Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
3-127391779-G-T c.-90G>T 5_prime_UTR_premature_start_codon_gain ABTB1 1 37600 2.65957E-5 18800 0 NA
3-127391813-C-T c.-56C>T 5_prime_UTR_premature_start_codon_gain ABTB1 2 41652 4.80169E-5 20826 0 NA
3-127391827-C-G c.-42C>G 5_prime_UTR_premature_start_codon_gain ABTB1 8 43692 1.831E-4 21846 0 0.00125
3-127391827-C-T c.-42C>T 5_prime_UTR_premature_start_codon_gain ABTB1 1 43692 2.28875E-5 21846 0 1.47958E-4
3-127391840-C-T c.-29C>T 5_prime_UTR_premature_start_codon_gain ABTB1 1 45886 2.17931E-5 22943 0 4.45157E-5
3-127391872-G-A p.Asp2Asn missense ABTB1 1 50820 1.96773E-5 25410 0 2.61315E-5
3-127391873-A-G p.Asp2Gly missense ABTB1 1 50892 1.96495E-5 25446 0 4.05688E-5
3-127391877-C-A p.Thr3Thr synonymous ABTB1 2 51318 3.89727E-5 25659 0 9.9963E-6
3-127391905-G-A p.Gly13Arg missense ABTB1 1 52356 1.91E-5 26178 0 6.16497E-5
3-127391911-G-A p.Val15Met missense ABTB1 1 52290 1.91241E-5 26145 0 NA
3-127391913-G-A p.Val15Val synonymous ABTB1 1 52264 1.91336E-5 26132 0 NA
3-127391917-C-A p.Arg17Arg synonymous ABTB1 2 51672 3.87057E-5 25836 0 4.17502E-5
3-127391932-C-T c.56+8C>T splice_region ABTB1 1 50208 1.99171E-5 25104 0 NA
3-127393013-C-T c.-556C>T 5_prime_UTR_premature_start_codon_gain ABTB1 118 27180 0.00434143 13590 0 0.00640127
3-127393030-C-T c.-539C>T 5_prime_UTR_premature_start_codon_gain ABTB1 2 31994 6.25117E-5 15997 0 NA
3-127393159-C-T c.-410C>T 5_prime_UTR_premature_start_codon_gain ABTB1 1 77640 1.288E-5 38820 0 NA
3-127393188-A-G c.-381A>G splice_region ABTB1 2 79362 2.5201E-5 39681 0 1.27608E-4
3-127393198-C-T c.-371C>T 5_prime_UTR_premature_start_codon_gain ABTB1 1 79690 1.25486E-5 39845 0 3.3389E-5
3-127393236-A-AC p.Leu21fs frameshift ABTB1 1 80948 1.23536E-5 40474 0 NA
3-127393246-G-A p.Glu23Glu synonymous ABTB1 3 81360 3.68732E-5 40680 0 1.22679E-5
3-127393259-GAGGTGAATGTGCGGGACAAGTGGGACAGCACCCCCTTGTGAGTGCTGGAGAGAGGGGTGGGGAGGGTGGGGGTTGGTGCACCCCTTCAGCACTGAGGACTGCCTCCTGTACTTCCTTCCTCCCTTC-G p.Glu28fs frameshift ABTB1 1 81898 1.22103E-5 40949 0 NA
3-127393272-G-A p.Arg32Gln missense ABTB1 9 81918 1.09866E-4 40959 0 0.0035533
3-127393275-A-T p.Asp33Val missense ABTB1 14 81858 1.71028E-4 40929 0 4.5235E-4
3-127393289-A-G p.Thr38Ala missense ABTB1 1 81732 1.22351E-5 40866 0 NA
3-127393289-A-T p.Thr38Ser missense ABTB1 2 81732 2.44702E-5 40866 0 NA
3-127393290-C-T p.Thr38Ile missense ABTB1 5 81808 6.11187E-5 40904 0 5.99137E-5
3-127393291-C-G p.Thr38Thr synonymous ABTB1 2 81790 2.44529E-5 40895 0 NA
3-127393296-TGTGAGTGCTGGAGAGAGGGGTGGGGAGGGTGGGGGTTGGTGCACCCCTTCAGCACTGAGGACTGCCTCCTGTACTTCCTTCCTCCCTTCAG-T c.119+1_120-1delGTGAGTGCTGGAGAGAGGGGTGGGGAGGGTGGGGGTTGGTGCACCCCTTCAGCACTGAGGACTGCCTCCTGTACTTCCTTCCTCCCTTCAG splice_acceptor ABTB1 5 81634 6.1249E-5 40817 0 NA
3-127393376-TCCTC-T c.120-11_120-8delCCTC splice_region ABTB1 1 82832 1.20726E-5 41416 0 1.19309E-5
3-127393390-A-G p.Tyr41Cys missense+splice_region ABTB1 1 82918 1.20601E-5 41459 0 NA
3-127393399-G-A p.Cys44Tyr missense ABTB1 1 82940 1.20569E-5 41470 0 NA
3-127393412-C-T p.Arg37* stop_gained ABTB1 2 82898 2.4126E-5 41449 0 3.97687E-6
3-127393413-G-A p.Glu49Lys missense ABTB1 1 82922 1.20595E-5 41461 0 3.18695E-5
3-127393418-G-T p.Glu50Asp missense ABTB1 1 82920 1.20598E-5 41460 0 NA
3-127393418-G-C p.Glu50Asp missense ABTB1 1 82920 1.20598E-5 41460 0 NA
3-127393425-C-T p.Leu53Phe missense ABTB1 3 82860 3.62056E-5 41430 0 3.18674E-5
3-127393427-C-T p.Leu53Leu synonymous ABTB1 2 82838 2.41435E-5 41419 0 1.89647E-4
3-127393430-C-T p.Pro43Ser missense ABTB1 1 82804 1.20767E-5 41402 0 NA
3-127393431-C-T p.Leu55Phe missense ABTB1 3 82816 3.62249E-5 41408 0 4.77259E-5
3-127393446-G-A c.175+3G>A splice_region ABTB1 1 82616 1.21042E-5 41308 0 2.38692E-5
3-127394818-C-A p.Arg61Ser missense ABTB1 2 80586 2.48182E-5 40293 0 1.2751E-4
3-127394818-C-T p.Arg61Cys missense ABTB1 1 80588 1.24088E-5 40294 0 3.18776E-5
3-127394819-GC-CT p.Arg61Pro missense ABTB1 2 80632 2.4804E-5 40316 0 NA
3-127394819-G-A p.Arg61His missense ABTB1 3 80632 3.72061E-5 40316 0 1.88567E-4
3-127394819-GC-AG p.Arg61Gln missense ABTB1 2 80632 2.4804E-5 40316 0 NA
3-127394820-C-T c.-244C>T 5_prime_UTR_premature_start_codon_gain ABTB1 14343 79918 0.179471 39959 1402 0.202128
3-127394823-C-T p.Arg51* stop_gained ABTB1 3 80980 3.70462E-5 40490 0 7.03594E-5
3-127394824-G-A p.Glu63Lys missense ABTB1 1 81086 1.23326E-5 40543 0 7.02259E-5
3-127394829-C-T p.Gln53* stop_gained ABTB1 1 81390 1.22865E-5 40695 0 NA
3-127394831-A-G p.Asn65Ser missense ABTB1 5 81506 6.13452E-5 40753 0 NA
3-127394835-C-T p.Leu55Phe missense ABTB1 1 81636 1.22495E-5 40818 0 3.18593E-5
3-127394838-C-T p.Arg56* stop_gained ABTB1 2 81686 2.4484E-5 40843 0 1.27453E-4
3-127394839-G-A p.Asp68Asn missense ABTB1 11 81746 1.34563E-4 40873 0 1.59347E-4
3-127394839-G-C p.Asp68His missense ABTB1 2 81746 2.4466E-5 40873 0 NA
3-127394858-A-G p.Tyr74Cys missense ABTB1 1 82154 1.21723E-5 41077 0 3.18796E-5
3-127394859-T-C p.Tyr74Tyr synonymous ABTB1 2 82186 2.4335E-5 41093 0 4.00468E-6
3-127394869-A-C p.Ser78Arg missense ABTB1 3 82242 3.64777E-5 41121 0 NA
3-127394870-G-A p.Ser78Asn missense ABTB1 3 82234 3.64813E-5 41117 0 6.25782E-4
3-127394873-A-AC p.Ile81fs frameshift ABTB1 2 82248 2.43167E-5 41124 0 NA
3-127394876-C-G p.Pro80Arg missense ABTB1 3 82328 3.64396E-5 41164 0 1.19965E-5
3-127394881-C-T p.Arg82Cys missense ABTB1 2 82342 2.42889E-5 41171 0 1.19835E-5
3-127394881-C-A p.Arg82Ser missense ABTB1 1 82342 1.21445E-5 41171 0 NA
3-127394882-G-A p.Arg82His missense ABTB1 8 82314 9.71888E-5 41157 0 1.91156E-4
3-127394885-G-A p.Arg83Gln missense ABTB1 5 82334 6.07283E-5 41167 0 5.05051E-4
3-127394887-G-A p.Ala84Thr missense ABTB1 1 82348 1.21436E-5 41174 0 NA
3-127394893-C-G p.Arg86Gly missense ABTB1 2 82374 2.42795E-5 41187 0 NA
3-127394894-G-A p.Arg86His missense ABTB1 1 82358 1.21421E-5 41179 0 4.2234E-5
3-127394895-C-T p.Arg86Arg synonymous ABTB1 3 82338 3.64352E-5 41169 0 6.75311E-5
3-127394907-G-A p.Gln90Gln synonymous ABTB1 3 82368 3.64219E-5 41184 0 3.98584E-6
3-127394912-C-T p.Thr92Met missense ABTB1 1 82298 1.2151E-5 41149 0 6.25E-4
3-127394912-C-G p.Thr92Arg missense ABTB1 1 82298 1.2151E-5 41149 0 NA
3-127394913-G-A p.Thr92Thr synonymous ABTB1 1 82298 1.2151E-5 41149 0 3.18634E-5
3-127394917-TC-T p.Cys95fs frameshift ABTB1 2 82312 2.42978E-5 41156 0 NA
3-127394925-G-A p.Arg96Arg synonymous ABTB1 1 82242 1.21592E-5 41121 0 3.18593E-5
3-127394930-G-A p.Arg98Gln missense ABTB1 1 82142 1.2174E-5 41071 0 8.3619E-6
3-127394943-C-T c.-121C>T 5_prime_UTR_premature_start_codon_gain ABTB1 2 82076 2.43677E-5 41038 0 1.1676E-4
3-127394957-G-A p.Arg107Gln missense+splice_region ABTB1 1 81790 1.22264E-5 40895 0 5.03525E-4
3-127394964-C-T c.320+7C>T splice_region ABTB1 36 81676 4.40766E-4 40838 0 6.25E-4
3-127395109-C-T c.321-6C>T splice_region ABTB1 1 81584 1.22573E-5 40792 0 3.32624E-5
3-127395112-C-A c.321-3C>A splice_region ABTB1 1 81568 1.22597E-5 40784 0 NA
3-127395113-A-C c.321-2A>C splice_acceptor ABTB1 1 81582 1.22576E-5 40791 0 NA
3-127395118-T-C p.Leu108Leu synonymous ABTB1 22 81584 2.69661E-4 40792 0 9.56778E-4
3-127395129-G-T p.Gly112Val missense ABTB1 4 81494 4.90834E-5 40747 0 NA
3-127395135-A-G p.His114Arg missense ABTB1 3 81572 3.67773E-5 40786 0 9.15707E-5
3-127395142-C-T c.-79C>T 5_prime_UTR_premature_start_codon_gain ABTB1 1 81472 1.22742E-5 40736 0 3.18898E-5
3-127395174-G-A p.Arg127Gln missense ABTB1 3 81412 3.68496E-5 40706 0 1.2751E-4
3-127395187-C-T p.Cys131Cys synonymous ABTB1 1 81530 1.22654E-5 40765 0 2.47227E-5
3-127395188-G-A p.Val132Ile missense ABTB1 203 81574 0.00248854 40787 0 0.00263338
3-127395201-G-A p.Arg136His missense ABTB1 2 81804 2.44487E-5 40902 0 7.95526E-6
3-127395206-G-A p.Ala138Thr missense ABTB1 1 81960 1.22011E-5 40980 0 NA
3-127395208-C-T p.Ala138Ala synonymous ABTB1 28 81998 3.41472E-4 40999 0 2.42622E-4
3-127395208-C-G p.Ala138Ala synonymous ABTB1 3 82000 3.65854E-5 41000 0 5.03525E-4
3-127395217-C-T p.Ala141Ala synonymous ABTB1 1 82218 1.21628E-5 41109 0 NA
3-127395230-A-G p.Thr146Ala missense ABTB1 3 82590 3.6324E-5 41295 0 2.38679E-5
3-127395232-C-T p.Thr146Thr synonymous ABTB1 1 82656 1.20983E-5 41328 0 9.56206E-5
3-127395242-G-A p.Gly150Ser missense ABTB1 1 82916 1.20604E-5 41458 0 NA
3-127395243-G-A p.Gly150Asp missense ABTB1 1 82944 1.20563E-5 41472 0 NA
3-127395254-G-A p.Val154Met missense ABTB1 1 83100 1.20337E-5 41550 0 3.18573E-5
3-127395263-A-G p.Arg157Gly missense ABTB1 1 83182 1.20218E-5 41591 0 8.24729E-6
3-127395273-TGGTATGTCCCTTCAGGGTGGCAGAGGGGCATGAACTGTCCAGGAACAGCAGGAGGTTGTGCTGGGTGGCTGCCTCTGACATTACTTTCTGGTTTTCTGCCCACA-T p.Ile161fs frameshift ABTB1 11 83192 1.32224E-4 41596 5 NA
3-127395375-A-G c.481-4A>G splice_region ABTB1 1 83092 1.20349E-5 41546 0 7.95349E-6
3-127395385-C-G p.Pro163Ala missense ABTB1 1 83080 1.20366E-5 41540 0 7.95355E-6
3-127395385-C-A p.Pro163Thr missense ABTB1 1 83080 1.20366E-5 41540 0 NA
3-127395387-C-T p.Pro163Pro synonymous ABTB1 1 83070 1.2038E-5 41535 0 9.56511E-5
3-127395400-G-A p.Ala168Thr missense ABTB1 1 82928 1.20587E-5 41464 0 NA
3-127395403-C-A p.Leu169Met missense ABTB1 1 82916 1.20604E-5 41458 0 8.23927E-6
3-127395403-C-T p.Leu169Leu synonymous ABTB1 1 82916 1.20604E-5 41458 0 NA
3-127395411-G-C p.Gln171His missense ABTB1 1 82850 1.207E-5 41425 0 3.97681E-6
3-127395430-C-T c.526+6C>T splice_region ABTB1 3 82512 3.63583E-5 41256 0 8.24253E-6
3-127395651-G-T n.745G>T splice_region ABTB1 1 69008 1.44911E-5 34504 0 NA
3-127395803-C-T c.527-7C>T splice_region ABTB1 1 81882 1.22127E-5 40941 0 NA
3-127395806-C-G c.527-4C>G splice_region ABTB1 2 81958 2.44027E-5 40979 0 8.82021E-6
3-127395812-C-T p.Arg177Cys missense+splice_region ABTB1 2 81970 2.43992E-5 40985 0 4.03454E-6
3-127395813-G-A p.Arg177His missense ABTB1 2 81970 2.43992E-5 40985 0 3.18593E-5
3-127395817-G-A p.Leu178Leu synonymous ABTB1 4186 81912 0.0511036 40956 138 0.0417093
3-127395833-C-T p.His184Tyr missense ABTB1 1 82192 1.21666E-5 41096 0 4.00346E-6
3-127395835-TGTGA-T p.Ser186fs frameshift ABTB1 5 82208 6.08213E-5 41104 0 NA
3-127395840-G-A p.Ser186Asn missense ABTB1 1 82216 1.21631E-5 41108 0 NA
3-127395844-C-G p.Asp187Glu missense ABTB1 1 82194 1.21663E-5 41097 0 8.52311E-6
3-127395845-T-C p.Cys188Arg missense ABTB1 1 82214 1.21634E-5 41107 0 NA
3-127395847-T-A p.Cys188* stop_gained ABTB1 1 82218 1.21628E-5 41109 0 6.37186E-5
3-127395852-G-A p.Arg190His missense ABTB1 2 82244 2.43179E-5 41122 0 1.69877E-5
3-127395859-C-G p.Ala192Ala synonymous ABTB1 1 82330 1.21462E-5 41165 0 6.25E-4
3-127395863-C-A p.Gln194Lys missense ABTB1 1 82366 1.21409E-5 41183 0 NA
3-127395881-C-T p.Leu200Leu synonymous ABTB1 1 82440 1.213E-5 41220 0 NA
3-127395887-A-G p.Ser202Gly missense ABTB1 1 82428 1.21318E-5 41214 0 1.27429E-4
3-127395889-C-T p.Ser202Ser synonymous ABTB1 4 82418 4.85331E-5 41209 0 0.00100705
3-127395896-G-A p.Glu205Lys missense ABTB1 3 82472 3.6376E-5 41236 0 4.18438E-5
3-127395906-G-A p.Cys208Tyr missense ABTB1 1 82504 1.21206E-5 41252 0 NA
3-127395909-A-C p.Glu209Ala missense ABTB1 1 82524 1.21177E-5 41262 0 NA
3-127395913-G-C p.Lys210Asn missense ABTB1 2 82550 2.42277E-5 41275 0 4.17774E-5
3-127395925-TGGTGCGAGCAGGGTTTGGGGCCCGGGGCCATGGGTGCGGCCTGGCAGGGCTGGCCTGGCTCCCTGAAGTTGTTCTTCCCCTGTA-T c.643+1_644-1delGTGCGAGCAGGGTTTGGGGCCCGGGGCCATGGGTGCGGCCTGGCAGGGCTGGCCTGGCTCCCTGAAGTTGTTCTTCCCCTGTAG splice_acceptor ABTB1 2 82562 2.42242E-5 41281 0 NA
3-127395932-A-G c.643+6A>G splice_region ABTB1 2 82574 2.42207E-5 41287 0 NA
3-127396004-C-T c.644-7C>T splice_region ABTB1 1 82478 1.21244E-5 41239 0 NA
3-127396005-C-A c.644-6C>A splice_region ABTB1 3 82484 3.63707E-5 41242 0 1.20556E-5
3-127396014-C-T p.Ala216Val missense ABTB1 4 82442 4.8519E-5 41221 0 9.08166E-6
3-127396015-G-C p.Ala216Ala synonymous ABTB1 164 82446 0.00198918 41223 0 0.006875
3-127396015-G-A p.Ala216Ala synonymous ABTB1 18 82448 2.18319E-4 41224 0 2.74243E-4
3-127396022-C-G p.Pro219Ala missense ABTB1 1 82432 1.21312E-5 41216 0 NA
3-127396026-G-C p.Gly220Ala missense ABTB1 1 82426 1.21321E-5 41213 0 4.03867E-6
3-127396029-C-T p.Thr221Met missense ABTB1 1 82402 1.21356E-5 41201 0 5.05051E-4
3-127396030-G-T p.Thr221Thr synonymous ABTB1 1 82400 1.21359E-5 41200 0 1.62006E-5
3-127396039-G-T p.Lys224Asn missense ABTB1 2 82444 2.42589E-5 41222 0 0.00101112
3-127396042-G-C p.Val225Val synonymous ABTB1 53 82406 6.43157E-4 41203 0 0.00124338
3-127396045-G-A p.Leu226Leu synonymous ABTB1 1 82422 1.21327E-5 41211 0 3.18857E-5
3-127396051-C-T p.Ile228Ile synonymous ABTB1 4 82382 4.85543E-5 41191 0 1.09032E-5
3-127396052-G-A p.Glu229Lys missense ABTB1 1 82372 1.214E-5 41186 0 3.19101E-5
3-127396059-C-T p.Pro231Leu missense ABTB1 12 82406 1.4562E-4 41203 0 6.37511E-5
3-127396060-A-G p.Pro231Pro synonymous ABTB1 1 82382 1.21386E-5 41191 0 6.38325E-5
3-127396065-C-T p.Ala233Val missense ABTB1 21 82400 2.54854E-4 41200 0 6.25782E-4
3-127396067-G-C p.Asp234His missense ABTB1 1 82380 1.21389E-5 41190 0 4.26428E-6
3-127396069-C-T p.Asp234Asp synonymous ABTB1 134 82372 0.00162677 41186 1 0.00328402
3-127396071-C-T p.Pro235Leu missense ABTB1 13 82382 1.57801E-4 41191 0 0.00101215
3-127396072-C-T p.Pro235Pro synonymous ABTB1 32 82394 3.88378E-4 41197 0 7.33325E-4
3-127396073-C-T p.Arg236Cys missense ABTB1 62 82380 7.5261E-4 41190 0 6.46683E-4
3-127396074-G-C p.Arg236Pro missense ABTB1 1 82372 1.214E-5 41186 0 NA
3-127396079-C-T p.Arg238Trp missense ABTB1 1 82350 1.21433E-5 41175 0 3.18695E-5
3-127396084-G-A p.Glu239Glu synonymous ABTB1 6 82328 7.28792E-5 41164 0 4.48527E-6
3-127396093-G-A p.Ala242Ala synonymous ABTB1 32 82224 3.89181E-4 41112 0 8.15879E-4
3-127396097-C-T p.Leu244Leu synonymous ABTB1 3 82222 3.64866E-5 41111 0 2.98597E-5
3-127396103-G-A p.Asp246Asn missense ABTB1 3 82206 3.64937E-5 41103 0 6.19886E-5
3-127396116-C-T p.Pro250Leu missense ABTB1 1 81988 1.21969E-5 40994 0 NA
3-127396120-C-G p.Pro251Pro synonymous ABTB1 28 81974 3.41572E-4 40987 0 0.00313283
3-127396120-C-T p.Pro251Pro synonymous ABTB1 1 81974 1.2199E-5 40987 0 6.37471E-5
3-127396121-G-A p.Glu252Lys missense ABTB1 3 81914 3.66238E-5 40957 0 NA
3-127396126-C-G p.Leu253Leu synonymous ABTB1 36 81948 4.39303E-4 40974 0 4.83434E-4
3-127396128-G-A p.Arg254Gln missense+splice_region ABTB1 2 81940 2.44081E-5 40970 0 4.85924E-5
3-127396305-C-T c.763-3C>T splice_region ABTB1 1 81640 1.22489E-5 40820 0 NA
3-127396328-C-T p.Pro261Pro synonymous ABTB1 2 82328 2.42931E-5 41164 0 NA
3-127396331-C-T p.Phe262Phe synonymous ABTB1 2 82398 2.42724E-5 41199 0 NA
3-127396343-C-T p.Asp266Asp synonymous ABTB1 6 82538 7.26938E-5 41269 0 5.03525E-4
3-127396344-G-A p.Gly267Ser missense ABTB1 4 82550 4.84555E-5 41275 0 6.37755E-5
3-127396357-G-C p.Cys271Ser missense ABTB1 2 82658 2.41961E-5 41329 0 2.26692E-4
3-127396358-C-T p.Cys271Cys synonymous ABTB1 30 82692 3.62792E-4 41346 0 0.005625
3-127396375-G-A p.Arg277Gln missense ABTB1 27 82688 3.26529E-4 41344 0 0.00375
3-127396381-C-G p.Ala279Gly missense ABTB1 1 82698 1.20922E-5 41349 0 NA
3-127396388-C-G p.Cys281Trp missense ABTB1 2 82578 2.42195E-5 41289 0 3.97924E-6
3-127396391-C-G p.Ser282Arg missense ABTB1 1 82606 1.21057E-5 41303 0 4.94592E-5
3-127396410-C-T c.861+4C>T splice_region ABTB1 1 82596 1.21071E-5 41298 0 6.37999E-5
3-127396413-G-A c.861+7G>A splice_region ABTB1 3 82582 3.63275E-5 41291 0 1.27608E-4
3-127396414-T-C c.861+8T>C splice_region ABTB1 162 82560 0.00196221 41280 2 0.00456053
3-127396521-C-G p.Ala288Ala splice_region+synonymous ABTB1 2 82608 2.42107E-5 41304 0 4.14158E-6
3-127396525-T-A p.Phe290Ile missense ABTB1 1 82604 1.2106E-5 41302 0 NA
3-127396535-G-A p.Arg293His missense ABTB1 5 82576 6.05503E-5 41288 0 0.00201613
3-127396542-C-G p.Asp295Glu missense ABTB1 14 82624 1.69442E-4 41312 0 1.59266E-4
3-127396549-C-T p.Arg298* stop_gained ABTB1 2 82592 2.42154E-5 41296 0 6.25E-4
3-127396550-G-A p.Arg298Gln missense ABTB1 1 82568 1.21112E-5 41284 0 4.19196E-6
3-127396560-G-A p.Leu301Leu synonymous ABTB1 5 82560 6.0562E-5 41280 0 1.00687E-5
3-127396562-A-G p.Asp302Gly missense ABTB1 5 82534 6.05811E-5 41267 0 5.04032E-4
3-127396573-C-T p.Arg306* stop_gained ABTB1 286 82502 0.00346658 41251 1 0.0054469
3-127396574-G-A p.Arg306Gln missense ABTB1 2 82530 2.42336E-5 41265 0 9.55597E-5
3-127396577-A-G p.Glu307Gly missense ABTB1 1 82528 1.21171E-5 41264 0 2.98163E-5
3-127396581-C-A p.Ser308Arg missense ABTB1 8 82466 9.70097E-5 41233 0 5.05051E-4
3-127396581-C-T p.Ser308Ser synonymous ABTB1 2 82466 2.42524E-5 41233 0 3.18532E-5
3-127396582-G-A p.Glu309Lys missense ABTB1 1 82512 1.21194E-5 41256 0 NA
3-127396583-A-G p.Glu309Gly missense ABTB1 3 82504 3.63619E-5 41252 0 3.18552E-5
3-127396588-C-T p.Pro311Ser missense ABTB1 16 82500 1.93939E-4 41250 0 0.00151515
3-127396593-G-A p.Ala312Ala synonymous ABTB1 1 82424 1.21324E-5 41212 0 7.74259E-5
3-127396596-C-T p.Thr313Thr synonymous ABTB1 1 82480 1.21242E-5 41240 0 NA
3-127396597-TC-T p.Ser314fs frameshift ABTB1 1 82472 1.21253E-5 41236 0 NA
3-127396598-CAG-C p.Gly316fs frameshift ABTB1 1 82486 1.21233E-5 41243 0 NA
3-127396599-AG-A p.Gly316fs frameshift ABTB1 2 82486 2.42465E-5 41243 0 4.46875E-5
3-127396600-G-A p.Gly315Arg missense ABTB1 1 82512 1.21194E-5 41256 0 NA
3-127396604-G-GC p.Ala319fs frameshift ABTB1 1 82408 1.21347E-5 41204 0 3.81497E-5
3-127396604-GC-G p.Pro318fs frameshift ABTB1 1 82410 1.21345E-5 41205 0 NA
3-127396605-C-T p.Gly316Gly synonymous ABTB1 88 82440 0.00106744 41220 0 0.00251849
3-127396615-G-A p.Val320Ile missense ABTB1 6 82466 7.27573E-5 41233 0 1.85165E-5
3-127396617-C-T p.Val320Val synonymous ABTB1 3 82504 3.63619E-5 41252 0 6.37024E-5
3-127396625-A-G p.His323Arg missense ABTB1 4 82416 4.85343E-5 41208 0 6.37267E-5
3-127396625-A-T p.His323Leu missense ABTB1 1 82416 1.21336E-5 41208 0 NA
3-127396632-C-T p.Ile325Ile synonymous ABTB1 1 82368 1.21406E-5 41184 0 NA
3-127396636-C-G p.Pro327Ala missense ABTB1 1 82312 1.21489E-5 41156 0 1.81759E-5
3-127396639-G-A p.Asp328Asn missense ABTB1 11 82220 1.33787E-4 41110 0 2.54842E-4
3-127396642-G-A p.Val329Ile missense ABTB1 10 82124 1.21767E-4 41062 0 2.7203E-4
3-127396647-C-T n.354-3C>T splice_region ABTB1 45 82042 5.485E-4 41021 0 8.91663E-4
3-127396652-A-T p.His332Leu missense ABTB1 1 81880 1.2213E-5 40940 0 4.02836E-6
3-127396654-G-A p.Val333Met missense ABTB1 4 81808 4.8895E-5 40904 0 1.81393E-5
3-127396671-C-T p.Tyr338Tyr synonymous ABTB1 3 81072 3.70041E-5 40536 0 3.66072E-5
3-127396692-G-A c.1029+6G>A splice_region ABTB1 1 79658 1.25537E-5 39829 0 3.18654E-5
3-127398420-C-T p.Pro127Leu missense ABTB1 3 51338 5.84362E-5 25669 0 6.37918E-5
3-127398421-G-A p.Pro127Pro synonymous ABTB1 1 51342 1.94772E-5 25671 0 6.69195E-5
3-127398437-A-G p.Ile133Val missense ABTB1 4 51376 7.78574E-5 25688 0 3.18918E-5
3-127398835-C-G p.Pro346Arg missense ABTB1 1 81410 1.22835E-5 40705 0 NA
3-127398836-C-T p.Pro346Pro synonymous ABTB1 14 81392 1.72007E-4 40696 0 0.00125
3-127398839-G-A p.Glu347Glu synonymous ABTB1 1 81630 1.22504E-5 40815 0 NA
3-127398843-GC-G p.Tyr350fs frameshift ABTB1 3 81772 3.66874E-5 40886 0 NA
3-127398847-A-G p.Tyr350Cys missense ABTB1 3 81920 3.66211E-5 40960 0 4.39143E-5
3-127398850-A-G p.Asp351Gly missense ABTB1 2 81972 2.43986E-5 40986 0 NA
3-127398860-C-T p.Ser354Ser synonymous ABTB1 3 82048 3.6564E-5 41024 0 1.998E-4
3-127398863-C-T p.Val355Val synonymous ABTB1 3 82126 3.65292E-5 41063 0 9.55779E-5
3-127398864-G-A p.Ala356Thr missense ABTB1 1 82118 1.21776E-5 41059 0 3.32613E-5
3-127398898-T-C p.Leu367Pro missense ABTB1 1 82388 1.21377E-5 41194 0 3.98086E-6
3-127398902-C-T p.Cys368Cys synonymous ABTB1 3 82342 3.64334E-5 41171 0 4.14312E-5
3-127398903-G-A p.Gly369Ser missense ABTB1 2 82334 2.42913E-5 41167 0 6.25E-4
3-127398906-C-T p.Arg370Cys missense ABTB1 5 82336 6.07268E-5 41168 0 9.10988E-5
3-127398907-G-A p.Arg370His missense ABTB1 2 82324 2.42943E-5 41162 0 1.98745E-4
3-127398909-A-C p.Ser371Arg missense ABTB1 1 82364 1.21412E-5 41182 0 NA
3-127398918-C-T p.Gln374* stop_gained ABTB1 3 82432 3.63936E-5 41216 0 NA
3-127398919-A-G p.Gln374Arg missense ABTB1 2 82442 2.42595E-5 41221 0 1.59182E-5
3-127398932-G-A p.Glu378Glu synonymous ABTB1 1 82536 1.21159E-5 41268 0 3.18471E-5
3-127398945-G-T p.Gly383Cys missense ABTB1 2 82566 2.4223E-5 41283 0 3.18532E-5
3-127398946-G-T p.Gly383Val missense ABTB1 4 82566 4.84461E-5 41283 0 NA
3-127398955-G-A p.Arg386His missense ABTB1 180 82592 0.00217939 41296 1 0.00151057
3-127398956-C-T p.Arg386Arg synonymous ABTB1 5 82602 6.05312E-5 41301 0 2.47705E-5
3-127398957-G-A p.Val387Met missense ABTB1 10 82630 1.21021E-4 41315 0 9.15248E-5
3-127398971-C-G p.Phe391Leu missense ABTB1 1 82650 1.20992E-5 41325 0 8.25382E-6
3-127398972-C-A p.Arg392Ser missense ABTB1 1 82654 1.20986E-5 41327 0 NA
3-127398973-G-A p.Arg392His missense ABTB1 1 82654 1.20986E-5 41327 0 1.07301E-4
3-127398979-C-T p.Ala394Val missense ABTB1 2 82658 2.41961E-5 41329 0 6.37308E-5
3-127398980-G-A p.Ala394Ala synonymous ABTB1 2 82676 2.41908E-5 41338 0 1.59234E-5
3-127398981-C-T p.Arg395Trp missense ABTB1 5 82668 6.04829E-5 41334 0 3.18573E-5
3-127398982-G-A p.Arg395Gln missense ABTB1 4 82664 4.83887E-5 41332 0 6.37024E-5
3-127398996-T-C p.Cys400Arg missense ABTB1 2 82630 2.42043E-5 41315 0 3.18674E-5
3-127398999-A-G p.Thr401Ala missense ABTB1 7 82634 8.47109E-5 41317 0 3.98194E-6
3-127399008-A-G p.Met404Val missense ABTB1 2 82632 2.42037E-5 41316 0 8.2526E-6
3-127399014-A-G p.Lys406Glu missense ABTB1 15 82600 1.81598E-4 41300 0 6.25E-4
3-127399021-T-C p.Ile408Thr missense ABTB1 2 82584 2.42178E-5 41292 0 6.25E-4
3-127399026-AAGGTGGGCCAGTGGTCTGCAGTGGGTGGGAAGGAGGGGTGAGAGGGCAGGCACCCCTCCACTGAGCTGGCCCTTCCCGCTCAT-A p.Lys410fs frameshift ABTB1 7 82566 8.47807E-5 41283 0 NA
3-127399032-G-A c.1230+4G>A splice_region ABTB1 1 82538 1.21156E-5 41269 0 7.97874E-6
3-127399104-G-A c.1231-8G>A splice_region ABTB1 1 82002 1.21948E-5 41001 0 6.37389E-5
3-127399107-C-T c.1231-5C>T splice_region ABTB1 3 82024 3.65747E-5 41012 0 9.55962E-5
3-127399109-T-C c.1231-3T>C splice_region ABTB1 1 82022 1.21919E-5 41011 0 8.65861E-6
3-127399113-T-C p.Leu411Pro missense+splice_region ABTB1 2 82006 2.43885E-5 41003 0 4.01532E-6
3-127399121-C-T p.Arg414Trp missense ABTB1 3 81896 3.66318E-5 40948 0 6.19217E-5
3-127399122-G-A p.Arg414Gln missense ABTB1 3 81974 3.6597E-5 40987 0 4.42862E-5
3-127399123-G-T p.Arg414Arg synonymous ABTB1 2 81980 2.43962E-5 40990 0 NA
3-127399123-G-C p.Arg414Arg synonymous ABTB1 1 81980 1.21981E-5 40990 0 NA
3-127399126-G-A p.Glu415Glu synonymous ABTB1 1 81996 1.21957E-5 40998 0 4.02321E-6
3-127399128-A-T p.Asp416Val missense ABTB1 4 81890 4.8846E-5 40945 0 NA
3-127399131-T-G p.Phe417Cys missense ABTB1 3 81962 3.66023E-5 40981 0 3.18857E-5
3-127399132-C-T p.Phe417Phe synonymous ABTB1 317 81906 0.00387029 40953 3 0.00790766
3-127399132-C-A p.Phe417Leu missense ABTB1 1 81920 1.2207E-5 40960 0 9.04765E-6
3-127399133-G-A p.Val418Met missense ABTB1 2 81948 2.44057E-5 40974 0 4.03424E-6
3-127399140-C-T p.Ala420Val missense ABTB1 5 81846 6.10903E-5 40923 0 1.27551E-4
3-127399141-G-A p.Ala420Ala synonymous ABTB1 3 81892 3.66336E-5 40946 0 9.5645E-5
3-127399147-G-A p.Lys422Lys synonymous ABTB1 4 81888 4.88472E-5 40944 0 0.00125
3-127399159-G-A p.Ala426Ala synonymous ABTB1 17 81872 2.07641E-4 40936 0 1.74669E-4
3-127399174-G-T p.Arg431Arg synonymous ABTB1 1 81810 1.22234E-5 40905 0 4.15873E-6
3-127399182-C-T p.Thr434Met missense ABTB1 6 81744 7.33999E-5 40872 0 6.37877E-5
3-127399183-G-A p.Thr434Thr synonymous ABTB1 3 81756 3.66946E-5 40878 0 5.04032E-4
3-127399189-T-G p.Ser436Ser synonymous ABTB1 1 81774 1.22288E-5 40887 0 4.17282E-6
3-127399190-A-G p.Ile437Val missense ABTB1 1 81758 1.22312E-5 40879 0 NA
3-127399204-C-T p.Asp441Asp synonymous ABTB1 15 81738 1.83513E-4 40869 0 9.91757E-5
3-127399211-C-G p.Arg444Gly missense ABTB1 2 81766 2.446E-5 40883 0 4.21774E-6
3-127399211-C-T p.Arg444Cys missense ABTB1 1 81766 1.223E-5 40883 0 2.10887E-5
3-127399230-C-T p.Thr450Met missense ABTB1 1 81748 1.22327E-5 40874 0 1.26916E-5
3-127399231-G-A p.Thr450Thr synonymous ABTB1 6 81738 7.34053E-5 40869 0 3.18837E-5
3-127399240-C-G p.Thr453Thr synonymous ABTB1 82 81768 0.00100284 40884 0 0.00207231
3-127399246-C-T p.Ser455Ser synonymous ABTB1 17 81716 2.08038E-4 40858 0 1.9129E-4
3-127399247-G-A p.Ala456Thr missense ABTB1 1 81736 1.22345E-5 40868 0 3.18796E-5
3-127399247-G-T p.Ala456Ser missense ABTB1 2 81736 2.4469E-5 40868 0 NA
3-127399260-C-T p.Ala460Val missense ABTB1 1 81630 1.22504E-5 40815 0 1.17462E-5
3-127399261-G-A p.Ala460Ala synonymous ABTB1 3 81616 3.67575E-5 40808 0 6.3804E-5
3-127399268-C-T p.Arg463Cys missense ABTB1 3 81584 3.67719E-5 40792 0 3.85033E-5
3-127399269-G-A p.Arg463His missense ABTB1 39 81612 4.77871E-4 40806 0 3.19428E-4
3-127399271-C-T p.Leu464Leu synonymous ABTB1 1 81636 1.22495E-5 40818 0 3.18918E-5
3-127399275-G-A p.Arg465Gln missense ABTB1 1 81582 1.22576E-5 40791 0 2.40466E-5
3-127399282-C-T p.Leu467Leu synonymous ABTB1 1 81490 1.22714E-5 40745 0 1.29634E-5
3-127399282-C-G p.Leu467Leu synonymous ABTB1 2 81490 2.45429E-5 40745 0 3.18878E-5
3-127399283-G-A p.Glu468Lys missense ABTB1 2 81532 2.45302E-5 40766 0 NA
3-127399288-C-T p.Asp469Asp synonymous ABTB1 5 81478 6.13663E-5 40739 0 4.78255E-4
3-127399294-C-T p.Leu471Leu synonymous ABTB1 2 81404 2.45688E-5 40702 0 9.78402E-5
3-127399295-G-A p.Val472Met missense ABTB1 1 81364 1.22904E-5 40682 0 1.22501E-5
3-127399301-A-G p.Ile474Val missense ABTB1 1 81384 1.22874E-5 40692 0 NA
3-127399303-C-T p.Ile474Ile synonymous ABTB1 5 81346 6.14658E-5 40673 0 8.6012E-5
3-127399304-G-A p.Gly475Ser missense ABTB1 2 81312 2.45966E-5 40656 0 2.45658E-5
3-127399752-G-C n.5059G>C splice_region ABTB1 4 50822 7.87061E-5 25411 0 3.18552E-5
3-127399759-T-A c.*441T>A splice_region ABTB1 1 49982 2.00072E-5 24991 0 NA