Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
6-31654727-T-C c.*262A>G splice_region ABHD16A 1 27348 3.65657E-5 13674 0 3.18715E-5
6-31654732-T-A n.913A>T splice_region ABHD16A 6232 26672 0.233653 13336 71 0.370146
6-31654995-G-A p.His338His synonymous ABHD16A 2 81148 2.46463E-5 40574 0 8.97586E-6
6-31655008-TG-T p.Gln334fs frameshift ABHD16A 1 81144 1.23238E-5 40572 0 NA
6-31655022-T-A p.Pro329Pro synonymous ABHD16A 2 81164 2.46415E-5 40582 0 NA
6-31655028-T-C p.Pro327Pro synonymous ABHD16A 1 81172 1.23195E-5 40586 0 NA
6-31655031-G-A p.Thr326Thr synonymous ABHD16A 1 81172 1.23195E-5 40586 0 NA
6-31655033-T-C p.Thr326Ala missense ABHD16A 2 81162 2.46421E-5 40581 0 1.75331E-5
6-31655043-G-A p.Ala322Ala synonymous ABHD16A 1 81186 1.23174E-5 40593 0 NA
6-31655043-G-T p.Ala322Ala synonymous ABHD16A 1 81186 1.23174E-5 40593 0 NA
6-31655067-C-T p.Arg314Arg synonymous ABHD16A 1 81092 1.23317E-5 40546 0 8.71627E-6
6-31655073-C-T c.937-1G>A splice_acceptor ABHD16A 1 81072 1.23347E-5 40536 0 NA
6-31655164-C-T n.615G>A splice_region ABHD16A 1 81020 1.23426E-5 40510 0 NA
6-31655294-C-T p.Arg306Gln missense ABHD16A 2 81462 2.45513E-5 40731 0 5.26917E-5
6-31655295-G-A p.Arg306Trp missense ABHD16A 1 81458 1.22763E-5 40729 0 6.8816E-5
6-31655297-C-T p.Arg305Gln missense ABHD16A 1 81464 1.22754E-5 40732 0 8.6023E-6
6-31655298-G-A p.Arg305Trp missense ABHD16A 1 81468 1.22748E-5 40734 0 8.6023E-6
6-31655299-T-C p.Gly304Gly synonymous ABHD16A 1 81468 1.22748E-5 40734 0 8.10655E-6
6-31655309-C-T p.Ser301Asn missense ABHD16A 1 81472 1.22742E-5 40736 0 4.0536E-6
6-31655312-A-G p.Met300Thr missense ABHD16A 3 81470 3.68234E-5 40735 0 8.60259E-6
6-31655313-T-C p.Met300Val missense ABHD16A 1 81466 1.22751E-5 40733 0 2.58082E-5
6-31655315-T-C p.Asp299Gly missense ABHD16A 1 81468 1.22748E-5 40734 0 NA
6-31655320-CCCTGCAGAGAGGAGGCGCTCAAAATAGGCCACACATCTGGGTATTCATCCCCTTCCTAGGCCCTTCCCACCCTCTCTCCTGCCCCAGGAGCTCCTTA-C p.Glu298fs frameshift ABHD16A 7 81470 8.59212E-5 40735 0 NA
6-31655354-C-A n.504G>T splice_region ABHD16A 2 81416 2.45652E-5 40708 0 NA
6-31655421-A-G p.Val296Ala missense+splice_region ABHD16A 2 81334 2.459E-5 40667 0 3.20164E-5
6-31655422-C-T p.Val296Met missense ABHD16A 2 81344 2.45869E-5 40672 0 4.05923E-5
6-31655423-G-A p.Ser295Ser synonymous ABHD16A 1 81340 1.22941E-5 40670 0 8.9306E-5
6-31655438-G-A p.Pro290Pro synonymous ABHD16A 7463 81268 0.091832 40634 398 0.126906
6-31655440-G-A p.Pro290Ser missense ABHD16A 1 81350 1.22926E-5 40675 0 6.38366E-5
6-31655441-C-T p.Gly289Gly synonymous ABHD16A 2 81354 2.45839E-5 40677 0 NA
6-31655444-G-A p.His288His synonymous ABHD16A 2 81362 2.45815E-5 40681 0 2.0296E-5
6-31655448-T-C p.Glu287Gly missense ABHD16A 1 81356 1.22917E-5 40678 0 NA
6-31655453-C-G p.Gln285His missense ABHD16A 1 81354 1.2292E-5 40677 0 NA
6-31655454-T-A p.Gln285Leu missense ABHD16A 1 81354 1.2292E-5 40677 0 NA
6-31655474-C-A p.Leu278Leu synonymous ABHD16A 1 81338 1.22944E-5 40669 0 NA
6-31655493-A-G p.Val272Ala missense ABHD16A 1 81342 1.22938E-5 40671 0 NA
6-31655495-C-T p.Glu271Glu synonymous ABHD16A 1 81354 1.2292E-5 40677 0 3.19101E-5
6-31655502-C-T p.Arg269Gln missense ABHD16A 2 81372 2.45785E-5 40686 0 4.46668E-5
6-31655512-T-C p.Ile266Val missense ABHD16A 29 81380 3.56353E-4 40690 0 5.44662E-4
6-31655517-GCTGGTCAGGGAGAGAGATGACAGCCAGTCAGCAACCTGACCTTGCTGGGCCCCCGCCCCAAGCCTCACTGGATCCCTTCTCAC-G c.790+1_791-1delGTGAGAAGGGATCCAGTGAGGCTTGGGGCGGGGGCCCAGCAAGGTCAGGTTGCTGACTGGCTGTCATCTCTCTCCCTGACCAG splice_acceptor ABHD16A 10 81366 1.22901E-4 40683 3 NA
6-31655521-G-C c.791-4C>G splice_region ABHD16A 3 81354 3.68759E-5 40677 0 6.38162E-5
6-31655522-T-G c.791-5A>C splice_region ABHD16A 2 81322 2.45936E-5 40661 0 1.04078E-4
6-31655552-C-A n.866G>T splice_region ABHD16A 1 81332 1.22953E-5 40666 0 4.0588E-6
6-31655601-C-G p.Ala264Pro missense+splice_region ABHD16A 2 81216 2.46257E-5 40608 0 4.05834E-6
6-31655615-G-A p.Ser259Leu missense ABHD16A 1 81204 1.23147E-5 40602 0 NA
6-31655619-A-C p.Ser258Ala missense ABHD16A 1 81188 1.23171E-5 40594 0 NA
6-31655619-A-G p.Ser258Pro missense ABHD16A 1 81188 1.23171E-5 40594 0 NA
6-31655626-C-G p.Leu255Phe missense ABHD16A 1 81194 1.23162E-5 40597 0 NA
6-31655645-C-T p.Arg249Gln missense ABHD16A 2 81284 2.46051E-5 40642 0 4.05755E-6
6-31655653-C-T p.Glu246Glu synonymous ABHD16A 1 81334 1.2295E-5 40667 0 NA
6-31655657-T-G p.Glu245Ala missense ABHD16A 1 81332 1.22953E-5 40666 0 NA
6-31655662-C-T p.Met243Ile missense ABHD16A 1 81354 1.2292E-5 40677 0 NA
6-31655663-A-G p.Met243Thr missense ABHD16A 1 81356 1.22917E-5 40678 0 NA
6-31655667-C-G p.Val242Leu missense ABHD16A 53 81370 6.51346E-4 40685 0 4.62629E-4
6-31655669-C-T p.Arg241Gln missense ABHD16A 2 81378 2.45767E-5 40689 0 7.74927E-5
6-31655681-C-T c.714-4G>A splice_region ABHD16A 110 81390 0.00135152 40695 2 0.00494017
6-31655682-G-A c.714-5C>T splice_region ABHD16A 1 81388 1.22868E-5 40694 0 1.46383E-4
6-31655684-A-G c.714-7T>C splice_region ABHD16A 1 81394 1.22859E-5 40697 0 8.11965E-6
6-31655811-C-T c.713+7G>A splice_region ABHD16A 1 81278 1.23035E-5 40639 0 1.72756E-5
6-31655848-T-C p.Asn228Ser missense ABHD16A 1 81378 1.22883E-5 40689 0 4.03473E-6
6-31655854-C-T p.Arg226Gln missense ABHD16A 14 81414 1.71961E-4 40707 0 6.37064E-5
6-31655855-G-A p.Arg226* stop_gained ABHD16A 4 81448 4.91111E-5 40724 0 4.03278E-6
6-31655859-G-A p.Ser224Ser synonymous ABHD16A 1 81514 1.22678E-5 40757 0 4.03011E-6
6-31655863-A-T p.Met223Lys missense ABHD16A 1 81562 1.22606E-5 40781 0 NA
6-31655873-C-T p.Glu220Lys missense ABHD16A 2 81768 2.44594E-5 40884 0 NA
6-31655881-C-G c.651-1G>C splice_acceptor ABHD16A 1 81958 1.22014E-5 40979 0 NA
6-31655887-G-A c.651-7C>T splice_region ABHD16A 17 82144 2.06954E-4 41072 0 1.21016E-4
6-31655888-T-C c.651-8A>G splice_region ABHD16A 1 82130 1.21758E-5 41065 0 8.58354E-6
6-31656018-G-A c.650+8C>T splice_region ABHD16A 2 83308 2.40073E-5 41654 0 3.1904E-5
6-31656026-G-A p.Thr217Met missense+splice_region ABHD16A 1 83310 1.20034E-5 41655 0 8.24484E-6
6-31656028-G-A p.Thr216Thr splice_region+synonymous ABHD16A 1 83298 1.20051E-5 41649 0 3.19E-5
6-31656034-G-A p.Ile214Ile synonymous ABHD16A 2 83292 2.40119E-5 41646 0 3.97722E-6
6-31656040-C-T p.Glu212Glu synonymous ABHD16A 2 83276 2.40165E-5 41638 0 NA
6-31656049-G-C p.Thr209Thr synonymous ABHD16A 1 83248 1.20123E-5 41624 0 3.18878E-5
6-31656053-C-A p.Arg208Ile missense ABHD16A 1 83228 1.20152E-5 41614 0 NA
6-31656056-C-T p.Arg207Gln missense ABHD16A 1 83216 1.20169E-5 41608 0 3.18979E-5
6-31656068-A-C p.Val203Gly missense ABHD16A 1 83136 1.20285E-5 41568 0 NA
6-31656076-C-G p.Gln200His missense ABHD16A 1 83066 1.20386E-5 41533 0 NA
6-31656078-G-T p.Gln200Lys missense ABHD16A 1 83072 1.20378E-5 41536 0 NA
6-31656085-T-G c.594-3A>C splice_region ABHD16A 1 83010 1.20467E-5 41505 0 NA
6-31656088-G-A c.594-6C>T splice_region ABHD16A 2 82988 2.40999E-5 41494 0 3.97931E-6
6-31656090-G-A c.594-8C>T splice_region ABHD16A 1 82962 1.20537E-5 41481 0 3.97969E-6
6-31656492-G-T c.593+8C>A splice_region ABHD16A 1 80310 1.24517E-5 40155 0 NA
6-31656500-C-T p.Arg198Lys missense+splice_region ABHD16A 2 80414 2.48713E-5 40207 0 8.68946E-6
6-31656513-C-T p.Glu194Lys missense ABHD16A 2 80554 2.48281E-5 40277 0 4.06012E-6
6-31656514-C-T p.Ala193Ala synonymous ABHD16A 563 80518 0.00699223 40259 7 0.00821396
6-31656515-G-A p.Ala193Val missense ABHD16A 6 80532 7.45045E-5 40266 0 0.00217865
6-31656516-C-T p.Ala193Thr missense ABHD16A 1 80546 1.24153E-5 40273 0 3.24812E-5
6-31656517-G-A p.Asn192Asn synonymous ABHD16A 9 80564 1.11712E-4 40282 0 0.00163399
6-31656543-C-A p.Val184Leu missense ABHD16A 2 80574 2.48219E-5 40287 0 NA
6-31656544-G-C p.Thr183Thr synonymous ABHD16A 11 80536 1.36585E-4 40268 0 4.87377E-5
6-31656544-G-A p.Thr183Thr synonymous ABHD16A 1 80538 1.24165E-5 40269 0 3.18776E-5
6-31656559-G-A p.Gly178Gly synonymous ABHD16A 35 80500 4.34783E-4 40250 0 3.95947E-4
6-31656565-TA-T c.530-3delT splice_region ABHD16A 882 80426 0.0109666 40213 11 0.0127265
6-31656567-G-C c.530-4C>G splice_region ABHD16A 1 80436 1.24322E-5 40218 0 NA
6-31656784-G-A c.529+8C>T splice_region ABHD16A 2 82864 2.41359E-5 41432 0 2.41526E-5
6-31656826-C-T p.Val165Val synonymous ABHD16A 1 83114 1.20317E-5 41557 0 7.96343E-6
6-31656880-C-T p.Met147Ile missense ABHD16A 2 83112 2.40639E-5 41556 0 NA
6-31656882-T-C p.Met147Val missense ABHD16A 1 83094 1.20346E-5 41547 0 NA
6-31656892-C-T p.Thr143Thr synonymous ABHD16A 4 82988 4.81997E-5 41494 0 5.44662E-4
6-31656895-G-C p.Ala142Ala splice_region+synonymous ABHD16A 1 82974 1.2052E-5 41487 0 3.18979E-5
6-31657355-T-C c.424+3A>G splice_region ABHD16A 4 80172 4.98927E-5 40086 0 NA
6-31657368-G-A p.Gly138Gly synonymous ABHD16A 7 80522 8.69328E-5 40261 0 2.02347E-4
6-31657382-C-A p.Ala134Ser missense ABHD16A 1 80726 1.23876E-5 40363 0 1.08598E-4
6-31657391-T-C p.Ile131Val missense ABHD16A 2 80858 2.47347E-5 40429 0 NA
6-31657398-C-T p.Gln128Gln synonymous ABHD16A 1 80896 1.23616E-5 40448 0 NA
6-31657399-T-C p.Gln128Arg missense ABHD16A 4 80896 4.94462E-5 40448 0 4.11631E-5
6-31657413-T-C p.Leu123Leu synonymous ABHD16A 61698 80034 0.770897 40017 24006 0.809368
6-31657415-G-A p.Leu123Leu synonymous ABHD16A 1 81006 1.23448E-5 40503 0 3.18776E-5
6-31657423-A-G p.Ile120Thr missense ABHD16A 1 81032 1.23408E-5 40516 0 NA
6-31657432-T-C p.Gln117Arg missense ABHD16A 1 81106 1.23295E-5 40553 0 NA
6-31657448-T-C p.Met112Val missense ABHD16A 4 81202 4.92599E-5 40601 0 2.63394E-5
6-31657467-C-T p.Pro105Pro synonymous ABHD16A 29 81204 3.57125E-4 40602 0 6.37146E-4
6-31657475-G-A p.Pro103Ser missense ABHD16A 2 81160 2.46427E-5 40580 0 8.24769E-6
6-31657476-C-G p.Val102Val synonymous ABHD16A 1 81150 1.23229E-5 40575 0 NA
6-31657478-C-A p.Val102Leu missense ABHD16A 1 81176 1.23189E-5 40588 0 8.94278E-6
6-31657479-C-T p.Gly101Gly splice_region+synonymous ABHD16A 2 81180 2.46366E-5 40590 0 NA
6-31657853-A-C c.300+2T>G splice_donor ABHD16A 1 81332 1.22953E-5 40666 0 NA
6-31657856-G-C p.Thr100Arg missense+splice_region ABHD16A 1 81322 1.22968E-5 40661 0 NA
6-31657856-G-A p.Thr100Met missense+splice_region ABHD16A 1 81322 1.22968E-5 40661 0 1.28781E-5
6-31657907-G-A c.251-3C>T splice_region ABHD16A 1 81250 1.23077E-5 40625 0 NA
6-31658309-G-A c.250+7C>T splice_region ABHD16A 4 81230 4.92429E-5 40615 0 5.16316E-5
6-31658323-G-A p.Pro81Pro synonymous ABHD16A 18 81242 2.2156E-4 40621 0 9.294E-4
6-31658327-G-A p.Thr80Met missense ABHD16A 2 81244 2.46172E-5 40622 0 5.16378E-5
6-31658329-G-A p.Ser79Ser synonymous ABHD16A 3 81232 3.69313E-5 40616 0 NA
6-31658334-C-T p.Val78Ile missense ABHD16A 1 81218 1.23125E-5 40609 0 3.18695E-5
6-31658335-G-A p.Cys77Cys synonymous ABHD16A 3 81206 3.69431E-5 40603 0 1.62219E-5
6-31658341-C-T p.Val75Val synonymous ABHD16A 1 81194 1.23162E-5 40597 0 NA
6-31658363-C-T p.Gly68Glu missense ABHD16A 2 81108 2.46585E-5 40554 0 NA
6-31658366-T-A p.Glu67Val missense ABHD16A 2 81076 2.46682E-5 40538 0 NA
6-31658383-G-A c.187-4C>T splice_region ABHD16A 142 80830 0.00175677 40415 2 0.00267584
6-31659225-A-G n.378T>C splice_region ABHD16A 1 74910 1.33494E-5 37455 0 NA
6-31659352-T-C c.186+4A>G splice_region ABHD16A 2 80116 2.49638E-5 40058 0 NA
6-31659371-G-A p.Pro57Pro synonymous ABHD16A 1 80642 1.24005E-5 40321 0 4.0626E-6
6-31659393-T-A p.Asp50Val missense ABHD16A 1 81084 1.23329E-5 40542 0 NA
6-31659401-C-T p.Met47Ile missense ABHD16A 1 81128 1.23262E-5 40564 0 3.18674E-5
6-31659454-T-C p.Asn30Asp missense ABHD16A 187 80588 0.00232044 40294 2 0.00361716
6-31659457-A-T p.Cys29Ser missense+splice_region ABHD16A 12 80486 1.49094E-4 40243 0 1.28271E-4
6-31659457-ACTGAGTACGGAAGACGCAATGGCCAAGATGCAAGGGTCAGGAGGCCACATCACAGGGGTGGGGCGGGGTGGGTGGGGGTGAGAGGGGAGGGCTTTAGGGGATGTGCGGGCAGGGAAGCCTCAC-A c.84+1_85-1del splice_acceptor ABHD16A 5 80484 6.21241E-5 40242 2 NA
6-31659465-C-T c.85-8G>A splice_region ABHD16A 683 80106 0.0085262 40053 19 0.0163682
6-31659578-C-G c.84+3G>C splice_region ABHD16A 1 79262 1.26164E-5 39631 0 NA
6-31659581-C-T p.Glu28Glu splice_region+synonymous ABHD16A 1 79420 1.25913E-5 39710 0 NA
6-31659595-G-A p.Arg24* stop_gained ABHD16A 2 79872 2.50401E-5 39936 0 NA
6-31659621-A-G p.Met15Thr missense ABHD16A 1 80410 1.24363E-5 40205 0 NA
6-31659648-G-T p.Ser6Tyr missense ABHD16A 1 80340 1.24471E-5 40170 0 NA
6-31659670-G-A p.Arg218Cys missense ABHD16A 4 79854 5.00914E-5 39927 0 9.98801E-6
6-31659675-A-C p.Leu216Arg missense ABHD16A 1 79742 1.25404E-5 39871 0 NA
6-31659679-T-C p.Thr215Ala missense ABHD16A 4 79542 5.02879E-5 39771 0 6.25E-4
6-31659683-C-T p.Ala213Ala synonymous ABHD16A 109 79516 0.00137079 39758 0 0.00494506
6-31659684-G-A p.Ala213Val missense ABHD16A 5 79524 6.28741E-5 39762 0 4.36224E-5
6-31659695-G-A p.Ser209Ser splice_region+synonymous ABHD16A 1 79238 1.26202E-5 39619 0 NA
6-31659703-G-A c.-31-8C>T splice_region ABHD16A 1 79032 1.26531E-5 39516 0 NA
6-31660706-A-G p.His143His synonymous ABHD16A 2 80610 2.48108E-5 40305 0 8.16127E-6
6-31660714-C-T p.Val141Ile missense ABHD16A 12 80950 1.4824E-4 40475 0 1.01492E-4
6-31660719-A-G p.Ile139Thr missense ABHD16A 4 81222 4.92477E-5 40611 0 1.27421E-4
6-31660733-C-T p.Ala134Ala synonymous ABHD16A 16 81582 1.96122E-4 40791 0 7.32624E-4
6-31660759-T-C p.Ile126Val missense ABHD16A 2 82316 2.42966E-5 41158 0 NA
6-31660774-A-T p.Trp121Arg missense ABHD16A 8 82560 9.68992E-5 41280 0 4.38614E-5
6-31660776-T-C p.His120Arg missense ABHD16A 1 82596 1.21071E-5 41298 0 NA
6-31660776-T-G p.His120Pro missense ABHD16A 2 82596 2.42142E-5 41298 0 8.29476E-6
6-31660789-G-A p.Arg116* stop_gained ABHD16A 3 82734 3.62608E-5 41367 0 1.59307E-4
6-31660793-C-A p.Gln114His missense ABHD16A 1 82826 1.20735E-5 41413 0 3.98314E-6
6-31660795-G-A p.Gln114* stop_gained ABHD16A 11 82870 1.32738E-4 41435 1 2.54842E-4
6-31660796-T-C c.-32+8A>G splice_region ABHD16A 1 82870 1.20671E-5 41435 0 NA
6-31660806-G-A p.Pro110Leu missense ABHD16A 1 83010 1.20467E-5 41505 0 8.25764E-6
6-31660814-G-A p.Gln206* stop_gained ABHD16A 1 83062 1.20392E-5 41531 0 3.18573E-5
6-31660820-G-C p.Pro204Ala missense ABHD16A 2 83090 2.40703E-5 41545 0 3.97918E-6
6-31660832-C-G p.Val200Leu missense ABHD16A 2 83120 2.40616E-5 41560 0 8.25055E-6
6-31660843-A-G p.Leu196Pro missense ABHD16A 1 83118 1.20311E-5 41559 0 NA
6-31660848-G-A p.Thr96Ile missense ABHD16A 1899 83060 0.022863 41530 48 0.0299564
6-31660861-C-T p.Arg190Gln missense ABHD16A 2 83084 2.4072E-5 41542 0 4.37888E-5
6-31660861-C-G p.Arg190Pro missense ABHD16A 1 83084 1.2036E-5 41542 0 NA
6-31660862-G-A p.Arg190Trp missense ABHD16A 23 83072 2.76868E-4 41536 0 3.82458E-4
6-31660868-G-T p.Leu188Met missense ABHD16A 1 83100 1.20337E-5 41550 0 3.98143E-6
6-31660869-G-A p.Pro89Leu missense ABHD16A 7 83056 8.42805E-5 41528 0 3.18654E-5
6-31660879-C-T p.Arg184His missense ABHD16A 152 83046 0.00183031 41523 0 0.0011276
6-31660879-C-A p.Arg184Leu missense ABHD16A 248 83040 0.00298651 41520 1 0.00544662
6-31660883-G-C p.Leu183Val missense ABHD16A 2 83058 2.40796E-5 41529 0 3.9847E-6
6-31660894-C-T p.Gly179Asp missense ABHD16A 1 82972 1.20523E-5 41486 0 NA
6-31660896-C-T p.Gly80Glu missense ABHD16A 1 82946 1.2056E-5 41473 0 3.99348E-6
6-31660897-C-T p.Arg178Gln missense ABHD16A 3 82934 3.61733E-5 41467 0 1.19857E-5
6-31660898-G-T p.Arg178Arg synonymous ABHD16A 3 82934 3.61733E-5 41467 0 9.18427E-5
6-31660898-G-A p.Arg178Trp missense ABHD16A 3 82936 3.61725E-5 41468 0 9.5584E-5
6-31660899-G-T p.Ala79Asp missense ABHD16A 1 82896 1.20633E-5 41448 0 3.99674E-6
6-31660900-C-T p.Arg177His missense ABHD16A 3 82882 3.6196E-5 41441 0 2.50656E-5
6-31660901-G-A p.Arg177Cys missense ABHD16A 1 82894 1.20636E-5 41447 0 1.6711E-5
6-31660907-G-A p.Pro175Ser missense ABHD16A 1 82864 1.2068E-5 41432 0 4.00378E-6
6-31660909-C-T p.Gly174Asp missense ABHD16A 2 82774 2.41622E-5 41387 0 4.00953E-6
6-31661137-G-A p.Arg168Trp missense+splice_region ABHD16A 8 81216 9.85028E-5 40608 0 1.98838E-4
6-31661138-G-A p.Ala69Val missense+splice_region ABHD16A 2 81214 2.46263E-5 40607 0 1.73172E-5
6-31661164-C-T p.Asp159Asn missense ABHD16A 30 81270 3.6914E-4 40635 0 0.0016098
6-31661165-G-A p.Ser60Leu missense ABHD16A 1 81278 1.23035E-5 40639 0 5.44662E-4
6-31661178-C-T p.Arg154Gln missense ABHD16A 2 81316 2.45954E-5 40658 0 5.68103E-5
6-31661192-G-A p.Thr51Ile missense ABHD16A 9 81350 1.10633E-4 40675 0 2.23015E-4
6-31661204-C-T p.Ser47Asn missense ABHD16A 1 81358 1.22914E-5 40679 0 3.18613E-5
6-31661212-G-C c.-228-3C>G splice_region ABHD16A 1 81350 1.22926E-5 40675 0 NA
6-31664724-C-T c.-229+1G>A splice_donor ABHD16A 1 81440 1.2279E-5 40720 0 8.60511E-6
6-31664742-G-A p.Gln138* stop_gained ABHD16A 1 81480 1.2273E-5 40740 0 NA
6-31664748-G-A p.Arg136Trp missense ABHD16A 15 81482 1.8409E-4 40741 0 0.0010917
6-31664750-T-C p.His135Arg missense ABHD16A 1 81480 1.2273E-5 40740 0 8.10892E-6
6-31664780-C-T p.Arg125Gln missense ABHD16A 13 81480 1.59548E-4 40740 0 1.27421E-4
6-31664781-G-A p.Arg125Trp missense ABHD16A 2 81488 2.45435E-5 40744 0 1.21639E-5
6-31664801-C-T p.Arg118His missense ABHD16A 4 81464 4.91014E-5 40732 0 8.60496E-6
6-31664801-C-A p.Arg118Leu missense ABHD16A 2 81464 2.45507E-5 40732 0 NA
6-31664804-C-A p.Gly117Val missense ABHD16A 1 81466 1.22751E-5 40733 0 NA
6-31664814-G-A c.-314-4C>T splice_region ABHD16A 7 81438 8.5955E-5 40719 0 3.18939E-5
6-31664818-A-G c.-314-8T>C splice_region ABHD16A 3 81434 3.68397E-5 40717 0 8.60556E-6
6-31668721-C-T p.Arg114Gln missense+splice_region ABHD16A 1 83348 1.19979E-5 41674 0 8.34864E-6
6-31668729-G-C p.Pro13Arg missense ABHD16A 2 83368 2.399E-5 41684 0 NA
6-31668747-T-C p.Tyr7Cys missense ABHD16A 3 83406 3.59686E-5 41703 0 3.97763E-5
6-31668755-A-G c.-351T>C 5_prime_UTR_premature_start_codon_gain ABHD16A 1 83400 1.19904E-5 41700 0 3.31961E-5
6-31668766-T-C p.Met1? start_lost ABHD16A 3 83402 3.59704E-5 41701 0 7.95482E-6
6-31668787-T-C p.Lys92Arg missense ABHD16A 1 83394 1.19913E-5 41697 0 NA
6-31668796-C-T p.Ser89Asn missense ABHD16A 1 83386 1.19924E-5 41693 0 8.39814E-6
6-31668800-A-G c.-396T>C 5_prime_UTR_premature_start_codon_gain ABHD16A 2 83380 2.39866E-5 41690 0 1.5926E-5
6-31668802-T-C p.Tyr87Cys missense ABHD16A 10 83376 1.19939E-4 41688 0 3.36927E-5
6-31668807-T-TTTCCTGTACAAGTAGAAGAA c.-401-3_-401-2insTTCTTCTACTTGTACAGGAA splice_region ABHD16A 2 83358 2.39929E-5 41679 0 NA
6-31669054-TC-T p.Gly86fs frameshift ABHD16A 1 83338 1.19993E-5 41669 0 3.1955E-5
6-31669056-C-A p.Arg84Met missense ABHD16A 1 83342 1.19988E-5 41671 0 3.18959E-5
6-31669065-T-C p.Tyr81Cys missense ABHD16A 1 83354 1.1997E-5 41677 0 NA
6-31669065-TAGA-T p.Phe80del disruptive_inframe_deletion ABHD16A 1 83354 1.1997E-5 41677 0 3.19061E-5
6-31669068-A-C p.Phe80Cys missense ABHD16A 3 83358 3.59893E-5 41679 0 1.19314E-5
6-31669076-G-A c.-427C>T 5_prime_UTR_premature_start_codon_gain ABHD16A 1 83354 1.1997E-5 41677 0 5.44662E-4
6-31669087-A-C p.Ser74Ala missense ABHD16A 1 83338 1.19993E-5 41669 0 NA
6-31669121-C-T c.-468-4G>A splice_region ABHD16A 1 83174 1.2023E-5 41587 0 NA
6-31669860-G-A p.Ile60Ile synonymous ABHD16A 1 81360 1.22911E-5 40680 0 NA
6-31669866-G-C p.Asp58Glu missense ABHD16A 1 81348 1.22929E-5 40674 0 4.04616E-6
6-31669875-T-C p.Thr64Ala missense ABHD16A 2 81360 2.45821E-5 40680 0 NA
6-31669888-C-T p.Arg51His missense ABHD16A 1 81340 1.22941E-5 40670 0 NA
6-31669901-A-T p.Tyr47Asn missense ABHD16A 1 81296 1.23007E-5 40648 0 NA
6-31669903-G-A p.Thr46Met missense ABHD16A 2 81276 2.46075E-5 40638 0 8.50685E-5
6-31669912-C-T c.-525-5G>A splice_region ABHD16A 1 81220 1.23122E-5 40610 0 NA
6-31670388-C-T c.-526+1G>A splice_donor ABHD16A 2 77238 2.5894E-5 38619 0 NA
6-31670389-C-G p.Gly53Arg missense+splice_region ABHD16A 2 77244 2.5892E-5 38622 0 1.64636E-4
6-31670396-C-T p.Ala50Ala synonymous ABHD16A 4 77206 5.18094E-5 38603 0 1.39315E-4
6-31670397-G-A p.Ala50Val missense ABHD16A 1 77192 1.29547E-5 38596 0 NA
6-31670397-G-T p.Ala50Glu missense ABHD16A 1 77192 1.29547E-5 38596 0 1.00539E-5
6-31670404-C-G p.Glu48Gln missense ABHD16A 1 77376 1.29239E-5 38688 0 NA
6-31670413-A-G p.Tyr45His missense ABHD16A 1 77450 1.29116E-5 38725 0 NA
6-31670417-T-C p.Ser43Ser synonymous ABHD16A 1 77464 1.29092E-5 38732 0 8.21409E-6
6-31670427-C-G p.Arg40Thr missense ABHD16A 1 77516 1.29006E-5 38758 0 NA
6-31670433-G-C p.Ala38Gly missense ABHD16A 3 77526 3.86967E-5 38763 0 6.36983E-5
6-31670443-G-C p.Pro35Ala missense ABHD16A 2 77552 2.57891E-5 38776 0 NA
6-31670444-C-A p.Pro34Pro synonymous ABHD16A 2 77528 2.57971E-5 38764 0 1.41064E-5
6-31670444-C-T p.Pro34Pro synonymous ABHD16A 1 77528 1.28986E-5 38764 0 NA
6-31670445-G-C p.Pro34Arg missense ABHD16A 5 77556 6.44695E-5 38778 0 3.18573E-5
6-31670452-G-A p.Gln32* stop_gained ABHD16A 1 77566 1.28922E-5 38783 0 3.18593E-5
6-31670460-G-C p.Ser29Cys missense ABHD16A 2 77576 2.57812E-5 38788 0 NA
6-31670463-C-T p.Arg28Gln missense ABHD16A 1 77574 1.28909E-5 38787 0 NA
6-31670475-G-A p.Ser24Phe missense ABHD16A 1 77614 1.28843E-5 38807 0 6.87994E-6
6-31670481-TA-T p.Tyr22fs frameshift ABHD16A 1 77616 1.28839E-5 38808 0 NA
6-31670492-C-G p.Gln18His missense ABHD16A 2 77608 2.57705E-5 38804 0 6.94435E-6
6-31670497-AT-A p.Glu16fs frameshift ABHD16A 1 77602 1.28863E-5 38801 0 NA
6-31670511-T-C p.Tyr12Cys missense ABHD16A 3 77588 3.86658E-5 38794 0 3.20349E-5
6-31670515-G-A p.Leu11Phe missense ABHD16A 18 77596 2.31971E-4 38798 0 7.51315E-4
6-31670517-G-C p.Ser10Cys missense ABHD16A 1 77582 1.28896E-5 38791 0 7.31529E-6
6-31670528-C-CA p.Phe7fs frameshift ABHD16A 3 77508 3.87057E-5 38754 0 9.56511E-5
6-31670530-G-A c.-667C>T 5_prime_UTR_premature_start_codon_gain ABHD16A 2 77460 2.58198E-5 38730 0 8.41708E-6
6-31670534-CG-C p.Pro4fs frameshift ABHD16A 3 77322 3.87988E-5 38661 0 3.45656E-5
6-31670535-G-A p.Pro4Leu missense ABHD16A 2 77332 2.58625E-5 38666 0 NA
6-31670536-G-A p.Pro4Ser missense ABHD16A 2 77330 2.58632E-5 38665 0 8.68991E-6
6-31670594-A-G c.-731T>C 5_prime_UTR_premature_start_codon_gain ABHD16A 1 75244 1.32901E-5 37622 0 6.37755E-5
6-31670596-G-A c.-733C>T 5_prime_UTR_premature_start_codon_gain ABHD16A 2 75140 2.6617E-5 37570 0 3.18918E-5
6-31670641-A-G c.-778T>C 5_prime_UTR_premature_start_codon_gain ABHD16A 81 71662 0.00113031 35831 0 0.00203887
6-31670675-G-A c.-812C>T 5_prime_UTR_premature_start_codon_gain ABHD16A 6 66038 9.08568E-5 33019 0 3.18979E-5
6-31670732-G-C c.-869C>G 5_prime_UTR_premature_start_codon_gain ABHD16A 5 57578 8.68387E-5 28789 0 3.18878E-5
6-31670807-G-A c.-944C>T 5_prime_UTR_premature_start_codon_gain ABHD16A 1 65890 1.51768E-5 32945 0 NA
6-31670935-T-C p.Ser42Gly missense ABHD16A 1 77228 1.29487E-5 38614 0 NA
6-31670940-T-TG p.His40fs frameshift ABHD16A 1 77434 1.29142E-5 38717 0 NA
6-31670944-G-T p.Pro39Thr missense ABHD16A 1 77676 1.2874E-5 38838 0 NA
6-31670949-G-A p.Thr37Ile missense ABHD16A 2 77798 2.57076E-5 38899 0 NA
6-31670957-C-T p.Thr34Thr synonymous ABHD16A 1 77852 1.28449E-5 38926 0 9.5584E-5
6-31670959-T-C p.Thr34Ala missense ABHD16A 1 78040 1.28139E-5 39020 0 2.80191E-5
6-31670974-C-G p.Val29Leu missense ABHD16A 4 77924 5.13321E-5 38962 0 5.5774E-4
6-31670980-CCGGGGCCCTTTCA-C p.Glu23fs frameshift ABHD16A 1 78238 1.27815E-5 39119 0 3.18674E-5
6-31670982-G-A p.Pro26Leu missense ABHD16A 40 78220 5.11378E-4 39110 0 4.40327E-4
6-31670988-C-G p.Arg24Thr missense ABHD16A 2 78182 2.55813E-5 39091 0 6.37471E-5
6-31671011-G-A p.Ile16Ile synonymous ABHD16A 1 78110 1.28025E-5 39055 0 NA
6-31671023-C-T p.Arg12Arg synonymous ABHD16A 1 77498 1.29036E-5 38749 0 NA
6-31671044-C-T p.Leu5Leu synonymous ABHD16A 1 74448 1.34322E-5 37224 0 NA
6-31671054-G-A p.Ala2Val missense ABHD16A 1 73142 1.3672E-5 36571 0 NA
6-31671057-A-G p.Met1? start_lost ABHD16A 3 73270 4.09445E-5 36635 0 NA
6-31671058-T-C p.Met1? start_lost ABHD16A 1 73186 1.36638E-5 36593 0 1.08956E-5
6-31671065-G-A c.-7C>T 5_prime_UTR_premature_start_codon_gain ABHD16A 1 72504 1.37923E-5 36252 0 3.18898E-5
6-31671105-G-A c.-47C>T 5_prime_UTR_premature_start_codon_gain ABHD16A 71 71176 9.97527E-4 35588 0 0.005
6-31671176-G-C c.-118C>G 5_prime_UTR_premature_start_codon_gain ABHD16A 30 62498 4.80015E-4 31249 0 1.91119E-4