Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
6-30539164-T-C c.-101T>C 5_prime_UTR_premature_start_codon_gain ABCF1 2 51050 3.91773E-5 25525 0 6.42508E-5
6-30539169-C-T c.-96C>T 5_prime_UTR_premature_start_codon_gain ABCF1 6 52772 1.13697E-4 26386 0 3.18898E-5
6-30539225-A-G c.-40A>G 5_prime_UTR_premature_start_codon_gain ABCF1 1 67222 1.48761E-5 33611 0 NA
6-30539261-C-T c.-4C>T 5_prime_UTR_premature_start_codon_gain ABCF1 1 71800 1.39276E-5 35900 0 5.39811E-5
6-30539269-C-G p.Pro2Arg missense ABCF1 2 72370 2.76358E-5 36185 0 3.72227E-5
6-30539290-C-T p.Pro9Leu missense ABCF1 1 72886 1.37201E-5 36443 0 0.00218818
6-30539291-G-A p.Pro9Pro synonymous ABCF1 1 72868 1.37234E-5 36434 0 NA
6-30539297-G-A p.Glu11Glu synonymous ABCF1 1 72808 1.37348E-5 36404 0 1.07657E-5
6-30539301-G-A p.Glu13Lys missense ABCF1 1 72750 1.37457E-5 36375 0 4.16719E-6
6-30539305-G-A p.Trp14* stop_gained ABCF1 1 72624 1.37696E-5 36312 0 NA
6-30539309-C-T c.-200C>T 5_prime_UTR_premature_start_codon_gain ABCF1 1 72466 1.37996E-5 36233 0 NA
6-30539313-G-A p.Asp17Asn missense ABCF1 3 72502 4.13782E-5 36251 0 NA
6-30539315-C-T c.-194C>T 5_prime_UTR_premature_start_codon_gain ABCF1 1 71754 1.39365E-5 35877 0 1.08272E-5
6-30539316-G-A p.Gly18Arg missense ABCF1 1 72134 1.38631E-5 36067 0 1.73284E-4
6-30539323-G-A p.Ser20Asn missense ABCF1 1 71486 1.39888E-5 35743 0 8.37156E-6
6-30539330-C-T p.Ser22Ser synonymous ABCF1 1 70940 1.40964E-5 35470 0 1.1117E-5
6-30539331-C-G p.Pro23Ala missense ABCF1 1 70992 1.40861E-5 35496 0 2.22687E-5
6-30545214-CAAG-C p.Lys36del disruptive_inframe_deletion ABCF1 4 83348 4.79916E-5 41674 0 1.70314E-5
6-30545220-G-C p.Lys36Asn missense ABCF1 1 83348 1.19979E-5 41674 0 NA
6-30545221-A-T p.Ile37Phe missense ABCF1 1 83352 1.19973E-5 41676 0 NA
6-30545223-C-CA p.Thr40fs frameshift ABCF1 1 83348 1.19979E-5 41674 0 NA
6-30545230-A-C p.Thr40Pro missense+splice_region ABCF1 2 83354 2.3994E-5 41677 0 6.94734E-5
6-30545231-C-T p.Thr40Met missense+splice_region ABCF1 1 83348 1.19979E-5 41674 0 8.68508E-6
6-30545615-A-G p.Val47Val synonymous ABCF1 1 80924 1.23573E-5 40462 0 NA
6-30545617-A-T p.Glu48Val missense ABCF1 1 80972 1.23499E-5 40486 0 NA
6-30545631-G-A p.Gly53Arg missense ABCF1 2 81098 2.46615E-5 40549 0 1.22158E-5
6-30545648-G-A p.Val58Val synonymous ABCF1 1 81132 1.23256E-5 40566 0 2.03398E-5
6-30545659-A-G p.Lys62Arg missense ABCF1 2 81188 2.46342E-5 40594 0 3.18817E-5
6-30545661-GAGC-G p.Gln68del disruptive_inframe_deletion ABCF1 3 81122 3.69813E-5 40561 0 NA
6-30545661-GAGCAGC-G p.Gln67_Gln68del disruptive_inframe_deletion ABCF1 12 81176 1.47827E-4 40588 0 2.55021E-4
6-30545661-G-GAGC p.Gln68dup disruptive_inframe_insertion ABCF1 1 81176 1.23189E-5 40588 0 NA
6-30545672-G-GCAGCAA p.Gln71_Gln72dup disruptive_inframe_insertion ABCF1 1 81136 1.2325E-5 40568 0 1.62371E-5
6-30545672-GCAGCAA-G p.Gln71_Gln72del disruptive_inframe_deletion ABCF1 2 81136 2.465E-5 40568 0 NA
6-30545675-G-A p.Gln67Gln synonymous ABCF1 1 81106 1.23295E-5 40553 0 NA
6-30545679-C-T p.Gln69* stop_gained ABCF1 1 81120 1.23274E-5 40560 0 NA
6-30545694-C-G c.216+4C>G splice_region ABCF1 1 81022 1.23423E-5 40511 0 NA
6-30545696-A-C c.216+6A>C splice_region ABCF1 3 81054 3.70124E-5 40527 0 6.25E-4
6-30545853-CA-C p.Lys76fs frameshift ABCF1 16 80214 1.99466E-4 40107 0 0.0837972
6-30545853-C-CA p.Arg77fs frameshift ABCF1 13 82638 1.57313E-4 41319 0 0.0102174
6-30545863-A-G p.Lys76Arg missense ABCF1 2 83320 2.40038E-5 41660 0 1.19441E-5
6-30545866-G-A p.Arg77Gln missense ABCF1 2 83318 2.40044E-5 41659 0 1.65265E-5
6-30545871-A-G p.Thr79Ala missense ABCF1 1 83320 1.20019E-5 41660 0 NA
6-30545872-C-T p.Thr79Ile missense ABCF1 2 83320 2.40038E-5 41660 0 1.59136E-5
6-30545875-G-A p.Arg80Gln missense ABCF1 2 83324 2.40027E-5 41662 0 3.97836E-6
6-30545879-A-G p.Lys81Lys synonymous ABCF1 793 83306 0.00951912 41653 7 0.033125
6-30545886-C-T p.Arg84Trp missense ABCF1 2 83324 2.40027E-5 41662 0 3.21688E-5
6-30545887-G-A p.Arg84Gln missense ABCF1 15 83338 1.7999E-4 41669 0 5.56855E-5
6-30545894-G-C p.Lys86Asn missense ABCF1 1 83338 1.19993E-5 41669 0 NA
6-30545900-G-C p.Val88Val synonymous ABCF1 1 83328 1.20008E-5 41664 0 NA
6-30545907-G-C p.Asp91His missense ABCF1 3 83338 3.5998E-5 41669 0 8.24198E-6
6-30545907-G-A p.Asp91Asn missense ABCF1 1 83338 1.19993E-5 41669 0 8.24198E-6
6-30545908-A-C p.Asp91Ala missense ABCF1 1 83338 1.19993E-5 41669 0 1.81321E-4
6-30545910-G-A p.Gly92Arg missense ABCF1 23 83332 2.76004E-4 41666 0 3.19468E-5
6-30545916-GA-TT p.Glu94Leu missense ABCF1 1 83334 1.19999E-5 41667 0 NA
6-30545934-C-T p.Arg100Cys missense ABCF1 8 83322 9.60131E-5 41661 0 5.44662E-4
6-30545935-G-A p.Arg100His missense ABCF1 3 83316 3.60075E-5 41658 0 9.58099E-5
6-30545948-C-T p.Leu104Leu synonymous ABCF1 8 83336 9.59969E-5 41668 0 1.43192E-4
6-30545977-A-C p.Glu114Ala missense+splice_region ABCF1 1 83350 1.19976E-5 41675 0 NA
6-30545979-G-A p.Val115Ile missense+splice_region ABCF1 14 83352 1.67962E-4 41676 0 1.91302E-4
6-30546142-C-T p.Arg121Cys missense ABCF1 4 83070 4.81522E-5 41535 0 4.12242E-5
6-30546143-G-A p.Arg121His missense ABCF1 1 83058 1.20398E-5 41529 0 5.96469E-5
6-30546144-C-T p.Arg121Arg synonymous ABCF1 3 83090 3.61054E-5 41545 0 8.24389E-5
6-30546145-G-A p.Gly122Arg missense ABCF1 1 83132 1.20291E-5 41566 0 6.37674E-5
6-30546151-A-G p.Lys124Glu missense ABCF1 3 83222 3.60482E-5 41611 0 7.1574E-5
6-30546160-AAGGTAAGCCATCTGTGTGGTAAACGGAGACTCCAAGGATGCAACCTTGACCATCCTACTGACTTCTGTGGCCCTTTCATTCTCT-A p.Gly128fs frameshift ABCF1 5 83268 6.00471E-5 41634 0 NA
6-30546164-T-A c.381+2T>A splice_donor ABCF1 3 83288 3.60196E-5 41644 0 8.23818E-6
6-30546167-G-A c.381+5G>A splice_region ABCF1 2 83306 2.40079E-5 41653 0 NA
6-30546170-A-G c.381+8A>G splice_region ABCF1 2 83326 2.40021E-5 41663 0 3.97633E-6
6-30546243-C-G c.382-4C>G splice_region ABCF1 11 83366 1.31948E-4 41683 0 6.60469E-5
6-30546255-T-C p.Asn130Asn synonymous ABCF1 2 83364 2.39912E-5 41682 0 3.19122E-5
6-30546258-T-G p.Val131Val synonymous ABCF1 1 83358 1.19964E-5 41679 0 8.26323E-6
6-30546261-T-C p.Phe132Phe synonymous ABCF1 1 83346 1.19982E-5 41673 0 3.18735E-5
6-30546263-C-T p.Ala133Val missense ABCF1 6 83348 7.19873E-5 41674 0 3.05957E-4
6-30546274-C-G p.Gln137Glu missense ABCF1 2 83376 2.39877E-5 41688 0 3.18857E-5
6-30546284-G-A p.Ser140Asn missense ABCF1 1 83384 1.19927E-5 41692 0 8.30275E-6
6-30546291-AGAG-A p.Glu146del disruptive_inframe_deletion ABCF1 3 83372 3.59833E-5 41686 0 3.9781E-6
6-30546332-C-T p.Pro156Leu missense ABCF1 1 83328 1.20008E-5 41664 0 2.58331E-5
6-30546333-G-A p.Pro156Pro synonymous ABCF1 16 83314 1.92045E-4 41657 0 0.00272331
6-30546344-G-A p.Arg160Gln missense ABCF1 2 83272 2.40177E-5 41636 0 0.00108932
6-30546345-G-A p.Arg160Arg synonymous ABCF1 1 83266 1.20097E-5 41633 0 1.7751E-5
6-30546361-G-T c.489+7G>T splice_region ABCF1 1 83194 1.20201E-5 41597 0 4.0244E-6
6-30547711-G-A p.Val165Ile missense ABCF1 1 81426 1.22811E-5 40713 0 1.62343E-5
6-30547715-C-G p.Ser166Cys missense ABCF1 3 81428 3.68424E-5 40714 0 9.51919E-5
6-30547729-C-T p.Pro171Ser missense ABCF1 2 81414 2.45658E-5 40707 0 4.05709E-6
6-30547731-T-C p.Pro171Pro synonymous ABCF1 2 81412 2.45664E-5 40706 0 3.18817E-5
6-30547732-G-A p.Ala172Thr missense ABCF1 1 81412 1.22832E-5 40706 0 NA
6-30547738-A-G p.Lys174Glu missense ABCF1 3 81400 3.6855E-5 40700 0 6.37267E-5
6-30547742-G-A p.Gly175Asp missense ABCF1 1 81390 1.22865E-5 40695 0 NA
6-30547743-C-T p.Gly175Gly synonymous ABCF1 1 81388 1.22868E-5 40694 0 NA
6-30547764-G-C p.Lys182Asn missense ABCF1 1 81368 1.22898E-5 40684 0 NA
6-30547775-A-G p.Lys186Arg missense ABCF1 1 81346 1.22932E-5 40673 0 4.06065E-6
6-30547782-G-A p.Lys188Lys splice_region+synonymous ABCF1 1 81332 1.22953E-5 40666 0 8.71703E-6
6-30548178-A-G c.565-5A>G splice_region ABCF1 2 80528 2.48361E-5 40264 0 1.97013E-5
6-30548182-G-A c.565-1G>A splice_acceptor ABCF1 2 80730 2.47739E-5 40365 0 NA
6-30548185-T-C p.Pro189Pro splice_region+synonymous ABCF1 1 80762 1.23821E-5 40381 0 NA
6-30548193-A-G p.Lys192Arg missense ABCF1 1 80908 1.23597E-5 40454 0 1.57381E-5
6-30548197-C-T p.Phe193Phe synonymous ABCF1 4 80892 4.94486E-5 40446 0 3.28818E-5
6-30548198-G-A p.Ala194Thr missense ABCF1 1 80842 1.23698E-5 40421 0 NA
6-30548210-A-G p.Asn198Asp missense ABCF1 1103 80996 0.013618 40498 12 0.0398472
6-30548211-A-G p.Asn198Ser missense ABCF1 2 81040 2.46792E-5 40520 0 NA
6-30548213-G-A p.Glu199Lys missense ABCF1 1 81052 1.23378E-5 40526 0 3.20718E-5
6-30548216-G-A p.Glu200Lys missense ABCF1 1 81046 1.23387E-5 40523 0 NA
6-30548218-G-A p.Glu200Glu synonymous ABCF1 3 81046 3.7016E-5 40523 0 2.64396E-5
6-30548224-TAAA-T p.???106fs frameshift ABCF1 3 81048 3.70151E-5 40524 0 3.2111E-5
6-30548226-A-G p.Lys203Arg missense ABCF1 1 81080 1.23335E-5 40540 0 NA
6-30548231-G-A p.Glu205Lys missense ABCF1 3 81060 3.70096E-5 40530 0 1.27747E-4
6-30548273-GAGA-G p.Lys220del conservative_inframe_deletion ABCF1 1 80734 1.23864E-5 40367 0 NA
6-30548283-A-C p.Lys222Thr missense ABCF1 3 80670 3.71885E-5 40335 0 NA
6-30548291-G-A p.Glu225Lys missense ABCF1 1 80578 1.24103E-5 40289 0 NA
6-30548299-G-A c.678+3G>A splice_region ABCF1 1 80498 1.24227E-5 40249 0 NA
6-30550168-C-T c.679-3C>T splice_region ABCF1 1 77682 1.2873E-5 38841 0 NA
6-30550175-C-T p.Ser228Leu missense ABCF1 7 77854 8.99119E-5 38927 0 3.19305E-4
6-30550184-AAGG-A p.Gly232del disruptive_inframe_deletion ABCF1 3 78048 3.84379E-5 39024 0 4.15275E-6
6-30550196-A-T p.Glu235Val missense ABCF1 1 78208 1.27864E-5 39104 0 9.76582E-6
6-30550200-AGAG-A p.Glu240del disruptive_inframe_deletion ABCF1 3 78262 3.83328E-5 39131 0 1.90038E-5
6-30550217-G-C p.Gly242Ala missense ABCF1 1 78360 1.27616E-5 39180 0 NA
6-30550231-G-GA p.Asp247fs frameshift ABCF1 1 78414 1.27528E-5 39207 0 NA
6-30550244-C-G p.Ala251Gly missense ABCF1 1 78422 1.27515E-5 39211 0 8.65621E-6
6-30550244-C-T p.Ala251Val missense ABCF1 1 78422 1.27515E-5 39211 0 4.09695E-6
6-30550252-A-G p.Ser254Gly missense ABCF1 1 78444 1.27479E-5 39222 0 NA
6-30550259-A-G p.Lys256Arg missense ABCF1 1 78448 1.27473E-5 39224 0 NA
6-30550848-G-A p.Glu266Glu synonymous ABCF1 2 81418 2.45646E-5 40709 0 NA
6-30550853-A-G p.Glu268Gly missense ABCF1 1 81410 1.22835E-5 40705 0 NA
6-30550856-GC-G p.Gln270fs frameshift ABCF1 1 81410 1.22835E-5 40705 0 NA
6-30550859-A-T p.Gln270Leu missense ABCF1 1 81418 1.22823E-5 40709 0 NA
6-30550860-A-G p.Gln270Gln synonymous ABCF1 4 81416 4.91304E-5 40708 0 6.25E-4
6-30550860-A-C p.Gln270His missense ABCF1 2 81416 2.45652E-5 40708 0 NA
6-30550862-T-G p.Val271Gly missense ABCF1 1 81418 1.22823E-5 40709 0 NA
6-30550881-C-T p.Ala277Ala synonymous ABCF1 27 81408 3.31663E-4 40704 0 6.69003E-4
6-30550883-A-G p.Asn278Ser missense ABCF1 22 81410 2.70237E-4 40705 0 6.02939E-5
6-30550886-C-A p.Ala279Glu missense ABCF1 1 81408 1.22838E-5 40704 0 NA
6-30550905-C-T p.Ser285Ser synonymous ABCF1 6 81364 7.37427E-5 40682 0 4.05752E-5
6-30550906-G-A p.Val286Met missense ABCF1 1 81376 1.22886E-5 40688 0 3.18471E-5
6-30550917-G-A p.Ala289Ala synonymous ABCF1 2 81344 2.45869E-5 40672 0 3.18451E-5
6-30550921-A-C p.Met291Leu missense ABCF1 1 81310 1.22986E-5 40655 0 8.62679E-6
6-30550932-C-A p.Arg294Arg synonymous ABCF1 1 81382 1.22877E-5 40691 0 5.67993E-5
6-30550953-A-G p.Ala301Ala synonymous ABCF1 3 81392 3.68587E-5 40696 0 1.21812E-5
6-30550962-C-G p.Ile304Met missense ABCF1 2 81388 2.45736E-5 40694 1 NA
6-30551385-C-G p.Leu306Val missense+splice_region ABCF1 2 83094 2.40691E-5 41547 1 NA
6-30551387-G-T p.Leu306Leu splice_region+synonymous ABCF1 1 83104 1.20331E-5 41552 0 NA
6-30551405-C-T p.Ser312Ser synonymous ABCF1 2 83190 2.40414E-5 41595 0 3.58272E-5
6-30551406-G-A p.Ala313Thr missense ABCF1 1 83196 1.20198E-5 41598 0 8.23981E-6
6-30551426-C-T p.Phe319Phe synonymous ABCF1 929 83240 0.0111605 41620 11 0.0413943
6-30551427-G-A p.Val320Ile missense ABCF1 1 83268 1.20094E-5 41634 0 3.58237E-5
6-30551431-A-G p.Asn321Ser missense ABCF1 3 83294 3.6017E-5 41647 0 1.19406E-5
6-30551445-A-G p.Ile326Val missense ABCF1 3 83270 3.60274E-5 41635 0 3.18512E-5
6-30551454-G-A p.Gly329Ser missense ABCF1 2 83266 2.40194E-5 41633 0 6.37186E-5
6-30551461-G-A p.Arg331His missense ABCF1 5 83358 5.99822E-5 41679 0 3.1857E-5
6-30551477-A-G p.Gly336Gly synonymous ABCF1 1 83382 1.1993E-5 41691 0 6.37633E-5
6-30551484-GGGTGAGAAGAGGAGGGAGCTGGAGGCAAAAAAGGGCCTGGAGGGAAAAGAAGAGATTTCTCAGTGGTGGCCAGGTCCTAATAGCTTTTATTCCCCA-G p.Gly339fs frameshift ABCF1 10 83382 1.1993E-4 41691 1 NA
6-30551576-C-T c.1017-6C>T splice_region ABCF1 1 82744 1.20855E-5 41372 0 NA
6-30551595-A-G p.Thr344Ala missense ABCF1 4 82056 4.87472E-5 41028 0 4.39733E-5
6-30551597-A-C p.Thr344Thr synonymous ABCF1 2 82012 2.43867E-5 41006 0 NA
6-30551600-C-T p.Leu345Leu synonymous ABCF1 1 81934 1.22049E-5 40967 0 NA
6-30551603-C-G p.Leu346Leu synonymous ABCF1 43 81886 5.2512E-4 40943 0 0.0025
6-30551617-A-G p.Asn351Ser missense ABCF1 1 81698 1.22402E-5 40849 0 2.40867E-5
6-30551623-C-A p.Ala353Asp missense ABCF1 1 81564 1.22603E-5 40782 0 8.49372E-6
6-30551629-G-A p.Ser355Asn missense ABCF1 4 81506 4.90761E-5 40753 0 1.01973E-4
6-30551634-C-T p.Pro357Ser missense ABCF1 1 81466 1.22751E-5 40733 0 NA
6-30551666-G-GGA p.Cys365fs frameshift ABCF1 3 81140 3.69731E-5 40570 1 NA
6-30551976-A-G p.Val370Val synonymous ABCF1 1 80228 1.24645E-5 40114 0 NA
6-30552009-T-C p.Leu381Leu synonymous ABCF1 1 80010 1.24984E-5 40005 0 NA
6-30552018-C-T p.Asp384Asp synonymous ABCF1 1 79978 1.25034E-5 39989 0 2.02993E-5
6-30552037-C-T p.Leu391Leu synonymous ABCF1 1 79870 1.25203E-5 39935 0 NA
6-30552050-G-A p.Arg395Gln missense ABCF1 1 79800 1.25313E-5 39900 0 2.02838E-5
6-30552052-C-T p.Arg396Trp missense ABCF1 4 79792 5.01303E-5 39896 0 5.44662E-4
6-30552053-G-A p.Arg396Gln missense ABCF1 192 79844 0.00240469 39922 2 0.00503473
6-30552057-T-G p.Leu397Leu synonymous ABCF1 5 79934 6.25516E-5 39967 0 1.72363E-5
6-30552066-G-A p.Gln400Gln synonymous ABCF1 1 79978 1.25034E-5 39989 0 NA
6-30552111-A-G c.1242+3A>G splice_region ABCF1 1 80772 1.23805E-5 40386 0 8.10721E-6
6-30552187-C-T c.1243-8C>T splice_region ABCF1 42 80954 5.18813E-4 40477 0 0.00108335
6-30552203-G-T p.Glu417Asp missense ABCF1 1 80828 1.2372E-5 40414 0 1.21663E-5
6-30552210-C-T p.Arg420Trp missense ABCF1 4 80660 4.95909E-5 40330 0 NA
6-30552224-G-A p.Ala424Ala synonymous ABCF1 2 80064 2.498E-5 40032 0 6.37714E-5
6-30552230-T-G p.Ala426Ala synonymous ABCF1 10 79826 1.25272E-4 39913 0 3.18857E-5
6-30552236-G-T p.Glu428Asp missense ABCF1 1 79528 1.25742E-5 39764 0 NA
6-30552277-C-T p.Pro442Leu missense ABCF1 1 72520 1.37893E-5 36260 0 NA
6-30552298-C-T p.Thr449Ile missense ABCF1 4 64684 6.18391E-5 32342 0 8.64589E-5
6-30552314-G-C p.Gly454Gly synonymous ABCF1 1 58972 1.69572E-5 29486 0 8.95977E-6
6-30552317-C-T p.Gly455Gly synonymous ABCF1 8 57922 1.38117E-4 28961 0 0.00272926
6-30552328-G-A p.Arg459His missense ABCF1 1 54032 1.85076E-5 27016 0 NA
6-30552343-G-C p.Arg464Thr missense+splice_region ABCF1 1 49810 2.00763E-5 24905 0 6.37633E-5
6-30553031-C-T c.1392-6C>T splice_region ABCF1 8 81360 9.83284E-5 40680 0 1.37464E-4
6-30553055-C-T p.Pro470Pro synonymous ABCF1 2 81430 2.4561E-5 40715 0 NA
6-30553068-C-T p.Leu475Leu synonymous ABCF1 2 81452 2.45543E-5 40726 0 1.27413E-4
6-30553076-G-A p.Glu477Glu synonymous ABCF1 3 81464 3.68261E-5 40732 0 2.02198E-5
6-30553106-C-T p.Val487Val synonymous ABCF1 1 81458 1.22763E-5 40729 0 NA
6-30553124-C-T c.1475+4C>T splice_region ABCF1 2 81424 2.45628E-5 40712 0 5.92305E-4
6-30553125-G-A c.1475+5G>A splice_region ABCF1 1 81422 1.22817E-5 40711 0 5.15048E-5
6-30553330-C-T c.1476-5C>T splice_region ABCF1 1 81476 1.22736E-5 40738 0 1.21673E-5
6-30553362-G-T p.Leu501Phe missense ABCF1 1 81502 1.22696E-5 40751 0 3.18654E-5
6-30553365-G-C p.Leu502Leu synonymous ABCF1 1 81504 1.22693E-5 40752 0 NA
6-30553368-C-T p.Ile503Ile synonymous ABCF1 2 81510 2.45369E-5 40755 0 3.18573E-5
6-30553369-G-A p.Val504Ile missense ABCF1 4 81510 4.90737E-5 40755 0 5.44662E-4
6-30553393-G-T p.Asp512Tyr missense ABCF1 3 81496 3.68116E-5 40748 0 NA
6-30553398-T-G p.Asp513Glu missense ABCF1 30 81492 3.68134E-4 40746 0 4.45973E-4
6-30553419-C-T p.His520His synonymous ABCF1 1 81492 1.22711E-5 40746 0 NA
6-30553423-G-A p.Asp522Asn missense ABCF1 4 81498 4.9081E-5 40749 0 3.18552E-5
6-30553428-C-T p.Ala523Ala synonymous ABCF1 1 81490 1.22714E-5 40745 0 4.05459E-6
6-30553430-A-G p.Gln524Arg missense ABCF1 2 81488 2.45435E-5 40744 0 3.18573E-5
6-30553432-C-T p.Arg525Trp missense ABCF1 1 81490 1.22714E-5 40745 0 4.05502E-6
6-30553439-A-G p.His527Arg missense ABCF1 2 81496 2.45411E-5 40748 0 1.72111E-5
6-30553446-T-C p.Tyr529Tyr synonymous ABCF1 37 81496 4.5401E-4 40748 1 0.00125
6-30553449-G-C p.Arg530Ser missense ABCF1 1 81498 1.22702E-5 40749 0 NA
6-30553648-T-G c.1601-8T>G splice_region ABCF1 1 81160 1.23213E-5 40580 0 1.6073E-5
6-30553652-C-T c.1601-4C>T splice_region ABCF1 1 81186 1.23174E-5 40593 0 4.45173E-6
6-30553654-A-G c.1601-2A>G splice_acceptor ABCF1 1 81190 1.23168E-5 40595 0 NA
6-30553670-A-G p.Met539Val missense ABCF1 1 81276 1.23038E-5 40638 0 NA
6-30553720-G-GA p.Leu558fs frameshift ABCF1 2 81372 2.45785E-5 40686 0 NA
6-30553747-C-T p.Gly564Gly synonymous ABCF1 1 81384 1.22874E-5 40692 0 1.17019E-5
6-30553764-A-T p.Gln570Leu missense ABCF1 1 81364 1.22904E-5 40682 0 NA
6-30553768-G-A p.Ala571Ala splice_region+synonymous ABCF1 9 81346 1.10639E-4 40673 0 1.3412E-4
6-30553905-C-T c.1714-6C>T splice_region ABCF1 1 83334 1.19999E-5 41667 0 8.46324E-6
6-30553921-C-T p.Thr575Met missense ABCF1 1 83368 1.1995E-5 41684 0 1.67305E-5
6-30553922-G-A p.Thr575Thr synonymous ABCF1 3 83364 3.59868E-5 41682 0 1.59357E-4
6-30553928-A-G p.Glu577Glu synonymous ABCF1 20 83376 2.39877E-4 41688 0 1.27462E-4
6-30553936-C-T p.Thr580Ile missense ABCF1 1 83376 1.19939E-5 41688 0 1.59704E-5
6-30553938-C-T p.Arg581Trp missense ABCF1 16 83372 1.91911E-4 41686 0 1.3291E-4
6-30553957-G-A p.Arg587Gln missense ABCF1 4 83378 4.79743E-5 41689 0 3.18654E-5
6-30553960-G-A p.Arg588Gln missense ABCF1 2 83372 2.39889E-5 41686 0 1.19471E-5
6-30553971-G-A p.Asp592Asn missense ABCF1 1 83360 1.19962E-5 41680 0 3.31301E-5
6-30553981-C-T p.Ser595Phe missense ABCF1 1 83340 1.1999E-5 41670 0 3.98257E-6
6-30553989-G-T p.Ala598Ser missense ABCF1 1 83302 1.20045E-5 41651 0 NA
6-30553990-C-G p.Ala598Gly missense ABCF1 9 83302 1.08041E-4 41651 0 1.91058E-4
6-30553993-C-T p.Pro599Leu missense ABCF1 272 83308 0.00326499 41654 2 0.00771143
6-30554000-C-T p.Leu601Leu synonymous ABCF1 1 83306 1.20039E-5 41653 0 5.44662E-4
6-30554006-G-A p.Lys603Lys synonymous ABCF1 1 83302 1.20045E-5 41651 0 NA
6-30554008-G-A p.Arg604His missense ABCF1 1 83274 1.20085E-5 41637 0 8.28748E-6
6-30554012-T-C p.Pro605Pro synonymous ABCF1 2 83282 2.40148E-5 41641 0 NA
6-30554015-G-A p.Lys606Lys synonymous ABCF1 3 83300 3.60144E-5 41650 0 NA
6-30554028-C-T p.Arg611Cys missense ABCF1 1 83290 1.20062E-5 41645 0 8.29876E-6
6-30554029-G-A p.Arg611His missense ABCF1 1 83296 1.20054E-5 41648 0 1.60489E-5
6-30554030-C-T p.Arg611Arg synonymous ABCF1 1 83308 1.20036E-5 41654 0 NA
6-30554044-A-AC p.Pro619fs frameshift ABCF1 1 83248 1.20123E-5 41624 0 4.02992E-6
6-30554044-A-ACC p.Pro619fs frameshift ABCF1 1 83248 1.20123E-5 41624 0 NA
6-30554044-A-T p.Asp616Val missense ABCF1 1 83248 1.20123E-5 41624 0 NA
6-30554050-C-G p.Pro618Arg missense ABCF1 2 83276 2.40165E-5 41638 0 8.33111E-6
6-30554051-A-G p.Pro618Pro synonymous ABCF1 4 83274 4.80342E-5 41637 1 NA
6-30554065-C-T p.Pro623Leu missense ABCF1 3 83254 3.60343E-5 41627 0 NA
6-30554066-A-G p.Pro623Pro synonymous ABCF1 1 83254 1.20114E-5 41627 0 NA
6-30554072-G-A p.Leu625Leu synonymous ABCF1 1 83242 1.20132E-5 41621 0 4.08537E-6
6-30554080-A-G p.His628Arg missense+splice_region ABCF1 13 83184 1.5628E-4 41592 0 1.27494E-4
6-30554251-G-A p.Gly629Asp missense+splice_region ABCF1 1 81496 1.22705E-5 40748 0 4.04223E-6
6-30554268-C-G p.Gln635Glu missense ABCF1 2 81498 2.45405E-5 40749 0 5.14642E-5
6-30554305-G-A p.Gly647Asp missense ABCF1 1 81498 1.22702E-5 40749 0 NA
6-30554325-AGTGAGTTGGCGGGGTTGCCTCAGGGATGTGTAGCAGGAGCCACAGGGAGAGTCTCTGGGGACCTCTTTGACCACCTGTCTTCCATCTTGCAG-A c.1960+1_1961-1delGTGAGTTGGCGGGGTTGCCTCAGGGATGTGTAGCAGGAGCCACAGGGAGAGTCTCTGGGGACCTCTTTGACCACCTGTCTTCCATCTTGCAG splice_acceptor ABCF1 10 81500 1.22699E-4 40750 3 NA
6-30554333-G-C c.1960+8G>C splice_region ABCF1 2 81480 2.45459E-5 40740 0 0.00125
6-30554420-T-G p.Cys655Gly missense+splice_region ABCF1 2 81476 2.45471E-5 40738 0 NA
6-30554430-G-A p.Gly658Asp missense ABCF1 2 81470 2.45489E-5 40735 0 NA
6-30554441-G-A p.Val662Met missense ABCF1 6 81450 7.36648E-5 40725 2 NA
6-30554446-G-A p.Gly663Gly synonymous ABCF1 1 81434 1.22799E-5 40717 0 3.62804E-5
6-30554458-A-G p.Leu667Leu synonymous ABCF1 4 81320 4.91884E-5 40660 0 5.44662E-4
6-30554463-T-A p.Leu669Gln missense ABCF1 1 81282 1.23028E-5 40641 0 NA
6-30554479-G-A p.Lys674Lys synonymous ABCF1 1 80976 1.23493E-5 40488 0 NA
6-30554488-G-A p.Pro677Pro splice_region+synonymous ABCF1 3 80536 3.72504E-5 40268 0 8.07787E-5
6-30557487-AC-A p.His686fs frameshift ABCF1 1 83426 1.19867E-5 41713 0 NA
6-30557493-G-A p.Arg687Gln missense ABCF1 3 83430 3.59583E-5 41715 0 1.27453E-4
6-30557494-G-A p.Arg687Arg synonymous ABCF1 40 83432 4.79432E-4 41716 0 3.82287E-4
6-30557496-TGGTAAGTTGGCATTGGGATTTAGGGAATGATAATCTGATGGAGGAAGTGTGACTTTAACCGACCACCTCCCTCTCTTCTCGGGCA-T c.2064+1_2065-1delGTAAGTTGGCATTGGGATTTAGGGAATGATAATCTGATGGAGGAAGTGTGACTTTAACCGACCACCTCCCTCTCTTCTCGGGCAG splice_acceptor ABCF1 4 83430 4.79444E-5 41715 1 NA
6-30557497-G-A p.Leu688Leu splice_region+synonymous ABCF1 2 83434 2.3971E-5 41717 0 NA
6-30557576-C-T c.2065-7C>T splice_region ABCF1 6 83402 7.19407E-5 41701 0 1.72976E-4
6-30557599-A-G p.Asn694Ser missense ABCF1 6 83336 7.19977E-5 41668 0 2.47121E-5
6-30557604-C-T p.Gln696* stop_gained ABCF1 1 83320 1.20019E-5 41660 0 NA
6-30557623-G-A p.Arg702His missense ABCF1 3 83206 3.60551E-5 41603 0 3.18674E-5
6-30557636-G-A p.Thr706Thr synonymous ABCF1 4 82966 4.82125E-5 41483 0 1.27421E-4
6-30557639-C-T p.Pro707Pro synonymous ABCF1 1 82922 1.20595E-5 41461 0 NA
6-30557642-T-A p.Thr708Thr synonymous ABCF1 1 82852 1.20697E-5 41426 0 NA
6-30557651-G-A c.316-4G>A splice_region ABCF1 1 82604 1.2106E-5 41302 0 3.98149E-6
6-30557655-C-T p.Arg106Trp missense+splice_region ABCF1 2 82436 2.42612E-5 41218 0 3.98384E-6
6-30557656-G-A p.Arg106Gln missense+splice_region ABCF1 1 82408 1.21347E-5 41204 0 1.59236E-4
6-30557658-G-T p.Gly714Cys missense ABCF1 1 82338 1.21451E-5 41169 0 1.66199E-5
6-30557700-C-T p.Arg728Cys missense ABCF1 1 81534 1.22648E-5 40767 0 1.60635E-5
6-30557701-G-A p.Arg728His missense ABCF1 2 81506 2.45381E-5 40753 0 8.45952E-6
6-30557708-C-G p.Gly730Gly synonymous ABCF1 6 81436 7.36775E-5 40718 0 2.01049E-5
6-30557720-C-T p.His734His synonymous ABCF1 2 81372 2.45785E-5 40686 0 2.55337E-5
6-30557732-C-A p.Ile738Ile synonymous ABCF1 2 81326 2.45924E-5 40663 1 NA
6-30557745-C-T p.Leu743Phe missense ABCF1 3 81270 3.6914E-5 40635 0 NA
6-30557914-CCTTT-C c.2234-11_2234-8delCTTT splice_region ABCF1 2 81486 2.45441E-5 40743 0 NA
6-30557921-T-A c.2234-5T>A splice_region ABCF1 1 81482 1.22726E-5 40741 0 3.18492E-5
6-30557923-C-T c.2234-3C>T splice_region ABCF1 2 81484 2.45447E-5 40742 0 4.0538E-6
6-30557927-T-A p.Gly745Gly splice_region+synonymous ABCF1 1 81486 1.2272E-5 40743 0 3.18492E-5
6-30557939-G-A p.Ala749Ala synonymous ABCF1 48 81492 5.89015E-4 40746 0 0.0025
6-30557965-G-T p.Cys758Phe missense ABCF1 1 81502 1.22696E-5 40751 0 NA
6-30557967-C-T p.Arg759Trp missense ABCF1 2 81502 2.45393E-5 40751 0 1.2158E-5
6-30557968-G-A p.Arg759Gln missense ABCF1 1 81502 1.22696E-5 40751 0 3.18451E-5
6-30557980-T-C p.Val763Ala missense ABCF1 3 81500 3.68098E-5 40750 0 8.60259E-6
6-30557985-A-G p.Ile765Val missense ABCF1 1 81498 1.22702E-5 40749 0 NA
6-30557989-TGGTGAGTGAGCTGGGCTGTGGGAAAAGGGATAAGGGTAACAGTAATGGAAGACGGGAGTTGCAGTGCTCAGTCATGGAATTCCTCCTATGTA-T p.Asp767fs frameshift ABCF1 8 81496 9.81643E-5 40748 1 NA
6-30558077-A-G c.2299-6A>G splice_region ABCF1 1 81474 1.22739E-5 40737 0 1.73756E-5
6-30558107-A-G p.Ile775Val missense ABCF1 4 81468 4.9099E-5 40734 0 3.18857E-5
6-30558116-A-G p.Ile778Val missense ABCF1 2 81470 2.45489E-5 40735 0 3.18756E-5
6-30558117-T-C p.Ile778Thr missense ABCF1 1 81470 1.22745E-5 40735 0 NA
6-30558306-T-A c.2372-6T>A splice_region ABCF1 1 81480 1.2273E-5 40740 0 NA
6-30558312-C-G p.Ala791Gly missense+splice_region ABCF1 1 81490 1.22714E-5 40745 0 8.96652E-6
6-30558320-G-A p.Val794Ile missense ABCF1 5 81492 6.13557E-5 40746 0 8.20917E-5
6-30558339-G-A p.Arg800Gln missense ABCF1 18 81496 2.2087E-4 40748 0 3.18654E-5
6-30558358-T-C p.Asn806Asn synonymous ABCF1 1 81496 1.22705E-5 40748 0 6.25E-4
6-30558380-G-GA p.Gln815fs frameshift ABCF1 2 81496 2.45411E-5 40748 0 4.05564E-6
6-30558387-G-A p.Ser816Asn missense ABCF1 3 81496 3.68116E-5 40748 0 8.61905E-6
6-30558388-T-C p.Ser816Ser synonymous ABCF1 1 81496 1.22705E-5 40748 0 3.19203E-5
6-30558394-C-G p.Ser818Arg missense ABCF1 4 81496 4.90822E-5 40748 0 3.00115E-4
6-30558400-C-T p.Ile820Ile synonymous ABCF1 1 81502 1.22696E-5 40751 0 NA
6-30558401-G-A p.Asp821Asn missense ABCF1 1 81502 1.22696E-5 40751 0 4.05548E-6
6-30558402-A-C p.Asp821Ala missense ABCF1 187 81500 0.00229448 40750 1 0.00503538
6-30558421-C-T p.Tyr827Tyr synonymous ABCF1 1 81492 1.22711E-5 40746 0 NA
6-30558425-C-T p.Arg829Trp missense ABCF1 4 81488 4.9087E-5 40744 0 2.15484E-4
6-30558429-A-G p.Glu830Gly missense ABCF1 1 81488 1.22717E-5 40744 0 NA
6-30558442-C-G p.Ala834Ala synonymous ABCF1 1 81486 1.2272E-5 40743 0 NA
6-30558465-G-A p.Arg842Gln missense ABCF1 5 81436 6.13979E-5 40718 0 6.25E-4
6-30558466-G-A p.Arg842Arg synonymous ABCF1 5 81432 6.14009E-5 40716 0 0.00108932
6-30558470-C-T p.Arg844* stop_gained ABCF1 4 81412 4.91328E-5 40706 0 6.17284E-5
6-30564340-TTTC-T c.*461-5_*461-3delTTC splice_region ABCF1 1 26 0.0384615 13 0 0.00657852
6-30564343-C-T c.*461-3C>T splice_region ABCF1 21 24 0.875 12 9 0.924425
6-30564344-A-T c.*461-2A>T splice_acceptor ABCF1 1 26 0.0384615 13 0 0.0395947