Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
6-30539164-T-C c.-101T>C 5_prime_UTR_premature_start_codon_gain ABCF1 2 49708 4.0235E-5 24854 0 6.42508E-5
6-30539169-C-T c.-96C>T 5_prime_UTR_premature_start_codon_gain ABCF1 6 51392 1.1675E-4 25696 0 3.18898E-5
6-30539225-A-G c.-40A>G 5_prime_UTR_premature_start_codon_gain ABCF1 1 65476 1.52728E-5 32738 0 NA
6-30539261-C-T c.-4C>T 5_prime_UTR_premature_start_codon_gain ABCF1 1 70024 1.42808E-5 35012 0 5.39811E-5
6-30539269-C-G p.Pro2Arg missense ABCF1 2 70590 2.83326E-5 35295 0 3.72227E-5
6-30539290-C-T p.Pro9Leu missense ABCF1 1 71110 1.40627E-5 35555 0 0.00218818
6-30539291-G-A p.Pro9Pro synonymous ABCF1 1 71094 1.40659E-5 35547 0 NA
6-30539297-G-A p.Glu11Glu synonymous ABCF1 1 71026 1.40794E-5 35513 0 1.07657E-5
6-30539301-G-A p.Glu13Lys missense ABCF1 1 70968 1.40909E-5 35484 0 4.16719E-6
6-30539305-G-A p.Trp14* stop_gained ABCF1 1 70846 1.41151E-5 35423 0 NA
6-30539309-C-T c.-200C>T 5_prime_UTR_premature_start_codon_gain ABCF1 1 70682 1.41479E-5 35341 0 NA
6-30539313-G-A p.Asp17Asn missense ABCF1 3 70718 4.2422E-5 35359 0 NA
6-30539315-C-T c.-194C>T 5_prime_UTR_premature_start_codon_gain ABCF1 1 69972 1.42914E-5 34986 0 1.08272E-5
6-30539316-G-A p.Gly18Arg missense ABCF1 1 70356 1.42134E-5 35178 0 1.73284E-4
6-30539323-G-A p.Ser20Asn missense ABCF1 1 69706 1.4346E-5 34853 0 8.37156E-6
6-30539330-C-T p.Ser22Ser synonymous ABCF1 1 69154 1.44605E-5 34577 0 1.1117E-5
6-30539331-C-G p.Pro23Ala missense ABCF1 1 69208 1.44492E-5 34604 0 2.22687E-5
6-30545214-CAAG-C p.Lys36del disruptive_inframe_deletion ABCF1 4 81044 4.93559E-5 40522 0 1.70314E-5
6-30545220-G-C p.Lys36Asn missense ABCF1 1 81046 1.23387E-5 40523 0 NA
6-30545221-A-T p.Ile37Phe missense ABCF1 1 81050 1.23381E-5 40525 0 NA
6-30545223-C-CA p.Thr40fs frameshift ABCF1 1 81046 1.23387E-5 40523 0 NA
6-30545230-A-C p.Thr40Pro missense+splice_region ABCF1 3 81052 3.70133E-5 40526 0 6.94734E-5
6-30545615-A-G p.Val47Val synonymous ABCF1 1 79122 1.26387E-5 39561 0 NA
6-30545617-A-T p.Glu48Val missense ABCF1 1 79168 1.26314E-5 39584 0 NA
6-30545631-G-A p.Gly53Arg missense ABCF1 2 79286 2.52251E-5 39643 0 1.22158E-5
6-30545648-G-A p.Val58Val synonymous ABCF1 1 79302 1.261E-5 39651 0 2.03398E-5
6-30545659-A-G p.Lys62Arg missense ABCF1 2 79344 2.52067E-5 39672 0 3.18817E-5
6-30545661-GAGC-G p.Gln68del disruptive_inframe_deletion ABCF1 2 79272 2.52296E-5 39636 0 NA
6-30545661-GAGCAGC-G p.Gln67_Gln68del disruptive_inframe_deletion ABCF1 12 79326 1.51274E-4 39663 0 2.55021E-4
6-30545661-G-GAGC p.Gln68dup disruptive_inframe_insertion ABCF1 1 79326 1.26062E-5 39663 0 NA
6-30545672-G-GCAGCAA p.Gln71_Gln72dup disruptive_inframe_insertion ABCF1 1 79258 1.2617E-5 39629 0 1.62371E-5
6-30545672-GCAGCAA-G p.Gln71_Gln72del disruptive_inframe_deletion ABCF1 2 79258 2.5234E-5 39629 0 NA
6-30545675-G-A p.Gln67Gln synonymous ABCF1 1 79224 1.26224E-5 39612 0 NA
6-30545694-C-G c.216+4C>G splice_region ABCF1 1 79080 1.26454E-5 39540 0 NA
6-30545696-A-C c.216+6A>C splice_region ABCF1 3 79102 3.79257E-5 39551 0 6.25E-4
6-30545853-CA-C p.Lys76fs frameshift ABCF1 14 78034 1.79409E-4 39017 0 0.0837972
6-30545853-C-CA p.Arg77fs frameshift ABCF1 10 80346 1.24462E-4 40173 0 0.0102174
6-30545862-A-G p.Lys76Glu missense ABCF1 1 81008 1.23445E-5 40504 0 NA
6-30545863-A-G p.Lys76Arg missense ABCF1 2 81002 2.46907E-5 40501 0 1.19441E-5
6-30545866-G-A p.Arg77Gln missense ABCF1 2 81000 2.46914E-5 40500 0 1.65265E-5
6-30545871-A-G p.Thr79Ala missense ABCF1 1 81002 1.23454E-5 40501 0 NA
6-30545872-C-T p.Thr79Ile missense ABCF1 2 81002 2.46907E-5 40501 0 1.59136E-5
6-30545875-G-A p.Arg80Gln missense ABCF1 2 81006 2.46895E-5 40503 0 3.97836E-6
6-30545879-A-G p.Lys81Lys synonymous ABCF1 729 80988 0.00900133 40494 6 0.033125
6-30545880-G-A p.Gly82Ser missense ABCF1 1 81010 1.23442E-5 40505 0 NA
6-30545886-C-T p.Arg84Trp missense ABCF1 2 81008 2.46889E-5 40504 0 3.21688E-5
6-30545887-G-A p.Arg84Gln missense ABCF1 15 81020 1.85139E-4 40510 0 5.56855E-5
6-30545894-G-C p.Lys86Asn missense ABCF1 1 81020 1.23426E-5 40510 0 NA
6-30545900-G-C p.Val88Val synonymous ABCF1 1 81012 1.23439E-5 40506 0 NA
6-30545907-G-C p.Asp91His missense ABCF1 3 81022 3.7027E-5 40511 0 8.24198E-6
6-30545907-G-A p.Asp91Asn missense ABCF1 1 81022 1.23423E-5 40511 0 8.24198E-6
6-30545908-A-C p.Asp91Ala missense ABCF1 1 81020 1.23426E-5 40510 0 1.81321E-4
6-30545910-G-A p.Gly92Arg missense ABCF1 23 81014 2.83902E-4 40507 0 3.19468E-5
6-30545916-GA-TT p.Glu94Leu missense ABCF1 1 81016 1.23432E-5 40508 0 NA
6-30545923-A-G p.Glu96Gly missense ABCF1 1 81012 1.23439E-5 40506 0 NA
6-30545934-C-T p.Arg100Cys missense ABCF1 8 81006 9.87581E-5 40503 0 5.44662E-4
6-30545935-G-A p.Arg100His missense ABCF1 3 80998 3.7038E-5 40499 0 9.58099E-5
6-30545948-C-T p.Leu104Leu synonymous ABCF1 8 81016 9.87459E-5 40508 0 1.43192E-4
6-30545977-A-C p.Glu114Ala missense+splice_region ABCF1 1 81030 1.23411E-5 40515 0 NA
6-30545979-G-A p.Val115Ile missense+splice_region ABCF1 14 81032 1.72771E-4 40516 0 1.91302E-4
6-30546130-G-A p.Ala117Thr missense ABCF1 1 80618 1.24042E-5 40309 0 2.47415E-5
6-30546142-C-T p.Arg121Cys missense ABCF1 4 80788 4.95123E-5 40394 0 4.12242E-5
6-30546143-G-A p.Arg121His missense ABCF1 1 80776 1.23799E-5 40388 0 5.96469E-5
6-30546144-C-T p.Arg121Arg synonymous ABCF1 3 80808 3.7125E-5 40404 0 8.24389E-5
6-30546145-G-A p.Gly122Arg missense ABCF1 1 80844 1.23695E-5 40422 0 6.37674E-5
6-30546151-A-G p.Lys124Glu missense ABCF1 3 80928 3.707E-5 40464 0 7.1574E-5
6-30546160-AAGGTAAGCCATCTGTGTGGTAAACGGAGACTCCAAGGATGCAACCTTGACCATCCTACTGACTTCTGTGGCCCTTTCATTCTCT-A p.Gly128fs frameshift ABCF1 4 80966 4.94035E-5 40483 0 NA
6-30546164-T-A c.381+2T>A splice_donor ABCF1 3 80982 3.70453E-5 40491 0 8.23818E-6
6-30546167-G-A c.381+5G>A splice_region ABCF1 2 81000 2.46914E-5 40500 0 NA
6-30546170-A-G c.381+8A>G splice_region ABCF1 2 81016 2.46865E-5 40508 0 3.97633E-6
6-30546243-C-G c.382-4C>G splice_region ABCF1 11 81056 1.35709E-4 40528 0 6.60469E-5
6-30546255-T-C p.Asn130Asn synonymous ABCF1 2 81050 2.46761E-5 40525 0 3.19122E-5
6-30546258-T-G p.Val131Val synonymous ABCF1 1 81044 1.2339E-5 40522 0 8.26323E-6
6-30546261-T-C p.Phe132Phe synonymous ABCF1 1 81032 1.23408E-5 40516 0 3.18735E-5
6-30546263-C-T p.Ala133Val missense ABCF1 6 81034 7.4043E-5 40517 0 3.05957E-4
6-30546274-C-G p.Gln137Glu missense ABCF1 2 81062 2.46725E-5 40531 0 3.18857E-5
6-30546284-G-A p.Ser140Asn missense ABCF1 1 81072 1.23347E-5 40536 0 8.30275E-6
6-30546291-AGAG-A p.Glu146del disruptive_inframe_deletion ABCF1 3 81060 3.70096E-5 40530 0 3.9781E-6
6-30546332-C-T p.Pro156Leu missense ABCF1 1 81020 1.23426E-5 40510 0 2.58331E-5
6-30546333-G-A p.Pro156Pro synonymous ABCF1 16 81010 1.97506E-4 40505 0 0.00272331
6-30546344-G-A p.Arg160Gln missense ABCF1 2 80982 2.46968E-5 40491 0 0.00108932
6-30546345-G-A p.Arg160Arg synonymous ABCF1 1 80972 1.23499E-5 40486 0 1.7751E-5
6-30546361-G-T c.489+7G>T splice_region ABCF1 1 80916 1.23585E-5 40458 0 4.0244E-6
6-30547711-G-A p.Val165Ile missense ABCF1 1 79626 1.25587E-5 39813 0 1.62343E-5
6-30547715-C-G p.Ser166Cys missense ABCF1 3 79628 3.76752E-5 39814 0 9.51919E-5
6-30547729-C-T p.Pro171Ser missense ABCF1 2 79612 2.51218E-5 39806 0 4.05709E-6
6-30547731-T-C p.Pro171Pro synonymous ABCF1 2 79610 2.51225E-5 39805 0 3.18817E-5
6-30547732-G-A p.Ala172Thr missense ABCF1 1 79610 1.25612E-5 39805 0 NA
6-30547738-A-G p.Lys174Glu missense ABCF1 3 79598 3.76894E-5 39799 0 6.37267E-5
6-30547742-G-A p.Gly175Asp missense ABCF1 1 79590 1.25644E-5 39795 0 NA
6-30547743-C-T p.Gly175Gly synonymous ABCF1 1 79588 1.25647E-5 39794 0 NA
6-30547764-G-C p.Lys182Asn missense ABCF1 1 79566 1.25682E-5 39783 0 NA
6-30547775-A-G p.Lys186Arg missense ABCF1 1 79544 1.25717E-5 39772 0 4.06065E-6
6-30547782-G-A p.Lys188Lys splice_region+synonymous ABCF1 1 79530 1.25739E-5 39765 0 8.71703E-6
6-30548178-A-G c.565-5A>G splice_region ABCF1 2 78774 2.53891E-5 39387 0 1.97013E-5
6-30548182-G-A c.565-1G>A splice_acceptor ABCF1 2 78962 2.53286E-5 39481 0 NA
6-30548185-T-C p.Pro189Pro splice_region+synonymous ABCF1 1 78988 1.26602E-5 39494 0 NA
6-30548193-A-G p.Lys192Arg missense ABCF1 1 79122 1.26387E-5 39561 0 1.57381E-5
6-30548197-C-T p.Phe193Phe synonymous ABCF1 4 79100 5.05689E-5 39550 0 3.28818E-5
6-30548198-G-A p.Ala194Thr missense ABCF1 1 79052 1.26499E-5 39526 0 NA
6-30548210-A-G p.Asn198Asp missense ABCF1 1075 79204 0.0135725 39602 11 0.0398472
6-30548211-A-G p.Asn198Ser missense ABCF1 2 79246 2.52379E-5 39623 0 NA
6-30548213-G-A p.Glu199Lys missense ABCF1 1 79256 1.26173E-5 39628 0 3.20718E-5
6-30548216-G-A p.Glu200Lys missense ABCF1 1 79250 1.26183E-5 39625 0 NA
6-30548218-G-A p.Glu200Glu synonymous ABCF1 3 79250 3.78549E-5 39625 0 2.64396E-5
6-30548224-TAAA-T p.???106fs frameshift ABCF1 3 79252 3.78539E-5 39626 0 3.2111E-5
6-30548226-A-G p.Lys203Arg missense ABCF1 1 79284 1.26129E-5 39642 0 NA
6-30548231-G-A p.Glu205Lys missense ABCF1 3 79264 3.78482E-5 39632 0 1.27747E-4
6-30548273-GAGA-G p.Lys220del conservative_inframe_deletion ABCF1 1 78940 1.26678E-5 39470 0 NA
6-30548291-G-A p.Glu225Lys missense ABCF1 1 78790 1.2692E-5 39395 0 NA
6-30550168-C-T c.679-3C>T splice_region ABCF1 1 75948 1.31669E-5 37974 0 NA
6-30550175-C-T p.Ser228Leu missense ABCF1 7 76104 9.19794E-5 38052 0 3.19305E-4
6-30550184-AAGG-A p.Gly232del disruptive_inframe_deletion ABCF1 3 76272 3.93329E-5 38136 0 4.15275E-6
6-30550196-A-T p.Glu235Val missense ABCF1 1 76428 1.30842E-5 38214 0 9.76582E-6
6-30550200-AGAG-A p.Glu240del disruptive_inframe_deletion ABCF1 3 76474 3.9229E-5 38237 0 1.90038E-5
6-30550217-G-C p.Gly242Ala missense ABCF1 1 76570 1.30599E-5 38285 0 NA
6-30550231-G-GA p.Asp247fs frameshift ABCF1 1 76622 1.30511E-5 38311 0 NA
6-30550244-C-G p.Ala251Gly missense ABCF1 1 76630 1.30497E-5 38315 0 8.65621E-6
6-30550244-C-T p.Ala251Val missense ABCF1 1 76630 1.30497E-5 38315 0 4.09695E-6
6-30550252-A-G p.Ser254Gly missense ABCF1 1 76654 1.30456E-5 38327 0 NA
6-30550259-A-G p.Lys256Arg missense ABCF1 1 76656 1.30453E-5 38328 0 NA
6-30550848-G-A p.Glu266Glu synonymous ABCF1 2 79622 2.51187E-5 39811 0 NA
6-30550853-A-G p.Glu268Gly missense ABCF1 1 79612 1.25609E-5 39806 0 NA
6-30550856-GC-G p.Gln270fs frameshift ABCF1 1 79612 1.25609E-5 39806 0 NA
6-30550859-A-T p.Gln270Leu missense ABCF1 1 79618 1.256E-5 39809 0 NA
6-30550860-A-G p.Gln270Gln synonymous ABCF1 4 79616 5.02412E-5 39808 0 6.25E-4
6-30550860-A-C p.Gln270His missense ABCF1 2 79616 2.51206E-5 39808 0 NA
6-30550862-T-G p.Val271Gly missense ABCF1 1 79620 1.25597E-5 39810 0 NA
6-30550881-C-T p.Ala277Ala synonymous ABCF1 27 79608 3.39162E-4 39804 0 6.69003E-4
6-30550883-A-G p.Asn278Ser missense ABCF1 22 79610 2.76347E-4 39805 0 6.02939E-5
6-30550886-C-A p.Ala279Glu missense ABCF1 1 79608 1.25616E-5 39804 0 NA
6-30550905-C-T p.Ser285Ser synonymous ABCF1 4 79562 5.02753E-5 39781 0 4.05752E-5
6-30550906-G-A p.Val286Met missense ABCF1 1 79574 1.25669E-5 39787 0 3.18471E-5
6-30550917-G-A p.Ala289Ala synonymous ABCF1 2 79538 2.51452E-5 39769 0 3.18451E-5
6-30550921-A-C p.Met291Leu missense ABCF1 1 79504 1.2578E-5 39752 0 8.62679E-6
6-30550932-C-A p.Arg294Arg synonymous ABCF1 1 79578 1.25663E-5 39789 0 5.67993E-5
6-30550953-A-G p.Ala301Ala synonymous ABCF1 4 79586 5.02601E-5 39793 0 1.21812E-5
6-30550962-C-G p.Ile304Met missense ABCF1 2 79584 2.51307E-5 39792 1 NA
6-30551385-C-G p.Leu306Val missense+splice_region ABCF1 2 80786 2.47568E-5 40393 1 NA
6-30551387-G-T p.Leu306Leu splice_region+synonymous ABCF1 1 80796 1.23769E-5 40398 0 NA
6-30551405-C-T p.Ser312Ser synonymous ABCF1 2 80880 2.4728E-5 40440 0 3.58272E-5
6-30551406-G-A p.Ala313Thr missense ABCF1 1 80886 1.23631E-5 40443 0 8.23981E-6
6-30551426-C-T p.Phe319Phe synonymous ABCF1 890 80934 0.0109966 40467 10 0.0413943
6-30551427-G-A p.Val320Ile missense ABCF1 1 80958 1.23521E-5 40479 0 3.58237E-5
6-30551431-A-G p.Asn321Ser missense ABCF1 3 80982 3.70453E-5 40491 0 1.19406E-5
6-30551445-A-G p.Ile326Val missense ABCF1 3 80962 3.70544E-5 40481 0 3.18512E-5
6-30551454-G-A p.Gly329Ser missense ABCF1 2 80960 2.47036E-5 40480 0 6.37186E-5
6-30551461-G-A p.Arg331His missense ABCF1 5 81050 6.16903E-5 40525 0 3.1857E-5
6-30551477-A-G p.Gly336Gly synonymous ABCF1 1 81076 1.23341E-5 40538 0 6.37633E-5
6-30551484-GGGTGAGAAGAGGAGGGAGCTGGAGGCAAAAAAGGGCCTGGAGGGAAAAGAAGAGATTTCTCAGTGGTGGCCAGGTCCTAATAGCTTTTATTCCCCA-G p.Gly339fs frameshift ABCF1 10 81074 1.23344E-4 40537 1 NA
6-30551576-C-T c.1017-6C>T splice_region ABCF1 1 80552 1.24143E-5 40276 0 NA
6-30551595-A-G p.Thr344Ala missense ABCF1 4 80024 4.9985E-5 40012 0 4.39733E-5
6-30551597-A-C p.Thr344Thr synonymous ABCF1 2 79984 2.5005E-5 39992 0 NA
6-30551600-C-T p.Leu345Leu synonymous ABCF1 1 79924 1.25119E-5 39962 0 NA
6-30551603-C-G p.Leu346Leu synonymous ABCF1 40 79884 5.00726E-4 39942 0 0.0025
6-30551617-A-G p.Asn351Ser missense ABCF1 1 79776 1.25351E-5 39888 0 2.40867E-5
6-30551623-C-A p.Ala353Asp missense ABCF1 1 79698 1.25474E-5 39849 0 8.49372E-6
6-30551629-G-A p.Ser355Asn missense ABCF1 4 79656 5.02159E-5 39828 0 1.01973E-4
6-30551634-C-T p.Pro357Ser missense ABCF1 1 79626 1.25587E-5 39813 0 NA
6-30551666-G-GGA p.Cys365fs frameshift ABCF1 3 79332 3.78158E-5 39666 1 NA
6-30551976-A-G p.Val370Val synonymous ABCF1 1 78426 1.27509E-5 39213 0 NA
6-30552009-T-C p.Leu381Leu synonymous ABCF1 1 78206 1.27867E-5 39103 0 NA
6-30552018-C-T p.Asp384Asp synonymous ABCF1 1 78172 1.27923E-5 39086 0 2.02993E-5
6-30552050-G-A p.Arg395Gln missense ABCF1 1 77996 1.28212E-5 38998 0 2.02838E-5
6-30552052-C-T p.Arg396Trp missense ABCF1 4 77988 5.12899E-5 38994 0 5.44662E-4
6-30552053-G-A p.Arg396Gln missense ABCF1 191 78040 0.00244746 39020 2 0.00503473
6-30552057-T-G p.Leu397Leu synonymous ABCF1 5 78134 6.39926E-5 39067 0 1.72363E-5
6-30552066-G-A p.Gln400Gln synonymous ABCF1 1 78178 1.27913E-5 39089 0 NA
6-30552111-A-G c.1242+3A>G splice_region ABCF1 1 78966 1.26637E-5 39483 0 8.10721E-6
6-30552187-C-T c.1243-8C>T splice_region ABCF1 42 79148 5.30651E-4 39574 0 0.00108335
6-30552203-G-T p.Glu417Asp missense ABCF1 1 79024 1.26544E-5 39512 0 1.21663E-5
6-30552210-C-T p.Arg420Trp missense ABCF1 4 78856 5.07254E-5 39428 0 NA
6-30552224-G-A p.Ala424Ala synonymous ABCF1 2 78260 2.55558E-5 39130 0 6.37714E-5
6-30552230-T-G p.Ala426Ala synonymous ABCF1 10 78022 1.28169E-4 39011 0 3.18857E-5
6-30552236-G-T p.Glu428Asp missense ABCF1 1 77724 1.2866E-5 38862 0 NA
6-30552277-C-T p.Pro442Leu missense ABCF1 1 70716 1.41411E-5 35358 0 NA
6-30552298-C-T p.Thr449Ile missense ABCF1 3 62882 4.77084E-5 31441 0 8.64589E-5
6-30552314-G-C p.Gly454Gly synonymous ABCF1 1 57142 1.75003E-5 28571 0 8.95977E-6
6-30552317-C-T p.Gly455Gly synonymous ABCF1 5 56076 8.91647E-5 28038 0 0.00272926
6-30552328-G-A p.Arg459His missense ABCF1 1 52092 1.91968E-5 26046 0 NA
6-30552343-G-C p.Arg464Thr missense+splice_region ABCF1 2 47666 4.19586E-5 23833 0 6.37633E-5
6-30553031-C-T c.1392-6C>T splice_region ABCF1 8 79578 1.0053E-4 39789 0 1.37464E-4
6-30553055-C-T p.Pro470Pro synonymous ABCF1 2 79642 2.51124E-5 39821 0 NA
6-30553068-C-T p.Leu475Leu synonymous ABCF1 1 79658 1.25537E-5 39829 0 1.27413E-4
6-30553076-G-A p.Glu477Glu synonymous ABCF1 3 79670 3.76553E-5 39835 0 2.02198E-5
6-30553106-C-T p.Val487Val synonymous ABCF1 1 79664 1.25527E-5 39832 0 NA
6-30553124-C-T c.1475+4C>T splice_region ABCF1 2 79630 2.51162E-5 39815 0 5.92305E-4
6-30553125-G-A c.1475+5G>A splice_region ABCF1 1 79628 1.25584E-5 39814 0 5.15048E-5
6-30553330-C-T c.1476-5C>T splice_region ABCF1 1 79676 1.25508E-5 39838 0 1.21673E-5
6-30553362-G-T p.Leu501Phe missense ABCF1 1 79700 1.25471E-5 39850 0 3.18654E-5
6-30553365-G-C p.Leu502Leu synonymous ABCF1 1 79702 1.25467E-5 39851 0 NA
6-30553368-C-T p.Ile503Ile synonymous ABCF1 2 79708 2.50916E-5 39854 0 3.18573E-5
6-30553369-G-A p.Val504Ile missense ABCF1 4 79710 5.01819E-5 39855 0 5.44662E-4
6-30553393-G-T p.Asp512Tyr missense ABCF1 3 79692 3.76449E-5 39846 0 NA
6-30553398-T-G p.Asp513Glu missense ABCF1 30 79690 3.76459E-4 39845 0 4.45973E-4
6-30553419-C-T p.His520His synonymous ABCF1 1 79692 1.25483E-5 39846 0 NA
6-30553423-G-A p.Asp522Asn missense ABCF1 4 79698 5.01895E-5 39849 0 3.18552E-5
6-30553428-C-T p.Ala523Ala synonymous ABCF1 1 79690 1.25486E-5 39845 0 4.05459E-6
6-30553430-A-G p.Gln524Arg missense ABCF1 2 79688 2.50979E-5 39844 0 3.18573E-5
6-30553432-C-T p.Arg525Trp missense ABCF1 1 79690 1.25486E-5 39845 0 4.05502E-6
6-30553439-A-G p.His527Arg missense ABCF1 2 79696 2.50954E-5 39848 0 1.72111E-5
6-30553446-T-C p.Tyr529Tyr synonymous ABCF1 36 79696 4.51717E-4 39848 1 0.00125
6-30553449-G-C p.Arg530Ser missense ABCF1 1 79696 1.25477E-5 39848 0 NA
6-30553648-T-G c.1601-8T>G splice_region ABCF1 1 79364 1.26002E-5 39682 0 1.6073E-5
6-30553652-C-T c.1601-4C>T splice_region ABCF1 1 79390 1.2596E-5 39695 0 4.45173E-6
6-30553654-A-G c.1601-2A>G splice_acceptor ABCF1 1 79392 1.25957E-5 39696 0 NA
6-30553670-A-G p.Met539Val missense ABCF1 1 79474 1.25827E-5 39737 0 NA
6-30553720-G-GA p.Leu558fs frameshift ABCF1 2 79572 2.51345E-5 39786 0 NA
6-30553747-C-T p.Gly564Gly synonymous ABCF1 1 79576 1.25666E-5 39788 0 1.17019E-5
6-30553764-A-T p.Gln570Leu missense ABCF1 1 79554 1.25701E-5 39777 0 NA
6-30553768-G-A p.Ala571Ala splice_region+synonymous ABCF1 6 79536 7.54375E-5 39768 0 1.3412E-4
6-30553771-G-A c.1713+3G>A splice_region ABCF1 1 79498 1.25789E-5 39749 0 1.22929E-5
6-30553905-C-T c.1714-6C>T splice_region ABCF1 1 81028 1.23414E-5 40514 0 8.46324E-6
6-30553921-C-T p.Thr575Met missense ABCF1 1 81062 1.23362E-5 40531 0 1.67305E-5
6-30553922-G-A p.Thr575Thr synonymous ABCF1 3 81058 3.70105E-5 40529 0 1.59357E-4
6-30553928-A-G p.Glu577Glu synonymous ABCF1 20 81066 2.46713E-4 40533 0 1.27462E-4
6-30553936-C-T p.Thr580Ile missense ABCF1 1 81066 1.23356E-5 40533 0 1.59704E-5
6-30553938-C-T p.Arg581Trp missense ABCF1 15 81064 1.85039E-4 40532 0 1.3291E-4
6-30553957-G-A p.Arg587Gln missense ABCF1 4 81064 4.93437E-5 40532 0 3.18654E-5
6-30553960-G-A p.Arg588Gln missense ABCF1 3 81060 3.70096E-5 40530 0 1.19471E-5
6-30553981-C-T p.Ser595Phe missense ABCF1 1 81026 1.23417E-5 40513 0 3.98257E-6
6-30553989-G-T p.Ala598Ser missense ABCF1 1 80990 1.23472E-5 40495 0 NA
6-30553990-C-G p.Ala598Gly missense ABCF1 9 80990 1.11125E-4 40495 0 1.91058E-4
6-30553993-C-T p.Pro599Leu missense ABCF1 271 80996 0.00334584 40498 2 0.00771143
6-30554006-G-A p.Lys603Lys synonymous ABCF1 1 80990 1.23472E-5 40495 0 NA
6-30554008-G-A p.Arg604His missense ABCF1 1 80966 1.23509E-5 40483 0 8.28748E-6
6-30554012-T-C p.Pro605Pro synonymous ABCF1 2 80974 2.46993E-5 40487 0 NA
6-30554015-G-A p.Lys606Lys synonymous ABCF1 3 80990 3.70416E-5 40495 0 NA
6-30554028-C-T p.Arg611Cys missense ABCF1 1 80982 1.23484E-5 40491 0 8.29876E-6
6-30554029-G-A p.Arg611His missense ABCF1 1 80986 1.23478E-5 40493 0 1.60489E-5
6-30554030-C-T p.Arg611Arg synonymous ABCF1 1 80998 1.2346E-5 40499 0 NA
6-30554044-A-AC p.Pro619fs frameshift ABCF1 1 80952 1.2353E-5 40476 0 4.02992E-6
6-30554044-A-ACC p.Pro619fs frameshift ABCF1 1 80952 1.2353E-5 40476 0 NA
6-30554044-A-T p.Asp616Val missense ABCF1 1 80952 1.2353E-5 40476 0 NA
6-30554050-C-G p.Pro618Arg missense ABCF1 2 80982 2.46968E-5 40491 0 8.33111E-6
6-30554065-C-T p.Pro623Leu missense ABCF1 3 80962 3.70544E-5 40481 0 NA
6-30554066-A-G p.Pro623Pro synonymous ABCF1 1 80960 1.23518E-5 40480 0 NA
6-30554080-A-G p.His628Arg missense+splice_region ABCF1 13 80894 1.60704E-4 40447 0 1.27494E-4
6-30554251-G-A p.Gly629Asp missense+splice_region ABCF1 1 79690 1.25486E-5 39845 0 4.04223E-6
6-30554268-C-G p.Gln635Glu missense ABCF1 2 79696 2.50954E-5 39848 0 5.14642E-5
6-30554305-G-A p.Gly647Asp missense ABCF1 1 79698 1.25474E-5 39849 0 NA
6-30554325-AGTGAGTTGGCGGGGTTGCCTCAGGGATGTGTAGCAGGAGCCACAGGGAGAGTCTCTGGGGACCTCTTTGACCACCTGTCTTCCATCTTGCAG-A c.1960+1_1961-1delGTGAGTTGGCGGGGTTGCCTCAGGGATGTGTAGCAGGAGCCACAGGGAGAGTCTCTGGGGACCTCTTTGACCACCTGTCTTCCATCTTGCAG splice_acceptor ABCF1 10 79700 1.25471E-4 39850 3 NA
6-30554333-G-C c.1960+8G>C splice_region ABCF1 1 79680 1.25502E-5 39840 0 0.00125
6-30554420-T-G p.Cys655Gly missense+splice_region ABCF1 2 79662 2.51061E-5 39831 0 NA
6-30554430-G-A p.Gly658Asp missense ABCF1 2 79654 2.51086E-5 39827 0 NA
6-30554441-G-A p.Val662Met missense ABCF1 2 79628 2.51168E-5 39814 1 NA
6-30554446-G-A p.Gly663Gly synonymous ABCF1 1 79614 1.25606E-5 39807 0 3.62804E-5
6-30554458-A-G p.Leu667Leu synonymous ABCF1 4 79504 5.03119E-5 39752 0 5.44662E-4
6-30554479-G-A p.Lys674Lys synonymous ABCF1 1 79162 1.26323E-5 39581 0 NA
6-30554488-G-A p.Pro677Pro splice_region+synonymous ABCF1 3 78728 3.81059E-5 39364 0 8.07787E-5
6-30557487-AC-A p.His686fs frameshift ABCF1 1 81112 1.23286E-5 40556 0 NA
6-30557493-G-A p.Arg687Gln missense ABCF1 3 81114 3.6985E-5 40557 0 1.27453E-4
6-30557494-G-A p.Arg687Arg synonymous ABCF1 40 81116 4.93121E-4 40558 0 3.82287E-4
6-30557496-TGGTAAGTTGGCATTGGGATTTAGGGAATGATAATCTGATGGAGGAAGTGTGACTTTAACCGACCACCTCCCTCTCTTCTCGGGCA-T c.2064+1_2065-1delGTAAGTTGGCATTGGGATTTAGGGAATGATAATCTGATGGAGGAAGTGTGACTTTAACCGACCACCTCCCTCTCTTCTCGGGCAG splice_acceptor ABCF1 4 81114 4.93133E-5 40557 1 NA
6-30557497-G-A p.Leu688Leu splice_region+synonymous ABCF1 2 81118 2.46554E-5 40559 0 NA
6-30557576-C-T c.2065-7C>T splice_region ABCF1 4 81086 4.93303E-5 40543 0 1.72976E-4
6-30557599-A-G p.Asn694Ser missense ABCF1 1 81032 1.23408E-5 40516 0 2.47121E-5
6-30557604-C-T p.Gln696* stop_gained ABCF1 1 81020 1.23426E-5 40510 0 NA
6-30557623-G-A p.Arg702His missense ABCF1 3 80920 3.70737E-5 40460 0 3.18674E-5
6-30557636-G-A p.Thr706Thr synonymous ABCF1 4 80726 4.95503E-5 40363 0 1.27421E-4
6-30557639-C-T p.Pro707Pro synonymous ABCF1 1 80698 1.23919E-5 40349 0 NA
6-30557642-T-A p.Thr708Thr synonymous ABCF1 1 80652 1.23989E-5 40326 0 NA
6-30557651-G-A c.316-4G>A splice_region ABCF1 1 80440 1.24316E-5 40220 0 3.98149E-6
6-30557655-C-T p.Arg106Trp missense+splice_region ABCF1 2 80296 2.49078E-5 40148 0 3.98384E-6
6-30557656-G-A p.Arg106Gln missense+splice_region ABCF1 1 80274 1.24573E-5 40137 0 1.59236E-4
6-30557658-G-T p.Gly714Cys missense ABCF1 1 80214 1.24667E-5 40107 0 1.66199E-5
6-30557700-C-T p.Arg728Cys missense ABCF1 1 79654 1.25543E-5 39827 0 1.60635E-5
6-30557701-G-A p.Arg728His missense ABCF1 2 79638 2.51136E-5 39819 0 8.45952E-6
6-30557708-C-G p.Gly730Gly synonymous ABCF1 6 79594 7.53826E-5 39797 0 2.01049E-5
6-30557720-C-T p.His734His synonymous ABCF1 2 79550 2.51414E-5 39775 0 2.55337E-5
6-30557732-C-A p.Ile738Ile synonymous ABCF1 2 79512 2.51534E-5 39756 1 NA
6-30557745-C-T p.Leu743Phe missense ABCF1 3 79458 3.77558E-5 39729 0 NA
6-30557914-CCTTT-C c.2234-11_2234-8delCTTT splice_region ABCF1 2 79682 2.50998E-5 39841 0 NA
6-30557921-T-A c.2234-5T>A splice_region ABCF1 1 79678 1.25505E-5 39839 0 3.18492E-5
6-30557923-C-T c.2234-3C>T splice_region ABCF1 2 79682 2.50998E-5 39841 0 4.0538E-6
6-30557927-T-A p.Gly745Gly splice_region+synonymous ABCF1 1 79684 1.25496E-5 39842 0 3.18492E-5
6-30557939-G-A p.Ala749Ala synonymous ABCF1 43 79690 5.39591E-4 39845 0 0.0025
6-30557965-G-T p.Cys758Phe missense ABCF1 1 79698 1.25474E-5 39849 0 NA
6-30557967-C-T p.Arg759Trp missense ABCF1 2 79698 2.50947E-5 39849 0 1.2158E-5
6-30557968-G-A p.Arg759Gln missense ABCF1 1 79698 1.25474E-5 39849 0 3.18451E-5
6-30557980-T-C p.Val763Ala missense ABCF1 3 79698 3.76421E-5 39849 0 8.60259E-6
6-30557985-A-G p.Ile765Val missense ABCF1 1 79696 1.25477E-5 39848 0 NA
6-30557989-TGGTGAGTGAGCTGGGCTGTGGGAAAAGGGATAAGGGTAACAGTAATGGAAGACGGGAGTTGCAGTGCTCAGTCATGGAATTCCTCCTATGTA-T p.Asp767fs frameshift ABCF1 8 79692 1.00386E-4 39846 1 NA
6-30558077-A-G c.2299-6A>G splice_region ABCF1 1 79668 1.25521E-5 39834 0 1.73756E-5
6-30558107-A-G p.Ile775Val missense ABCF1 4 79662 5.02121E-5 39831 0 3.18857E-5
6-30558116-A-G p.Ile778Val missense ABCF1 2 79666 2.51048E-5 39833 0 3.18756E-5
6-30558306-T-A c.2372-6T>A splice_region ABCF1 1 79676 1.25508E-5 39838 0 NA
6-30558312-C-G p.Ala791Gly missense+splice_region ABCF1 2 79686 2.50985E-5 39843 0 8.96652E-6
6-30558320-G-A p.Val794Ile missense ABCF1 5 79690 6.27431E-5 39845 0 8.20917E-5
6-30558339-G-A p.Arg800Gln missense ABCF1 17 79694 2.13316E-4 39847 0 3.18654E-5
6-30558358-T-C p.Asn806Asn synonymous ABCF1 1 79696 1.25477E-5 39848 0 6.25E-4
6-30558380-G-GA p.Gln815fs frameshift ABCF1 2 79696 2.50954E-5 39848 0 4.05564E-6
6-30558387-G-A p.Ser816Asn missense ABCF1 3 79696 3.7643E-5 39848 0 8.61905E-6
6-30558388-T-C p.Ser816Ser synonymous ABCF1 1 79694 1.2548E-5 39847 0 3.19203E-5
6-30558394-C-G p.Ser818Arg missense ABCF1 4 79694 5.0192E-5 39847 0 3.00115E-4
6-30558400-C-T p.Ile820Ile synonymous ABCF1 1 79700 1.25471E-5 39850 0 NA
6-30558401-G-A p.Asp821Asn missense ABCF1 1 79700 1.25471E-5 39850 0 4.05548E-6
6-30558402-A-C p.Asp821Ala missense ABCF1 185 79698 0.00232126 39849 1 0.00503538
6-30558421-C-T p.Tyr827Tyr synonymous ABCF1 1 79690 1.25486E-5 39845 0 NA
6-30558425-C-T p.Arg829Trp missense ABCF1 4 79686 5.0197E-5 39843 0 2.15484E-4
6-30558429-A-G p.Glu830Gly missense ABCF1 1 79686 1.25493E-5 39843 0 NA
6-30558442-C-G p.Ala834Ala synonymous ABCF1 1 79684 1.25496E-5 39842 0 NA
6-30558465-G-A p.Arg842Gln missense ABCF1 4 79638 5.02273E-5 39819 0 6.25E-4
6-30558466-G-A p.Arg842Arg synonymous ABCF1 5 79636 6.27857E-5 39818 0 0.00108932
6-30558470-C-T p.Arg844* stop_gained ABCF1 2 79618 2.51199E-5 39809 0 6.17284E-5
6-30564340-TTTC-T c.*461-5_*461-3delTTC splice_region ABCF1 1 26 0.0384615 13 0 0.00657852
6-30564343-C-T c.*461-3C>T splice_region ABCF1 21 24 0.875 12 9 0.924425
6-30564344-A-T c.*461-2A>T splice_acceptor ABCF1 1 26 0.0384615 13 0 0.0395947