Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
7-73150866-G-A c.*298C>T splice_region ABHD11 4 78008 5.12768E-5 39004 0 1.12939E-4
7-73150888-CTT-C p.Ter316fs frameshift ABHD11 4 78074 5.12334E-5 39037 0 8.04156E-6
7-73150895-C-T c.*389G>A splice_region ABHD11 4 78062 5.12413E-5 39031 0 9.55718E-5
7-73150905-C-T p.Arg311Gln missense ABHD11 1 78068 1.28093E-5 39034 0 3.18634E-5
7-73150906-G-A p.Arg311* stop_gained ABHD11 1 78066 1.28097E-5 39033 0 0.00103199
7-73150908-A-G p.Ile310Thr missense ABHD11 6 78068 7.68561E-5 39034 0 3.18634E-5
7-73150914-G-T p.Ala308Asp missense ABHD11 1 78074 1.28084E-5 39037 0 NA
7-73150917-A-T p.Ile307Lys missense ABHD11 2 78070 2.5618E-5 39035 0 NA
7-73150928-T-C p.Pro303Pro synonymous ABHD11 1 78062 1.28103E-5 39031 0 4.0169E-6
7-73150932-C-T p.Arg302His missense ABHD11 1 78048 1.28126E-5 39024 0 6.3743E-5
7-73150932-C-G p.Arg302Pro missense ABHD11 1 78048 1.28126E-5 39024 0 8.23737E-6
7-73150933-G-A p.Arg302Cys missense ABHD11 2 78050 2.56246E-5 39025 0 3.18471E-5
7-73150934-G-A p.Asp301Asp synonymous ABHD11 168 78054 0.00215236 39027 0 0.00165574
7-73150958-G-A p.Asn293Asn synonymous ABHD11 1 78030 1.28156E-5 39015 0 4.01613E-6
7-73150962-G-A p.Pro292Leu missense ABHD11 2 78018 2.56351E-5 39009 0 3.61466E-5
7-73150963-G-A p.Pro292Ser missense ABHD11 1 78010 1.28189E-5 39005 0 1.64775E-5
7-73150981-C-A p.Ala286Ser missense ABHD11 1 78008 1.28192E-5 39004 0 8.03477E-6
7-73150983-C-G p.Arg285Pro missense ABHD11 2 77984 2.56463E-5 38992 0 3.18654E-5
7-73150984-G-A p.Arg285Trp missense ABHD11 6 78010 7.69132E-5 39005 0 4.12126E-5
7-73150988-G-A p.Phe283Phe synonymous ABHD11 1 78016 1.28179E-5 39008 0 4.01723E-6
7-73150995-C-T p.Arg281Gln missense ABHD11 2 77986 2.56456E-5 38993 0 2.41101E-5
7-73150996-G-A p.Arg281Trp missense ABHD11 4 77982 5.12939E-5 38991 0 3.18492E-5
7-73150999-T-G p.Met280Leu missense ABHD11 1 78000 1.28205E-5 39000 0 NA
7-73150999-T-A p.Met280Leu missense ABHD11 1 78000 1.28205E-5 39000 0 NA
7-73151012-G-A p.Pro158Ser missense ABHD11 1 78000 1.28205E-5 39000 0 NA
7-73151263-C-T p.Val271Met missense ABHD11 1 80710 1.239E-5 40355 0 8.30965E-6
7-73151264-G-A p.Phe270Phe synonymous ABHD11 5 80740 6.19272E-5 40370 0 6.64E-5
7-73151276-TCCA-T p.Gly266del disruptive_inframe_deletion ABHD11 2 80916 2.4717E-5 40458 0 9.56511E-5
7-73151285-G-A p.Leu263Leu synonymous ABHD11 6 80990 7.40832E-5 40495 0 2.47836E-5
7-73151289-AAG-A p.Phe262fs frameshift ABHD11 2 81014 2.46871E-5 40507 0 8.2575E-6
7-73151297-T-C p.Pro259Pro synonymous ABHD11 1 81014 1.23435E-5 40507 0 NA
7-73151300-C-A p.Gly258Gly synonymous ABHD11 205 81016 0.00253036 40508 0 0.00273891
7-73151303-G-A p.Leu257Leu synonymous ABHD11 1 81028 1.23414E-5 40514 0 1.99073E-5
7-73151322-T-C p.Gln251Arg missense ABHD11 4 81052 4.9351E-5 40526 0 6.37836E-5
7-73151335-A-T p.Leu247Met missense ABHD11 1 81064 1.23359E-5 40532 0 NA
7-73151370-T-C p.Asn235Ser missense ABHD11 1 81032 1.23408E-5 40516 0 3.18878E-5
7-73151383-C-T p.Val231Met missense ABHD11 3 81020 3.70279E-5 40510 0 3.18593E-5
7-73151384-G-A p.Phe230Phe synonymous ABHD11 6 81020 7.40558E-5 40510 0 5.03525E-4
7-73151385-A-G p.Phe230Ser missense ABHD11 6 81020 7.40558E-5 40510 0 6.36522E-5
7-73151388-C-T p.Arg229His missense ABHD11 1 81004 1.23451E-5 40502 0 2.4728E-5
7-73151392-C-T p.Gly228Arg missense ABHD11 3 81006 3.70343E-5 40503 0 7.5605E-5
7-73151399-C-G p.Glu225Asp missense ABHD11 1 81004 1.23451E-5 40502 0 8.24321E-6
7-73151400-T-C p.Glu225Gly missense ABHD11 11 81004 1.35796E-4 40502 0 0.00125
7-73151404-C-T p.Trp183* stop_gained ABHD11 1 80990 1.23472E-5 40495 0 8.24362E-6
7-73151408-G-A p.Thr182Ile missense ABHD11 1 80994 1.23466E-5 40497 0 3.18471E-5
7-73151414-G-A p.Ser180Leu missense ABHD11 1 80964 1.23512E-5 40482 0 NA
7-73151420-G-A p.Thr178Ile missense ABHD11 40 80960 4.94071E-4 40480 0 0.00100705
7-73151431-C-T p.Val215Met missense ABHD11 3 80910 3.70782E-5 40455 0 1.19559E-5
7-73151432-G-A p.Pro174Leu missense ABHD11 1 80906 1.236E-5 40453 0 NA
7-73151433-G-A p.Ala214Val missense ABHD11 5 80902 6.18032E-5 40451 0 5.18308E-5
7-73151439-TCCTGTGGGGGTGCAGCAGTTGGGGGAGGTTCCTTGTGCGGTCTGGGGGTGCCACTCTTCCCTTGACAGGTCCTGGTCTACAATACCATCCGGGGCACCTTGGGTGTATCA-T p.Asp212fs frameshift ABHD11 1 80860 1.23671E-5 40430 0 NA
7-73151444-TG-T p.His170fs frameshift ABHD11 1 80848 1.23689E-5 40424 0 3.18857E-5
7-73151446-G-A c.634-6C>T splice_region ABHD11 1 80844 1.23695E-5 40422 0 3.98998E-6
7-73151449-G-A p.His168His synonymous ABHD11 6 80808 7.42501E-5 40404 0 3.30306E-5
7-73151458-T-C p.Gln165Gln synonymous ABHD11 1 80762 1.23821E-5 40381 0 3.19081E-5
7-73151462-G-T p.Pro164His missense ABHD11 3 80716 3.71674E-5 40358 0 5.19186E-5
7-73151463-G-A p.Pro164Ser missense ABHD11 2 80734 2.47727E-5 40367 0 9.58474E-5
7-73151466-G-A p.Leu163Phe missense ABHD11 1 80706 1.23907E-5 40353 0 3.30426E-5
7-73151468-T-C p.Asn162Ser missense ABHD11 3 80670 3.71885E-5 40335 0 6.37349E-5
7-73151477-C-T p.Arg159His missense ABHD11 15 80526 1.86275E-4 40263 0 1.1202E-4
7-73151478-G-A p.Arg159Cys missense ABHD11 3 80522 3.72569E-5 40261 0 6.37227E-5
7-73151480-T-A p.Asp158Val missense ABHD11 1 80490 1.24239E-5 40245 0 NA
7-73151484-G-C p.Pro157Ala missense ABHD11 1 80422 1.24344E-5 40211 0 3.9991E-6
7-73151489-G-T p.Ala155Glu missense ABHD11 1 80338 1.24474E-5 40169 0 NA
7-73151491-C-T p.Val154Val synonymous ABHD11 1 80366 1.24431E-5 40183 0 NA
7-73151520-A-G p.Cys145Arg missense ABHD11 3 80250 3.73832E-5 40125 0 NA
7-73151522-TACCATCCGGGGC-T p.Cys140_Trp143del disruptive_inframe_deletion ABHD11 1 80230 1.24642E-5 40115 0 NA
7-73151528-C-A p.Gly142Val missense ABHD11 2 80212 2.49339E-5 40106 0 1.65074E-5
7-73151529-C-T p.Gly142Arg missense ABHD11 16 80180 1.99551E-4 40090 0 1.07686E-4
7-73151543-T-C p.His137Arg missense ABHD11 1 80226 1.24648E-5 40113 0 3.98371E-6
7-73151568-G-GCTGTTCAT p.Leu206fs frameshift ABHD11 1 80460 1.24285E-5 40230 0 8.24429E-6
7-73151578-C-T p.Ala202Ala synonymous ABHD11 7 80520 8.69349E-5 40260 0 5.03525E-4
7-73151580-C-A p.Ala202Ser missense ABHD11 4 80520 4.96771E-5 40260 0 1.64859E-5
7-73151583-G-C p.Leu201Val missense ABHD11 1 80568 1.24119E-5 40284 0 NA
7-73151585-T-TG p.Lys200fs frameshift ABHD11 1 80572 1.24113E-5 40286 0 8.24212E-6
7-73151586-T-TTCA p.Arg199_Lys200insTer stop_gained ABHD11 1 80582 1.24097E-5 40291 0 8.24198E-6
7-73151588-C-T p.Arg199Gln missense ABHD11 3 80560 3.72393E-5 40280 0 6.37064E-5
7-73151589-G-A p.Arg199* stop_gained ABHD11 2 80570 2.48231E-5 40285 0 8.24266E-6
7-73151594-C-T p.Arg197His missense ABHD11 1 80536 1.24168E-5 40268 0 3.29669E-5
7-73151600-C-T p.Arg195His missense ABHD11 8 80536 9.93345E-5 40268 0 1.87081E-4
7-73151601-G-A p.Arg195Cys missense ABHD11 1 80558 1.24134E-5 40279 0 8.24144E-6
7-73151614-T-G p.Ala190Ala synonymous ABHD11 1 80554 1.2414E-5 40277 0 3.18492E-5
7-73151616-C-T p.Ala190Thr missense ABHD11 3 80502 3.72662E-5 40251 0 0.0025
7-73151617-G-A p.Ile189Ile synonymous ABHD11 2 80526 2.48367E-5 40263 0 3.18492E-5
7-73151617-G-C p.Ile189Met missense ABHD11 1 80526 1.24183E-5 40263 0 NA
7-73151621-T-C p.Asn188Ser missense ABHD11 3 80508 3.72634E-5 40254 0 1.59172E-5
7-73151643-C-T p.Val181Met missense ABHD11 926 80188 0.0115479 40094 22 0.0346399
7-73151643-CA-TG p.TyrVal180TyrMet missense ABHD11 435 80218 0.00542272 40109 30 NA
7-73151644-A-G p.Met119Thr missense ABHD11 43541 79224 0.549594 39612 12576 0.635
7-73151652-C-T p.Ala178Thr missense ABHD11 1 80142 1.24779E-5 40071 0 NA
7-73151664-C-T p.Val174Ile missense ABHD11 2 79862 2.50432E-5 39931 0 0.00151057
7-73151676-C-T p.Trp108* stop_gained ABHD11 1 79542 1.2572E-5 39771 0 NA
7-73151682-G-T p.Pro168Thr missense ABHD11 1 79376 1.25983E-5 39688 0 NA
7-73151694-CA-C p.Val164fs frameshift ABHD11 1 79144 1.26352E-5 39572 0 8.29215E-6
7-73151699-A-G p.Ile162Thr missense ABHD11 1 79030 1.26534E-5 39515 0 NA
7-73151727-G-A c.463-6C>T splice_region ABHD11 2 78758 2.53942E-5 39379 0 NA
7-73151884-C-T c.462+8G>A splice_region ABHD11 1 79286 1.26126E-5 39643 0 3.06724E-5
7-73151884-CG-C c.462+7delC splice_region ABHD11 1 79286 1.26126E-5 39643 0 NA
7-73151886-G-A c.462+6C>T splice_region ABHD11 1 79302 1.261E-5 39651 0 NA
7-73151888-T-TACA c.462+3_462+4insTGT splice_region ABHD11 1 79400 1.25945E-5 39700 0 NA
7-73151889-C-T c.462+3G>A splice_region ABHD11 439 79440 0.00552618 39720 1 0.00857179
7-73151898-T-C c.*359A>G splice_region ABHD11 1 79674 1.25511E-5 39837 0 2.73324E-5
7-73151901-T-C p.Ala151Ala synonymous ABHD11 1 79684 1.25496E-5 39842 0 3.63042E-5
7-73151907-C-T p.Leu149Leu synonymous ABHD11 5 79748 6.26975E-5 39874 0 8.99766E-6
7-73151908-AG-CC p.Leu149Gly missense ABHD11 1 79788 1.25332E-5 39894 0 NA
7-73151915-C-A p.Ala147Ser missense ABHD11 1 79894 1.25166E-5 39947 0 NA
7-73151919-C-T p.Lys145Lys synonymous ABHD11 2 79954 2.50144E-5 39977 0 3.23549E-5
7-73151926-C-T p.Gly143Glu missense ABHD11 5 80026 6.24797E-5 40013 0 6.37186E-5
7-73151946-G-A p.Val136Val synonymous ABHD11 4 80158 4.99014E-5 40079 0 8.39342E-5
7-73151948-C-T p.Val136Ile missense ABHD11 3 80176 3.74177E-5 40088 0 1.59884E-5
7-73151955-C-T p.Val133Val synonymous ABHD11 9 80238 1.12166E-4 40119 0 6.39131E-5
7-73151957-C-T p.Val133Met missense ABHD11 1 80264 1.24589E-5 40132 0 NA
7-73151958-C-T p.Leu132Leu synonymous ABHD11 1 80272 1.24576E-5 40136 0 NA
7-73151959-A-C p.Leu132Arg missense ABHD11 2 80264 2.49178E-5 40132 0 NA
7-73151971-G-T p.Pro128His missense ABHD11 1 80318 1.24505E-5 40159 0 NA
7-73152000-G-A n.746C>T splice_region ABHD11 2 80484 2.48497E-5 40242 0 1.99216E-5
7-73152001-A-G p.Ile118Thr missense ABHD11 1 80484 1.24248E-5 40242 0 3.9846E-6
7-73152002-T-G p.Ile118Leu missense ABHD11 1 80474 1.24264E-5 40237 0 NA
7-73152003-C-A p.Glu117Asp missense ABHD11 2 80484 2.48497E-5 40242 0 8.32945E-6
7-73152024-G-A p.His110His synonymous ABHD11 2 80460 2.48571E-5 40230 0 NA
7-73152026-G-A p.His110Tyr missense ABHD11 1 80478 1.24258E-5 40239 0 7.9848E-6
7-73152030-G-A p.Ser108Ser synonymous ABHD11 9 80424 1.11907E-4 40212 0 0.00100705
7-73152033-G-C p.Asp107Glu missense ABHD11 7 80428 8.70344E-5 40214 0 5.03525E-4
7-73152041-G-C p.His105Asp missense ABHD11 3 80356 3.73339E-5 40178 0 6.02013E-5
7-73152046-C-T p.Arg103His missense ABHD11 1 80258 1.24598E-5 40129 0 6.25E-4
7-73152047-G-A p.Arg103Cys missense ABHD11 3 80220 3.73972E-5 40110 0 3.18532E-5
7-73152058-G-C p.Thr99Arg missense ABHD11 1 80062 1.24903E-5 40031 0 2.44487E-5
7-73152065-C-CCCTACGGCCTGTCTG c.289-1_289insCAGACAGGCCGTAGG splice_acceptor ABHD11 1 79898 1.2516E-5 39949 0 NA
7-73152072-A-T c.289-7T>A splice_region ABHD11 1 79626 1.25587E-5 39813 0 NA
7-73152073-G-A c.289-8C>T splice_region ABHD11 2 79628 2.51168E-5 39814 0 6.95894E-5
7-73152200-C-T n.323+6G>A splice_region ABHD11 4 77796 5.14165E-5 38898 0 6.37389E-5
7-73152205-CCTAGGAGG-C n.316_323delCCTCCTAG splice_region ABHD11 1 77650 1.28783E-5 38825 0 NA
7-73152208-A-G n.321T>C splice_region ABHD11 2 77550 2.57898E-5 38775 0 NA
7-73152406-G-A c.259-4C>T splice_region ABHD11 1 70432 1.41981E-5 35216 0 1.95559E-5
7-73152653-C-T c.288+5G>A splice_region ABHD11 1 78376 1.2759E-5 39188 0 1.95783E-5
7-73152664-G-C p.Gly94Gly splice_region+synonymous ABHD11 3 78790 3.80759E-5 39395 0 6.02352E-5
7-73152665-C-T p.Gly94Asp missense+splice_region ABHD11 1 78822 1.26868E-5 39411 0 3.19591E-5
7-73152666-C-A p.Gly94Cys missense ABHD11 2 78908 2.5346E-5 39454 0 1.88462E-5
7-73152666-C-G p.Gly94Arg missense ABHD11 1 78908 1.2673E-5 39454 0 1.60499E-5
7-73152671-T-A p.Gln92Leu missense ABHD11 1 79016 1.26557E-5 39508 0 NA
7-73152675-G-C p.Gln91Glu missense ABHD11 1 79092 1.26435E-5 39546 0 NA
7-73152689-G-A p.Ala86Val missense ABHD11 1 79320 1.26072E-5 39660 0 9.29005E-6
7-73152694-G-A p.Ser84Ser synonymous ABHD11 1 79420 1.25913E-5 39710 0 4.47161E-4
7-73152698-T-C p.Asn83Ser missense ABHD11 1 79426 1.25903E-5 39713 0 9.36224E-6
7-73152705-T-C p.Asn81Asp missense ABHD11 3 79498 3.77368E-5 39749 0 0.00100908
7-73152706-A-C p.Thr80Thr synonymous ABHD11 1 79502 1.25783E-5 39751 0 NA
7-73152712-G-C p.Ser78Arg missense ABHD11 1 79500 1.25786E-5 39750 0 NA
7-73152715-G-A p.Gly77Gly synonymous ABHD11 1 79466 1.2584E-5 39733 0 4.02781E-6
7-73152727-G-A p.His73His synonymous ABHD11 7 79476 8.80769E-5 39738 0 1.21474E-5
7-73152739-G-A p.Val69Val synonymous ABHD11 9 79358 1.1341E-4 39679 0 4.11184E-6
7-73152745-C-T p.Pro67Pro synonymous ABHD11 1 79232 1.26212E-5 39616 0 1.06598E-5
7-73152751-G-A p.Ala65Ala synonymous ABHD11 14 79266 1.7662E-4 39633 0 2.5481E-4
7-73152763-G-A p.Asp61Asp synonymous ABHD11 82 79120 0.0010364 39560 3 0.00406676
7-73152767-A-G p.Leu60Pro missense ABHD11 10 79146 1.26349E-4 39573 0 0.00151515
7-73152773-C-T c.153-1G>A splice_acceptor ABHD11 2 79208 2.525E-5 39604 0 4.13777E-6
7-73152790-C-G p.Pro52Pro synonymous ABHD11 1 79014 1.2656E-5 39507 0 NA
7-73152795-T-TC c.153-3_153-2insG splice_region ABHD11 2 78974 2.53248E-5 39487 0 NA
7-73152796-G-A c.153-3C>T splice_region ABHD11 928 78904 0.0117611 39452 7 0.0130163
7-73152995-G-T p.Arg45Arg synonymous ABHD11 1 74958 1.33408E-5 37479 0 NA
7-73153001-C-T p.Gly43Ser missense ABHD11 6 75564 7.94029E-5 37782 0 9.5761E-5
7-73153001-CGCT-C p.Ser42del conservative_inframe_deletion ABHD11 1 75558 1.32349E-5 37779 0 1.16996E-4
7-73153009-C-A p.Ser40Ile missense ABHD11 1 76028 1.3153E-5 38014 0 3.18837E-5
7-73153020-G-A p.Val36Val synonymous ABHD11 1 76352 1.30972E-5 38176 0 3.18939E-5
7-73153028-C-A p.Val34Leu missense ABHD11 1 76586 1.30572E-5 38293 0 4.45659E-5
7-73153032-C-A p.Ala32Ala synonymous ABHD11 2 76644 2.60947E-5 38322 0 3.18979E-5
7-73153042-G-A p.Pro29Leu missense ABHD11 2 77142 2.59262E-5 38571 0 NA
7-73153055-C-T p.Gly25Ser missense ABHD11 6 77454 7.74653E-5 38727 0 8.12536E-5
7-73153056-G-T p.Leu24Leu synonymous ABHD11 1 77574 1.28909E-5 38787 0 6.38203E-5
7-73153069-G-C p.Pro20Arg missense ABHD11 1 77990 1.28222E-5 38995 0 NA
7-73153073-G-C p.Leu19Val missense ABHD11 1 78118 1.28011E-5 39059 0 6.25E-4
7-73153084-C-T p.Arg15Gln missense ABHD11 1 78258 1.27782E-5 39129 0 2.03455E-5
7-73153084-C-G p.Arg15Pro missense ABHD11 1 78258 1.27782E-5 39129 0 NA
7-73153085-G-T p.Arg15Arg synonymous ABHD11 2 78290 2.5546E-5 39145 0 0.00100908
7-73153086-G-T p.Thr14Thr synonymous ABHD11 90 78294 0.00114951 39147 0 7.84048E-4
7-73153089-C-G p.Trp13Cys missense ABHD11 1 78270 1.27763E-5 39135 0 4.12735E-5
7-73153098-C-A p.Met10Ile missense ABHD11 1 78424 1.27512E-5 39212 0 2.00373E-5
7-73153100-T-C p.Met10Val missense ABHD11 2 78478 2.54848E-5 39239 0 6.38774E-5
7-73153102-C-T p.Ser9Asn missense ABHD11 1 78430 1.27502E-5 39215 0 5.03941E-5
7-73153114-T-C p.Gln5Arg missense ABHD11 1 78304 1.27707E-5 39152 0 1.04919E-5
7-73153116-G-A p.Gly4Gly synonymous ABHD11 3 78242 3.83426E-5 39121 0 2.11385E-5
7-73153123-C-T p.Arg2Gln missense ABHD11 1 77912 1.2835E-5 38956 0 1.08861E-5
7-73153124-G-A p.Arg2* stop_gained ABHD11 2 77826 2.56984E-5 38913 0 NA
7-73153167-T-A c.-40A>T 5_prime_UTR_premature_start_codon_gain ABHD11 2 75566 2.64669E-5 37783 0 3.20862E-5
7-73153191-G-A c.-64C>T 5_prime_UTR_premature_start_codon_gain ABHD11 4 74012 5.40453E-5 37006 0 NA