Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
3-183903816-C-T c.-180C>T 5_prime_UTR_premature_start_codon_gain ABCF3 1 59286 1.68674E-5 29643 0 3.18492E-5
3-183903841-C-G c.-155C>G 5_prime_UTR_premature_start_codon_gain ABCF3 2 66234 3.0196E-5 33117 0 NA
3-183903879-C-T c.-117C>T 5_prime_UTR_premature_start_codon_gain ABCF3 63 74186 8.49217E-4 37093 0 4.4603E-4
3-183903943-G-T c.-53G>T 5_prime_UTR_premature_start_codon_gain ABCF3 1 81346 1.22932E-5 40673 0 NA
3-183903950-G-T c.-46G>T 5_prime_UTR_premature_start_codon_gain ABCF3 11 82020 1.34114E-4 41010 0 1.0976E-4
3-183903953-C-T c.-43C>T 5_prime_UTR_premature_start_codon_gain ABCF3 1 82178 1.21687E-5 41089 0 3.18573E-5
3-183903978-C-T c.-18C>T 5_prime_UTR_premature_start_codon_gain ABCF3 3 82934 3.61733E-5 41467 0 6.25E-4
3-183904003-C-T p.Thr3Ile missense ABCF3 2 83162 2.40494E-5 41581 0 8.28597E-6
3-183904004-T-C p.Thr3Thr synonymous ABCF3 6 83158 7.21518E-5 41579 0 9.15277E-5
3-183904008-G-C p.Ala5Pro missense ABCF3 1 83140 1.20279E-5 41570 0 8.28034E-6
3-183904011-G-A p.Glu6Lys missense ABCF3 2 83166 2.40483E-5 41583 0 NA
3-183904012-A-G p.Glu6Gly missense ABCF3 1 83170 1.20236E-5 41585 0 NA
3-183904025-C-G p.Ser10Arg missense ABCF3 1 83198 1.20195E-5 41599 0 9.55171E-5
3-183904026-G-T p.Glu11* stop_gained ABCF3 2 83212 2.4035E-5 41606 0 NA
3-183904031-C-T p.Phe12Phe synonymous ABCF3 108 83240 0.00129745 41620 0 0.00257913
3-183904035-G-A p.Glu14Lys missense ABCF3 2 83244 2.40258E-5 41622 0 NA
3-183904049-A-G p.Gln18Gln synonymous ABCF3 15590 83028 0.187768 41514 1755 0.239678
3-183904050-G-A p.Val19Ile missense ABCF3 2 83250 2.4024E-5 41625 0 7.95773E-6
3-183904052-C-T p.Val19Val synonymous ABCF3 1 83252 1.20117E-5 41626 0 NA
3-183904061-C-T p.Tyr22Tyr synonymous ABCF3 1 83236 1.2014E-5 41618 0 NA
3-183904291-C-T c.74-4C>T splice_region ABCF3 1 83220 1.20163E-5 41610 0 1.13916E-4
3-183904295-G-T p.Gly25Val missense+splice_region ABCF3 1 83240 1.20135E-5 41620 0 4.04878E-6
3-183904295-G-C p.Gly25Ala missense+splice_region ABCF3 1 83240 1.20135E-5 41620 0 NA
3-183904305-C-T p.His28His synonymous ABCF3 1 83272 1.20088E-5 41636 0 NA
3-183904308-C-T p.Ser29Ser synonymous ABCF3 2 83270 2.40183E-5 41635 0 3.18451E-5
3-183904313-G-T p.Ser31Ile missense ABCF3 2 83276 2.40165E-5 41638 0 1.68645E-5
3-183904338-C-T p.Asp39Asp synonymous ABCF3 2 83316 2.4005E-5 41658 0 7.96705E-6
3-183904341-G-A p.Leu40Leu synonymous ABCF3 13 83320 1.56025E-4 41660 0 5.29606E-4
3-183904349-C-T p.Ala43Val missense ABCF3 1 83322 1.20016E-5 41661 0 3.18471E-5
3-183904351-G-C p.Val44Leu missense ABCF3 3 83314 3.60084E-5 41657 0 4.77654E-5
3-183904357-G-C p.Glu46Gln missense ABCF3 13 83306 1.56051E-4 41653 0 1.27371E-4
3-183904360-C-T p.Leu47Leu synonymous ABCF3 1 83296 1.20054E-5 41648 0 3.97962E-6
3-183904365-G-A p.Leu48Leu synonymous ABCF3 10 83292 1.2006E-4 41646 0 6.37064E-5
3-183904386-C-T p.Ser55Ser synonymous ABCF3 1 83248 1.20123E-5 41624 0 NA
3-183904408-G-A p.Ala63Thr missense ABCF3 3 83160 3.6075E-5 41580 0 3.18451E-5
3-183904410-C-T p.Ala63Ala synonymous ABCF3 1 83138 1.20282E-5 41569 0 NA
3-183904416-C-T p.Cys65Cys synonymous ABCF3 1 83140 1.20279E-5 41570 0 8.41765E-6
3-183904418-A-G p.Gln66Arg missense ABCF3 2 83146 2.40541E-5 41573 0 NA
3-183904419-G-T p.Gln66His missense ABCF3 1 83136 1.20285E-5 41568 0 NA
3-183904432-ACT-A p.Leu72fs frameshift ABCF3 1 83090 1.20351E-5 41545 0 NA
3-183904578-A-C c.204-6A>C splice_region ABCF3 1 83266 1.20097E-5 41633 0 NA
3-183904578-A-T c.204-6A>T splice_region ABCF3 2 83266 2.40194E-5 41633 0 NA
3-183904580-A-G c.204-4A>G splice_region ABCF3 1 83274 1.20085E-5 41637 0 NA
3-183904585-G-A p.Ala69Thr missense+splice_region ABCF3 1 83286 1.20068E-5 41643 0 3.98813E-6
3-183904591-C-T p.Pro71Ser missense ABCF3 1 83300 1.20048E-5 41650 0 NA
3-183904592-C-T p.Pro71Leu missense ABCF3 4 83298 4.80204E-5 41649 0 3.18552E-5
3-183904598-G-A p.Ser73Asn missense ABCF3 1 83304 1.20042E-5 41652 0 3.18654E-5
3-183904627-G-A p.Ala83Thr missense ABCF3 15 83304 1.80063E-4 41652 0 5.09554E-4
3-183904631-CT-C p.Ile85fs frameshift ABCF3 1 83308 1.20036E-5 41654 0 8.27965E-6
3-183904645-A-G p.Lys89Glu missense ABCF3 1 83322 1.20016E-5 41661 0 8.30248E-6
3-183904645-A-C p.Lys89Gln missense ABCF3 1 83322 1.20016E-5 41661 0 NA
3-183904652-C-T p.Thr91Met missense ABCF3 1 83306 1.20039E-5 41653 0 1.66797E-5
3-183904653-G-A p.Thr91Thr synonymous ABCF3 3 83310 3.60101E-5 41655 0 NA
3-183904670-G-A c.283+7G>A splice_region ABCF3 4 83236 4.80561E-5 41618 0 2.54039E-5
3-183904670-G-T c.283+7G>T splice_region ABCF3 1 83236 1.2014E-5 41618 0 1.20396E-5
3-183904832-A-T n.659A>T splice_region ABCF3 1 66088 1.51313E-5 33044 0 NA
3-183905071-A-G n.813A>G splice_region ABCF3 8 80836 9.89658E-5 40418 0 9.55353E-5
3-183905071-A-T n.813A>T splice_region ABCF3 1 80836 1.23707E-5 40418 0 3.18451E-5
3-183905147-C-T c.302-5C>T splice_region ABCF3 11 83198 1.32215E-4 41599 0 1.59246E-4
3-183905157-A-G p.Arg103Gly missense ABCF3 11 83234 1.32158E-4 41617 0 2.06403E-4
3-183905181-A-G c.284-4A>G splice_region ABCF3 1 83280 1.20077E-5 41640 0 1.64802E-5
3-183905186-CTG-C p.Cys96fs frameshift ABCF3 1 83294 1.20057E-5 41647 0 3.18573E-5
3-183905191-G-A p.Gly97Glu missense ABCF3 1 83290 1.20062E-5 41645 0 1.64777E-5
3-183905203-C-G p.Pro101Arg missense ABCF3 1 83294 1.20057E-5 41647 0 NA
3-183905206-G-A p.Gly102Glu missense ABCF3 1 83298 1.20051E-5 41649 0 NA
3-183905207-ACTG-A p.Leu104del disruptive_inframe_deletion ABCF3 2 83300 2.40096E-5 41650 0 NA
3-183905211-C-G p.Leu104Val missense ABCF3 1 83286 1.20068E-5 41643 0 NA
3-183905218-G-A p.Arg106Lys missense ABCF3 42 83294 5.04238E-4 41647 0 0.0020141
3-183905231-G-A p.Ser110Ser splice_region+synonymous ABCF3 2 83276 2.40165E-5 41638 0 NA
3-183905234-G-A c.330+3G>A splice_region ABCF3 1 83278 1.2008E-5 41639 0 8.24049E-6
3-183905237-G-A c.330+6G>A splice_region ABCF3 1 83274 1.20085E-5 41637 0 8.24063E-6
3-183905399-G-A n.566G>A splice_region ABCF3 1 83308 1.20036E-5 41654 0 NA
3-183905453-C-T p.Thr111Ile missense+splice_region ABCF3 2 83396 2.3982E-5 41698 0 3.97659E-6
3-183905467-A-C p.Lys116Gln missense ABCF3 1 83394 1.19913E-5 41697 0 8.2375E-6
3-183905473-G-A p.Glu118Lys missense ABCF3 2 83390 2.39837E-5 41695 0 NA
3-183905481-C-T p.Ala120Ala synonymous ABCF3 2 83396 2.3982E-5 41698 0 1.64745E-5
3-183905488-C-T p.Arg123* stop_gained ABCF3 1 83400 1.19904E-5 41700 0 3.97671E-6
3-183905491-C-A p.Leu124Ile missense ABCF3 2 83398 2.39814E-5 41699 0 3.97665E-6
3-183905513-G-A p.Arg131His missense ABCF3 3 83394 3.59738E-5 41697 0 5.03525E-4
3-183905522-A-G p.Lys134Arg missense ABCF3 4 83388 4.79685E-5 41694 0 7.95355E-6
3-183905528-C-T p.Thr136Met missense ABCF3 25 83386 2.99811E-4 41693 0 7.32437E-4
3-183905537-C-T p.Thr139Ile missense ABCF3 3 83372 3.59833E-5 41686 0 NA
3-183905544-C-T p.Asn141Asn synonymous ABCF3 1 83374 1.19941E-5 41687 0 3.18221E-5
3-183905545-C-T p.Pro142Ser missense ABCF3 1 83372 1.19944E-5 41686 0 8.23927E-6
3-183905548-C-T p.Leu143Leu splice_region+synonymous ABCF3 5 83376 5.99693E-5 41688 0 4.77312E-5
3-183905549-TGTGAGTGGGGGAAGCATGGCTCAGAAGAGAGCAGAGCAGCTTTTGCCTGGACAGAAGGTGGTGGGGAGCACTAAGAGCTGTCCATTTCTCCCTTTAAAG-T c.428+1_429-1delGTGAGTGGGGGAAGCATGGCTCAGAAGAGAGCAGAGCAGCTTTTGCCTGGACAGAAGGTGGTGGGGAGCACTAAGAGCTGTCCATTTCTCCCTTTAAAG splice_acceptor ABCF3 7 83378 8.3955E-5 41689 0 NA
3-183905556-G-C c.428+7G>C splice_region ABCF3 2 83370 2.39894E-5 41685 0 1.19336E-5
3-183905643-T-G c.429-6T>G splice_region ABCF3 3 83358 3.59893E-5 41679 0 8.26187E-6
3-183905645-A-G c.429-4A>G splice_region ABCF3 1 83360 1.19962E-5 41680 0 NA
3-183905648-G-GAT p.Val144fs frameshift ABCF3 1 83360 1.19962E-5 41680 0 NA
3-183905649-A-C p.Leu143Leu splice_region+synonymous ABCF3 1 83354 1.1997E-5 41677 0 8.26433E-6
3-183905650-G-A p.Val144Ile missense+splice_region ABCF3 19 83348 2.2796E-4 41674 0 6.25E-4
3-183905650-G-C p.Val144Leu missense+splice_region ABCF3 1 83346 1.19982E-5 41673 0 NA
3-183905652-C-T p.Val144Val synonymous ABCF3 2 83348 2.39958E-5 41674 0 NA
3-183905652-C-CCAA p.Val144_Leu145insGln conservative_inframe_insertion ABCF3 1 83346 1.19982E-5 41673 0 NA
3-183905662-G-T p.Ala148Ser missense ABCF3 1 83326 1.20011E-5 41663 0 3.97915E-6
3-183905671-A-G p.Ser151Gly missense ABCF3 1 83296 1.20054E-5 41648 0 NA
3-183905680-G-A p.Gly154Ser missense ABCF3 3 83250 3.6036E-5 41625 0 3.97988E-6
3-183905696-G-A p.Ser159Asn missense ABCF3 1 83128 1.20296E-5 41564 0 NA
3-183905698-C-T p.Arg160Trp missense ABCF3 1 83092 1.20349E-5 41546 0 1.65942E-5
3-183905706-A-G p.Glu162Glu synonymous ABCF3 1 83028 1.20441E-5 41514 0 3.1839E-5
3-183905710-T-G p.Ser164Ala missense ABCF3 5 82994 6.02453E-5 41497 0 1.91083E-4
3-183905712-T-C p.Ser164Ser synonymous ABCF3 1 82976 1.20517E-5 41488 0 NA
3-183905751-T-G p.Phe177Leu missense ABCF3 1 81732 1.22351E-5 40866 0 8.33333E-6
3-183905751-T-A p.Phe177Leu missense ABCF3 1 81732 1.22351E-5 40866 0 8.33333E-6
3-183905752-G-T p.Asp178Tyr missense ABCF3 2 81674 2.44876E-5 40837 0 NA
3-183905766-C-T p.Gly182Gly synonymous ABCF3 4 80400 4.97512E-5 40200 0 0.00151057
3-183905767-G-A p.Asp183Asn missense ABCF3 2 80428 2.4867E-5 40214 0 1.66875E-5
3-183905779-A-C c.551+8A>C splice_region ABCF3 877 79260 0.0110648 39630 17 0.0231514
3-183905942-G-A p.Gly189Arg missense ABCF3 1 81008 1.23445E-5 40504 0 NA
3-183905946-C-T p.Ala190Val missense ABCF3 1 81106 1.23295E-5 40553 0 8.28185E-6
3-183905947-G-A p.Ala190Ala synonymous ABCF3 2 81224 2.46233E-5 40612 0 9.55171E-5
3-183905949-A-T p.Asp191Val missense ABCF3 1 81362 1.22908E-5 40681 0 NA
3-183905962-A-T p.Ala195Ala synonymous ABCF3 2 81880 2.4426E-5 40940 0 2.22958E-4
3-183905963-T-C p.Trp196Arg missense ABCF3 1 81896 1.22106E-5 40948 0 NA
3-183905969-C-G p.Arg198Gly missense ABCF3 1 82114 1.21782E-5 41057 0 NA
3-183905970-G-A p.Arg198His missense ABCF3 1 82232 1.21607E-5 41116 0 3.18451E-5
3-183905970-G-T p.Arg198Leu missense ABCF3 2 82232 2.43214E-5 41116 0 1.19487E-5
3-183905973-G-A p.Arg199His missense ABCF3 2 82444 2.42589E-5 41222 0 0.00125
3-183905989-G-A p.Gly204Gly synonymous ABCF3 1 82834 1.20723E-5 41417 0 8.25328E-6
3-183905992-G-T p.Arg205Arg synonymous ABCF3 3 82910 3.61838E-5 41455 0 1.59189E-5
3-183905996-G-A p.Gly207Arg missense ABCF3 2 82980 2.41022E-5 41490 0 NA
3-183906012-C-T p.Thr212Met missense ABCF3 2 83134 2.40575E-5 41567 0 2.47337E-5
3-183906016-A-G p.Leu213Leu synonymous ABCF3 1 83176 1.20227E-5 41588 0 NA
3-183906030-C-G p.Ala218Gly missense ABCF3 1 83228 1.20152E-5 41614 0 8.24198E-6
3-183906031-C-A p.Ala218Ala synonymous ABCF3 1 83232 1.20146E-5 41616 0 3.9775E-6
3-183906036-G-A p.Arg220Gln missense ABCF3 4 83274 4.80342E-5 41637 0 NA
3-183906037-G-T p.Arg220Arg synonymous ABCF3 1 83280 1.20077E-5 41640 0 8.24185E-6
3-183906045-G-A p.Arg223Gln missense ABCF3 1 83278 1.2008E-5 41639 0 2.38646E-5
3-183906062-T-A p.Ser229Thr missense ABCF3 2 83284 2.40142E-5 41642 0 8.23995E-6
3-183906065-C-G p.Leu230Val missense ABCF3 1 83290 1.20062E-5 41645 0 8.23981E-6
3-183906067-G-A p.Leu230Leu synonymous ABCF3 1 83266 1.20097E-5 41633 0 NA
3-183906073-C-T p.His232His synonymous ABCF3 2 83246 2.40252E-5 41623 0 2.47219E-5
3-183906074-G-A p.Val233Ile missense ABCF3 6 83234 7.20859E-5 41617 0 4.37522E-5
3-183906082-A-G p.Gln235Gln synonymous ABCF3 1 83224 1.20158E-5 41612 0 8.24158E-6
3-183906097-T-C p.Asp240Asp synonymous ABCF3 3 83078 3.61106E-5 41539 0 3.97937E-6
3-183906107-G-T p.Ala244Ser missense ABCF3 3 82904 3.61864E-5 41452 0 5.03525E-4
3-183906122-C-T p.Leu249Leu synonymous ABCF3 1 82752 1.20843E-5 41376 0 8.25069E-6
3-183906125-G-A p.Glu250Lys missense ABCF3 1 82732 1.20872E-5 41366 0 3.18532E-5
3-183906135-G-T p.Ser253Ile missense ABCF3 8 82650 9.67937E-5 41325 0 5.03525E-4
3-183906145-G-A p.Glu256Glu synonymous ABCF3 1 82422 1.21327E-5 41211 0 NA
3-183906146-G-T p.Asp257Tyr missense ABCF3 4 82376 4.85578E-5 41188 0 2.39917E-5
3-183906147-A-T p.Asp257Val missense ABCF3 1 82346 1.21439E-5 41173 0 3.18552E-5
3-183906155-C-T p.Arg260Trp missense ABCF3 2 82142 2.43481E-5 41071 0 6.25E-4
3-183906156-G-A p.Arg260Gln missense ABCF3 3 82094 3.65435E-5 41047 0 8.30979E-5
3-183906158-A-G p.Arg261Gly missense ABCF3 1 82040 1.21892E-5 41020 0 NA
3-183906164-C-T p.Arg263Trp missense ABCF3 2 81938 2.44087E-5 40969 0 6.37105E-5
3-183906168-A-G p.Glu264Gly missense ABCF3 1 81954 1.2202E-5 40977 0 NA
3-183906178-C-G p.Ala267Ala synonymous ABCF3 1 81786 1.2227E-5 40893 0 1.67636E-5
3-183906179-C-G p.Gln268Glu missense ABCF3 4 81798 4.8901E-5 40899 0 6.37064E-5
3-183906180-A-G p.Gln268Arg missense ABCF3 1 81806 1.2224E-5 40903 0 NA
3-183906182-A-G p.Ile269Val missense ABCF3 3 81784 3.6682E-5 40892 0 NA
3-183906183-T-C p.Ile269Thr missense ABCF3 1 81804 1.22243E-5 40902 0 NA
3-183906184-T-G p.Ile269Met missense ABCF3 1 81794 1.22258E-5 40897 0 NA
3-183906190-T-C p.Ala271Ala synonymous ABCF3 1 81728 1.22357E-5 40864 0 8.44666E-6
3-183906449-C-T n.1230-3C>T splice_region ABCF3 2 79480 2.51636E-5 39740 0 NA
3-183906452-C-T n.1230C>T splice_region ABCF3 1 79744 1.25401E-5 39872 0 NA
3-183906466-A-T n.1236+8A>T splice_region ABCF3 2 80984 2.46962E-5 40492 0 NA
3-183906543-C-T c.819-6C>T splice_region ABCF3 1 82914 1.20607E-5 41457 0 NA
3-183906545-C-G c.819-4C>G splice_region ABCF3 3 82912 3.61829E-5 41456 0 3.99135E-6
3-183906545-C-A c.819-4C>A splice_region ABCF3 1 82914 1.20607E-5 41457 0 8.37254E-6
3-183906550-G-A p.Ala274Thr missense+splice_region ABCF3 1 82930 1.20584E-5 41465 0 8.36456E-6
3-183906551-C-T p.Ala274Val missense+splice_region ABCF3 11 82922 1.32655E-4 41461 0 1.91217E-4
3-183906552-G-A p.Ala274Ala synonymous ABCF3 26 82944 3.13464E-4 41472 0 6.58546E-4
3-183906560-C-G p.Ser277Cys missense ABCF3 1 82992 1.20494E-5 41496 0 8.35715E-6
3-183906578-C-T p.Ala283Val missense ABCF3 19 83012 2.28883E-4 41506 0 6.70327E-4
3-183906581-A-T p.Glu284Val missense ABCF3 1 83024 1.20447E-5 41512 0 2.39326E-5
3-183906587-A-C p.Tyr286Ser missense ABCF3 41 83014 4.93893E-4 41507 0 2.5933E-4
3-183906587-A-G p.Tyr286Cys missense ABCF3 1 83014 1.20462E-5 41507 0 8.35324E-6
3-183906591-C-T p.Ala287Ala synonymous ABCF3 1 83000 1.20482E-5 41500 0 3.99055E-6
3-183906593-A-G p.Lys288Arg missense ABCF3 1 83002 1.20479E-5 41501 0 1.67034E-5
3-183906603-G-A p.Glu291Glu synonymous ABCF3 10 82982 1.20508E-4 41491 0 3.18613E-5
3-183906605-T-C p.Ile292Thr missense ABCF3 1 82974 1.2052E-5 41487 0 6.37633E-5
3-183906615-C-T n.1014C>T splice_region ABCF3 1 82954 1.20549E-5 41477 0 8.35562E-6
3-183906620-C-G p.Ala297Gly missense ABCF3 1 82918 1.20601E-5 41459 0 3.18573E-5
3-183906627-CAGGTATTTAAAGCTCCCCCTCCCTCCTTCAGATTTCCTTTCCCTTCTGTGGACTGTTCCAACTGAGTTCTTCGATTTCTTCTCTACT-C p.Arg300fs frameshift ABCF3 14 82868 1.68943E-4 41434 7 NA
3-183906636-A-G c.899+7A>G splice_region ABCF3 1 82830 1.20729E-5 41415 0 NA
3-183906715-A-G c.900-2A>G splice_acceptor ABCF3 1 83202 1.20189E-5 41601 0 3.97817E-6
3-183906733-G-T p.Ala306Ser missense ABCF3 1 83276 1.20083E-5 41638 0 1.64902E-5
3-183906734-C-G p.Ala306Gly missense ABCF3 5 83302 6.00226E-5 41651 0 8.24498E-6
3-183906734-C-A p.Ala306Asp missense ABCF3 1 83302 1.20045E-5 41651 0 3.9775E-6
3-183906751-C-T p.Pro312Ser missense ABCF3 1 83358 1.19964E-5 41679 0 3.9764E-6
3-183906756-A-T p.Lys313Asn missense ABCF3 2 83362 2.39917E-5 41681 0 NA
3-183906770-C-G p.Pro318Arg missense ABCF3 2 83346 2.39964E-5 41673 0 NA
3-183906775-C-T p.Arg320Trp missense+splice_region ABCF3 11 83356 1.31964E-4 41678 0 0.00151057
3-183906775-CGGTGAGTGACCCTTGCCATTCTTGGCTTTGAACCCTGTTGTCTCAGCCCCTTCCTGCCCTGATGAACACCCACCCATAATGTGACTCCATCATTCTTTA-C p.Glu321fs frameshift ABCF3 6 83356 7.19804E-5 41678 3 NA
3-183906776-G-A p.Arg320Gln missense+splice_region ABCF3 1 83360 1.19962E-5 41680 0 4.11991E-5
3-183906869-T-C c.960-7T>C splice_region ABCF3 2 83262 2.40206E-5 41631 0 3.29766E-5
3-183906870-C-T c.960-6C>T splice_region ABCF3 1 83260 1.20106E-5 41630 0 7.42011E-5
3-183906909-C-G p.Ala331Ala synonymous ABCF3 2 83262 2.40206E-5 41631 0 NA
3-183906916-C-T p.Arg334Trp missense ABCF3 185 83270 0.00222169 41635 0 0.0014931
3-183906917-G-A p.Arg334Gln missense ABCF3 1 83262 1.20103E-5 41631 0 3.30289E-5
3-183906929-C-T p.Ala338Val missense ABCF3 1 83308 1.20036E-5 41654 0 NA
3-183906930-T-G p.Ala338Ala splice_region+synonymous ABCF3 1 83310 1.20034E-5 41655 0 3.98191E-6
3-183906931-AGGTGAGTCTCCTG-A c.1016+2_1016+14delTGAGTCTCCTGGG splice_donor ABCF3 2 83306 2.40079E-5 41653 1 NA
3-183907039-A-G c.1017-4A>G splice_region ABCF3 2 83356 2.39935E-5 41678 0 3.18695E-5
3-183907048-A-G p.Asp341Gly missense ABCF3 2 83352 2.39946E-5 41676 0 1.59051E-5
3-183907053-C-G p.Leu343Val missense ABCF3 2 83348 2.39958E-5 41674 0 NA
3-183907064-TGGTGAGTTTGAAATGGGGCACCCTGACTTTAGGATGGGCAGGGGTGGTAGCATCCAAGTTCCTAGTTCTCCAGCCCTTCAATCCCAAGTGTGTGCTCCCCTGCTTCTCCA-T c.1039+1_1040-1del splice_acceptor ABCF3 1 83346 1.19982E-5 41673 0 NA
3-183907170-C-T c.1040-6C>T splice_region ABCF3 1 83316 1.20025E-5 41658 0 2.47093E-5
3-183907201-G-A p.Arg355Arg synonymous ABCF3 1 83328 1.20008E-5 41664 0 NA
3-183907205-A-G p.Ile357Val missense ABCF3 2 83328 2.40015E-5 41664 0 2.47101E-5
3-183907228-GCAGGTGAGTGCCTGTGGGTGCTGGAGTGTGTTGGGGAAAGGCGGCCTCCAAGATACCTGGGGGCCTGAGAACTGACTGCCCTCCCAAACCGGGCCTGCTGTCCTGTGACCCCT-G c.1095+1_1096-1del splice_acceptor ABCF3 1 83296 1.20054E-5 41648 0 NA
3-183907231-G-A p.Gln365Gln splice_region+synonymous ABCF3 1 83300 1.20048E-5 41650 0 NA
3-183907232-G-A c.1095+1G>A splice_donor ABCF3 1 83290 1.20062E-5 41645 0 NA
3-183907239-C-T c.1095+8C>T splice_region ABCF3 2 83288 2.40131E-5 41644 0 3.18613E-5
3-183907338-C-T c.1096-7C>T splice_region ABCF3 1 83232 1.20146E-5 41616 0 NA
3-183907341-T-G c.1096-4T>G splice_region ABCF3 2 83240 2.40269E-5 41620 0 3.29527E-5
3-183907346-C-T p.Thr366Met missense+splice_region ABCF3 2 83226 2.4031E-5 41613 0 9.88614E-5
3-183907347-G-A p.Thr366Thr splice_region+synonymous ABCF3 4 83230 4.80596E-5 41615 0 3.18674E-5
3-183907352-C-G p.Pro368Arg missense ABCF3 2 83244 2.40258E-5 41622 0 3.97757E-6
3-183907355-C-T p.Ser369Phe missense ABCF3 6 83246 7.20755E-5 41623 0 6.59087E-5
3-183907369-G-A p.Val374Ile missense ABCF3 1 83222 1.20161E-5 41611 0 1.19316E-5
3-183907377-C-T p.His376His synonymous ABCF3 1 83246 1.20126E-5 41623 0 3.18471E-5
3-183907378-G-A p.Asp377Asn missense ABCF3 1 83226 1.20155E-5 41613 0 6.37308E-5
3-183907381-C-T p.Arg378Cys missense ABCF3 2 83224 2.40315E-5 41612 0 8.239E-6
3-183907382-G-A p.Arg378His missense ABCF3 2 83208 2.40361E-5 41604 0 3.18552E-5
3-183907383-C-G p.Arg378Arg synonymous ABCF3 3 83210 3.60534E-5 41605 0 1.64777E-5
3-183907385-A-G p.Asn379Ser missense ABCF3 3 83218 3.60499E-5 41609 0 1.31822E-4
3-183907399-A-G p.Ile384Val missense ABCF3 1 83200 1.20192E-5 41600 0 3.29571E-5
3-183907401-C-T p.Ile384Ile synonymous ABCF3 5 83202 6.00947E-5 41601 0 7.95444E-5
3-183907417-C-T p.His390Tyr missense ABCF3 2 83196 2.40396E-5 41598 0 1.19323E-5
3-183907419-C-T p.His390His synonymous ABCF3 1 83180 1.20221E-5 41590 0 NA
3-183907428-C-G p.Ser393Arg missense ABCF3 2 83174 2.4046E-5 41587 0 NA
3-183907433-G-A p.Arg395Gln missense ABCF3 6 83144 7.2164E-5 41572 0 4.94511E-5
3-183907446-C-T p.Tyr399Tyr synonymous ABCF3 1 83148 1.20267E-5 41574 0 NA
3-183907447-C-T p.Arg400Trp missense ABCF3 3 83140 3.60837E-5 41570 0 1.64995E-5
3-183907448-G-A p.Arg400Gln missense ABCF3 13 83138 1.56367E-4 41569 0 4.04224E-4
3-183907460-A-AGTAAGCAG p.Thr405fs frameshift ABCF3 1 83124 1.20302E-5 41562 0 NA
3-183907463-C-G p.Thr405Ser missense ABCF3 1 83128 1.20296E-5 41564 0 NA
3-183907468-A-G p.Ile407Val missense ABCF3 1 83128 1.20296E-5 41564 0 NA
3-183907475-G-A p.Ser409Asn missense ABCF3 16 83124 1.92484E-4 41562 0 1.83054E-4
3-183907486-C-T p.Arg413Trp missense ABCF3 1 83072 1.20378E-5 41536 0 5.79461E-5
3-183907500-G-C p.Gln417His missense ABCF3 2 83042 2.40842E-5 41521 0 3.18471E-5
3-183907504-C-T p.Arg419Cys missense ABCF3 1 83002 1.20479E-5 41501 0 1.19561E-5
3-183907505-G-A p.Arg419His missense ABCF3 2 83014 2.40923E-5 41507 0 5.03525E-4
3-183907517-C-T p.Ala423Val missense ABCF3 4 82966 4.82125E-5 41483 0 3.18492E-5
3-183907518-G-A p.Ala423Ala synonymous ABCF3 1 82948 1.20557E-5 41474 0 3.18471E-5
3-183907531-C-T p.Arg428Cys missense ABCF3 1 82992 1.20494E-5 41496 0 NA
3-183907535-A-G p.Gln429Arg missense ABCF3 2 82984 2.4101E-5 41492 0 6.36943E-5
3-183907542-CCAGGTGTGGGGCCTGGCAGGGCTGGGGGTCCCATCCCAGGGGTTCCAGAGTGGGGGATAGTGGGGGAATTTGACCAATGCCTACACTCCTCCACCTG-C p.Gln432del splice_donor ABCF3 15 83008 1.80705E-4 41504 7 NA
3-183907549-T-G c.1296+4T>G splice_region ABCF3 1 83000 1.20482E-5 41500 0 NA
3-183907553-G-T c.1296+8G>T splice_region ABCF3 1 83012 1.20465E-5 41506 0 8.29779E-6
3-183907636-C-T c.1297-7C>T splice_region ABCF3 3 83250 3.6036E-5 41625 0 3.1841E-5
3-183907637-C-A c.1297-6C>A splice_region ABCF3 1 83244 1.20129E-5 41622 0 NA
3-183907657-G-T p.Arg437Arg synonymous ABCF3 1 83250 1.2012E-5 41625 0 NA
3-183907693-G-A p.Gln449Gln synonymous ABCF3 2 83176 2.40454E-5 41588 1 3.97652E-6
3-183907704-A-G p.Lys453Arg missense ABCF3 1 83148 1.20267E-5 41574 0 NA
3-183907746-C-T n.656C>T splice_region ABCF3 1 82456 1.21277E-5 41228 0 8.33181E-6
3-183908777-CTT-C c.1374-9_1374-8delTT splice_region ABCF3 3 83370 3.59842E-5 41685 0 NA
3-183908783-C-T c.1374-4C>T splice_region ABCF3 3 83376 3.59816E-5 41688 0 3.18796E-5
3-183908808-C-G p.Asp465Glu missense ABCF3 4 83390 4.79674E-5 41695 0 1.65213E-4
3-183908809-A-G p.Lys466Glu missense ABCF3 1 83392 1.19916E-5 41696 0 3.97684E-6
3-183908821-G-A p.Val470Ile missense ABCF3 1 83404 1.19898E-5 41702 0 8.2511E-6
3-183908823-C-A p.Val470Val synonymous ABCF3 4 83404 4.79593E-5 41702 0 6.36983E-5
3-183908823-C-T p.Val470Val synonymous ABCF3 2 83404 2.39797E-5 41702 0 1.40255E-4
3-183908831-AGTAAGTGCTGGGCCAGTGGGGCTGGTGGGGAATTGCTTGCTTCCAGCTGCCCCCACATCCTCACCCCTACCTCCTGCAG-A c.1418+1_1419-1delGTAAGTGCTGGGCCAGTGGGGCTGGTGGGGAATTGCTTGCTTCCAGCTGCCCCCACATCCTCACCCCTACCTCCTGCAG splice_acceptor ABCF3 10 83406 1.19895E-4 41703 3 NA
3-183908905-C-G c.1419-6C>G splice_region ABCF3 1 83392 1.19916E-5 41696 0 NA
3-183908911-G-A p.Lys473Lys splice_region+synonymous ABCF3 1 83410 1.1989E-5 41705 0 3.97621E-6
3-183908925-T-C p.Phe478Ser missense ABCF3 4 83406 4.79582E-5 41703 0 1.27462E-4
3-183908937-C-G p.Ser482Trp missense ABCF3 2 83402 2.39802E-5 41701 0 NA
3-183908937-C-T p.Ser482Leu missense ABCF3 2 83402 2.39802E-5 41701 0 3.97621E-5
3-183908938-G-A p.Ser482Ser synonymous ABCF3 5 83398 5.99535E-5 41699 0 1.40019E-4
3-183908941-G-A p.Pro483Pro synonymous ABCF3 14 83394 1.67878E-4 41697 0 1.27429E-4
3-183908945-A-G p.Ile485Val missense ABCF3 21 83402 2.51793E-4 41701 0 1.27453E-4
3-183908950-G-T p.Leu486Leu synonymous ABCF3 1 83396 1.1991E-5 41698 0 NA
3-183908956-A-G p.Leu488Leu synonymous ABCF3 1 83394 1.19913E-5 41697 0 7.95241E-6
3-183908960-G-A p.Glu490Lys missense ABCF3 1 83396 1.1991E-5 41698 0 8.23642E-6
3-183908977-C-T p.Tyr495Tyr synonymous ABCF3 1 83398 1.19907E-5 41699 0 7.15717E-5
3-183908978-G-C p.Asp496His missense ABCF3 560 83394 0.00671511 41697 4 0.00907643
3-183908982-C-T p.Pro497Leu missense ABCF3 3175 83344 0.0380951 41672 70 0.06125
3-183908983-G-A p.Pro497Pro synonymous ABCF3 4 83392 4.79662E-5 41696 0 1.27389E-4
3-183908984-A-G p.Lys498Glu missense ABCF3 1 83392 1.19916E-5 41696 0 3.97627E-6
3-183908985-A-C p.Lys498Thr missense ABCF3 1 83390 1.19918E-5 41695 0 NA
3-183908989-C-T p.His499His synonymous ABCF3 8 83396 9.59279E-5 41698 0 0.001875
3-183908990-G-T p.Val500Phe missense ABCF3 1 83396 1.1991E-5 41698 0 3.18512E-5
3-183908998-C-T p.Phe502Phe synonymous ABCF3 1 83396 1.1991E-5 41698 0 7.95248E-6
3-183909000-G-T p.Ser503Ile missense ABCF3 8 83400 9.59233E-5 41700 0 5.03525E-4
3-183909002-C-T p.Arg504Cys missense ABCF3 9 83394 1.07921E-4 41697 0 6.36943E-5
3-183909003-G-A p.Arg504His missense ABCF3 539 83396 0.00646314 41698 11 0.0129986
3-183909007-C-T p.Leu505Leu synonymous ABCF3 3 83402 3.59704E-5 41701 0 3.18451E-5
3-183909010-T-C p.Ser506Ser synonymous ABCF3 1 83404 1.19898E-5 41702 0 NA
3-183909011-G-A p.Val507Met missense ABCF3 3 83406 3.59686E-5 41703 0 2.47093E-5
3-183909011-G-T p.Val507Leu missense ABCF3 1 83406 1.19895E-5 41703 0 8.23642E-6
3-183909013-G-C p.Val507Val synonymous ABCF3 2 83404 2.39797E-5 41702 0 NA
3-183909033-G-A p.Arg514His missense ABCF3 2 83372 2.39889E-5 41686 0 NA
3-183909040-T-C p.Cys516Cys synonymous ABCF3 8 83370 9.59578E-5 41685 0 4.94185E-5
3-183910400-T-C p.Asn521Asn synonymous ABCF3 3 82504 3.63619E-5 41252 0 8.98101E-6
3-183910419-A-G p.Met528Val missense ABCF3 1 82470 1.21256E-5 41235 0 4.0334E-6
3-183910431-C-T p.Leu532Phe missense ABCF3 20 82420 2.4266E-4 41210 0 5.09587E-4
3-183910439-G-A p.Gly534Gly synonymous ABCF3 1 82264 1.2156E-5 41132 0 6.37105E-5
3-183910448-A-G p.Ala537Ala synonymous ABCF3 2 82152 2.43451E-5 41076 0 1.62314E-5
3-183910455-C-T p.Arg540Trp missense ABCF3 1 82166 1.21705E-5 41083 0 6.25E-4
3-183910456-G-A p.Arg540Gln missense ABCF3 2 82146 2.43469E-5 41073 0 NA
3-183910465-G-C p.Arg543Thr missense ABCF3 2 82108 2.43582E-5 41054 0 6.37267E-5
3-183910467-C-T p.His544Tyr missense ABCF3 3 82054 3.65613E-5 41027 0 6.37389E-5
3-183910469-C-T p.His544His synonymous ABCF3 4 82006 4.87769E-5 41003 0 0.00125
3-183910470-G-A p.Ala545Thr missense ABCF3 3 81996 3.65871E-5 40998 0 2.68164E-5
3-183910474-ACAGGTCAGGCCCACCCGCACCCCTGCCCCCATGAGCACATTTGCAGGCACCCATGCTGCCTGCGCTCCTTCGTGGCCATTGCCTTTGTCTGTTTTTCCACCTCGGCTTCTGCCTG-A p.Asn548fs frameshift ABCF3 6 82006 7.31654E-5 41003 0 NA
3-183910475-C-T p.His546His splice_region+synonymous ABCF3 2 82030 2.43813E-5 41015 0 3.18613E-5
3-183910478-G-T c.1640+1G>T splice_donor ABCF3 1 81986 1.21972E-5 40993 0 1.79882E-5
3-183910585-G-A c.1641-8G>A splice_region ABCF3 1 82362 1.21415E-5 41181 0 8.28212E-6
3-183910589-G-T c.1641-4G>T splice_region ABCF3 1 82448 1.21289E-5 41224 0 NA
3-183910604-T-C p.Ile551Thr missense ABCF3 21 82572 2.54324E-4 41286 0 0.001875
3-183910605-T-A p.Ile551Ile synonymous ABCF3 1 82572 1.21106E-5 41286 0 3.97991E-6
3-183910607-G-T p.Gly552Val missense ABCF3 1 82544 1.21148E-5 41272 0 7.9614E-6
3-183910615-A-T p.Ser555Cys missense ABCF3 2 82568 2.42225E-5 41284 0 6.36862E-5
3-183910626-T-C p.His558His synonymous ABCF3 2 82644 2.42002E-5 41322 0 5.03525E-4
3-183910635-G-A p.Gln561Gln synonymous ABCF3 1 82654 1.20986E-5 41327 0 3.1837E-5
3-183910672-C-T p.Arg574Cys missense ABCF3 1 82748 1.20849E-5 41374 0 4.95991E-5
3-183910673-G-A p.Arg574His missense ABCF3 2 82740 2.41721E-5 41370 0 4.96015E-5
3-183910888-A-T c.1733-2A>T splice_acceptor ABCF3 2 83188 2.40419E-5 41594 1 NA
3-183910892-C-T p.Arg579Trp missense+splice_region ABCF3 2 83172 2.40466E-5 41586 0 2.71434E-5
3-183910893-G-A p.Arg579Gln missense ABCF3 1 83194 1.20201E-5 41597 0 1.06052E-5
3-183910910-C-T p.Arg585Cys missense ABCF3 10 83270 1.20091E-4 41635 0 2.25754E-4
3-183910911-G-A p.Arg585His missense ABCF3 4 83270 4.80365E-5 41635 0 9.57488E-5
3-183910925-C-T p.Arg590Trp missense ABCF3 5 83292 6.00298E-5 41646 0 8.11366E-5
3-183910926-G-A p.Arg590Gln missense ABCF3 9 83296 1.08048E-4 41648 0 9.91545E-5
3-183910939-C-T p.Ser594Ser synonymous ABCF3 6 83302 7.20271E-5 41651 0 1.17062E-4
3-183910940-G-A p.Gly595Arg missense ABCF3 1 83306 1.20039E-5 41653 0 3.18959E-5
3-183910948-G-C p.Leu597Leu synonymous ABCF3 1 83304 1.20042E-5 41652 0 NA
3-183910948-G-T p.Leu597Leu synonymous ABCF3 1 83304 1.20042E-5 41652 0 8.99523E-6
3-183910953-T-C p.Met599Thr missense ABCF3 1 83300 1.20048E-5 41650 0 1.41365E-5
3-183910955-C-T p.Arg600Cys missense ABCF3 1 83290 1.20062E-5 41645 0 6.37592E-5
3-183910956-G-A p.Arg600His missense ABCF3 2 83296 2.40108E-5 41648 0 9.56694E-5
3-183910971-T-C p.Leu605Pro missense ABCF3 1 83314 1.20028E-5 41657 0 NA
3-183910974-C-G p.Ser606Cys missense ABCF3 1 83312 1.20031E-5 41656 0 NA
3-183910975-T-TG p.Gln609fs frameshift ABCF3 1 83304 1.20042E-5 41652 0 NA
3-183910992-G-A p.Arg612Gln missense ABCF3 1 83292 1.2006E-5 41646 0 3.18898E-5
3-183910994-G-A p.Val613Met missense ABCF3 2 83290 2.40125E-5 41645 0 3.18756E-5
3-183910998-C-T p.Ala614Val missense ABCF3 2 83284 2.40142E-5 41642 1 NA
3-183911006-C-T p.Gln617* stop_gained ABCF3 1 83280 1.20077E-5 41640 0 NA
3-183911017-G-T p.Met620Ile missense ABCF3 3 83246 3.60378E-5 41623 0 4.67898E-6
3-183911029-C-G c.1865+7C>G splice_region ABCF3 1 83194 1.20201E-5 41597 0 4.65315E-6
3-183911030-C-T c.1865+8C>T splice_region ABCF3 3 83210 3.60534E-5 41605 0 9.2804E-6
3-183911145-C-G c.1866-8C>G splice_region ABCF3 1 82908 1.20616E-5 41454 0 3.98102E-6
3-183911146-C-T c.1866-7C>T splice_region ABCF3 1 82924 1.20592E-5 41462 0 NA
3-183911153-C-G p.Cys622Trp missense+splice_region ABCF3 1 82966 1.20531E-5 41483 0 2.38804E-5
3-183911186-C-T p.Asn633Asn synonymous ABCF3 1 83170 1.20236E-5 41585 0 NA
3-183911195-C-A p.Asp636Glu missense ABCF3 1 83220 1.20163E-5 41610 0 NA
3-183911196-AT-A p.Met637fs frameshift ABCF3 1 83232 1.20146E-5 41616 0 NA
3-183911205-A-G p.Ile640Val missense ABCF3 1 83248 1.20123E-5 41624 0 3.97731E-6
3-183911206-T-C p.Ile640Thr missense ABCF3 2 83244 2.40258E-5 41622 0 3.29484E-5
3-183911210-G-A p.Glu641Glu synonymous ABCF3 1 83256 1.20111E-5 41628 0 NA
3-183911220-C-T p.Arg645Cys missense ABCF3 1 83278 1.2008E-5 41639 0 8.23696E-6
3-183911221-G-A p.Arg645His missense ABCF3 3 83282 3.60222E-5 41641 0 6.37755E-5
3-183911230-A-G p.Asn648Ser missense ABCF3 1 83302 1.20045E-5 41651 0 3.97684E-6
3-183911237-C-T p.Phe650Phe synonymous ABCF3 1 83310 1.20034E-5 41655 0 3.18634E-5
3-183911239-GGGTGAGTGTGCCTTCACCCTGACCACTCCTCCCAGGCCTCGGTGCCTCTTGTGTCCCCCTGAGCACCTCCTGCCCTCCTGTCTTTCA-G p.Gly652fs frameshift ABCF3 13 83306 1.56051E-4 41653 5 NA
3-183911240-G-T p.Arg651Ser missense+splice_region ABCF3 1 83300 1.20048E-5 41650 0 NA
3-183911316-CCTGT-C c.1954-11_1954-8delCTGT splice_region ABCF3 2 83346 2.39964E-5 41673 0 NA
3-183911325-C-T c.1954-3C>T splice_region ABCF3 1 83360 1.19962E-5 41680 0 NA
3-183911345-G-A p.Val657Val synonymous ABCF3 8 83380 9.59463E-5 41690 0 9.55779E-5
3-183911347-C-G p.Ser658Cys missense ABCF3 1 83372 1.19944E-5 41686 0 7.959E-6
3-183911358-C-T p.Arg662Cys missense ABCF3 1 83386 1.19924E-5 41693 0 1.15359E-4
3-183911360-C-T p.Arg662Arg synonymous ABCF3 1 83386 1.19924E-5 41693 0 3.97836E-6
3-183911379-C-T p.Arg669Trp missense ABCF3 4 83354 4.79881E-5 41677 0 2.4717E-5
3-183911388-T-C p.Trp672Arg missense ABCF3 1 83346 1.19982E-5 41673 0 NA
3-183911393-A-G p.Val673Val synonymous ABCF3 1 83344 1.19985E-5 41672 0 6.37349E-5
3-183911393-A-C p.Val673Val synonymous ABCF3 1 83344 1.19985E-5 41672 0 8.23913E-6
3-183911397-G-A p.Glu675Lys missense ABCF3 5 83328 6.00038E-5 41664 0 6.37024E-5
3-183911405-C-T p.Gly677Gly synonymous ABCF3 1 83312 1.20031E-5 41656 0 3.18552E-5
3-183911406-G-T p.Gly678Cys missense ABCF3 3 83314 3.60084E-5 41657 0 5.57165E-5
3-183911406-G-A p.Gly678Ser missense ABCF3 2 83314 2.40056E-5 41657 0 3.1838E-5
3-183911409-G-A p.Val679Ile missense ABCF3 6 83298 7.20305E-5 41649 0 6.36943E-5
3-183911410-T-G p.Val679Gly missense ABCF3 2 83276 2.40165E-5 41638 0 8.24131E-6
3-183911415-C-T p.Arg681Cys missense ABCF3 25 83260 3.00264E-4 41630 0 0.00151057
3-183911416-G-A p.Arg681His missense ABCF3 23 83244 2.76296E-4 41622 0 7.00548E-4
3-183911417-T-C p.Arg681Arg synonymous ABCF3 2 83232 2.40292E-5 41616 0 3.18436E-5
3-183911442-C-T p.Arg690Cys missense ABCF3 4 83018 4.81823E-5 41509 0 6.25E-4
3-183911443-G-A p.Arg690His missense ABCF3 1 82976 1.20517E-5 41488 0 3.18593E-5
3-183911444-C-T p.Arg690Arg synonymous ABCF3 5 82972 6.02613E-5 41486 0 4.16431E-5
3-183911445-G-A p.Ala691Thr missense ABCF3 4 82934 4.82311E-5 41467 0 5.73541E-4
3-183911451-C-T p.Leu693Phe missense ABCF3 1 82904 1.20621E-5 41452 0 8.39941E-6
3-183911465-C-T p.Phe697Phe synonymous ABCF3 2287 82680 0.0276609 41340 35 0.0304869
3-183911466-C-T p.Arg698Cys missense ABCF3 5 82690 6.04668E-5 41345 0 4.78689E-5
3-183911467-G-A p.Arg698His missense ABCF3 2 82666 2.41937E-5 41333 0 0.00100705
3-183911467-G-T p.Arg698Leu missense ABCF3 3 82666 3.62906E-5 41333 0 9.75229E-6
3-183911469-C-T p.Arg699Cys missense ABCF3 2 82626 2.42055E-5 41313 0 6.37024E-5
3-183911470-G-A p.Arg699His missense ABCF3 13 82592 1.574E-4 41296 0 1.10057E-4
3-183911472-G-A p.Glu700Lys missense ABCF3 1 82544 1.21148E-5 41272 0 1.0239E-5
3-183911477-C-T p.Gly701Gly synonymous ABCF3 3 82462 3.63804E-5 41231 0 NA
3-183911788-C-T n.1358C>T splice_region ABCF3 1 51664 1.93558E-5 25832 0 NA
3-183911790-C-T n.1360C>T splice_region ABCF3 1 50990 1.96117E-5 25495 0 NA
3-183911795-C-T c.*309C>T splice_region ABCF3 4 49960 8.0064E-5 24980 0 3.18552E-5