Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
7-150905159-A-G p.Ter635Argext*? stop_lost ABCF2 3 79556 3.77093E-5 39778 0 1.65322E-5
7-150905167-G-A p.Pro632Leu missense ABCF2 236 78104 0.00302161 39052 1 0.00805639
7-150905171-G-A p.Leu631Leu synonymous ABCF2 2 77154 2.59222E-5 38577 0 3.99524E-6
7-150905172-A-G p.Ser630Ser synonymous ABCF2 1 76870 1.3009E-5 38435 0 8.27787E-6
7-150905176-G-A p.Ala629Val missense ABCF2 8 75938 1.05349E-4 37969 0 6.37024E-5
7-150905178-C-T p.Leu628Leu synonymous ABCF2 1 75532 1.32394E-5 37766 0 6.80261E-5
7-150905180-A-C p.Leu628Val missense ABCF2 1 75100 1.33156E-5 37550 0 4.00282E-6
7-150905181-T-C p.Thr627Thr synonymous ABCF2 2 74884 2.6708E-5 37442 0 4.00436E-6
7-150905193-C-CACGTTGTGGGTCCTCTTGGTGAGCTGGGGCTCCTCAT c.1869-1_1869insATGAGGAGCCCCAGCTCACCAAGAGGACCCACAACGT splice_acceptor ABCF2 1 70502 1.4184E-5 35251 0 NA
7-150905193-C-CACGTTGTGGGTCCTCTTGGTGAG c.1869-1_1869insCTCACCAAGAGGACCCACAACGT splice_acceptor ABCF2 1 70504 1.41836E-5 35252 0 NA
7-150911145-C-T p.Val623Met missense+splice_region ABCF2 8 83298 9.60407E-5 41649 0 0.00100705
7-150911145-C-A p.Val623Leu missense+splice_region ABCF2 2 83298 2.40102E-5 41649 0 8.24239E-6
7-150911152-G-C p.Thr620Thr synonymous ABCF2 1 83340 1.1999E-5 41670 0 1.64823E-5
7-150911154-T-A p.Thr620Ser missense ABCF2 1 83356 1.19967E-5 41678 0 NA
7-150911155-C-T p.Arg619Arg synonymous ABCF2 3 83360 3.59885E-5 41680 0 5.76825E-5
7-150911161-G-A p.Thr617Thr synonymous ABCF2 1 83372 1.19944E-5 41686 0 8.23968E-6
7-150911164-G-A p.Leu616Leu synonymous ABCF2 90 83368 0.00107955 41684 0 0.0018797
7-150911179-A-G p.Asp611Asp synonymous ABCF2 1 83388 1.19921E-5 41694 0 8.23845E-6
7-150911215-C-T p.Leu599Leu synonymous ABCF2 1 83390 1.19918E-5 41695 0 5.03525E-4
7-150911225-C-T p.Gly596Glu missense ABCF2 5 83378 5.99679E-5 41689 0 7.41327E-5
7-150911274-C-T p.Ala580Thr missense ABCF2 1 83204 1.20187E-5 41602 0 NA
7-150911958-G-T c.1734+7C>A splice_region ABCF2 1 82740 1.20861E-5 41370 0 NA
7-150911994-C-T p.Val569Ile missense ABCF2 1 83138 1.20282E-5 41569 0 1.59091E-5
7-150911995-C-A p.Leu568Leu synonymous ABCF2 1 83160 1.2025E-5 41580 0 NA
7-150912002-A-G p.Met566Thr missense ABCF2 1 83188 1.2021E-5 41594 0 NA
7-150912017-T-C p.Glu561Gly missense ABCF2 2 83192 2.40408E-5 41596 1 NA
7-150912020-T-C p.Asn560Ser missense ABCF2 280 83194 0.00336563 41597 1 0.005625
7-150912040-G-A p.Asp553Asp synonymous ABCF2 1 83252 1.20117E-5 41626 0 9.55657E-5
7-150912043-G-A p.Ile552Ile synonymous ABCF2 1 83270 1.20091E-5 41635 0 3.18552E-5
7-150912052-G-A p.Ile549Ile synonymous ABCF2 16 83258 1.92174E-4 41629 0 2.55687E-4
7-150912067-G-A p.Thr544Thr synonymous ABCF2 4 83256 4.80446E-5 41628 0 5.03525E-4
7-150912069-T-C p.Thr544Ala missense ABCF2 1 83260 1.20106E-5 41630 0 NA
7-150912078-C-T p.Asp541Asn missense ABCF2 1 83220 1.20163E-5 41610 0 NA
7-150912085-G-A p.Leu538Leu synonymous ABCF2 2 83186 2.40425E-5 41593 0 NA
7-150912092-T-TG p.His536fs frameshift ABCF2 1 83150 1.20265E-5 41575 0 NA
7-150912101-T-TGCCAGGCCA p.Leu530_Trp532dup conservative_inframe_insertion ABCF2 1 83126 1.20299E-5 41563 0 NA
7-150912115-G-C p.Ala528Ala synonymous ABCF2 1 83026 1.20444E-5 41513 0 1.68288E-5
7-150912118-C-T p.Leu527Leu synonymous ABCF2 4 83002 4.81916E-5 41501 0 3.18451E-5
7-150912120-G-A p.Leu527Leu synonymous ABCF2 2 82982 2.41016E-5 41491 0 4.25807E-5
7-150912131-C-T p.Cys523Tyr missense ABCF2 1 82842 1.20712E-5 41421 0 3.98877E-6
7-150912142-G-A p.Asp519Asp synonymous ABCF2 2 82630 2.42043E-5 41315 0 3.19829E-5
7-150912155-C-T p.Arg515Gln missense ABCF2 1 82242 1.21592E-5 41121 0 1.60896E-5
7-150912166-C-T p.Val511Val splice_region+synonymous ABCF2 2 82162 2.43422E-5 41081 0 NA
7-150912168-C-T p.Val511Met missense+splice_region ABCF2 1 82138 1.21746E-5 41069 0 4.06316E-6
7-150912172-A-G c.1531-4T>C splice_region ABCF2 1 82056 1.21868E-5 41028 0 NA
7-150912684-A-G c.1530+6T>C splice_region ABCF2 1 83172 1.20233E-5 41586 0 NA
7-150912688-A-G c.1530+2T>C splice_donor ABCF2 1 83208 1.20181E-5 41604 0 1.59101E-5
7-150912721-A-G p.Ile500Thr missense ABCF2 1 83314 1.20028E-5 41657 0 8.23669E-6
7-150912725-T-G p.Ile499Leu missense ABCF2 2 83316 2.4005E-5 41658 0 8.23655E-6
7-150912725-T-C p.Ile499Val missense ABCF2 1 83316 1.20025E-5 41658 0 3.9763E-6
7-150912750-G-T p.Ile490Ile synonymous ABCF2 6471 83210 0.0777671 41605 267 0.0854189
7-150912762-G-A p.Cys486Cys synonymous ABCF2 1 83330 1.20005E-5 41665 0 NA
7-150912764-A-C p.Cys486Gly missense ABCF2 1 83330 1.20005E-5 41665 0 8.23642E-6
7-150912774-G-A p.Tyr482Tyr synonymous ABCF2 4 83336 4.79985E-5 41668 0 3.18512E-5
7-150912775-T-A p.Tyr482Phe missense ABCF2 1 83330 1.20005E-5 41665 0 NA
7-150912786-T-C p.Ser478Ser synonymous ABCF2 7780 83124 0.0935951 41562 382 0.102078
7-150912786-T-G p.Ser478Ser synonymous ABCF2 1 83314 1.20028E-5 41657 0 8.23655E-6
7-150912794-C-G p.Asp476His missense ABCF2 1 83294 1.20057E-5 41647 0 1.193E-5
7-150912798-G-A p.Asp474Asp synonymous ABCF2 3 83288 3.60196E-5 41644 0 6.25E-4
7-150912810-T-C p.Gln470Gln synonymous ABCF2 2 83250 2.4024E-5 41625 0 NA
7-150912820-TAC-T c.1402-4_1402-3delGT splice_region ABCF2 8 83198 9.61562E-5 41599 0 1.27413E-4
7-150912820-T-TGATGGTAACGCCCTATCTTG c.1402-3_1402-2insCAAGATAGGGCGTTACCATC splice_region ABCF2 2 83198 2.4039E-5 41599 1 NA
7-150913045-G-A c.1401+8C>T splice_region ABCF2 2 83152 2.40523E-5 41576 0 3.18471E-5
7-150913056-A-G p.His466His synonymous ABCF2 3 83204 3.6056E-5 41602 0 NA
7-150913063-C-T p.Arg464His missense ABCF2 3 83206 3.60551E-5 41603 0 6.36862E-5
7-150913064-G-A p.Arg464Cys missense ABCF2 1 83218 1.20166E-5 41609 0 NA
7-150913065-C-A p.Gly463Gly synonymous ABCF2 1 83220 1.20163E-5 41610 0 3.18532E-5
7-150913078-T-C p.His459Arg missense ABCF2 1 83194 1.20201E-5 41597 0 NA
7-150913083-G-A p.His457His synonymous ABCF2 2 83190 2.40414E-5 41595 0 5.96493E-5
7-150913091-G-A p.Arg455* stop_gained ABCF2 2 83160 2.405E-5 41580 0 NA
7-150913117-T-TCTCC c.1339-3_1339-2insGGAG splice_region ABCF2 1 82894 1.20636E-5 41447 0 NA
7-150915163-A-G c.1338+4T>C splice_region ABCF2 1 83276 1.20083E-5 41638 0 3.18593E-5
7-150915179-C-T p.Leu442Leu synonymous ABCF2 1 83332 1.20002E-5 41666 0 8.25887E-6
7-150915204-G-C p.Ala434Gly missense ABCF2 1 83344 1.19985E-5 41672 0 3.97725E-6
7-150915212-G-A p.Pro431Pro synonymous ABCF2 3 83346 3.59945E-5 41673 0 2.231E-4
7-150915234-G-A p.Thr424Ile missense ABCF2 1 83342 1.19988E-5 41671 0 NA
7-150915236-G-A p.Asp423Asp synonymous ABCF2 1 83336 1.19996E-5 41668 0 3.18451E-5
7-150915239-A-G p.Leu422Leu synonymous ABCF2 2 83334 2.39998E-5 41667 0 3.18573E-5
7-150915240-A-G p.Leu422Pro missense ABCF2 2 83336 2.39992E-5 41668 0 NA
7-150915269-G-A p.Ile412Ile synonymous ABCF2 1 83234 1.20143E-5 41617 0 NA
7-150915278-C-CCCATCTTT c.1228-2_1228-1insAAAGATGG splice_acceptor ABCF2 1 83164 1.20244E-5 41582 0 NA
7-150915278-C-CCCATCTTTTGTATACTTGAAGCTCACATT c.1228-2_1228-1insAATGTGAGCTTCAAGTATACAAAAGATGG splice_acceptor ABCF2 1 83164 1.20244E-5 41582 0 NA
7-150915278-C-CCCATCTT c.1228-2_1228-1insAAGATGG splice_acceptor ABCF2 1 83164 1.20244E-5 41582 0 NA
7-150915282-G-A c.1228-5C>T splice_region ABCF2 1 83120 1.20308E-5 41560 0 NA
7-150915645-A-T c.1227+2T>A splice_donor ABCF2 1 82996 1.20488E-5 41498 0 NA
7-150915659-A-G p.Tyr405Tyr synonymous ABCF2 1 83158 1.20253E-5 41579 0 1.19326E-5
7-150915674-A-G p.Asn400Asn synonymous ABCF2 1 83254 1.20114E-5 41627 0 NA
7-150915680-C-T p.Val398Val synonymous ABCF2 2 83264 2.402E-5 41632 0 5.03525E-4
7-150915683-CATA-C p.Ile396del disruptive_inframe_deletion ABCF2 1 83276 1.20083E-5 41638 0 NA
7-150915736-TCTAGGAAGAAAAGAGGGCATTTATCAAGTTGGCTCCTTTCTTATCCACCTCACCTTAGGCCACCCAACCCCACCCAATCACACCCCACCCAATCACACCCCAC-T c.1137+1_1138-1del splice_acceptor ABCF2 4 83288 4.80261E-5 41644 0 NA
7-150915743-AG-A c.1138-8delC splice_region ABCF2 1 83268 1.20094E-5 41634 0 3.97763E-6
7-150915835-C-T c.1137+5G>A splice_region ABCF2 1 83280 1.20077E-5 41640 0 3.97867E-6
7-150915841-T-G p.Lys379Thr missense+splice_region ABCF2 1 83296 1.20054E-5 41648 0 NA
7-150915845-C-T p.Asp378Asn missense ABCF2 1 83294 1.20057E-5 41647 0 NA
7-150915846-G-A p.Ser377Ser synonymous ABCF2 3 83292 3.60179E-5 41646 0 3.29533E-5
7-150915851-C-T p.Val376Met missense ABCF2 3 83312 3.60092E-5 41656 0 5.03525E-4
7-150915852-G-A p.Val375Val synonymous ABCF2 28 83302 3.36126E-4 41651 0 7.69527E-4
7-150915852-G-C p.Val375Val synonymous ABCF2 1 83302 1.20045E-5 41651 0 1.19334E-5
7-150915855-C-G p.Arg374Ser missense ABCF2 1 83334 1.19999E-5 41667 0 8.23696E-6
7-150915864-C-T p.Leu371Leu synonymous ABCF2 2 83340 2.39981E-5 41670 0 2.78374E-5
7-150915865-A-C p.Leu371Arg missense ABCF2 1 83334 1.19999E-5 41667 0 NA
7-150915882-T-C p.Lys365Lys synonymous ABCF2 1 83360 1.19962E-5 41680 0 NA
7-150915891-C-T p.Thr362Thr synonymous ABCF2 1 83348 1.19979E-5 41674 0 1.64739E-5
7-150915892-G-A p.Thr362Met missense ABCF2 2 83356 2.39935E-5 41678 0 1.64747E-5
7-150915915-C-T p.Arg354Arg synonymous ABCF2 2 83318 2.40044E-5 41659 0 3.1953E-5
7-150915918-G-A p.Ala353Ala synonymous ABCF2 4 83308 4.80146E-5 41654 0 6.25E-4
7-150915918-G-C p.Ala353Ala synonymous ABCF2 3 83308 3.60109E-5 41654 0 NA
7-150915937-T-C p.His347Arg missense ABCF2 1 83278 1.2008E-5 41639 0 NA
7-150915946-C-T p.Arg344Lys missense ABCF2 1 83256 1.20111E-5 41628 0 7.96128E-6
7-150915948-C-T p.Ala343Ala synonymous ABCF2 7940 83092 0.0955567 41546 419 0.0964787
7-150915954-G-A p.Tyr341Tyr synonymous ABCF2 5 83214 6.0086E-5 41607 0 9.55848E-5
7-150915961-T-TTCATGTGTGC c.1018-3_1018-2insGCACACATGA splice_region ABCF2 1 83166 1.20241E-5 41583 0 NA
7-150916159-T-A p.Ala336Ala synonymous ABCF2 1 83362 1.19959E-5 41681 0 8.23683E-6
7-150916162-A-C p.Ile335Met missense ABCF2 1 83366 1.19953E-5 41683 0 3.97646E-6
7-150916163-A-G p.Ile335Thr missense ABCF2 2 83366 2.39906E-5 41683 0 NA
7-150916193-A-T p.Met325Lys missense ABCF2 1 83364 1.19956E-5 41682 0 NA
7-150916195-C-G p.Gln324His missense ABCF2 1 83364 1.19956E-5 41682 0 NA
7-150916195-C-T p.Gln324Gln synonymous ABCF2 1 83364 1.19956E-5 41682 0 3.97652E-6
7-150916207-C-T p.Leu320Leu synonymous ABCF2 1 83354 1.1997E-5 41677 0 3.18532E-5
7-150916209-G-A p.Leu320Leu synonymous ABCF2 2 83356 2.39935E-5 41678 0 3.18552E-5
7-150916219-C-T p.Thr316Thr synonymous ABCF2 2 83332 2.40004E-5 41666 0 3.18674E-5
7-150916228-G-A p.Tyr313Tyr synonymous ABCF2 32759 82364 0.397734 41182 6663 0.418707
7-150916229-T-C p.Tyr313Cys missense ABCF2 1 83320 1.20019E-5 41660 0 NA
7-150916230-A-G p.Tyr313His missense ABCF2 1 83320 1.20019E-5 41660 0 NA
7-150916237-A-G p.Tyr310Tyr synonymous ABCF2 2 83306 2.40079E-5 41653 0 NA
7-150916238-T-C p.Tyr310Cys missense ABCF2 1 83302 1.20045E-5 41651 0 NA
7-150916242-T-C p.Asn309Asp missense ABCF2 2 83288 2.40131E-5 41644 0 3.29495E-5
7-150916245-C-CCGTATAATA c.922-1_922insTATTATACG splice_acceptor ABCF2 1 83274 1.20085E-5 41637 0 NA
7-150916246-C-CGTATAATACTTCAGTTTCT c.922-2_922-1insAGAAACTGAAGTATTATAC splice_acceptor ABCF2 4 83274 4.80342E-5 41637 1 NA
7-150916246-C-CGTATAATACTTCAGTT c.922-2_922-1insAACTGAAGTATTATAC splice_acceptor ABCF2 1 83274 1.20085E-5 41637 0 NA
7-150916246-C-CGTATAATACTTCAGTTTCTTGTTG c.922-2_922-1insCAACAAGAAACTGAAGTATTATAC splice_acceptor ABCF2 1 83274 1.20085E-5 41637 0 NA
7-150918664-C-T p.Thr307Thr splice_region+synonymous ABCF2 1 83000 1.20482E-5 41500 0 8.23913E-6
7-150918665-G-A p.Thr307Met missense+splice_region ABCF2 1 82998 1.20485E-5 41499 0 6.39795E-5
7-150918667-A-C p.Tyr306* stop_gained ABCF2 1 83050 1.20409E-5 41525 0 NA
7-150918685-G-A p.Asn300Asn synonymous ABCF2 3 83166 3.60724E-5 41583 0 6.38692E-5
7-150918695-T-TG p.His297fs frameshift ABCF2 3 83216 3.60508E-5 41608 0 NA
7-150918697-AATG-A p.Ile296del disruptive_inframe_deletion ABCF2 1 83222 1.20161E-5 41611 0 NA
7-150918704-T-C p.Asn294Ser missense ABCF2 4 83228 4.80607E-5 41614 0 3.18756E-5
7-150918706-G-A p.Thr293Thr synonymous ABCF2 1 83220 1.20163E-5 41610 0 6.37755E-5
7-150918707-G-A p.Thr293Ile missense ABCF2 1 83226 1.20155E-5 41613 0 NA
7-150918723-G-A p.???288??? splice_region+synonymous ABCF2 1 83238 1.20137E-5 41619 0 4.37459E-5
7-150918744-C-T p.Val281Ile missense ABCF2 6 83238 7.20825E-5 41619 0 6.7602E-5
7-150918747-G-C p.Leu280Val missense ABCF2 1 83244 1.20129E-5 41622 0 8.23764E-6
7-150918751-C-A p.Leu278Phe missense ABCF2 1 83244 1.20129E-5 41622 0 NA
7-150918766-A-AGTTTTTAGTT c.819-1_819insAACTAAAAAC splice_acceptor ABCF2 6 83176 7.21362E-5 41588 2 NA
7-150918769-G-A c.819-3C>T splice_region ABCF2 20 83126 2.40599E-4 41563 0 0.001875
7-150919604-T-TA c.818+2_818+3insT splice_donor ABCF2 1 83202 1.20189E-5 41601 0 3.18654E-5
7-150919633-G-A p.Cys264Cys synonymous ABCF2 2 83334 2.39998E-5 41667 0 1.64756E-5
7-150919684-G-A p.Pro247Pro synonymous ABCF2 3 83322 3.60049E-5 41661 0 NA
7-150919705-GA-G c.723-4delT splice_region ABCF2 1 83240 1.20135E-5 41620 0 1.66254E-5
7-150919707-A-G c.723-5T>C splice_region ABCF2 804 83190 0.00966462 41595 24 0.021516
7-150919709-G-C c.723-7C>G splice_region ABCF2 1 83196 1.20198E-5 41598 0 NA
7-150920757-G-T c.722+7C>A splice_region ABCF2 1 67494 1.48161E-5 33747 0 NA
7-150920773-G-A p.Ala238Val missense ABCF2 1 70452 1.41941E-5 35226 0 8.97135E-6
7-150920790-G-A p.Gly232Gly synonymous ABCF2 2 73620 2.71665E-5 36810 0 1.74993E-5
7-150920802-G-A p.Asp228Asp synonymous ABCF2 3 75336 3.98216E-5 37668 0 2.81335E-5
7-150920815-T-A p.Lys224Met missense ABCF2 644 76902 0.00837429 38451 26 0.0194636
7-150920818-C-T p.Arg223His missense ABCF2 7 77154 9.07276E-5 38577 0 1.02724E-4
7-150920819-G-A p.Arg223Cys missense ABCF2 2 77228 2.58973E-5 38614 0 2.86716E-4
7-150920821-T-C p.Gln222Arg missense ABCF2 2 77720 2.57334E-5 38860 0 NA
7-150920835-G-A p.Phe217Phe synonymous ABCF2 15 78716 1.90558E-4 39358 0 1.59347E-4
7-150920841-C-T p.Leu215Leu synonymous ABCF2 1 79034 1.26528E-5 39517 0 NA
7-150920847-A-G p.His213His synonymous ABCF2 14 79514 1.7607E-4 39757 0 0.00151057
7-150920847-A-C p.His213Gln missense ABCF2 1 79518 1.25758E-5 39759 0 NA
7-150920857-C-T p.Arg210Gln missense ABCF2 1 79976 1.25038E-5 39988 0 8.45609E-6
7-150920859-C-T p.Ser209Ser synonymous ABCF2 4 80098 4.99388E-5 40049 1 7.59824E-5
7-150920862-G-T p.Ala208Ala synonymous ABCF2 1 80376 1.24415E-5 40188 0 0.00100705
7-150920863-G-A p.Ala208Val missense ABCF2 1 80390 1.24394E-5 40195 0 NA
7-150920869-A-G p.Met206Thr missense ABCF2 1 80748 1.23842E-5 40374 0 6.37186E-5
7-150920871-C-G p.Glu205Asp missense ABCF2 1 80838 1.23704E-5 40419 0 NA
7-150920880-G-T p.Asp202Glu missense ABCF2 1 81030 1.23411E-5 40515 0 NA
7-150920882-C-T p.Asp202Asn missense ABCF2 4 81074 4.93376E-5 40537 0 6.25E-4
7-150920883-G-A p.Ala201Ala synonymous ABCF2 1 81052 1.23378E-5 40526 0 3.18593E-5
7-150920891-G-A p.Leu199Leu synonymous ABCF2 1394 81218 0.0171637 40609 19 0.0187958
7-150920907-G-A p.Tyr193Tyr synonymous ABCF2 4 81372 4.9157E-5 40686 0 3.10283E-4
7-150920919-G-A p.Leu189Leu synonymous ABCF2 428 81556 0.00524793 40778 2 0.011722
7-150920930-A-G p.Cys186Arg missense ABCF2 4 81524 4.90653E-5 40762 0 3.19061E-5
7-150920935-G-A p.Ala184Val missense+splice_region ABCF2 12 81458 1.47315E-4 40729 0 1.00457E-4
7-150920935-GCTGTGGACAGTGTATGGCCATGAGGCTCCTGGGGGCCTTTCTGGGAGGACGCCCACCCCTATGCCCAGGTCTGGAGCCCTAC-G c.550+1_551-1delGTAGGGCTCCAGACCTGGGCATAGGGGTGGGCGTCCTCCCAGAAAGGCCCCCAGGAGCCTCATGGCCATACACTGTCCACAG splice_acceptor ABCF2 11 81456 1.35042E-4 40728 5 NA
7-150920940-G-A c.551-5C>T splice_region ABCF2 1 81520 1.22669E-5 40760 0 NA
7-150921019-A-G p.Asp183Asp splice_region+synonymous ABCF2 1 81278 1.23035E-5 40639 0 NA
7-150921022-C-T p.Glu182Glu synonymous ABCF2 1 81352 1.22923E-5 40676 0 NA
7-150921025-A-G p.His181His synonymous ABCF2 1 81356 1.22917E-5 40678 0 NA
7-150921035-C-T p.Arg178Gln missense ABCF2 1 81562 1.22606E-5 40781 0 3.30109E-5
7-150921036-G-T p.Arg178Arg synonymous ABCF2 1 81602 1.22546E-5 40801 0 7.98677E-6
7-150921043-C-T p.Glu175Glu synonymous ABCF2 2 81974 2.4398E-5 40987 0 NA
7-150921056-A-T p.Met171Lys missense ABCF2 2 82270 2.43102E-5 41135 0 3.29859E-5
7-150921072-C-T p.Asp166Asn missense ABCF2 2 82580 2.42189E-5 41290 0 5.03525E-4
7-150921073-G-C p.Val165Val synonymous ABCF2 2 82618 2.42078E-5 41309 0 NA
7-150921073-G-A p.Val165Val synonymous ABCF2 2 82618 2.42078E-5 41309 0 2.47292E-5
7-150921110-G-A p.Pro153Leu missense ABCF2 2 83114 2.40633E-5 41557 0 NA
7-150921113-G-A p.Pro152Leu missense ABCF2 3 83120 3.60924E-5 41560 0 3.18654E-5
7-150921122-C-T p.Arg149Gln missense ABCF2 1 83168 1.20239E-5 41584 0 6.25E-4
7-150921123-G-C p.Arg149Gly missense ABCF2 2 83176 2.40454E-5 41588 0 3.97782E-6
7-150921152-G-A p.Pro139Leu missense ABCF2 1 83292 1.2006E-5 41646 0 NA
7-150921154-G-T p.Ile138Ile synonymous ABCF2 1 83298 1.20051E-5 41649 0 NA
7-150921169-C-A p.Lys133Asn missense ABCF2 7 83302 8.40316E-5 41651 0 5.03525E-4
7-150921176-A-G p.Ile131Thr missense ABCF2 1 83290 1.20062E-5 41645 0 NA
7-150921177-T-C p.Ile131Val missense ABCF2 3 83288 3.60196E-5 41644 0 4.94511E-5
7-150921178-A-T p.Ala130Ala synonymous ABCF2 1 83288 1.20065E-5 41644 0 NA
7-150921182-G-C p.Ser129Cys missense ABCF2 4 83278 4.80319E-5 41639 0 6.25E-4
7-150921182-G-T p.Ser129Tyr missense ABCF2 2 83278 2.40159E-5 41639 0 NA
7-150921192-T-C p.Met126Val missense ABCF2 1 83248 1.20123E-5 41624 0 3.18898E-5
7-150921201-C-CAATTCCATTTAAACCAATGAGGCCATAACGACGGCCTGAGTT c.368-2_368-1insAACTCAGGCCGTCGTTATGGCCTCATTGGTTTAAATGGAATT splice_acceptor ABCF2 2 83222 2.40321E-5 41611 1 NA
7-150921201-C-CAATTCCATTTAAACCAATGAGGCCATAACGACGGCCTGAGTTTAA c.368-2_368-1insTTAAACTCAGGCCGTCGTTATGGCCTCATTGGTTTAAATGGAATT splice_acceptor ABCF2 1 83220 1.20163E-5 41610 0 NA
7-150921208-G-A c.368-8C>T splice_region ABCF2 1 83142 1.20276E-5 41571 0 NA
7-150921864-A-G p.Ile122Thr missense+splice_region ABCF2 1 83336 1.19996E-5 41668 0 8.24742E-6
7-150921869-A-G p.Asn120Asn synonymous ABCF2 13 83344 1.5598E-4 41672 0 6.25E-4
7-150921875-A-G p.Gly118Gly synonymous ABCF2 1 83356 1.19967E-5 41678 0 NA
7-150921894-C-T p.Arg112His missense ABCF2 4 83382 4.7972E-5 41691 0 7.15746E-5
7-150921926-G-A p.Leu101Leu synonymous ABCF2 1 83388 1.19921E-5 41694 0 7.95248E-6
7-150921938-A-C p.Gly97Gly synonymous ABCF2 1 83386 1.19924E-5 41693 0 NA
7-150921950-A-G p.Leu93Leu synonymous ABCF2 58368 83134 0.702095 41567 20589 0.723424
7-150921959-G-A p.Asn90Asn synonymous ABCF2 1 83394 1.19913E-5 41697 0 8.23655E-6
7-150921967-T-C p.Ile88Val missense ABCF2 2 83390 2.39837E-5 41695 0 8.23696E-6
7-150921978-G-T p.Thr84Asn missense ABCF2 1 83392 1.19916E-5 41696 0 NA
7-150921980-A-G p.Ser83Ser synonymous ABCF2 1 83390 1.19918E-5 41695 0 NA
7-150921984-T-C p.Asn82Ser missense ABCF2 1 83390 1.19918E-5 41695 0 8.23655E-6
7-150921989-G-A p.His80His synonymous ABCF2 2 83388 2.39843E-5 41694 0 NA
7-150922008-G-C p.Thr74Ser missense ABCF2 1 83394 1.19913E-5 41697 0 NA
7-150922034-C-A p.Met65Ile missense ABCF2 2 83362 2.39917E-5 41681 0 NA
7-150922038-T-C p.Glu64Gly missense ABCF2 1 83358 1.19964E-5 41679 0 3.97643E-6
7-150922043-G-A p.Asp62Asp synonymous ABCF2 2 83348 2.39958E-5 41674 0 3.1841E-5
7-150922049-T-C p.Leu60Leu synonymous ABCF2 1 83342 1.19988E-5 41671 0 8.23723E-6
7-150922050-A-G p.Leu60Pro missense ABCF2 1 83338 1.19993E-5 41669 0 NA
7-150922054-C-A p.Glu59* stop_gained ABCF2 1 83308 1.20036E-5 41654 0 NA
7-150922062-A-G p.Leu56Pro missense ABCF2 3 83258 3.60326E-5 41629 0 NA
7-150922070-T-C p.Val53Val synonymous ABCF2 2 83154 2.40518E-5 41577 0 6.3674E-5
7-150922077-G-GTGGTCTCTCTGCCATTGGCCTCATTCTTCTCTGCCACCTGTGGTT c.155-4_155-3insAACCACAGGTGGCAGAGAAGAATGAGGCCAATGGCAGAGAGACCA splice_region ABCF2 2 83002 2.40958E-5 41501 1 NA
7-150922077-G-GTGGT c.155-4_155-3insACCA splice_region ABCF2 1 83004 1.20476E-5 41502 0 NA
7-150922079-G-A c.155-5C>T splice_region ABCF2 2 82904 2.41243E-5 41452 0 9.55292E-5
7-150923383-C-A c.154+8G>T splice_region ABCF2 5 82878 6.03296E-5 41439 1 0.001875
7-150923396-G-A p.Thr50Ile missense ABCF2 1 83090 1.20351E-5 41545 0 NA
7-150923398-C-G p.Glu49Asp missense ABCF2 1 83118 1.20311E-5 41559 0 2.48221E-5
7-150923398-C-T p.Glu49Glu synonymous ABCF2 1 83118 1.20311E-5 41559 0 NA
7-150923424-C-T p.Glu41Lys missense ABCF2 2 83348 2.39958E-5 41674 0 NA
7-150923441-G-C p.Thr35Arg missense ABCF2 1 83394 1.19913E-5 41697 0 8.23913E-6
7-150923443-GACA-G p.Val34del disruptive_inframe_deletion ABCF2 1 83402 1.19901E-5 41701 0 3.18492E-5
7-150923492-T-C p.Lys18Arg missense ABCF2 1 83400 1.19904E-5 41700 0 NA
7-150923517-CCTT-C p.Lys9del conservative_inframe_deletion ABCF2 1 83396 1.1991E-5 41698 0 1.64997E-5
7-150923519-T-C p.Lys9Arg missense ABCF2 2 83390 2.39837E-5 41695 0 NA
7-150923529-C-T p.Ala6Thr missense ABCF2 1 83370 1.19947E-5 41685 0 NA
7-150923532-G-A p.Leu5Leu synonymous ABCF2 59 83362 7.07757E-4 41681 0 3.50316E-4
7-150923533-G-A p.Asp4Asp synonymous ABCF2 130 83356 0.00155958 41678 0 0.00178104
7-150923536-G-T p.Ser3Ser synonymous ABCF2 4 83346 4.79927E-5 41673 0 3.31879E-5
7-150923540-G-A p.Pro2Leu missense ABCF2 1 83342 1.19988E-5 41671 0 NA
7-150923560-G-A n.248C>T splice_region ABCF2 1 83236 1.2014E-5 41618 0 3.18634E-5
7-150923561-G-A n.247C>T splice_region ABCF2 113 83214 0.00135794 41607 0 0.00136102
7-150923561-G-C n.247C>G splice_region ABCF2 1 83220 1.20163E-5 41610 0 4.02418E-6
7-150923563-T-C c.-19A>G 5_prime_UTR_premature_start_codon_gain ABCF2 1 83204 1.20187E-5 41602 0 NA
7-150923583-G-C c.-39C>G 5_prime_UTR_premature_start_codon_gain ABCF2 1 82696 1.20925E-5 41348 0 NA
7-150923585-G-A c.-41C>T splice_region ABCF2 1 82566 1.21115E-5 41283 0 NA
7-150923587-CT-C c.-42-2delA splice_acceptor ABCF2 1 82486 1.21233E-5 41243 0 4.23991E-6
7-150923592-G-A c.-42-6C>T splice_region ABCF2 1 82246 1.21586E-5 41123 0 8.62872E-6
7-150923600-A-G c.-56T>C 5_prime_UTR_premature_start_codon_gain ABCF2 1 81712 1.22381E-5 40856 0 3.18756E-5
7-150923674-T-C c.-130A>G 5_prime_UTR_premature_start_codon_gain ABCF2 5 76250 6.55738E-5 38125 0 3.1841E-5
7-150923816-T-A n.221+8A>T splice_region ABCF2 3 22336 1.34312E-4 11168 0 1.27453E-4
7-150923942-C-G c.-43+1G>C splice_donor ABCF2 1 448 0.00223214 224 0 0.00739466
7-150924030-C-A c.-130G>T 5_prime_UTR_premature_start_codon_gain ABCF2 31 512 0.0605469 256 0 0.0453413