Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
7-73150866-G-A c.*298C>T splice_region ABHD11 4 80224 4.98604E-5 40112 0 1.12939E-4
7-73150888-CTT-C p.Ter316fs frameshift ABHD11 4 80344 4.97859E-5 40172 0 8.04156E-6
7-73150895-C-T c.*389G>A splice_region ABHD11 4 80332 4.97934E-5 40166 0 9.55718E-5
7-73150905-C-T p.Arg311Gln missense ABHD11 1 80350 1.24456E-5 40175 0 3.18634E-5
7-73150906-G-A p.Arg311* stop_gained ABHD11 1 80348 1.24459E-5 40174 0 0.00103199
7-73150908-A-G p.Ile310Thr missense ABHD11 6 80350 7.46733E-5 40175 0 3.18634E-5
7-73150914-G-T p.Ala308Asp missense ABHD11 1 80358 1.24443E-5 40179 0 NA
7-73150917-A-T p.Ile307Lys missense ABHD11 2 80352 2.48905E-5 40176 0 NA
7-73150928-T-C p.Pro303Pro synonymous ABHD11 1 80346 1.24462E-5 40173 0 4.0169E-6
7-73150932-C-T p.Arg302His missense ABHD11 1 80332 1.24483E-5 40166 0 6.3743E-5
7-73150932-C-G p.Arg302Pro missense ABHD11 1 80332 1.24483E-5 40166 0 8.23737E-6
7-73150933-G-A p.Arg302Cys missense ABHD11 2 80332 2.48967E-5 40166 0 3.18471E-5
7-73150934-G-A p.Asp301Asp synonymous ABHD11 167 80336 0.00207877 40168 0 0.00165574
7-73150958-G-A p.Asn293Asn synonymous ABHD11 1 80310 1.24517E-5 40155 0 4.01613E-6
7-73150962-G-A p.Pro292Leu missense ABHD11 2 80296 2.49078E-5 40148 0 3.61466E-5
7-73150963-G-A p.Pro292Ser missense ABHD11 1 80290 1.24549E-5 40145 0 1.64775E-5
7-73150981-C-A p.Ala286Ser missense ABHD11 1 80296 1.24539E-5 40148 0 8.03477E-6
7-73150983-C-G p.Arg285Pro missense ABHD11 2 80268 2.49165E-5 40134 0 3.18654E-5
7-73150984-G-A p.Arg285Trp missense ABHD11 6 80298 7.47217E-5 40149 0 4.12126E-5
7-73150988-G-A p.Phe283Phe synonymous ABHD11 1 80298 1.24536E-5 40149 0 4.01723E-6
7-73150991-GA-TT p.Leu282Gln missense ABHD11 1 80302 1.2453E-5 40151 0 NA
7-73150995-C-T p.Arg281Gln missense ABHD11 2 80268 2.49165E-5 40134 0 2.41101E-5
7-73150996-G-A p.Arg281Trp missense ABHD11 4 80266 4.98343E-5 40133 0 3.18492E-5
7-73150999-T-G p.Met280Leu missense ABHD11 1 80286 1.24555E-5 40143 0 NA
7-73150999-T-A p.Met280Leu missense ABHD11 1 80286 1.24555E-5 40143 0 NA
7-73151012-G-A p.Pro158Ser missense ABHD11 1 80260 1.24595E-5 40130 0 NA
7-73151263-C-T p.Val271Met missense ABHD11 1 82976 1.20517E-5 41488 0 8.30965E-6
7-73151264-G-A p.Phe270Phe synonymous ABHD11 5 83006 6.02366E-5 41503 0 6.64E-5
7-73151276-TCCA-T p.Gly266del disruptive_inframe_deletion ABHD11 2 83188 2.40419E-5 41594 0 9.56511E-5
7-73151285-G-A p.Leu263Leu synonymous ABHD11 6 83264 7.206E-5 41632 0 2.47836E-5
7-73151289-AAG-A p.Phe262fs frameshift ABHD11 2 83294 2.40113E-5 41647 0 8.2575E-6
7-73151300-C-A p.Gly258Gly synonymous ABHD11 206 83296 0.00247311 41648 0 0.00273891
7-73151303-G-A p.Leu257Leu synonymous ABHD11 1 83308 1.20036E-5 41654 0 1.99073E-5
7-73151322-T-C p.Gln251Arg missense ABHD11 6 83332 7.20012E-5 41666 0 6.37836E-5
7-73151335-A-T p.Leu247Met missense ABHD11 1 83342 1.19988E-5 41671 0 NA
7-73151370-T-C p.Asn235Ser missense ABHD11 1 83302 1.20045E-5 41651 0 3.18878E-5
7-73151383-C-T p.Val231Met missense ABHD11 3 83292 3.60179E-5 41646 0 3.18593E-5
7-73151384-G-A p.Phe230Phe synonymous ABHD11 6 83292 7.20357E-5 41646 0 5.03525E-4
7-73151385-A-G p.Phe230Ser missense ABHD11 8 83294 9.60453E-5 41647 1 6.36522E-5
7-73151388-C-T p.Arg229His missense ABHD11 1 83280 1.20077E-5 41640 0 2.4728E-5
7-73151392-C-T p.Gly228Arg missense ABHD11 4 83280 4.80307E-5 41640 0 7.5605E-5
7-73151399-C-G p.Glu225Asp missense ABHD11 1 83278 1.2008E-5 41639 0 8.24321E-6
7-73151400-T-C p.Glu225Gly missense ABHD11 11 83278 1.32088E-4 41639 0 0.00125
7-73151404-C-T p.Trp183* stop_gained ABHD11 1 83262 1.20103E-5 41631 0 8.24362E-6
7-73151408-G-A p.Thr182Ile missense ABHD11 1 83264 1.201E-5 41632 0 3.18471E-5
7-73151414-G-A p.Ser180Leu missense ABHD11 1 83230 1.20149E-5 41615 0 NA
7-73151420-G-A p.Thr178Ile missense ABHD11 39 83224 4.68615E-4 41612 0 0.00100705
7-73151431-C-T p.Val215Met missense ABHD11 3 83174 3.6069E-5 41587 0 1.19559E-5
7-73151432-G-A p.Pro174Leu missense ABHD11 1 83172 1.20233E-5 41586 0 NA
7-73151433-G-A p.Ala214Val missense ABHD11 5 83166 6.01207E-5 41583 0 5.18308E-5
7-73151439-TCCTGTGGGGGTGCAGCAGTTGGGGGAGGTTCCTTGTGCGGTCTGGGGGTGCCACTCTTCCCTTGACAGGTCCTGGTCTACAATACCATCCGGGGCACCTTGGGTGTATCA-T p.Asp212fs frameshift ABHD11 1 83120 1.20308E-5 41560 0 NA
7-73151444-TG-T p.His170fs frameshift ABHD11 2 83104 2.40662E-5 41552 0 3.18857E-5
7-73151446-G-A c.634-6C>T splice_region ABHD11 1 83094 1.20346E-5 41547 0 3.98998E-6
7-73151449-G-A p.His168His synonymous ABHD11 5 83064 6.01946E-5 41532 0 3.30306E-5
7-73151458-T-C p.Gln165Gln synonymous ABHD11 1 83002 1.20479E-5 41501 0 3.19081E-5
7-73151462-G-T p.Pro164His missense ABHD11 1 82958 1.20543E-5 41479 0 5.19186E-5
7-73151462-G-A p.Pro164Leu missense ABHD11 1 82958 1.20543E-5 41479 0 3.18573E-5
7-73151463-G-A p.Pro164Ser missense ABHD11 2 82978 2.41028E-5 41489 0 9.58474E-5
7-73151466-G-A p.Leu163Phe missense ABHD11 1 82952 1.20552E-5 41476 0 3.30426E-5
7-73151468-T-C p.Asn162Ser missense ABHD11 3 82904 3.61864E-5 41452 0 6.37349E-5
7-73151477-C-T p.Arg159His missense ABHD11 14 82750 1.69184E-4 41375 0 1.1202E-4
7-73151478-G-A p.Arg159Cys missense ABHD11 3 82744 3.62564E-5 41372 0 6.37227E-5
7-73151480-T-A p.Asp158Val missense ABHD11 1 82706 1.2091E-5 41353 0 NA
7-73151484-G-C p.Pro157Ala missense ABHD11 1 82640 1.21007E-5 41320 0 3.9991E-6
7-73151489-G-T p.Ala155Glu missense ABHD11 1 82542 1.2115E-5 41271 0 NA
7-73151491-C-T p.Val154Val synonymous ABHD11 1 82568 1.21112E-5 41284 0 NA
7-73151520-A-G p.Cys145Arg missense ABHD11 3 82458 3.63822E-5 41229 0 NA
7-73151522-TACCATCCGGGGC-T p.Cys140_Trp143del disruptive_inframe_deletion ABHD11 1 82446 1.21292E-5 41223 0 NA
7-73151528-C-A p.Gly142Val missense ABHD11 2 82434 2.42618E-5 41217 0 1.65074E-5
7-73151529-C-T p.Gly142Arg missense ABHD11 16 82396 1.94184E-4 41198 0 1.07686E-4
7-73151543-T-C p.His137Arg missense ABHD11 1 82444 1.21294E-5 41222 0 3.98371E-6
7-73151565-T-G p.Ser207Arg missense ABHD11 2 82696 2.4185E-5 41348 0 NA
7-73151568-G-GCTGTTCAT p.Leu206fs frameshift ABHD11 1 82698 1.20922E-5 41349 0 8.24429E-6
7-73151578-C-T p.Ala202Ala synonymous ABHD11 9 82760 1.08748E-4 41380 0 5.03525E-4
7-73151579-G-A p.Ala202Val missense ABHD11 1 82724 1.20884E-5 41362 0 3.18593E-5
7-73151580-C-A p.Ala202Ser missense ABHD11 4 82758 4.83337E-5 41379 0 1.64859E-5
7-73151583-G-C p.Leu201Val missense ABHD11 1 82808 1.20761E-5 41404 0 NA
7-73151585-T-TG p.Lys200fs frameshift ABHD11 1 82810 1.20758E-5 41405 0 8.24212E-6
7-73151586-T-TTCA p.Arg199_Lys200insTer stop_gained ABHD11 1 82822 1.20741E-5 41411 0 8.24198E-6
7-73151588-C-T p.Arg199Gln missense ABHD11 3 82802 3.6231E-5 41401 0 6.37064E-5
7-73151589-G-A p.Arg199* stop_gained ABHD11 2 82808 2.41523E-5 41404 0 8.24266E-6
7-73151594-C-T p.Arg197His missense ABHD11 3 82770 3.6245E-5 41385 0 3.29669E-5
7-73151600-C-T p.Arg195His missense ABHD11 9 82760 1.08748E-4 41380 0 1.87081E-4
7-73151601-G-A p.Arg195Cys missense ABHD11 1 82780 1.20802E-5 41390 0 8.24144E-6
7-73151614-T-G p.Ala190Ala synonymous ABHD11 1 82778 1.20805E-5 41389 0 3.18492E-5
7-73151616-C-T p.Ala190Thr missense ABHD11 3 82716 3.62687E-5 41358 0 0.0025
7-73151617-G-A p.Ile189Ile synonymous ABHD11 2 82744 2.41709E-5 41372 0 3.18492E-5
7-73151617-G-C p.Ile189Met missense ABHD11 1 82744 1.20855E-5 41372 0 NA
7-73151621-T-C p.Asn188Ser missense ABHD11 2 82726 2.41762E-5 41363 0 1.59172E-5
7-73151643-C-T p.Val181Met missense ABHD11 943 82388 0.0114458 41194 23 0.0346399
7-73151643-CA-TG p.TyrVal180TyrMet missense ABHD11 448 82418 0.00543571 41209 30 NA
7-73151644-A-G p.Met119Thr missense ABHD11 44763 81412 0.549833 40706 12932 0.635
7-73151652-C-T p.Ala178Thr missense ABHD11 1 82348 1.21436E-5 41174 0 NA
7-73151664-C-T p.Val174Ile missense ABHD11 2 82074 2.43683E-5 41037 0 0.00151057
7-73151676-C-T p.Trp108* stop_gained ABHD11 1 81756 1.22315E-5 40878 0 NA
7-73151682-G-T p.Pro168Thr missense ABHD11 1 81592 1.22561E-5 40796 0 NA
7-73151694-CA-C p.Val164fs frameshift ABHD11 1 81348 1.22929E-5 40674 0 8.29215E-6
7-73151699-A-G p.Ile162Thr missense ABHD11 1 81222 1.23119E-5 40611 0 NA
7-73151727-G-A c.463-6C>T splice_region ABHD11 2 80866 2.47323E-5 40433 0 NA
7-73151884-C-T c.462+8G>A splice_region ABHD11 1 81080 1.23335E-5 40540 0 3.06724E-5
7-73151884-CG-C c.462+7delC splice_region ABHD11 1 81080 1.23335E-5 40540 0 NA
7-73151886-G-A c.462+6C>T splice_region ABHD11 1 81102 1.23302E-5 40551 0 NA
7-73151888-T-TACA c.462+3_462+4insTGT splice_region ABHD11 1 81226 1.23113E-5 40613 0 NA
7-73151889-C-T c.462+3G>A splice_region ABHD11 448 81268 0.00551262 40634 2 0.00857179
7-73151898-T-C c.*359A>G splice_region ABHD11 1 81586 1.2257E-5 40793 0 2.73324E-5
7-73151901-T-C p.Ala151Ala synonymous ABHD11 1 81608 1.22537E-5 40804 0 3.63042E-5
7-73151907-C-T p.Leu149Leu synonymous ABHD11 5 81680 6.12145E-5 40840 0 8.99766E-6
7-73151908-AG-CC p.Leu149Gly missense ABHD11 1 81738 1.22342E-5 40869 0 NA
7-73151915-C-A p.Ala147Ser missense ABHD11 1 81888 1.22118E-5 40944 0 NA
7-73151919-C-T p.Lys145Lys synonymous ABHD11 2 81978 2.43968E-5 40989 0 3.23549E-5
7-73151926-C-T p.Gly143Glu missense ABHD11 5 82068 6.09251E-5 41034 0 6.37186E-5
7-73151946-G-A p.Val136Val synonymous ABHD11 4 82280 4.86145E-5 41140 0 8.39342E-5
7-73151948-C-T p.Val136Ile missense ABHD11 2 82292 2.43037E-5 41146 0 1.59884E-5
7-73151955-C-T p.Val133Val synonymous ABHD11 12 82362 1.45698E-4 41181 0 6.39131E-5
7-73151957-C-T p.Val133Met missense ABHD11 1 82396 1.21365E-5 41198 0 NA
7-73151958-C-T p.Leu132Leu synonymous ABHD11 1 82402 1.21356E-5 41201 0 NA
7-73151959-A-C p.Leu132Arg missense ABHD11 2 82400 2.42718E-5 41200 0 NA
7-73151971-G-T p.Pro128His missense ABHD11 1 82484 1.21236E-5 41242 0 NA
7-73152000-G-A n.746C>T splice_region ABHD11 2 82680 2.41896E-5 41340 0 1.99216E-5
7-73152001-A-G p.Ile118Thr missense ABHD11 1 82680 1.20948E-5 41340 0 3.9846E-6
7-73152002-T-G p.Ile118Leu missense ABHD11 1 82668 1.20966E-5 41334 0 NA
7-73152003-C-A p.Glu117Asp missense ABHD11 2 82684 2.41885E-5 41342 0 8.32945E-6
7-73152024-G-A p.His110His synonymous ABHD11 2 82656 2.41967E-5 41328 0 NA
7-73152026-G-A p.His110Tyr missense ABHD11 1 82670 1.20963E-5 41335 0 7.9848E-6
7-73152030-G-A p.Ser108Ser synonymous ABHD11 10 82616 1.21042E-4 41308 0 0.00100705
7-73152033-G-C p.Asp107Glu missense ABHD11 7 82622 8.47232E-5 41311 0 5.03525E-4
7-73152041-G-C p.His105Asp missense ABHD11 3 82544 3.63443E-5 41272 0 6.02013E-5
7-73152046-C-T p.Arg103His missense ABHD11 1 82444 1.21294E-5 41222 0 6.25E-4
7-73152047-G-A p.Arg103Cys missense ABHD11 3 82410 3.64033E-5 41205 0 3.18532E-5
7-73152057-C-T p.Gly98Ser missense ABHD11 1 82226 1.21616E-5 41113 0 8.56062E-6
7-73152058-G-C p.Thr99Arg missense ABHD11 1 82230 1.2161E-5 41115 0 2.44487E-5
7-73152065-C-CCCTACGGCCTGTCTG c.289-1_289insCAGACAGGCCGTAGG splice_acceptor ABHD11 1 82060 1.21862E-5 41030 0 NA
7-73152072-A-T c.289-7T>A splice_region ABHD11 1 81766 1.223E-5 40883 0 NA
7-73152073-G-A c.289-8C>T splice_region ABHD11 2 81764 2.44606E-5 40882 0 6.95894E-5
7-73152200-C-T n.323+6G>A splice_region ABHD11 3 79406 3.77805E-5 39703 0 6.37389E-5
7-73152205-CCTAGGAGG-C n.316_323delCCTCCTAG splice_region ABHD11 1 79236 1.26205E-5 39618 0 NA
7-73152208-A-G n.321T>C splice_region ABHD11 2 79110 2.52813E-5 39555 0 NA
7-73152406-G-A c.259-4C>T splice_region ABHD11 1 70746 1.41351E-5 35373 0 1.95559E-5
7-73152653-C-T c.288+5G>A splice_region ABHD11 1 80568 1.24119E-5 40284 0 1.95783E-5
7-73152664-G-C p.Gly94Gly splice_region+synonymous ABHD11 3 81018 3.70288E-5 40509 0 6.02352E-5
7-73152665-C-T p.Gly94Asp missense+splice_region ABHD11 1 81046 1.23387E-5 40523 0 3.19591E-5
7-73152666-C-A p.Gly94Cys missense ABHD11 2 81138 2.46494E-5 40569 0 1.88462E-5
7-73152666-C-G p.Gly94Arg missense ABHD11 1 81138 1.23247E-5 40569 0 1.60499E-5
7-73152671-T-A p.Gln92Leu missense ABHD11 1 81258 1.23065E-5 40629 0 NA
7-73152675-G-C p.Gln91Glu missense ABHD11 1 81332 1.22953E-5 40666 0 NA
7-73152689-G-A p.Ala86Val missense ABHD11 1 81566 1.226E-5 40783 0 9.29005E-6
7-73152694-G-A p.Ser84Ser synonymous ABHD11 1 81668 1.22447E-5 40834 0 4.47161E-4
7-73152698-T-C p.Asn83Ser missense ABHD11 1 81682 1.22426E-5 40841 0 9.36224E-6
7-73152703-G-A p.Asn81Asn synonymous ABHD11 2 81764 2.44606E-5 40882 0 NA
7-73152705-T-C p.Asn81Asp missense ABHD11 4 81748 4.89309E-5 40874 0 0.00100908
7-73152706-A-C p.Thr80Thr synonymous ABHD11 1 81754 1.22318E-5 40877 0 NA
7-73152712-G-C p.Ser78Arg missense ABHD11 1 81744 1.22333E-5 40872 0 NA
7-73152715-G-A p.Gly77Gly synonymous ABHD11 1 81706 1.2239E-5 40853 0 4.02781E-6
7-73152720-A-G p.Phe76Leu missense ABHD11 1 81768 1.22297E-5 40884 0 NA
7-73152727-G-A p.His73His synonymous ABHD11 7 81718 8.56604E-5 40859 0 1.21474E-5
7-73152739-G-A p.Val69Val synonymous ABHD11 9 81594 1.10302E-4 40797 0 4.11184E-6
7-73152745-C-T p.Pro67Pro synonymous ABHD11 1 81456 1.22766E-5 40728 0 1.06598E-5
7-73152751-G-A p.Ala65Ala synonymous ABHD11 17 81484 2.0863E-4 40742 0 2.5481E-4
7-73152763-G-A p.Asp61Asp synonymous ABHD11 84 81308 0.00103311 40654 3 0.00406676
7-73152767-A-G p.Leu60Pro missense ABHD11 10 81324 1.22965E-4 40662 0 0.00151515
7-73152773-C-T c.153-1G>A splice_acceptor ABHD11 2 81388 2.45736E-5 40694 0 4.13777E-6
7-73152790-C-G p.Pro52Pro synonymous ABHD11 1 81142 1.23241E-5 40571 0 NA
7-73152795-T-TC c.153-3_153-2insG splice_region ABHD11 2 81094 2.46627E-5 40547 0 NA
7-73152796-G-A c.153-3C>T splice_region ABHD11 942 81018 0.011627 40509 7 0.0130163
7-73152995-G-T p.Arg45Arg synonymous ABHD11 1 76676 1.30419E-5 38338 0 NA
7-73153001-C-T p.Gly43Ser missense ABHD11 7 77322 9.05305E-5 38661 0 9.5761E-5
7-73153001-CGCT-C p.Ser42del conservative_inframe_deletion ABHD11 1 77316 1.29339E-5 38658 0 1.16996E-4
7-73153009-C-A p.Ser40Ile missense ABHD11 1 77804 1.28528E-5 38902 0 3.18837E-5
7-73153020-G-A p.Val36Val synonymous ABHD11 1 78146 1.27966E-5 39073 0 3.18939E-5
7-73153028-C-A p.Val34Leu missense ABHD11 1 78406 1.27541E-5 39203 0 4.45659E-5
7-73153032-C-A p.Ala32Ala synonymous ABHD11 2 78472 2.54868E-5 39236 0 3.18979E-5
7-73153042-G-A p.Pro29Leu missense ABHD11 2 79002 2.53158E-5 39501 0 NA
7-73153055-C-T p.Gly25Ser missense ABHD11 5 79330 6.30279E-5 39665 0 8.12536E-5
7-73153056-G-T p.Leu24Leu synonymous ABHD11 1 79454 1.25859E-5 39727 0 6.38203E-5
7-73153069-G-C p.Pro20Arg missense ABHD11 1 79904 1.2515E-5 39952 0 NA
7-73153073-G-C p.Leu19Val missense ABHD11 2 80050 2.49844E-5 40025 0 6.25E-4
7-73153084-C-T p.Arg15Gln missense ABHD11 1 80190 1.24704E-5 40095 0 2.03455E-5
7-73153084-C-G p.Arg15Pro missense ABHD11 1 80190 1.24704E-5 40095 0 NA
7-73153085-G-T p.Arg15Arg synonymous ABHD11 2 80220 2.49314E-5 40110 0 0.00100908
7-73153086-G-T p.Thr14Thr synonymous ABHD11 89 80230 0.00110931 40115 0 7.84048E-4
7-73153089-C-G p.Trp13Cys missense ABHD11 1 80204 1.24682E-5 40102 0 4.12735E-5
7-73153098-C-A p.Met10Ile missense ABHD11 1 80364 1.24434E-5 40182 0 2.00373E-5
7-73153100-T-C p.Met10Val missense ABHD11 3 80424 3.73023E-5 40212 0 6.38774E-5
7-73153102-C-T p.Ser9Asn missense ABHD11 1 80374 1.24418E-5 40187 0 5.03941E-5
7-73153114-T-C p.Gln5Arg missense ABHD11 1 80242 1.24623E-5 40121 0 1.04919E-5
7-73153116-G-A p.Gly4Gly synonymous ABHD11 3 80180 3.74158E-5 40090 0 2.11385E-5
7-73153123-C-T p.Arg2Gln missense ABHD11 1 79846 1.25241E-5 39923 0 1.08861E-5
7-73153124-G-A p.Arg2* stop_gained ABHD11 2 79762 2.50746E-5 39881 0 NA
7-73153167-T-A c.-40A>T 5_prime_UTR_premature_start_codon_gain ABHD11 2 77368 2.58505E-5 38684 0 3.20862E-5
7-73153191-G-A c.-64C>T 5_prime_UTR_premature_start_codon_gain ABHD11 4 75584 5.29213E-5 37792 0 NA