABTB2 4 80580 4.96401E-5 40290 0 9.84649E-5
11-34218865-T-A c.686+7A>T splice_region ABTB2 1 82924 1.20592E-5 41462 0 8.29463E-6
11-34218867-C-T c.686+5G>A splice_region ABTB2 2 82968 2.41057E-5 41484 0 8.29339E-6
11-34218872-C-T p.Arg229Gln missense+splice_region ABTB2 1 83024 1.20447E-5 41512 0 1.59257E-5
11-34218873-G-A p.Arg229Trp missense+splice_region ABTB2 6 83052 7.22439E-5 41526 0 0.00100705
11-34218874-T-C p.Glu228Glu splice_region+synonymous ABTB2 2 83060 2.4079E-5 41530 0 NA
11-34218881-T-C p.Asn226Ser missense ABTB2 1 83094 1.20346E-5 41547 0 NA
11-34218887-G-A p.Thr224Ile missense ABTB2 1 83104 1.20331E-5 41552 0 NA
11-34218895-C-CG p.Arg222fs frameshift ABTB2 1 83112 1.2032E-5 41556 0 NA
11-34218895-C-T p.Pro221Pro synonymous ABTB2 1 83114 1.20317E-5 41557 0 1.65815E-5
11-34218901-G-C p.Asp219Glu missense ABTB2 2 83104 2.40662E-5 41552 0 3.1902E-5
11-34218906-G-A p.Leu218Leu synonymous ABTB2 1 83116 1.20314E-5 41558 0 8.28803E-6
11-34218912-G-A p.Pro216Ser missense ABTB2 1 83124 1.20302E-5 41562 0 NA
11-34218916-C-T p.Glu214Glu synonymous ABTB2 1 83142 1.20276E-5 41571 0 3.1902E-5
11-34218923-G-A p.Ser212Phe missense ABTB2 1 83146 1.2027E-5 41573 0 8.29793E-6
11-34218927-C-A p.Glu211* stop_gained ABTB2 1 83134 1.20288E-5 41567 0 NA
11-34218950-T-C p.Tyr203Cys missense ABTB2 4 82986 4.82009E-5 41493 0 3.19305E-5
11-34218951-A-C p.Tyr203Asp missense ABTB2 2 82996 2.40975E-5 41498 0 NA
11-34218952-G-A p.Tyr202Tyr synonymous ABTB2 1 82984 1.20505E-5 41492 0 NA
11-34218955-G-C p.Leu201Leu synonymous ABTB2 1 82916 1.20604E-5 41458 0 NA
11-34218958-C-T p.Thr200Thr synonymous ABTB2 2 82710 2.41809E-5 41355 0 5.04032E-4
11-34218959-G-A p.Thr200Met missense ABTB2 10 82708 1.20907E-4 41354 0 5.04032E-4
11-34218965-A-G p.Leu198Pro missense ABTB2 1 82386 1.2138E-5 41193 0 8.48119E-6
11-34218969-C-T p.Ala197Thr missense ABTB2 1 81866 1.22151E-5 40933 0 8.525E-6
11-34218970-G-A p.Asp196Asp synonymous ABTB2 4 81686 4.8968E-5 40843 0 9.37511E-5
11-34218972-C-T p.Asp196Asn missense ABTB2 11 81408 1.35122E-4 40704 0 6.25E-4
11-34218973-G-A p.Pro195Pro synonymous ABTB2 23 81016 2.83895E-4 40508 0 1.82634E-4
11-34218975-G-C p.Pro195Ala missense ABTB2 1 80648 1.23996E-5 40324 0 4.05979E-5
11-34218977-G-A p.Ser194Phe missense ABTB2 1 80288 1.24552E-5 40144 0 NA
11-34218985-G-T p.Ile191Ile synonymous ABTB2 1 79726 1.2543E-5 39863 0 NA
11-34218997-C-T p.Pro187Pro synonymous ABTB2 9 78640 1.14446E-4 39320 0 1.98595E-4
11-34219001-T-C p.Gln186Arg missense ABTB2 1 77982 1.28235E-5 38991 0 9.50227E-6
11-34219004-C-T p.Arg185His missense ABTB2 1 77222 1.29497E-5 38611 0 3.51124E-5
11-34219010-T-C p.Gln183Arg missense ABTB2 2 76442 2.61636E-5 38221 0 9.6406E-6
11-34219011-G-T p.Gln183Lys missense ABTB2 1 76302 1.31058E-5 38151 0 NA
11-34219013-C-T p.Arg182His missense ABTB2 2 75504 2.64887E-5 37752 0 3.55745E-5
11-34219014-G-A p.Arg182Cys missense ABTB2 2 75532 2.64788E-5 37766 0 2.23992E-5
11-34219030-C-T p.Pro176Pro synonymous ABTB2 3 71838 4.17606E-5 35919 0 8.82982E-5
11-34219031-G-A p.Pro176Leu missense ABTB2 6 72180 8.31255E-5 36090 0 7.98107E-5
11-34219035-A-G p.Cys175Arg missense ABTB2 1 71120 1.40607E-5 35560 0 1.88516E-5
11-34219036-C-A p.Leu174Leu synonymous ABTB2 2 71038 2.81539E-5 35519 0 3.45925E-5
11-34219040-G-A p.Pro173Leu missense ABTB2 2 70708 2.82853E-5 35354 0 3.19489E-5
11-34219045-A-G p.Arg171Arg synonymous ABTB2 94 68500 0.00137226 34250 1 0.00404449
11-34219046-C-T p.Arg171His missense ABTB2 28 67816 4.12882E-4 33908 0 9.30203E-4
11-34219047-G-A p.Arg171Cys missense ABTB2 1 67342 1.48496E-5 33671 0 6.40041E-5
11-34219090-T-TG c.473-6_473-5insC splice_region ABTB2 1 57928 1.72628E-5 28964 0 NA
11-34219091-G-C c.473-6C>G splice_region ABTB2 33 58406 5.6501E-4 29203 0 7.3384E-4
11-34219092-G-T c.473-7C>A splice_region ABTB2 1 58478 1.71004E-5 29239 0 NA
11-34226098-C-T p.Ser155Ser synonymous ABTB2 9 82804 1.0869E-4 41402 0 5.03525E-4
11-34226099-G-A p.Ser155Leu missense ABTB2 1 82814 1.20753E-5 41407 0 3.65106E-5
11-34226121-C-T p.Ala148Thr missense ABTB2 1 82794 1.20782E-5 41397 0 4.01465E-6
11-34226140-G-T p.Thr141Thr synonymous ABTB2 1087 82700 0.0131439 41350 41 0.0256369
11-34226141-G-A p.Thr141Ile missense ABTB2 1 82708 1.20907E-5 41354 0 NA
11-34226144-C-T p.Arg140Gln missense ABTB2 5 82678 6.04756E-5 41339 0 5.03525E-4
11-34226160-C-A p.Ala135Ser missense ABTB2 4 82494 4.84884E-5 41247 0 1.6774E-5
11-34226170-G-A p.Ala131Ala synonymous ABTB2 1 82102 1.218E-5 41051 0 2.04008E-5
11-34226174-C-T p.Arg130Gln missense ABTB2 4 81736 4.8938E-5 40868 0 1.71487E-4
11-34226178-C-T p.Glu129Lys missense ABTB2 5 80752 6.1918E-5 40376 0 8.80421E-6
11-34226179-G-A p.Asp128Asp synonymous ABTB2 1 80518 1.24196E-5 40259 0 6.39141E-5
11-34226187-C-T p.Gly126Ser missense ABTB2 4 80748 4.95368E-5 40374 0 2.05909E-5
11-34226188-C-T p.Leu125Leu synonymous ABTB2 1 80672 1.23959E-5 40336 0 3.71873E-5
11-34226194-C-A p.Gly123Gly synonymous ABTB2 41 81894 5.00647E-4 40947 0 6.05558E-4
11-34226196-C-T p.Gly123Arg missense ABTB2 3 82512 3.63583E-5 41256 0 2.00359E-5
11-34226197-G-A p.Gly122Gly synonymous ABTB2 1 82518 1.21186E-5 41259 0 3.38656E-5
11-34226199-C-T p.Gly122Ser missense ABTB2 1 82588 1.21083E-5 41294 0 3.18695E-5
11-34226200-G-C p.Asn121Lys missense ABTB2 2 82542 2.42301E-5 41271 0 2.537E-5
11-34226204-T-A p.Tyr120Phe missense ABTB2 1 82702 1.20916E-5 41351 0 NA
11-34226210-C-T p.Ser118Asn missense ABTB2 1 82702 1.20916E-5 41351 0 1.2024E-5
11-34226220-C-T p.Ala115Thr missense ABTB2 2 82630 2.42043E-5 41315 0 3.40849E-5
11-34226221-G-A p.Pro114Pro synonymous ABTB2 2 82640 2.42014E-5 41320 0 4.42225E-5
11-34226238-C-CATTGGCGTTCTTGCCGCAGATGAGATGCTCA c.326-2_326-1insTGAGCATCTCATCTGCGGCAAGAACGCCAAT splice_acceptor ABTB2 2 82536 2.42319E-5 41268 1 NA
11-34226244-G-A c.326-7C>T splice_region ABTB2 9 82426 1.09189E-4 41213 0 8.66341E-5
11-34378253-G-A p.Ala107Val missense ABTB2 2 80294 2.49085E-5 40147 0 4.30182E-5
11-34378295-C-T p.Gly93Asp missense ABTB2 1 81152 1.23226E-5 40576 0 NA
11-34378306-G-T p.Ala89Ala synonymous ABTB2 47 81290 5.78177E-4 40645 0 0.00146572
11-34378306-G-A p.Ala89Ala synonymous ABTB2 1 81290 1.23016E-5 40645 0 NA
11-34378323-C-T p.Val84Ile missense ABTB2 1 81626 1.2251E-5 40813 0 NA
11-34378342-A-C p.Ser77Ser synonymous ABTB2 3 81664 3.67359E-5 40832 0 4.54463E-5
11-34378344-A-G p.Ser77Pro missense ABTB2 1 81572 1.22591E-5 40786 0 1.14964E-5
11-34378345-C-T p.Val76Val synonymous ABTB2 38 81584 4.65778E-4 40792 0 2.89466E-4
11-34378351-C-A p.Gly74Gly synonymous ABTB2 1 81756 1.22315E-5 40878 0 NA
11-34378357-T-C p.Gly72Gly synonymous ABTB2 58 81628 7.10541E-4 40814 0 0.00114745
11-34378360-G-C p.Ala71Ala synonymous ABTB2 1 81650 1.22474E-5 40825 0 NA
11-34378363-C-T p.Gly70Gly synonymous ABTB2 1 81712 1.22381E-5 40856 0 NA
11-34378368-C-T p.Gly69Arg missense ABTB2 5 81716 6.11875E-5 40858 0 NA
11-34378379-CTG-TTC p.HisSer64GlnAsn missense ABTB2 1 81770 1.22294E-5 40885 0 NA
11-34378379-C-T p.Ser65Asn missense ABTB2 2 81770 2.44588E-5 40885 0 4.99975E-5
11-34378381-G-C p.His64Gln missense ABTB2 8415 81654 0.103057 40827 647 0.12284
11-34378383-G-A p.His64Tyr missense ABTB2 6 81758 7.33873E-5 40879 0 3.18512E-5
11-34378389-C-T p.Ala62Thr missense ABTB2 3 81678 3.67296E-5 40839 0 9.30505E-5
11-34378401-C-G p.Ala58Pro missense ABTB2 1 81686 1.2242E-5 40843 0 4.32253E-6
11-34378423-C-T p.Glu50Glu synonymous ABTB2 1 81654 1.22468E-5 40827 0 6.25E-4
11-34378425-C-G p.Glu50Gln missense ABTB2 1 81622 1.22516E-5 40811 0 1.41343E-5
11-34378428-T-C p.Met49Val missense ABTB2 14 81594 1.71581E-4 40797 0 1.91168E-4
11-34378428-T-G p.Met49Leu missense ABTB2 1 81594 1.22558E-5 40797 0 NA
11-34378429-G-A p.Cys48Cys synonymous ABTB2 22 81574 2.69694E-4 40787 0 4.77768E-4
11-34378450-T-C p.Ala41Ala synonymous ABTB2 4 81324 4.9186E-5 40662 0 1.32181E-5
11-34378467-G-T p.Arg36Ser missense ABTB2 1 80998 1.2346E-5 40499 0 NA
11-34378481-G-A p.Thr31Ile missense ABTB2 1 80914 1.23588E-5 40457 0 8.95448E-6
11-34378505-C-A p.Arg23Leu missense ABTB2 3 80784 3.71361E-5 40392 0 1.88793E-5
11-34378524-G-A p.Leu17Phe missense ABTB2 2 80612 2.48102E-5 40306 0 NA
11-34378526-C-T p.Gly16Asp missense ABTB2 2 80528 2.48361E-5 40264 0 2.89009E-5
11-34378540-C-T p.Lys11Lys synonymous ABTB2 1 80510 1.24208E-5 40255 0 NA
11-34378543-G-A p.Gly10Gly synonymous ABTB2 2 80458 2.48577E-5 40229 0 NA
11-34378544-C-A p.Gly10Val missense ABTB2 3 80460 3.72856E-5 40230 0 2.57003E-5
11-34378547-C-A p.Arg9Leu missense ABTB2 985 80382 0.012254 40191 6 0.0212917
11-34378548-G-A p.Arg9Trp missense ABTB2 1 80382 1.24406E-5 40191 0 0.00152905
11-34378553-A-G p.Leu7Pro missense ABTB2 1 80298 1.24536E-5 40149 0 NA
11-34378559-T-C p.Asp5Gly missense ABTB2 3 80206 3.74037E-5 40103 0 NA
11-34378567-G-A p.Ser2Ser synonymous ABTB2 3 80034 3.74841E-5 40017 0 8.57854E-5
11-34378578-A-G p.Tyr185His missense ABTB2 4 79790 5.01316E-5 39895 0 0.00256148
11-34378579-C-G p.Leu184Leu synonymous ABTB2 23 79766 2.88343E-4 39883 0 3.50475E-4
11-34378583-G-A p.Ser183Phe missense ABTB2 1 79490 1.25802E-5 39745 0 NA
11-34378589-G-A p.Ala181Val missense ABTB2 1 78962 1.26643E-5 39481 0 NA
11-34378607-G-A p.Ala175Val missense ABTB2 4 77860 5.13743E-5 38930 0 7.39831E-6
11-34378608-C-A p.Ala175Ser missense ABTB2 1 77852 1.28449E-5 38926 0 7.46102E-6
11-34378609-G-C p.Cys174Trp missense ABTB2 1 77830 1.28485E-5 38915 0 NA
11-34378627-C-T p.Trp168* stop_gained ABTB2 1 76928 1.29992E-5 38464 0 NA
11-34378634-T-A p.His166Leu missense ABTB2 2 76604 2.61083E-5 38302 0 3.18512E-5
11-34378637-A-C p.Val165Gly missense ABTB2 1 76474 1.30763E-5 38237 0 NA
11-34378639-C-T p.Leu164Leu synonymous ABTB2 3 76408 3.92629E-5 38204 0 1.60725E-5
11-34378642-G-A p.Arg163Arg synonymous ABTB2 2 76148 2.62646E-5 38074 0 NA
11-34378659-C-A p.Val158Leu missense ABTB2 1 75236 1.32915E-5 37618 0 NA
11-34378661-T-C p.Glu157Gly missense ABTB2 1 75174 1.33025E-5 37587 0 6.07533E-4
11-34378664-A-G p.Phe156Ser missense ABTB2 2 75066 2.66432E-5 37533 0 NA
11-34378668-G-A p.Arg155Cys missense ABTB2 1 74810 1.33672E-5 37405 0 3.18512E-5
11-34378679-G-A p.Ala151Val missense ABTB2 1 74264 1.34655E-5 37132 0 9.26922E-6
11-34378685-A-G p.Leu149Pro missense ABTB2 1 74020 1.35099E-5 37010 0 NA
11-34378708-G-A p.Arg141Arg synonymous ABTB2 82 72698 0.00112795 36349 0 0.0026133
11-34378719-G-T p.Arg138Ser missense ABTB2 3 72626 4.13075E-5 36313 0 1.99768E-5
11-34378727-G-C p.Ala135Gly missense ABTB2 1 72534 1.37866E-5 36267 0 NA
11-34378733-C-T p.Arg133His missense ABTB2 1 72514 1.37904E-5 36257 0 NA
11-34378736-A-G p.Leu132Pro missense ABTB2 3 72684 4.12746E-5 36342 0 5.73723E-4
11-34378737-G-A p.Leu132Phe missense ABTB2 5 72624 6.88478E-5 36312 0 1.2747E-4
11-34378744-G-C p.Ala129Ala synonymous ABTB2 1 72796 1.3737E-5 36398 0 NA
11-34378745-G-A p.Ala129Val missense ABTB2 1 72778 1.37404E-5 36389 0 6.37674E-5
11-34378749-G-C p.Leu128Val missense ABTB2 2 73026 2.73875E-5 36513 0 1.88115E-5
11-34378759-C-T p.Ala124Ala synonymous ABTB2 1 73530 1.35999E-5 36765 0 2.81088E-5
11-34378762-C-T p.Glu123Glu synonymous ABTB2 3 73718 4.06956E-5 36859 0 9.55901E-5
11-34378763-T-A p.Glu123Val missense ABTB2 1 73684 1.35715E-5 36842 0 NA
11-34378764-C-G p.Glu123Gln missense ABTB2 166 73734 0.00225134 36867 0 0.00405351
11-34378767-C-G p.Ala122Pro missense ABTB2 2 73878 2.70717E-5 36939 0 3.18756E-5
11-34378777-G-C p.Pro118Pro synonymous ABTB2 1 74296 1.34597E-5 37148 0 3.18796E-5
11-34378778-G-A p.Pro118Leu missense ABTB2 1 74270 1.34644E-5 37135 0 NA
11-34378784-C-T p.Arg116Gln missense ABTB2 4 74484 5.37028E-5 37242 0 2.97654E-5
11-34378796-G-A p.Ala112Val missense ABTB2 16 75268 2.12574E-4 37634 0 6.30517E-4
11-34378803-T-G p.Lys110Gln missense ABTB2 1 75608 1.32261E-5 37804 0 NA
11-34378811-A-C p.Val107Gly missense ABTB2 1 75700 1.321E-5 37850 0 NA
11-34378812-C-G p.Val107Leu missense ABTB2 1 75824 1.31884E-5 37912 0 NA
11-34378814-C-G p.Arg106Pro missense ABTB2 1 75874 1.31797E-5 37937 0 NA
11-34378815-G-A p.Arg106Trp missense ABTB2 1 75900 1.31752E-5 37950 0 6.27353E-4
11-34378822-G-A p.Asp103Asp synonymous ABTB2 1 76000 1.31579E-5 38000 0 NA
11-34378825-TC-T p.Gly102fs frameshift ABTB2 1 76062 1.31472E-5 38031 0 NA
11-34378826-C-T p.Gly102Glu missense ABTB2 2 76082 2.62874E-5 38041 0 NA
11-34378831-G-C p.Thr100Thr synonymous ABTB2 1 76120 1.31372E-5 38060 0 9.654E-6
11-34378865-G-A p.Pro89Leu missense ABTB2 1 76354 1.30969E-5 38177 0 NA
11-34378871-C-A p.Arg87Leu missense ABTB2 1 76350 1.30976E-5 38175 0 NA
11-34378872-G-A p.Arg87Cys missense ABTB2 1 76358 1.30962E-5 38179 0 NA
11-34378874-G-A p.Ser86Leu missense ABTB2 4 76360 5.23834E-5 38180 0 3.18573E-5
11-34378903-G-A p.Pro76Pro synonymous ABTB2 1 76374 1.30935E-5 38187 0 NA
11-34378908-G-A p.Leu75Leu synonymous ABTB2 2 76376 2.61862E-5 38188 0 1.41719E-5
11-34378924-G-A p.Asp69Asp synonymous ABTB2 1 76362 1.30955E-5 38181 0 0.0013587
11-34378931-C-T p.Ser67Asn missense ABTB2 1 76348 1.30979E-5 38174 0 NA
11-34378949-A-G p.Met61Thr missense ABTB2 2 75756 2.64005E-5 37878 0 7.8064E-5
11-34378951-G-A p.Ser60Ser synonymous ABTB2 1 75748 1.32017E-5 37874 0 NA
11-34378956-C-A p.Gly59Cys missense ABTB2 1 75632 1.32219E-5 37816 0 NA
11-34378960-G-A p.Tyr57Tyr synonymous ABTB2 1 75530 1.32398E-5 37765 0 3.18593E-5
11-34378962-A-G p.Tyr57His missense ABTB2 1 75504 1.32443E-5 37752 0 2.89268E-4
11-34378979-C-T p.Gly51Glu missense ABTB2 3 75112 3.99404E-5 37556 0 NA
11-34378988-T-A p.Gln48Leu missense ABTB2 1 74764 1.33754E-5 37382 0 NA
11-34379008-C-A p.Ala41Ala synonymous ABTB2 2 73826 2.70907E-5 36913 0 NA
11-34379012-T-C p.Gln40Arg missense ABTB2 2 73588 2.71783E-5 36794 0 6.25E-4
11-34379018-T-C p.Asn38Ser missense ABTB2 1 73274 1.36474E-5 36637 0 NA
11-34379063-GC-G p.Ala23fs frameshift ABTB2 1 67906 1.47262E-5 33953 0 NA
11-34379082-A-G p.Leu17Leu synonymous ABTB2 2 66394 3.01232E-5 33197 0 7.48682E-6
11-34379091-C-T p.Asp14Asn missense ABTB2 1 65264 1.53224E-5 32632 0 NA
11-34379105-A-G p.Leu9Pro missense ABTB2 1 64188 1.55792E-5 32094 0 NA
11-34379117-T-G p.Tyr5Ser missense ABTB2 2 62688 3.1904E-5 31344 0 3.18634E-5
11-34379123-C-A p.Gly3Val missense ABTB2 3 62078 4.83263E-5 31039 0 NA
11-34379123-C-T p.Gly3Glu missense ABTB2 1 62078 1.61088E-5 31039 0 NA
11-34379125-G-A p.Ala2Ala synonymous ABTB2 1 62050 1.6116E-5 31025 0 NA
11-34379280-G-A c.-150C>T 5_prime_UTR_premature_start_codon_gain ABTB2 3109 29644 0.104878 14822 37 0.105618
11-34379327-C-T c.-197G>A 5_prime_UTR_premature_start_codon_gain ABTB2 1 20192 4.95246E-5 10096 0 NA
11-34379503-G-A c.-373C>T 5_prime_UTR_premature_start_codon_gain ABTB2 124 1372 0.090379 686 5 0.123099