Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
17-908294-GA-TT p.Ser153Asn missense ABR 1 34714 2.88068E-5 17357 0 NA
17-908300-A-G p.Leu151Pro missense ABR 1 33024 3.0281E-5 16512 0 NA
17-908302-C-G p.Gln150His missense ABR 6 32360 1.85414E-4 16180 0 0.00219298
17-908312-G-A p.Ala147Val missense ABR 1 28314 3.53182E-5 14157 0 6.37105E-5
17-908317-CCGGGACA-C p.Val143fs frameshift ABR 9 26498 3.39648E-4 13249 0 0.0070922
17-908318-C-T p.Arg145Gln missense ABR 5 26012 1.92219E-4 13006 0 2.0202E-4
17-908326-C-G p.Trp142Cys missense ABR 1 23094 4.33013E-5 11547 0 NA
17-908328-A-G p.Trp142Arg missense ABR 2 22440 8.91266E-5 11220 0 3.18512E-5
17-908352-C-T p.Gly134Arg missense ABR 748 13406 0.0557959 6703 13 0.0955882
17-908362-G-A p.His130His synonymous ABR 1 11362 8.80127E-5 5681 0 NA
17-908386-C-T p.Ala122Ala splice_region+synonymous ABR 5 8098 6.17436E-4 4049 0 3.56125E-4
17-908387-G-GCCT p.Glu121dup conservative_inframe_insertion ABR 23 7730 0.00297542 3865 0 0.0208333
17-908975-A-C c.*275T>G splice_region ABR 4 49930 8.01122E-5 24965 0 NA
17-909267-C-A p.Gly186Cys missense ABR 1 80924 1.23573E-5 40462 0 3.4321E-4
17-909273-C-G p.Ala184Pro missense ABR 1 81008 1.23445E-5 40504 0 NA
17-909274-T-C p.Pro183Pro synonymous ABR 1 81030 1.23411E-5 40515 0 NA
17-909281-G-A p.Ala181Val missense ABR 1 81058 1.23368E-5 40529 0 3.1841E-5
17-909282-C-T p.Ala181Thr missense ABR 1 81066 1.23356E-5 40533 0 9.55718E-5
17-909291-C-A p.Val178Leu missense ABR 1 81122 1.23271E-5 40561 0 6.33168E-6
17-909296-C-T p.Arg176Gln missense ABR 1 81138 1.23247E-5 40569 0 1.47464E-4
17-909297-G-A p.Arg176Trp missense ABR 55 81114 6.78058E-4 40557 0 0.00124243
17-909300-C-T p.Gly175Arg missense ABR 4 81156 4.92878E-5 40578 0 4.82998E-5
17-909301-G-A c.*19C>T splice_region ABR 1 81140 1.23244E-5 40570 0 4.80077E-5
17-909302-C-T p.Cys174Tyr missense ABR 4 81178 4.92744E-5 40589 0 3.18451E-5
17-909316-C-T p.Pro169Pro synonymous ABR 1 81300 1.23001E-5 40650 0 1.34072E-4
17-909317-G-A p.Pro169Leu missense ABR 62 81278 7.62814E-4 40639 0 8.41229E-4
17-909324-ACGT-A p.Asp821del disruptive_inframe_deletion ABR 1 81310 1.22986E-5 40655 0 NA
17-909325-C-T p.Val822Met missense ABR 4 81310 4.91944E-5 40655 0 0.00101833
17-909326-G-A p.Thr166Met missense ABR 231 81314 0.00284084 40657 1 0.00560688
17-909327-T-C p.Asp821Gly missense ABR 1 81326 1.22962E-5 40663 0 5.53367E-6
17-909328-C-A p.Asp821Tyr missense ABR 1 81326 1.22962E-5 40663 0 NA
17-909329-G-A p.Pro165Leu missense ABR 7 81320 8.60797E-5 40660 0 1.27421E-4
17-909332-G-A p.Pro164Leu missense ABR 2 81356 2.45833E-5 40678 0 NA
17-909334-A-G p.Ser819Pro missense ABR 1 81364 1.22904E-5 40682 0 NA
17-909335-G-A p.Ser163Phe missense ABR 3 81376 3.68659E-5 40688 0 3.89257E-5
17-909353-C-T p.Ser157Asn missense ABR 11 81434 1.35079E-4 40717 0 0.00114056
17-909356-G-C p.Ser156* stop_gained ABR 1 81452 1.22772E-5 40726 0 NA
17-909364-C-T p.Ala809Thr missense ABR 3 81416 3.68478E-5 40708 0 5.0813E-4
17-909365-G-A c.463-5C>T splice_region ABR 2 81426 2.45622E-5 40713 0 NA
17-909369-G-A p.Ser807Phe missense ABR 4 81438 4.91171E-5 40719 0 3.18593E-5
17-909370-A-C p.Ser807Ala missense ABR 1 81432 1.22802E-5 40716 0 4.79547E-6
17-909374-G-C p.Pro805Pro synonymous ABR 1 81430 1.22805E-5 40715 0 6.37186E-5
17-909379-G-T p.Pro804Thr missense ABR 1 81426 1.22811E-5 40713 0 NA
17-909379-G-C p.Pro804Ala missense ABR 2 81426 2.45622E-5 40713 0 4.90745E-6
17-909380-G-A p.His803His synonymous ABR 7 81400 8.59951E-5 40700 0 0.0035533
17-909393-T-C p.Tyr799Cys missense ABR 1 81356 1.22917E-5 40678 0 NA
17-909404-C-G p.Gln795His missense ABR 1 81232 1.23104E-5 40616 0 1.0522E-5
17-910399-G-A c.2379+6C>T splice_region ABR 12 80422 1.49213E-4 40211 0 1.60339E-4
17-910400-G-C c.2379+5C>G splice_region ABR 1 80626 1.24029E-5 40313 0 NA
17-910401-G-A c.2379+4C>T splice_region ABR 27953 75016 0.372627 37508 5926 0.415394
17-910401-G-T c.2379+4C>A splice_region ABR 1 80734 1.23864E-5 40367 0 NA
17-910401-G-GTACCTGCGCCATGACGTCATGGGACCATCACCCTCCGCCAGCCACGGGCCCGGGCGGTGCCAGGGTACCTGCGCCATGACGTCATGGGACCGTCACCCTCCGCCAGCCACGGGCCCGGGCGGTGCCAGGA c.2379+3_2379+4insTCCTGGCACCGCCCGGGCCCGTGGCTGGCGGAGGGTGACGGTCCCATGACGTCATGGCGCAGGTACCCTGGCACCGCCCGGGCCCGTGGCTGGCGGAGGGTGATGGTCCCATGACGTCATGGCGCAGGTA splice_region ABR 1 80738 1.23857E-5 40369 0 NA
17-910401-G-GTACCTGCGCCATGACGTCATGGGACCATCACCCTCCGCCAGCCACGGGCCCGGGCGGTGCCAGGGTACCTGCGCCATGATGTCATGGGACCGTCACCCTCCGCCAGCCACGGGCCCGGGCGGTGCCAGGA c.2379+3_2379+4insTCCTGGCACCGCCCGGGCCCGTGGCTGGCGGAGGGTGACGGTCCCATGACATCATGGCGCAGGTACCCTGGCACCGCCCGGGCCCGTGGCTGGCGGAGGGTGATGGTCCCATGACGTCATGGCGCAGGTA splice_region ABR 1 80738 1.23857E-5 40369 0 1.54258E-4
17-910417-G-A p.Asp789Asp synonymous ABR 3 82378 3.64175E-5 41189 0 NA
17-910421-T-C p.His788Arg missense ABR 2 82674 2.41914E-5 41337 0 NA
17-910435-C-T p.Ala783Ala synonymous ABR 1 83042 1.20421E-5 41521 0 6.37755E-5
17-910437-C-T p.Ala783Thr missense ABR 1 83062 1.20392E-5 41531 0 NA
17-910441-C-T p.Ser781Ser synonymous ABR 2 83102 2.40668E-5 41551 0 8.28871E-6
17-910442-G-A p.Ser781Leu missense ABR 1 83124 1.20302E-5 41562 0 6.25E-4
17-910444-G-A p.Thr780Thr synonymous ABR 3 83172 3.60698E-5 41586 0 NA
17-910452-G-A p.His778Tyr missense ABR 2 83234 2.40286E-5 41617 0 9.56267E-5
17-910462-C-T p.Glu774Glu synonymous ABR 16 83272 1.92141E-4 41636 0 1.98712E-4
17-910482-G-A p.Leu768Leu synonymous ABR 1 83320 1.20019E-5 41660 0 8.27212E-6
17-910487-G-A p.Thr766Met missense ABR 2 83332 2.40004E-5 41666 0 NA
17-910492-T-C p.Gly764Gly synonymous ABR 4 83330 4.80019E-5 41665 0 5.03525E-4
17-910495-A-C p.Phe763Leu missense ABR 2 83336 2.39992E-5 41668 0 3.97909E-6
17-910501-G-A p.Thr761Thr synonymous ABR 4 83342 4.7995E-5 41671 0 1.65393E-5
17-910534-G-A p.Pro750Pro synonymous ABR 2 83310 2.40067E-5 41655 0 6.37349E-5
17-910545-C-T p.Glu747Lys missense ABR 3 83264 3.603E-5 41632 0 6.3743E-5
17-910546-G-A p.Ala746Ala synonymous ABR 1578 83220 0.0189618 41610 73 0.0421956
17-910554-TAAG-T c.2232-5_2232-3delCTT splice_region ABR 1 83188 1.2021E-5 41594 0 NA
17-912913-C-T c.2231+6G>A splice_region ABR 2 78932 2.53383E-5 39466 0 5.85079E-5
17-912914-G-A c.2231+5C>T splice_region ABR 15220 77518 0.196341 38759 1617 0.20375
17-912935-G-C p.Leu739Val missense ABR 1 80822 1.23729E-5 40411 0 NA
17-912944-G-T p.Leu736Ile missense ABR 1 81194 1.23162E-5 40597 0 7.97658E-6
17-912945-G-A p.Phe735Phe synonymous ABR 2 81238 2.4619E-5 40619 0 NA
17-912966-G-A p.Pro728Pro synonymous ABR 7 81560 8.58264E-5 40780 0 1.27413E-4
17-912977-G-A p.Arg725Cys missense ABR 1 81728 1.22357E-5 40864 0 3.18431E-5
17-912995-A-G p.Cys719Arg missense ABR 1 81808 1.22237E-5 40904 0 NA
17-912997-T-C p.Asn718Ser missense ABR 1 81774 1.22288E-5 40887 0 3.98988E-6
17-913024-G-A p.Ala709Val missense+splice_region ABR 3 81080 3.70005E-5 40540 0 1.67193E-5
17-913660-C-T n.372+5G>A splice_region ABR 1 18260 5.47645E-5 9130 0 NA
17-913664-C-T n.372+1G>A splice_donor ABR 1 21122 4.7344E-5 10561 0 NA
17-913968-C-CAGGG p.Ser711fs frameshift ABR 1 82738 1.20863E-5 41369 0 NA
17-913969-C-T p.Ala709Thr missense+splice_region ABR 1 82732 1.20872E-5 41366 0 NA
17-913970-G-A p.Ile708Ile splice_region+synonymous ABR 11 82778 1.32886E-4 41389 0 9.12015E-5
17-913972-T-C p.Ile708Val missense ABR 2 82802 2.4154E-5 41401 0 3.98937E-6
17-913989-G-A p.Pro702Leu missense ABR 2 82948 2.41115E-5 41474 0 NA
17-913994-G-C p.Leu700Leu synonymous ABR 1 82930 1.20584E-5 41465 0 NA
17-914003-C-T p.Thr697Thr synonymous ABR 1 82966 1.20531E-5 41483 0 1.65503E-5
17-914004-G-A p.Thr697Met missense ABR 1 82974 1.2052E-5 41487 0 NA
17-914018-G-A p.Pro692Pro synonymous ABR 4 82818 4.82987E-5 41409 0 2.62082E-5
17-914023-G-A p.Leu691Leu synonymous ABR 1 82888 1.20645E-5 41444 0 NA
17-914024-T-C p.Glu690Glu synonymous ABR 1 82888 1.20645E-5 41444 0 3.98676E-6
17-914028-C-T p.Arg689Gln missense ABR 1 82944 1.20563E-5 41472 0 NA
17-914042-G-C p.Leu684Leu synonymous ABR 8 83030 9.63507E-5 41515 0 6.76752E-5
17-914045-C-T p.Thr683Thr synonymous ABR 1 83034 1.20433E-5 41517 0 3.18959E-5
17-914051-G-A p.Ala681Ala synonymous ABR 3 83076 3.61115E-5 41538 0 4.37846E-5
17-914053-C-T p.Ala681Thr missense ABR 1 83078 1.20369E-5 41539 0 9.56999E-5
17-914054-G-A p.Ile680Ile synonymous ABR 10 83100 1.20337E-4 41550 0 7.01575E-4
17-914060-G-A p.Asn678Asn synonymous ABR 2 83132 2.40581E-5 41566 0 3.18817E-5
17-914082-A-G p.Met671Thr missense ABR 2 83150 2.40529E-5 41575 0 7.96026E-6
17-914090-G-A p.Ile668Ile synonymous ABR 2 83158 2.40506E-5 41579 0 2.48016E-5
17-914387-T-C p.His30Arg missense+splice_region ABR 3 25112 1.19465E-4 12556 0 1.95398E-4
17-914407-C-T p.Ser23Ser synonymous ABR 7 18460 3.79198E-4 9230 0 2.55004E-4
17-914433-C-T p.Gly15Ser missense ABR 1 12494 8.00384E-5 6247 0 3.18512E-5
17-914465-C-T p.Arg4His missense ABR 2 5960 3.3557E-4 2980 0 9.81162E-4
17-914523-G-A c.-48C>T 5_prime_UTR_premature_start_codon_gain ABR 1 2052 4.87329E-4 1026 0 1.16414E-4
17-915092-C-T p.Asp662Asn missense ABR 1 82714 1.20899E-5 41357 0 3.18593E-5
17-915093-G-A p.Phe661Phe synonymous ABR 2 82716 2.41791E-5 41358 0 1.27928E-5
17-915094-A-G p.Phe661Ser missense ABR 1 82722 1.20887E-5 41361 0 NA
17-915098-C-T p.Val660Ile missense ABR 7 82798 8.45431E-5 41399 0 3.18695E-5
17-915105-G-C p.Leu657Leu synonymous ABR 6 82872 7.24008E-5 41436 0 5.03525E-4
17-915108-C-T p.Ala656Ala synonymous ABR 266 82896 0.00320884 41448 0 0.0031244
17-915109-G-A p.Ala656Val missense ABR 2 82914 2.41214E-5 41457 0 5.03525E-4
17-915120-C-T p.Thr652Thr synonymous ABR 21 83004 2.53E-4 41502 0 0.00125
17-915128-C-T p.Val650Met missense ABR 2 83054 2.40807E-5 41527 0 5.03525E-4
17-915132-C-T p.Ser648Ser synonymous ABR 22 83060 2.64869E-4 41530 0 0.00100705
17-915146-T-C p.Ile644Val missense ABR 1 83108 1.20325E-5 41554 0 NA
17-915158-C-T p.Glu640Lys missense ABR 8 83164 9.61955E-5 41582 0 2.5507E-4
17-915159-G-A p.Ile639Ile synonymous ABR 2 83144 2.40547E-5 41572 0 3.32403E-5
17-915168-C-T p.Lys636Lys synonymous ABR 8 83160 9.62001E-5 41580 0 6.25E-4
17-915176-C-G c.363+1G>C splice_donor ABR 2 83132 2.40581E-5 41566 0 3.9841E-6
17-915197-C-T p.Val627Ile missense ABR 7 83076 8.42602E-5 41538 0 1.31459E-4
17-915198-G-A p.Ile626Ile synonymous ABR 2 83078 2.40738E-5 41539 0 3.31461E-5
17-915200-T-C p.Ile626Val missense ABR 1 83088 1.20354E-5 41544 0 3.18715E-5
17-915211-T-G p.Lys622Thr missense ABR 1 83016 1.20459E-5 41508 0 8.29215E-6
17-915216-G-A p.Arg620Arg synonymous ABR 4 82932 4.82323E-5 41466 0 1.99368E-5
17-915217-C-T p.Arg620His missense ABR 3 82912 3.61829E-5 41456 0 2.79209E-5
17-915219-C-T p.Glu619Glu synonymous ABR 1 82890 1.20642E-5 41445 0 8.30179E-6
17-915224-G-A p.Arg618Trp missense+splice_region ABR 1 82822 1.20741E-5 41411 0 NA
17-915224-G-T p.Arg618Arg splice_region+synonymous ABR 1 82822 1.20741E-5 41411 0 8.31048E-6
17-915709-G-A c.*65+5C>T splice_region ABR 4 61498 6.50428E-5 30749 0 1.62022E-4
17-915781-A-G p.Ter117Glnext*? stop_lost ABR 1 71464 1.39931E-5 35732 0 7.40368E-6
17-915790-C-T p.Val114Met missense ABR 1 72260 1.38389E-5 36130 0 NA
17-915791-C-T p.Pro113Pro synonymous ABR 2 72384 2.76304E-5 36192 0 3.1902E-5
17-915792-G-A p.Pro113Leu missense ABR 4 72546 5.51374E-5 36273 0 1.11022E-4
17-915797-TCTGCCACCGCCGAGCGGGGGGTAACTGATTAGGTGCCAGGATGGGCACCGGCGGGGAGGGCTGGGGGGCCCGGGCTGGGGGGGACCCGGGGCACCGACGCCAGGACTGGGAGACCCGAGGCAGCACCTAC-T c.332+1_333-1del splice_acceptor ABR 1 73156 1.36694E-5 36578 0 NA
17-915798-C-T c.333-1G>A splice_acceptor ABR 1 73252 1.36515E-5 36626 0 7.38225E-6
17-915930-C-T p.Thr616Thr splice_region+synonymous ABR 1 80630 1.24023E-5 40315 0 7.79423E-5
17-915931-G-A p.Thr616Met missense ABR 2 80692 2.47856E-5 40346 0 3.82497E-5
17-915939-G-A p.Ser613Ser synonymous ABR 4 80990 4.93888E-5 40495 0 1.04406E-4
17-915951-A-G p.Gly609Gly synonymous ABR 2 81288 2.46039E-5 40644 0 NA
17-915954-G-A p.Phe608Phe synonymous ABR 9 81340 1.10647E-4 40670 0 1.76118E-4
17-915960-G-A p.Gly606Gly synonymous ABR 16 81430 1.96488E-4 40715 0 5.09684E-4
17-915962-C-T p.Gly606Ser missense ABR 2 81456 2.45531E-5 40728 0 NA
17-915963-G-A p.Thr605Thr synonymous ABR 313 81454 0.00384266 40727 2 0.0110067
17-915963-G-C p.Thr605Thr synonymous ABR 3 81460 3.68279E-5 40730 0 2.6395E-5
17-915978-C-T p.Pro600Pro synonymous ABR 10 81504 1.22693E-4 40752 0 0.00152594
17-915979-G-A p.Pro600Leu missense ABR 5 81516 6.13377E-5 40758 0 1.90304E-4
17-915990-C-G p.Leu596Leu synonymous ABR 3 81570 3.67782E-5 40785 0 2.32234E-5
17-915994-C-A p.Ser595Ile missense ABR 1 81576 1.22585E-5 40788 0 8.95809E-6
17-916004-G-T p.Arg592Arg synonymous ABR 3 81506 3.68071E-5 40753 0 NA
17-916005-G-A p.Ser591Ser synonymous ABR 1 81488 1.22717E-5 40744 0 NA
17-916008-G-A p.Thr590Thr synonymous ABR 1 81470 1.22745E-5 40735 0 4.67998E-6
17-916017-C-T p.Met587Ile missense ABR 1 81334 1.2295E-5 40667 0 NA
17-916019-T-C p.Met587Val missense ABR 1 81360 1.22911E-5 40680 0 3.18918E-5
17-916026-T-C p.Glu584Glu synonymous ABR 1 81304 1.22995E-5 40652 0 4.96106E-6
17-916282-A-T n.103+2T>A splice_donor ABR 1 82284 1.2153E-5 41142 0 NA
17-916284-CTG-C n.101_102delCA splice_region ABR 1 82364 1.21412E-5 41182 0 NA
17-916337-C-T c.1740+8G>A splice_region ABR 11 83078 1.32406E-4 41539 0 1.27404E-4
17-916338-G-A c.1740+7C>T splice_region ABR 219 83056 0.00263678 41528 2 0.00200033
17-916338-G-T c.1740+7C>A splice_region ABR 1 83062 1.20392E-5 41531 0 3.30633E-5
17-916347-C-T p.Gly580Arg missense+splice_region ABR 1 83106 1.20328E-5 41553 0 8.26337E-6
17-916348-G-A p.Asn579Asn synonymous ABR 14 83114 1.68443E-4 41557 0 5.03525E-4
17-916348-G-C p.Asn579Lys missense ABR 1 83114 1.20317E-5 41557 0 NA
17-916362-C-T p.Val575Met missense ABR 3 83172 3.60698E-5 41586 0 5.03525E-4
17-916363-G-A p.Asp574Asp synonymous ABR 56 83172 6.73303E-4 41586 0 0.00352467
17-916366-C-T p.Thr573Thr synonymous ABR 1 83198 1.20195E-5 41599 0 3.18593E-5
17-916367-G-A p.Thr573Met missense ABR 2 83200 2.40385E-5 41600 0 8.25832E-5
17-916367-G-T p.Thr573Lys missense ABR 4 83200 4.80769E-5 41600 2 NA
17-916383-T-C p.Thr568Ala missense ABR 1 83196 1.20198E-5 41598 0 NA
17-916390-G-A p.Thr565Thr synonymous ABR 17 83196 2.04337E-4 41598 0 3.30306E-4
17-916407-G-A c.1681-3C>T splice_region ABR 1 83152 1.20262E-5 41576 0 NA
17-934831-C-CG c.144+6_144+7insC splice_region ABR 23 31336 7.3398E-4 15668 0 0.00242226
17-934832-G-A c.144+6C>T splice_region ABR 3079 30924 0.0995667 15462 181 0.4
17-934833-G-GAGGAGCAGCTTGTTGC c.144+4_144+5insGCAACAAGCTGCTCCT splice_region ABR 1 31446 3.18005E-5 15723 0 NA
17-934833-G-A c.144+5C>T splice_region ABR 1 31446 3.18005E-5 15723 0 NA
17-934834-G-A c.144+4C>T splice_region ABR 1 31530 3.17158E-5 15765 0 NA
17-934837-C-CG p.Leu49fs frameshift ABR 1 31748 3.1498E-5 15874 0 NA
17-934838-C-CTGCTG p.Lys48fs frameshift ABR 1 31808 3.14386E-5 15904 0 NA
17-934838-C-G p.Lys48Asn missense+splice_region ABR 2 31808 6.28773E-5 15904 0 NA
17-934849-G-T p.Leu45Ile missense ABR 2 32294 6.1931E-5 16147 0 NA
17-934856-G-A p.Asn42Asn synonymous ABR 2 32622 6.13083E-5 16311 0 NA
17-934857-T-C p.Asn42Ser missense ABR 4 32658 1.22481E-4 16329 0 3.25055E-5
17-934859-G-A p.Arg41Arg synonymous ABR 1 32684 3.0596E-5 16342 0 NA
17-934882-C-T p.Ala34Thr missense ABR 1 33454 2.98918E-5 16727 0 3.22518E-5
17-934885-C-T p.Gly33Ser missense ABR 1 33494 2.98561E-5 16747 0 NA
17-934886-G-A p.Thr32Thr synonymous ABR 2 33518 5.96694E-5 16759 0 NA
17-934891-T-TG p.Asn31fs frameshift ABR 1 33782 2.96016E-5 16891 0 8.62069E-4
17-934893-G-C p.Pro30Arg missense ABR 2 33870 5.90493E-5 16935 0 0.00170068
17-934894-G-A p.Pro30Ser missense ABR 5 33878 1.47588E-4 16939 0 1.92715E-4
17-934897-G-A p.Pro29Ser missense ABR 6 33770 1.77672E-4 16885 0 3.21419E-5
17-934898-G-A p.Arg28Arg synonymous ABR 5045 33424 0.150939 16712 477 0.46875
17-934924-C-T p.Ala20Thr missense ABR 8 33796 2.36714E-4 16898 0 0.00130548
17-934930-G-T p.Pro18Thr missense ABR 2838 33496 0.0847265 16748 165 0.4375
17-934930-G-GT p.Pro18fs frameshift ABR 4 33684 1.18751E-4 16842 0 NA
17-934936-G-A p.Arg16Cys missense ABR 2 33394 5.9891E-5 16697 0 NA
17-934941-G-A p.Ala14Val missense ABR 2 33282 6.00925E-5 16641 0 9.60615E-5
17-934942-C-T p.Ala14Thr missense ABR 1 33340 2.9994E-5 16670 0 3.19959E-5
17-934954-AGTCGGGCTGGGGCAGGACGTCGGTCATGCCGGGGGGGACGG-A p.Met1fs frameshift ABR 1 33126 3.01878E-5 16563 0 NA
17-934957-C-T p.Asp9Asn missense ABR 12 32986 3.63791E-4 16493 0 6.34518E-4
17-934958-G-T p.Pro8Pro synonymous ABR 2 33030 6.0551E-5 16515 0 NA
17-934960-G-A p.Pro8Ser missense ABR 5 33020 1.51423E-4 16510 0 NA
17-934961-C-G p.Gln7His missense ABR 1 32964 3.03361E-5 16482 0 NA
17-934972-C-T p.Val4Ile missense ABR 8 32588 2.45489E-4 16294 0 0.00254453
17-934972-CGTCGGTCATGCCG-C p.Met1fs frameshift ABR 2 32588 6.13723E-5 16294 0 NA
17-934975-C-A p.Asp3Tyr missense ABR 1 32474 3.07939E-5 16237 0 NA
17-934975-C-CGGT p.Thr2dup conservative_inframe_insertion ABR 1 32474 3.07939E-5 16237 0 NA
17-934976-G-A p.Thr2Thr synonymous ABR 7 32510 2.15318E-4 16255 0 5.54432E-4
17-934994-G-A c.-13C>T 5_prime_UTR_premature_start_codon_gain ABR 1 32122 3.11313E-5 16061 0 3.22269E-5
17-935001-G-A c.-20C>T 5_prime_UTR_premature_start_codon_gain ABR 3 31942 9.39202E-5 15971 0 3.21337E-5
17-935039-G-A c.-58C>T 5_prime_UTR_premature_start_codon_gain ABR 1 30700 3.25733E-5 15350 0 3.24907E-5
17-935072-G-A c.-91C>T 5_prime_UTR_premature_start_codon_gain ABR 1 29626 3.37541E-5 14813 0 NA
17-953222-G-A n.237C>T splice_region ABR 1 82244 1.21589E-5 41122 0 NA
17-953322-C-T p.Val550Met missense ABR 2 83296 2.40108E-5 41648 0 1.19332E-5
17-953330-T-C p.Asn547Ser missense ABR 5 83298 6.00254E-5 41649 0 3.18451E-5
17-953332-G-A p.Asn546Asn synonymous ABR 1 83302 1.20045E-5 41651 0 8.24226E-6
17-953337-C-A p.Asp545Tyr missense ABR 1 83294 1.20057E-5 41647 0 8.24144E-6
17-953339-T-C p.Lys544Arg missense ABR 3 83290 3.60187E-5 41645 0 2.47239E-5
17-953350-G-A p.Thr540Thr synonymous ABR 3 83294 3.6017E-5 41647 0 3.18471E-5
17-953351-G-A p.Thr540Ile missense ABR 1 83288 1.20065E-5 41644 0 NA
17-953395-G-T p.Ser525Ser synonymous ABR 6 83170 7.21414E-5 41585 0 6.36862E-5
17-953410-G-A p.Ile520Ile synonymous ABR 10 83074 1.20375E-4 41537 0 9.55414E-5
17-953415-C-G p.Glu519Gln missense ABR 1 83058 1.20398E-5 41529 0 3.31862E-5
17-953774-C-T c.1548+3G>A splice_region ABR 1 82802 1.2077E-5 41401 0 NA
17-953795-C-T p.Ala188Ala splice_region+synonymous ABR 146 83020 0.00175861 41510 0 0.00389031
17-953796-G-A p.Ala188Val missense+splice_region ABR 1 83024 1.20447E-5 41512 0 1.6567E-5
17-953805-C-T p.Arg507Gln missense ABR 1 83064 1.20389E-5 41532 0 NA
17-953807-G-A p.Phe506Phe synonymous ABR 2 83076 2.40743E-5 41538 0 8.28034E-6
17-953843-G-A p.Phe494Phe synonymous ABR 7 83036 8.43008E-5 41518 0 5.04032E-4
17-959286-T-C p.Lys480Arg missense ABR 4066 82968 0.0490068 41484 121 0.0498375
17-959303-G-A p.His474His synonymous ABR 1 83128 1.20296E-5 41564 0 3.97709E-6
17-959309-G-A p.Ile472Ile synonymous ABR 2 83102 2.40668E-5 41551 0 6.25E-4
17-959328-T-C p.Tyr466Cys missense ABR 1 83078 1.20369E-5 41539 0 3.29957E-5
17-959329-A-G p.Tyr466His missense ABR 8 83086 9.62858E-5 41543 0 5.44474E-4
17-959331-A-C p.Leu465Arg missense ABR 1 83098 1.2034E-5 41549 0 NA
17-959337-G-A p.Pro463Leu missense ABR 1 83068 1.20383E-5 41534 0 NA
17-959340-G-A p.Ser462Phe missense ABR 9 83036 1.08387E-4 41518 0 3.18512E-5
17-959342-C-T p.Glu461Glu synonymous ABR 7 83028 8.43089E-5 41514 0 1.65055E-5
17-959345-A-G p.Asp460Asp synonymous ABR 21 83002 2.53006E-4 41501 0 5.03525E-4
17-959348-G-A p.Asp459Asp splice_region+synonymous ABR 2 82954 2.41097E-5 41477 0 6.60557E-5
17-959355-A-G c.1376-6T>C splice_region ABR 1 82866 1.20677E-5 41433 0 NA
17-960230-G-A c.1375+8C>T splice_region ABR 2 82798 2.41552E-5 41399 0 9.55779E-5
17-960231-A-G c.1375+7T>C splice_region ABR 1 82822 1.20741E-5 41411 0 NA
17-960275-C-T p.Arg446Arg synonymous ABR 2 83034 2.40865E-5 41517 0 8.2481E-6
17-960295-C-A p.Gly440* stop_gained ABR 1 82870 1.20671E-5 41435 0 NA
17-960296-T-C p.Thr439Thr synonymous ABR 2 82828 2.41464E-5 41414 0 NA
17-960320-G-A p.Ser431Ser synonymous ABR 1 82138 1.21746E-5 41069 0 NA
17-960332-G-A p.Ala427Ala synonymous ABR 1 81492 1.22711E-5 40746 0 3.18715E-5
17-960333-G-T p.Ala427Asp missense ABR 1 81454 1.22769E-5 40727 0 3.98533E-6
17-960342-T-A p.Asp424Val missense+splice_region ABR 2 80662 2.47948E-5 40331 0 NA
17-960346-G-C c.1271-4C>G splice_region ABR 2 80388 2.48793E-5 40194 0 8.30165E-6
17-961079-C-T n.204+5G>A splice_region ABR 1 76838 1.30144E-5 38419 0 NA
17-961214-C-T p.Lys422Lys synonymous ABR 1 83280 1.20077E-5 41640 0 NA
17-961231-T-C p.Ile417Val missense ABR 8 83280 9.60615E-5 41640 0 1.59418E-4
17-961249-A-C p.Ser411Ala missense ABR 2 83268 2.40188E-5 41634 0 NA
17-961250-C-T p.Arg410Arg synonymous ABR 10 83270 1.20091E-4 41635 0 2.38584E-5
17-961255-C-G p.Glu409Gln missense ABR 2 83258 2.40217E-5 41629 0 NA
17-961256-G-A p.Tyr408Tyr synonymous ABR 5 83262 6.00514E-5 41631 0 1.91192E-4
17-961270-G-A p.Leu404Leu synonymous ABR 11 83242 1.32145E-4 41621 0 2.23029E-4
17-961279-G-A p.Leu401Leu synonymous ABR 1 83246 1.20126E-5 41623 0 8.24334E-6
17-961991-A-G p.Asn396Asn synonymous ABR 19 82922 2.29131E-4 41461 1 3.51012E-4
17-961996-G-A p.Arg395Trp missense ABR 2 82964 2.41068E-5 41482 0 3.97943E-6
17-961996-G-T p.Arg395Arg synonymous ABR 2 82964 2.41068E-5 41482 0 9.14335E-5
17-961998-T-C p.Asn394Ser missense ABR 10 83008 1.2047E-4 41504 0 1.98932E-4
17-962012-C-T p.Pro389Pro synonymous ABR 1 83120 1.20308E-5 41560 0 3.18756E-5
17-962015-G-A p.Ile388Ile synonymous ABR 1 83148 1.20267E-5 41574 0 NA
17-962039-C-G p.Leu380Leu synonymous ABR 1 83268 1.20094E-5 41634 0 8.25055E-6
17-962051-C-T p.Glu376Glu synonymous ABR 1 83314 1.20028E-5 41657 0 3.97678E-6
17-962059-T-C p.Met374Val missense ABR 1 83334 1.19999E-5 41667 0 NA
17-962061-T-A p.Lys373Met missense ABR 1 83334 1.19999E-5 41667 0 1.64902E-5
17-962073-C-T p.Arg369His missense ABR 1 83316 1.20025E-5 41658 0 1.19301E-5
17-962078-G-A p.Ile367Ile synonymous ABR 2 83304 2.40085E-5 41652 0 7.15842E-5
17-962080-T-C p.Ile367Val missense ABR 1 83306 1.20039E-5 41653 0 1.31967E-4
17-962085-C-T p.Arg365Gln missense ABR 1 83294 1.20057E-5 41647 0 NA
17-962086-G-A p.Arg365Trp missense ABR 1 83284 1.20071E-5 41642 0 7.95418E-6
17-962104-C-T p.Ala359Thr missense ABR 1 83274 1.20085E-5 41637 0 3.9788E-6
17-962111-C-G c.1072-4G>C splice_region ABR 2 83260 2.40211E-5 41630 0 3.18532E-5
17-970323-C-T p.Gln355Gln synonymous ABR 1 82876 1.20662E-5 41438 0 4.00522E-6
17-970354-A-G p.Met345Thr missense ABR 2 82946 2.41121E-5 41473 0 NA
17-970374-A-G p.His338His synonymous ABR 1 82978 1.20514E-5 41489 0 8.4786E-6
17-970386-G-A p.Pro334Pro synonymous ABR 5 82928 6.02933E-5 41464 0 1.68665E-5
17-970406-C-G n.524+1G>C splice_donor ABR 1 82862 1.20683E-5 41431 0 NA
17-970413-C-T p.Glu325Glu synonymous ABR 73305 81742 0.896785 40871 32957 0.927419
17-970419-G-A p.Pro323Pro synonymous ABR 5 82814 6.03763E-5 41407 0 9.56084E-5
17-970439-C-G p.Asp317His missense ABR 1 82524 1.21177E-5 41262 0 NA
17-970440-G-A p.Ala316Ala synonymous ABR 14 82502 1.69693E-4 41251 0 1.59408E-4
17-970464-G-C p.Asp308Glu missense ABR 1 81714 1.22378E-5 40857 0 NA
17-970470-C-G p.Gln306His missense ABR 1 81396 1.22856E-5 40698 0 NA
17-970478-G-T p.His304Asn missense ABR 1 80938 1.23551E-5 40469 0 NA
17-970490-C-T c.906-8G>A splice_region ABR 3 80354 3.73348E-5 40177 0 1.96331E-5
17-973009-CGCAGAGGTCAGGACCCCCTCCCCCGCCCCTGGACTCACACACTCACCTCGCAGAGGTCCGGACCCCCTCCCCCGCCCCTGGACTCGCACACTCACCCCGCAGAGGTCAGGACCCCCTCCCCCGCCCCGGACTCGCACACTCACCCCGCAGAGGTCCGGACCCCCTCCCCCGCCCCGTGCCCCTGGACTCACACACTCACCCT-C p.Gly302del splice_donor ABR 1 37896 2.6388E-5 18948 0 NA
17-973205-T-A c.905+4A>T splice_region ABR 2 80478 2.48515E-5 40239 0 4.27818E-6
17-973214-A-G p.Ser300Ser synonymous ABR 1 81234 1.23101E-5 40617 0 8.39659E-6
17-973218-G-T p.Thr299Asn missense ABR 1 81498 1.22702E-5 40749 0 NA
17-973233-G-A p.Ala294Val missense ABR 2 82170 2.43398E-5 41085 0 NA
17-973268-C-T p.Arg282Arg synonymous ABR 1 82804 1.20767E-5 41402 0 NA
17-973270-G-A p.Arg282Trp missense ABR 1 82828 1.20732E-5 41414 0 3.98029E-6
17-973327-G-A p.Arg263* stop_gained ABR 1 82380 1.21389E-5 41190 0 3.98661E-6
17-973328-C-T p.Thr262Thr splice_region+synonymous ABR 1 82344 1.21442E-5 41172 0 1.19607E-5
17-975866-C-T p.Thr257Thr synonymous ABR 14 82288 1.70134E-4 41144 0 4.45917E-4
17-975872-C-A p.Val255Val synonymous ABR 1 82350 1.21433E-5 41175 0 3.1841E-5
17-975882-C-T p.Arg252Gln missense ABR 1 82242 1.21592E-5 41121 0 0.00100908
17-975885-CG-C p.Arg251fs frameshift ABR 1 82218 1.21628E-5 41109 0 NA
17-975886-G-A p.Arg251Cys missense ABR 1 82274 1.21545E-5 41137 0 1.86421E-5
17-975892-C-T p.Asp249Asn missense ABR 4 82106 4.87175E-5 41053 0 9.24744E-6
17-975893-G-A p.Ile248Ile synonymous ABR 5 82152 6.08628E-5 41076 0 1.9118E-4
17-975898-C-T p.Asp247Asn missense ABR 1 82176 1.2169E-5 41088 0 NA
17-975933-C-T p.Arg235His missense ABR 2 82054 2.43742E-5 41027 0 8.82581E-6
17-975935-G-A p.Leu234Leu synonymous ABR 2 82054 2.43742E-5 41027 0 1.75682E-5
17-975953-C-T p.Pro228Pro synonymous ABR 1 81848 1.22178E-5 40924 0 1.20267E-5
17-975954-G-C p.Pro228Arg missense ABR 1 81868 1.22148E-5 40934 0 NA
17-975955-G-C p.Pro228Ala missense ABR 1 81860 1.2216E-5 40930 0 8.70489E-6
17-976854-TTGACACTCA-T c.642+2_642+10delTGAGTGTCA splice_donor ABR 1 81174 1.23192E-5 40587 0 NA
17-976865-G-A p.His214His splice_region+synonymous ABR 1 81404 1.22844E-5 40702 0 4.27804E-6
17-976907-G-C p.Tyr200* stop_gained ABR 1 81842 1.22187E-5 40921 0 4.12249E-6
17-976910-G-A p.Leu199Leu synonymous ABR 1 81854 1.22169E-5 40927 0 NA
17-976915-G-A p.Leu198Leu splice_region+synonymous ABR 5 81804 6.11217E-5 40902 0 0.00100705
17-976920-G-A c.590-3C>T splice_region ABR 2 81734 2.44696E-5 40867 0 3.57628E-5
17-976922-C-T c.590-5G>A splice_region ABR 83 81660 0.00101641 40830 2 0.00163075
17-976923-G-A c.590-6C>T splice_region ABR 1 81648 1.22477E-5 40824 0 3.19693E-5
17-982039-GA-AG c.55+5_55+6delTCinsCT splice_region ABR 3032 34656 0.0874885 17328 172 NA
17-982039-G-A c.55+6C>T splice_region ABR 346 34710 0.00996831 17355 105 0.142539
17-982040-A-G c.55+5T>C splice_region ABR 350 34726 0.0100789 17363 107 0.142494
17-982056-T-C p.Tyr15Cys missense+splice_region ABR 1 34780 2.87522E-5 17390 0 9.3633E-5
17-982062-C-G p.Cys13Ser missense ABR 1 34794 2.87406E-5 17397 0 NA
17-982073-G-C p.Phe9Leu missense ABR 1 34800 2.87356E-5 17400 0 NA
17-982118-G-A c.-19C>T 5_prime_UTR_premature_start_codon_gain ABR 1 34808 2.8729E-5 17404 0 1.87688E-4
17-982121-G-A c.-22C>T 5_prime_UTR_premature_start_codon_gain ABR 1 34818 2.87208E-5 17409 0 7.8036E-6
17-982127-G-A c.-28C>T 5_prime_UTR_premature_start_codon_gain ABR 4 34802 1.14936E-4 17401 0 3.90698E-5
17-982152-G-A c.-53C>T 5_prime_UTR_premature_start_codon_gain ABR 545 34752 0.0156826 17376 4 0.024375
17-982160-C-G c.-61G>C 5_prime_UTR_premature_start_codon_gain ABR 1 34752 2.87753E-5 17376 0 NA
17-982169-C-A c.-70G>T 5_prime_UTR_premature_start_codon_gain ABR 1 34746 2.87803E-5 17373 0 NA
17-982170-G-A c.-71C>T 5_prime_UTR_premature_start_codon_gain ABR 10 34754 2.87737E-4 17377 1 1.27551E-4
17-982203-G-A c.-104C>T 5_prime_UTR_premature_start_codon_gain ABR 1 34604 2.88984E-5 17302 0 4.15442E-4
17-982216-G-A c.-117C>T 5_prime_UTR_premature_start_codon_gain ABR 6 34462 1.74105E-4 17231 0 2.56098E-4
17-982228-C-A c.-129G>T 5_prime_UTR_premature_start_codon_gain ABR 1 34236 2.9209E-5 17118 0 NA
17-982229-G-A c.-130C>T 5_prime_UTR_premature_start_codon_gain ABR 27 34212 7.89197E-4 17106 0 2.24532E-4
17-982267-G-A c.-168C>T 5_prime_UTR_premature_start_codon_gain ABR 1 32982 3.03196E-5 16491 0 6.4156E-5
17-982272-G-A c.-173C>T 5_prime_UTR_premature_start_codon_gain ABR 1 32850 3.04414E-5 16425 0 3.2111E-5
17-982323-G-A c.-224C>T 5_prime_UTR_premature_start_codon_gain ABR 2 34004 5.88166E-5 17002 0 3.19122E-5
17-982353-G-A c.-254C>T 5_prime_UTR_premature_start_codon_gain ABR 2 35786 5.58878E-5 17893 0 3.18898E-5
17-982381-G-A c.-282C>T 5_prime_UTR_premature_start_codon_gain ABR 1 37834 2.64313E-5 18917 0 3.18878E-5
17-982562-C-G c.589+8G>C splice_region ABR 3 81556 3.67845E-5 40778 0 4.0295E-6
17-982562-C-T c.589+8G>A splice_region ABR 1 81556 1.22615E-5 40778 0 2.4177E-5
17-982569-C-G c.589+1G>C splice_donor ABR 2 81780 2.44559E-5 40890 0 NA
17-982586-C-T p.Thr191Thr synonymous ABR 3 82054 3.65613E-5 41027 0 4.8122E-5
17-982586-C-G p.Thr191Thr synonymous ABR 6 82054 7.31226E-5 41027 0 4.01017E-6
17-982587-G-A p.Thr191Met missense ABR 3 82060 3.65586E-5 41030 0 9.27403E-6
17-982593-C-T p.Ser189Asn missense ABR 1 82096 1.21809E-5 41048 0 NA
17-982606-C-T p.Asp185Asn missense ABR 2 82084 2.43653E-5 41042 0 9.34877E-6
17-982625-G-C p.Leu178Leu synonymous ABR 2 82036 2.43795E-5 41018 0 1.93442E-5
17-982635-C-A c.529-5G>T splice_region ABR 138 81908 0.00168482 40954 0 0.00430622
17-986502-ATTTTTTTT-A n.470_*6delAAAAAAAA splice_region ABR 37 2662 0.0138993 1331 7 0.0717801
17-986502-ATTTTTTTTT-A n.469_*6delAAAAAAAAA splice_region ABR 69 2652 0.0260181 1326 21 0.0605688
17-986502-ATTTTTTTTTTT-A n.467_*6delAAAAAAAAAAA splice_region ABR 2 2702 7.40192E-4 1351 1 NA
17-986502-ATTTTTTTTTT-A n.468_*6delAAAAAAAAAA splice_region ABR 5 2700 0.00185185 1350 2 NA
17-986502-ATTTTTTT-A n.471_*6delAAAAAAA splice_region ABR 5 2702 0.00185048 1351 0 NA
17-986752-C-T c.528+8G>A splice_region ABR 1 82234 1.21604E-5 41117 0 2.11049E-5
17-986753-G-A c.528+7C>T splice_region ABR 3 82308 3.64485E-5 41154 0 6.90453E-5
17-986781-G-A p.Asn169Asn synonymous ABR 1 82878 1.20659E-5 41439 0 3.1902E-5
17-986784-G-A p.Asn168Asn synonymous ABR 1 82896 1.20633E-5 41448 0 5.89384E-5
17-986820-G-A p.Val156Val synonymous ABR 2 82884 2.41301E-5 41442 0 6.38081E-5
17-986834-C-T p.Asp152Asn missense ABR 3 82806 3.62293E-5 41403 0 NA
17-986835-G-A p.Val151Val synonymous ABR 1 82760 1.20831E-5 41380 0 3.18857E-5
17-986841-C-T p.Ala149Ala synonymous ABR 1 82652 1.20989E-5 41326 0 3.18756E-5
17-986850-C-G p.Val146Val synonymous ABR 1 82420 1.2133E-5 41210 0 3.29582E-5
17-986855-C-T p.Gly145Ser missense ABR 1 82156 1.2172E-5 41078 0 8.2394E-6
17-986856-G-A p.Leu144Leu synonymous ABR 5 82192 6.08332E-5 41096 0 5.17187E-5
17-986856-G-T p.Leu144Leu synonymous ABR 1 82192 1.21666E-5 41096 0 3.97836E-6
17-986870-G-T c.421-3C>A splice_region ABR 2 81608 2.45074E-5 40804 0 NA
17-986871-C-A c.421-4G>T splice_region ABR 1 81560 1.22609E-5 40780 0 NA
17-986873-G-A c.421-6C>T splice_region ABR 2 81500 2.45399E-5 40750 0 8.35581E-5
17-994907-G-C p.Leu140Val missense+splice_region ABR 1 83204 1.20187E-5 41602 0 8.47946E-6
17-994908-C-T p.Lys139Lys synonymous ABR 1 83208 1.20181E-5 41604 0 NA
17-994932-G-A p.Val131Val synonymous ABR 1 83264 1.201E-5 41632 0 NA
17-994934-C-T p.Val131Ile missense ABR 10 83264 1.201E-4 41632 0 6.25E-4
17-994955-C-T p.Val124Met missense ABR 2 83276 2.40165E-5 41638 0 NA
17-994962-G-A p.Cys121Cys synonymous ABR 151 83270 0.00181338 41635 0 0.00109373
17-994975-T-C p.Tyr117Cys missense ABR 3 83282 3.60222E-5 41641 0 1.64785E-5
17-994980-C-T p.Glu115Glu synonymous ABR 1 83284 1.20071E-5 41642 0 NA
17-994989-G-C p.Ile112Met missense ABR 1 83276 1.20083E-5 41638 0 3.97681E-6
17-994991-T-C p.Ile112Val missense ABR 6 83276 7.20496E-5 41638 0 2.38607E-5
17-995048-C-T p.Val93Met missense ABR 1 83114 1.20317E-5 41557 0 3.97972E-6
17-995049-G-A p.Pro92Pro synonymous ABR 8 83104 9.62649E-5 41552 0 3.58215E-5
17-995066-C-T p.Ala87Thr missense ABR 1 82910 1.20613E-5 41455 0 3.18918E-5
17-995066-C-G p.Ala87Pro missense ABR 1 82910 1.20613E-5 41455 0 NA
17-995067-G-A p.Thr86Thr synonymous ABR 3 82926 3.61768E-5 41463 0 0.00100705
17-995075-T-G p.Lys84Gln missense ABR 11 82796 1.32857E-4 41398 0 NA
17-995088-G-A p.Pro79Pro splice_region+synonymous ABR 1 82542 1.2115E-5 41271 0 5.03525E-4
17-995093-G-A c.235-3C>T splice_region ABR 1 82454 1.2128E-5 41227 0 NA
17-1003879-G-T p.Leu78Met missense+splice_region ABR 2 83118 2.40622E-5 41559 0 NA
17-1003907-G-A p.Ile68Ile synonymous ABR 3 83276 3.60248E-5 41638 0 NA
17-1003915-C-T p.Glu66Lys missense ABR 1 83304 1.20042E-5 41652 0 1.193E-5
17-1003916-G-A p.Ser65Ser synonymous ABR 3 83296 3.60161E-5 41648 0 5.03525E-4
17-1003918-T-G p.Ser65Arg missense ABR 2 83304 2.40085E-5 41652 0 3.18878E-5
17-1003931-C-T p.Ser60Ser synonymous ABR 5 83310 6.00168E-5 41655 0 9.54381E-5
17-1003940-C-G p.Leu57Leu synonymous ABR 1 83304 1.20042E-5 41652 0 7.9533E-6
17-1003942-G-A p.Leu57Leu synonymous ABR 2 83306 2.40079E-5 41653 0 1.64734E-5
17-1003961-T-C p.Lys50Lys synonymous ABR 6 83274 7.20513E-5 41637 0 3.97735E-6
17-1003976-C-CCCAGGAGCCAGTCCCTCAGG c.136-2_136-1insCCTGAGGGACTGGCTCCTGG splice_acceptor ABR 1 83234 1.20143E-5 41617 0 NA
17-1003978-G-GGAGTCGGGGAGACGC c.136-4_136-3insGCGTCTCCCCGACTC splice_region ABR 1 83228 1.20152E-5 41614 0 NA
17-1003980-A-ATCCCCCCCGCC c.136-6_136-5insGGCGGGGGGGA splice_region ABR 1 83236 1.2014E-5 41618 0 NA
17-1012166-G-A c.135+8C>T splice_region ABR 1 78402 1.27548E-5 39201 0 1.10996E-4
17-1012176-T-G p.Lys45Gln missense+splice_region ABR 2 78594 2.54472E-5 39297 0 1.13202E-5
17-1012189-G-C p.Phe40Leu missense ABR 2 78720 2.54065E-5 39360 0 NA
17-1012191-A-G p.Phe40Leu missense ABR 1 78736 1.27007E-5 39368 0 4.41626E-6
17-1012193-G-T p.Pro39His missense ABR 3 78732 3.81039E-5 39366 0 4.07614E-5
17-1012196-G-A p.Ser38Phe missense ABR 1 78688 1.27084E-5 39344 0 NA
17-1012209-G-A p.Pro34Ser missense ABR 1 78760 1.26968E-5 39380 0 9.56755E-5
17-1012213-G-A p.Thr32Thr synonymous ABR 1 78820 1.26871E-5 39410 0 NA
17-1012214-G-A p.Thr32Ile missense ABR 1703 78788 0.021615 39394 60 0.0332525
17-1012227-G-T p.Leu28Met missense ABR 1 78930 1.26695E-5 39465 0 NA
17-1012249-C-T p.Val20Val synonymous ABR 1 79078 1.26457E-5 39539 0 1.14223E-4
17-1012257-C-T p.Glu18Lys missense ABR 1 79028 1.26537E-5 39514 0 NA
17-1012266-G-C p.Leu15Val missense ABR 1 79122 1.26387E-5 39561 0 NA
17-1012271-T-C p.Lys13Arg missense ABR 1 79098 1.26425E-5 39549 0 NA
17-1012275-C-G p.Asp12His missense ABR 1 79140 1.26358E-5 39570 0 NA
17-1012275-C-T p.Asp12Asn missense ABR 1 79140 1.26358E-5 39570 0 NA
17-1012276-C-T p.Leu11Leu synonymous ABR 3 79146 3.79046E-5 39573 0 2.27118E-4
17-1012284-C-T p.Gly9Ser missense ABR 1 79170 1.2631E-5 39585 0 6.38366E-5
17-1012289-G-T p.Ala7Glu missense ABR 1 79054 1.26496E-5 39527 0 3.50453E-5
17-1012308-T-C p.Met1? start_lost ABR 1 78750 1.26984E-5 39375 0 NA
17-1012316-G-A c.-8C>T 5_prime_UTR_premature_start_codon_gain ABR 5 78472 6.3717E-5 39236 0 1.81594E-5
17-1018557-G-A c.-66C>T 5_prime_UTR_premature_start_codon_gain ABR 1 18 0.0555556 9 0 0.0164044
17-1028510-G-A c.246+8C>T splice_region ABR 2 80318 2.4901E-5 40159 0 NA
17-1028513-C-G c.246+5G>C splice_region ABR 1 80348 1.24459E-5 40174 0 NA
17-1028522-G-A p.Pro81Leu missense ABR 1 80392 1.2439E-5 40196 0 NA
17-1028524-A-C p.Ala80Ala synonymous ABR 2 80378 2.48824E-5 40189 0 5.03525E-4
17-1028531-C-G p.Gly78Ala missense ABR 3 80400 3.73134E-5 40200 0 9.50201E-5
17-1028546-G-A p.Pro73Leu missense ABR 2 80432 2.48657E-5 40216 0 2.55216E-4
17-1028553-C-T p.Val71Ile missense ABR 3 80378 3.73236E-5 40189 0 5.03525E-4
17-1028553-C-G p.Val71Leu missense ABR 1 80378 1.24412E-5 40189 0 8.61698E-6
17-1028554-G-A p.Gly70Gly synonymous ABR 5 80378 6.22061E-5 40189 0 1.91522E-4
17-1028558-T-TC p.Asp69fs frameshift ABR 1 80310 1.24517E-5 40155 0 2.1467E-5
17-1028565-C-G p.Gly67Arg missense ABR 2 80342 2.48936E-5 40171 0 5.03525E-4
17-1028565-C-T p.Gly67Arg missense ABR 1 80344 1.24465E-5 40172 0 1.27649E-4
17-1028565-C-A p.Gly67Trp missense ABR 1 80344 1.24465E-5 40172 0 1.59561E-4
17-1028566-G-A p.Gly66Gly synonymous ABR 156 80276 0.0019433 40138 0 0.00503525
17-1028566-G-T p.Gly66Gly synonymous ABR 3 80280 3.73692E-5 40140 0 NA
17-1028567-C-T p.Gly66Asp missense ABR 1 80300 1.24533E-5 40150 0 4.20154E-5
17-1028568-C-A p.Gly66Cys missense ABR 4 80320 4.98008E-5 40160 0 1.67735E-5
17-1028577-G-A p.Arg63Cys missense ABR 3 80410 3.73088E-5 40205 0 1.62201E-5
17-1028580-C-T p.Ala62Thr missense ABR 20 80434 2.48651E-4 40217 0 1.05319E-4
17-1028581-G-A p.Ser61Ser synonymous ABR 8 80448 9.94431E-5 40224 0 3.23999E-5
17-1028581-G-T p.Ser61Arg missense ABR 1 80448 1.24304E-5 40224 0 NA
17-1028587-C-T p.Gln59Gln synonymous ABR 74 80542 9.18775E-4 40271 0 5.97468E-4
17-1028590-C-T p.Pro58Pro synonymous ABR 1 80538 1.24165E-5 40269 0 6.38447E-5
17-1028591-G-A p.Pro58Leu missense ABR 1 80594 1.24079E-5 40297 0 8.27993E-6
17-1028598-T-C p.Met56Val missense ABR 1 80666 1.23968E-5 40333 0 3.19816E-5
17-1028600-G-A p.Thr55Ile missense ABR 2 80666 2.47936E-5 40333 0 NA
17-1028605-C-T p.Ser53Ser synonymous ABR 4 80658 4.95921E-5 40329 0 3.19122E-5
17-1028614-G-A p.Ile50Ile synonymous ABR 5 80784 6.18934E-5 40392 0 2.4795E-5
17-1028616-T-C p.Ile50Val missense ABR 1 80816 1.23738E-5 40408 0 NA
17-1028620-C-A p.Pro48Pro synonymous ABR 11 80822 1.36102E-4 40411 0 4.46713E-4
17-1028620-C-T p.Pro48Pro synonymous ABR 3 80822 3.71186E-5 40411 0 1.65213E-5
17-1028621-G-A p.Pro48Leu missense ABR 1 80838 1.23704E-5 40419 0 2.47795E-5
17-1028622-G-A p.Pro48Ser missense ABR 1 80842 1.23698E-5 40421 0 NA
17-1028622-G-T p.Pro48Thr missense ABR 1 80842 1.23698E-5 40421 0 NA
17-1028642-G-A p.Pro41Leu missense ABR 13 80914 1.60664E-4 40457 0 6.4155E-5
17-1028672-CCGT-C p.Asp30del disruptive_inframe_deletion ABR 2 80920 2.47158E-5 40460 0 NA
17-1028674-G-A c.-49C>T 5_prime_UTR_premature_start_codon_gain ABR 2 80860 2.47341E-5 40430 0 6.38203E-5
17-1028676-C-T p.Asp30Asn missense ABR 634 80800 0.00784653 40400 4 0.00698758
17-1028677-G-A c.-52C>T 5_prime_UTR_premature_start_codon_gain ABR 4 80846 4.94768E-5 40423 0 3.30437E-5
17-1028678-T-C p.Tyr29Cys missense ABR 1 80846 1.23692E-5 40423 0 8.02124E-6
17-1028682-C-T p.Glu28Lys missense ABR 2 80826 2.47445E-5 40413 0 3.19163E-5
17-1028683-G-A c.-58C>T 5_prime_UTR_premature_start_codon_gain ABR 1 80782 1.2379E-5 40391 0 5.03525E-4
17-1028686-C-T p.Thr26Thr synonymous ABR 1 80816 1.23738E-5 40408 0 1.65281E-5
17-1028689-C-T p.Gly25Gly synonymous ABR 1 80748 1.23842E-5 40374 0 NA
17-1028691-C-T p.Gly25Arg missense ABR 1 80794 1.23772E-5 40397 0 8.26747E-6
17-1028692-G-A c.-67C>T 5_prime_UTR_premature_start_codon_gain ABR 2 80784 2.47574E-5 40392 0 4.13414E-5
17-1028702-T-TTGCTGTAGAGGGTGTCGATCCAGGACAGGCGCGGCAGGCCCCGGTGG c.62-1_62insCCACCGGGGCCTGCCGCGCCTGTCCTGGATCGACACCCTCTACAGCA splice_acceptor ABR 2 80674 2.47911E-5 40337 0 NA
17-1028702-T-TTGCTGTAGAGGGTGTCGATCCAGGACAGGCGCGGCAGGCC c.62-1_62insGGCCTGCCGCGCCTGTCCTGGATCGACACCCTCTACAGCA splice_acceptor ABR 1 80674 1.23956E-5 40337 0 NA
17-1028713-G-C c.-88C>G 5_prime_UTR_premature_start_codon_gain ABR 1 80526 1.24183E-5 40263 0 NA
17-1028728-C-T c.-103G>A 5_prime_UTR_premature_start_codon_gain ABR 4 80290 4.98194E-5 40145 0 1.91388E-4
17-1028762-T-C c.-137A>G 5_prime_UTR_premature_start_codon_gain ABR 1 79322 1.26068E-5 39661 0 NA
17-1028766-G-A c.-141C>T 5_prime_UTR_premature_start_codon_gain ABR 4 79040 5.06073E-5 39520 0 6.02887E-5
17-1028778-G-A c.-153C>T 5_prime_UTR_premature_start_codon_gain ABR 4 77948 5.13163E-5 38974 0 1.54979E-4
17-1028781-G-A c.-156C>T 5_prime_UTR_premature_start_codon_gain ABR 2 77546 2.57911E-5 38773 0 3.84638E-5
17-1028784-G-A c.-159C>T 5_prime_UTR_premature_start_codon_gain ABR 4 77116 5.18699E-5 38558 0 3.21027E-5
17-1028791-G-A c.-166C>T 5_prime_UTR_premature_start_codon_gain ABR 5 76432 6.54176E-5 38216 0 5.32793E-5
17-1028806-G-A c.-181C>T 5_prime_UTR_premature_start_codon_gain ABR 14 74942 1.86811E-4 37471 0 2.35104E-4
17-1028820-C-T c.-195G>A 5_prime_UTR_premature_start_codon_gain ABR 2 73186 2.73276E-5 36593 0 6.60308E-5
17-1028830-G-A c.-205C>T 5_prime_UTR_premature_start_codon_gain ABR 10 69964 1.42931E-4 34982 0 2.20434E-4
17-1028834-G-A c.-209C>T 5_prime_UTR_premature_start_codon_gain ABR 19 68434 2.7764E-4 34217 0 7.38315E-4
17-1028845-G-A c.-220C>T 5_prime_UTR_premature_start_codon_gain ABR 16 65064 2.45912E-4 32532 0 0.00146572
17-1028869-G-A c.-244C>T 5_prime_UTR_premature_start_codon_gain ABR 25 57034 4.38335E-4 28517 0 3.20574E-4
17-1028890-G-A c.-265C>T 5_prime_UTR_premature_start_codon_gain ABR 6 51256 1.17059E-4 25628 0 NA
17-1028906-G-A c.-281C>T 5_prime_UTR_premature_start_codon_gain ABR 82 47170 0.00173839 23585 0 6.71742E-4
17-1028922-G-A c.-297C>T 5_prime_UTR_premature_start_codon_gain ABR 8 45098 1.77391E-4 22549 0 NA
17-1028932-G-A c.-307C>T 5_prime_UTR_premature_start_codon_gain ABR 8 43604 1.83469E-4 21802 0 1.91804E-4
17-1028951-G-A c.-326C>T 5_prime_UTR_premature_start_codon_gain ABR 4 40428 9.89413E-5 20214 0 6.38081E-5
17-1057043-GCGGGAGGGCTGGGGGTCCAGGCACACCTGCGGGAGGGCTGGGGGTCCAGGCACACCTA-G n.494+2_494+59delTAGGTGTGCCTGGACCCCCAGCCCTCCCGCAGGTGTGCCTGGACCCCCAGCCCTCCCG splice_donor ABR 3 266 0.0112782 133 1 0.00822765
17-1057072-GCGGGAGGGCTGGGGGTCCAGGCACACCTA-G n.494+2_494+30delTAGGTGTGCCTGGACCCCCAGCCCTCCCG splice_donor ABR 45 1468 0.030654 734 6 0.0642368
17-1057101-A-G n.494+2T>C splice_donor ABR 143 2362 0.0605419 1181 33 0.106403
17-1081208-G-A c.-78+3C>T splice_region ABR 2 34 0.0588235 17 0 0.0707592
17-1082970-G-A p.Leu18Phe missense ABR 1 74248 1.34684E-5 37124 0 NA
17-1082992-C-T p.Pro10Pro synonymous ABR 1 71884 1.39113E-5 35942 0 1.68458E-5
17-1082992-C-A p.Pro10Pro synonymous ABR 1 71884 1.39113E-5 35942 0 1.68458E-5
17-1082993-G-A p.Pro10Leu missense ABR 1 72046 1.388E-5 36023 0 NA
17-1082997-G-A c.-257C>T 5_prime_UTR_premature_start_codon_gain ABR 1 71446 1.39966E-5 35723 0 NA
17-1083001-C-G p.Arg7Arg synonymous ABR 2 70692 2.82917E-5 35346 0 NA
17-1083002-C-T p.Arg7Gln missense ABR 1 70300 1.42248E-5 35150 0 3.46885E-5
17-1083003-G-T p.Arg7Arg synonymous ABR 76 70086 0.00108438 35043 0 0.00206612
17-1083005-T-G p.His6Pro missense ABR 1 69306 1.44288E-5 34653 0 NA
17-1083014-G-C p.Pro3Arg missense ABR 1 67018 1.49214E-5 33509 0 NA
17-1083073-A-C c.-52T>G 5_prime_UTR_premature_start_codon_gain ABR 1 46212 2.16394E-5 23106 0 NA
17-1083115-G-C c.-94C>G 5_prime_UTR_premature_start_codon_gain ABR 2 38816 5.15251E-5 19408 0 NA
17-1090141-A-G c.-125T>C 5_prime_UTR_premature_start_codon_gain ABR 1 2648 3.77644E-4 1324 0 4.14224E-4
17-1090244-G-A c.-228C>T 5_prime_UTR_premature_start_codon_gain ABR 2 2944 6.79348E-4 1472 0 3.18552E-5
17-1090449-G-A c.-433C>T 5_prime_UTR_premature_start_codon_gain ABR 1 2966 3.37154E-4 1483 0 3.50385E-4