Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
14-74753040-CATGTGGCTCCTGCACGGGATCT-C c.*1624_*11718delAGATCCCGTGCAGGAGCCACAT splice_region ABCD4 1 71416 1.40025E-5 35708 0 NA
14-74753096-GTCC-G p.Glu156del disruptive_inframe_deletion ABCD4 4 81032 4.93632E-5 40516 0 6.36943E-5
14-74753096-G-A p.Asp157Asp synonymous ABCD4 6 81030 7.40466E-5 40515 0 6.21305E-5
14-74753107-C-G p.Asp154His missense ABCD4 1976 81434 0.024265 40717 104 0.0564938
14-74753107-C-A p.Asp154Tyr missense ABCD4 5 81680 6.12145E-5 40840 0 2.58853E-5
14-74753112-C-T p.Arg152Lys missense ABCD4 1992 81630 0.0244028 40815 110 0.0564866
14-74753115-A-G p.Leu151Pro missense ABCD4 1 81950 1.22026E-5 40975 0 8.52631E-6
14-74753120-C-T p.Ala149Ala synonymous ABCD4 3 82078 3.65506E-5 41039 0 1.60146E-5
14-74753123-C-T p.Ser148Ser synonymous ABCD4 1 82220 1.21625E-5 41110 0 3.18451E-5
14-74753124-G-A p.Ser148Leu missense ABCD4 4 82264 4.86239E-5 41132 0 3.37519E-5
14-74753128-C-T p.Gly147Arg missense ABCD4 2 82788 2.41581E-5 41394 0 9.21227E-5
14-74753129-G-A p.Gly146Gly synonymous ABCD4 6 82834 7.2434E-5 41417 0 7.97385E-6
14-74753129-G-GC p.Gly147fs frameshift ABCD4 2 82834 2.41447E-5 41417 0 NA
14-74753130-CCA-C p.Cys145fs frameshift ABCD4 1 82858 1.20688E-5 41429 0 3.1841E-5
14-74753134-A-G p.Cys145Arg missense ABCD4 2 82954 2.41097E-5 41477 0 6.36821E-5
14-74753140-G-A p.Pro143Ser missense ABCD4 2 82994 2.40981E-5 41497 0 NA
14-74753141-C-T p.Glu142Glu synonymous ABCD4 1495 82938 0.0180255 41469 85 0.0404433
14-74753151-A-G p.Leu139Ser missense ABCD4 2 83100 2.40674E-5 41550 0 NA
14-74753159-G-A p.Leu136Leu synonymous ABCD4 2 83124 2.40604E-5 41562 0 7.95634E-6
14-74753171-A-G p.Val605Ala missense ABCD4 1 83176 1.20227E-5 41588 0 2.4802E-5
14-74753191-C-G p.Trp598Cys missense ABCD4 1 83192 1.20204E-5 41596 0 3.1837E-5
14-74753195-C-A p.Arg597Ile missense ABCD4 1 83202 1.20189E-5 41601 0 8.253E-6
14-74753204-CCA-C p.Cys593fs frameshift ABCD4 1 83206 1.20184E-5 41603 0 NA
14-74753228-T-A p.His586Leu missense ABCD4 1 83202 1.20189E-5 41601 0 NA
14-74753236-C-T p.Val111Ile missense ABCD4 3 83188 3.60629E-5 41594 0 8.24756E-6
14-74753253-A-G p.Met105Thr missense ABCD4 1 83120 1.20308E-5 41560 0 3.29881E-5
14-74753254-T-A p.Met105Leu missense ABCD4 1 83114 1.20317E-5 41557 0 NA
14-74753256-G-A p.Ser104Phe missense ABCD4 5 83086 6.01786E-5 41543 0 7.96147E-6
14-74753274-C-A c.*103G>T splice_region ABCD4 62 82932 7.476E-4 41466 0 4.14693E-4
14-74753382-C-CGAGAG p.Ala488fs frameshift ABCD4 1 82982 1.20508E-5 41491 0 NA
14-74753384-A-ACGGG p.Met487fs frameshift ABCD4 2 83016 2.40917E-5 41508 0 NA
14-74753385-T-TA p.Met487fs frameshift ABCD4 2 83020 2.40906E-5 41510 0 NA
14-74753385-T-A p.Met487Leu missense ABCD4 1 83020 1.20453E-5 41510 0 8.28583E-6
14-74753397-C-T p.Val483Met missense ABCD4 4 83046 4.81661E-5 41523 0 4.78053E-5
14-74753398-G-C c.1752+6C>G splice_region ABCD4 2 83060 2.4079E-5 41530 0 NA
14-74753399-G-A p.Pro482Leu missense ABCD4 112 83056 0.00134849 41528 2 0.0125
14-74753412-G-C p.Leu478Val missense ABCD4 1 83120 1.20308E-5 41560 0 7.96261E-6
14-74753413-G-C p.Ser477Arg missense ABCD4 4 83092 4.81394E-5 41546 0 4.95401E-5
14-74753419-C-T p.Arg475Arg synonymous ABCD4 1 83104 1.20331E-5 41552 0 5.03525E-4
14-74753420-C-T p.Arg475Gln missense ABCD4 227 83108 0.00273139 41554 1 0.00560688
14-74753421-G-A p.Arg475Trp missense ABCD4 3 83112 3.60959E-5 41556 0 3.18492E-5
14-74753423-T-C p.His474Arg missense ABCD4 4 83130 4.81174E-5 41565 0 2.47651E-5
14-74753432-C-T p.Ser471Asn missense ABCD4 3 83164 3.60733E-5 41582 0 NA
14-74753440-C-T p.Thr468Thr synonymous ABCD4 12 83142 1.44331E-4 41571 0 1.59175E-4
14-74753444-A-G p.Met467Thr missense ABCD4 1 83140 1.20279E-5 41570 0 3.18573E-5
14-74753446-C-A p.Gly466Gly synonymous ABCD4 8 83158 9.62024E-5 41579 0 6.25E-4
14-74753452-C-T p.Gln464Gln synonymous ABCD4 4 83140 4.81116E-5 41570 0 1.19387E-5
14-74753463-T-C p.Ile461Val missense ABCD4 2 83116 2.40628E-5 41558 0 8.25805E-6
14-74753466-G-A p.Arg460Cys missense ABCD4 3 83108 3.60976E-5 41554 0 1.65199E-5
14-74753468-T-C p.Tyr459Cys missense ABCD4 5 83110 6.01612E-5 41555 0 6.37024E-5
14-74753469-A-G p.Tyr459His missense ABCD4 2 83104 2.40662E-5 41552 0 NA
14-74753476-G-A p.Ser456Ser synonymous ABCD4 7 82998 8.43394E-5 41499 0 9.55475E-5
14-74753479-C-T p.Glu455Glu synonymous ABCD4 3 83002 3.61437E-5 41501 0 NA
14-74753487-C-T p.Glu453Lys missense ABCD4 1 82934 1.20578E-5 41467 0 1.19414E-5
14-74753497-G-C p.Pro183Arg missense ABCD4 1 82822 1.20741E-5 41411 0 NA
14-74753525-G-C c.1325-6C>G splice_region ABCD4 3 82122 3.6531E-5 41061 0 1.59297E-4
14-74753525-G-T c.1325-6C>A splice_region ABCD4 1 82120 1.21773E-5 41060 0 3.99351E-6
14-74753525-G-A c.1325-6C>T splice_region ABCD4 1 82122 1.2177E-5 41061 0 8.42659E-6
14-74754516-C-A p.Ala441Ser missense ABCD4 2 82624 2.4206E-5 41312 0 2.29331E-5
14-74754516-C-T p.Ala441Thr missense ABCD4 3 82624 3.63091E-5 41312 0 2.29331E-5
14-74754523-C-T p.Arg172Gln missense ABCD4 1 82734 1.20869E-5 41367 0 4.36767E-5
14-74754529-C-A p.Cys170Phe missense ABCD4 1 82812 1.20755E-5 41406 0 NA
14-74754531-G-T p.Leu436Met missense ABCD4 1 82858 1.20688E-5 41429 0 NA
14-74754557-C-T p.Arg427Gln missense ABCD4 1 82960 1.2054E-5 41480 0 9.77727E-6
14-74754559-T-C p.Asn160Ser missense ABCD4 1 82956 1.20546E-5 41478 0 6.25E-4
14-74754560-T-A p.Gln426Leu missense ABCD4 8 82956 9.64367E-5 41478 0 9.55962E-5
14-74754561-G-C p.Gln426Glu missense ABCD4 2 82954 2.41097E-5 41477 0 NA
14-74754561-G-A p.Gln426* stop_gained ABCD4 1 82954 1.20549E-5 41477 0 9.75515E-6
14-74754562-C-T p.Met425Ile missense ABCD4 1 82944 1.20563E-5 41472 0 NA
14-74754566-T-TC p.Glu424fs frameshift ABCD4 2 82938 2.41144E-5 41469 0 NA
14-74754571-C-T p.Arg156Gln missense ABCD4 6 82936 7.23449E-5 41468 0 3.18471E-5
14-74754572-G-A p.Pro422Leu missense ABCD4 6 82922 7.23572E-5 41461 0 4.91555E-5
14-74754580-A-C p.Phe153Cys missense ABCD4 1 82902 1.20624E-5 41451 0 NA
14-74754589-C-A p.Trp416Cys missense+splice_region ABCD4 1 82844 1.20709E-5 41422 0 NA
14-74754923-C-T p.Val412Met missense ABCD4 1 82826 1.20735E-5 41413 0 3.18634E-5
14-74754924-C-T p.Arg145Lys missense ABCD4 2 82828 2.41464E-5 41414 0 3.18593E-5
14-74754924-C-G p.Gln411His missense ABCD4 1 82828 1.20732E-5 41414 0 9.53816E-6
14-74754930-G-A p.Thr143Ile missense ABCD4 7 82772 8.45697E-5 41386 0 6.37308E-5
14-74754936-G-A p.Ala141Val missense ABCD4 2423 82666 0.0293107 41333 229 0.0632814
14-74754937-C-A p.Gly407Val missense ABCD4 2 82772 2.41628E-5 41386 0 NA
14-74754940-T-C p.Glu406Gly missense ABCD4 1 82762 1.20828E-5 41381 0 3.22755E-5
14-74754949-G-T p.Ala403Glu missense ABCD4 2 82610 2.42101E-5 41305 0 5.04032E-4
14-74754950-C-T p.Trp136* stop_gained ABCD4 4 82590 4.8432E-5 41295 0 0.00187735
14-74754951-C-T p.Trp136* stop_gained ABCD4 12 82596 1.45285E-4 41298 0 7.42028E-5
14-74754953-C-A p.Val402Leu missense ABCD4 1 82554 1.21133E-5 41277 0 NA
14-74754957-G-C p.Asn400Lys missense ABCD4 1 82510 1.21197E-5 41255 0 NA
14-74754970-A-G c.1195-8T>C splice_region ABCD4 1 82226 1.21616E-5 41113 0 9.55353E-5
14-74755355-C-T c.395+8G>A splice_region ABCD4 2 82056 2.43736E-5 41028 0 9.62232E-5
14-74755356-T-C c.395+7A>G splice_region ABCD4 10 82064 1.21856E-4 41032 0 0.0025
14-74755359-C-G c.395+4G>C splice_region ABCD4 2 82132 2.4351E-5 41066 0 NA
14-74755372-G-A p.Thr129Ile missense ABCD4 1 82438 1.21303E-5 41219 0 6.25E-4
14-74755377-C-T p.Gly127Gly synonymous ABCD4 7 82510 8.48382E-5 41255 0 1.27478E-4
14-74755391-G-C p.Pro123Ala missense ABCD4 1 82744 1.20855E-5 41372 0 3.18817E-5
14-74755394-C-T p.Asp122Asn missense ABCD4 1 82778 1.20805E-5 41389 0 5.6971E-5
14-74755418-C-T c.1194+1G>A splice_donor ABCD4 2 83006 2.40946E-5 41503 0 4.00606E-6
14-74755422-G-T p.Gly397Gly synonymous ABCD4 2 83042 2.40842E-5 41521 0 2.82491E-5
14-74755422-G-C p.Gly397Gly synonymous ABCD4 1 83042 1.20421E-5 41521 0 9.41637E-6
14-74755427-C-T p.Ala396Thr missense ABCD4 9 83168 1.08215E-4 41584 0 5.03525E-4
14-74755444-A-G p.Leu390Ser missense ABCD4 1 83190 1.20207E-5 41595 0 3.98902E-6
14-74755447-A-G p.Ile389Thr missense ABCD4 1 83194 1.20201E-5 41597 0 7.20474E-5
14-74755449-C-T p.Arg388Arg synonymous ABCD4 1 83200 1.20192E-5 41600 0 3.18573E-5
14-74755458-A-G p.Ter173Argext*? stop_lost ABCD4 1 83202 1.20189E-5 41601 0 NA
14-74755458-A-T p.Ter173Argext*? stop_lost ABCD4 1 83202 1.20189E-5 41601 0 0.00100705
14-74755460-C-T p.Asp385Asn missense ABCD4 11 83194 1.32221E-4 41597 0 1.91253E-4
14-74755461-G-A p.Arg172* stop_gained ABCD4 1 83178 1.20224E-5 41589 0 9.14327E-6
14-74755471-G-GAGTCGGGGTAGACCTCCTTCAGGGGATATATCACCTGCTC c.1145-4_1145-3insGAGCAGGTGATATATCCCCTGAAGGAGGTCTACCCCGACT splice_region ABCD4 1 83142 1.20276E-5 41571 0 NA
14-74756188-G-A p.Ser381Leu missense+splice_region ABCD4 2 83192 2.40408E-5 41596 0 NA
14-74756192-C-T p.Asp380Asn missense ABCD4 6 83178 7.21345E-5 41589 0 4.78484E-5
14-74756193-G-A p.Arg167* stop_gained ABCD4 1 83180 1.20221E-5 41590 0 3.98746E-5
14-74756195-G-A p.Pro379Ser missense ABCD4 1 83180 1.20221E-5 41590 0 NA
14-74756217-T-C p.Ile371Met missense ABCD4 1 83162 1.20247E-5 41581 0 NA
14-74756224-TG-T c.1108-3delC splice_region ABCD4 1 83170 1.20236E-5 41585 0 NA
14-74756730-C-T p.Gln369Gln splice_region+synonymous ABCD4 1 83208 1.20181E-5 41604 0 6.37633E-5
14-74756737-C-T p.Arg367Gln missense ABCD4 1 83230 1.20149E-5 41615 0 6.37918E-5
14-74756738-G-A p.Arg367Trp missense ABCD4 184 83224 0.0022109 41612 0 0.00352467
14-74756745-C-T p.Gly364Gly synonymous ABCD4 1 83252 1.20117E-5 41626 0 3.97678E-6
14-74756747-C-T p.Gly364Arg missense ABCD4 5 83256 6.00557E-5 41628 0 3.97665E-6
14-74756748-G-A p.Asp363Asp synonymous ABCD4 1 83242 1.20132E-5 41621 0 3.18756E-5
14-74756760-T-C p.Pro359Pro synonymous ABCD4 1 83280 1.20077E-5 41640 0 NA
14-74756774-G-A p.Leu355Leu synonymous ABCD4 1 83244 1.20129E-5 41622 0 NA
14-74756781-C-T p.Val352Val synonymous ABCD4 1 82766 1.20823E-5 41383 0 9.12378E-5
14-74756796-A-G p.Phe347Phe synonymous ABCD4 2 82916 2.41208E-5 41458 0 NA
14-74756800-T-C p.Asp346Gly missense ABCD4 6 82918 7.23606E-5 41459 0 3.19081E-5
14-74756803-G-A p.Thr345Met missense ABCD4 3 82944 3.6169E-5 41472 0 6.25E-4
14-74756812-T-C p.Gln342Arg missense ABCD4 2 83060 2.4079E-5 41530 0 1.19352E-5
14-74756821-C-T p.Gly339Asp missense+splice_region ABCD4 1 83090 1.20351E-5 41545 0 NA
14-74756827-G-T c.1016-6C>A splice_region ABCD4 2 83118 2.40622E-5 41559 0 NA
14-74756829-G-A c.1016-8C>T splice_region ABCD4 1 83114 1.20317E-5 41557 0 NA
14-74756986-G-A c.1015+8C>T splice_region ABCD4 2 83090 2.40703E-5 41545 0 3.29886E-5
14-74756992-AC-A c.1015+1delG splice_donor ABCD4 1 83150 1.20265E-5 41575 0 NA
14-74756993-C-T c.1015+1G>A splice_donor ABCD4 1 83156 1.20256E-5 41578 0 1.64902E-5
14-74756995-C-G p.Arg338Arg splice_region+synonymous ABCD4 2 83166 2.40483E-5 41583 1 NA
14-74756995-C-A p.Arg338Arg splice_region+synonymous ABCD4 1 83166 1.20241E-5 41583 0 3.18674E-5
14-74756996-C-T p.Arg338Gln missense+splice_region ABCD4 27 83180 3.24597E-4 41590 0 3.95713E-4
14-74756997-G-A p.Arg338Trp missense ABCD4 2 83158 2.40506E-5 41579 0 1.19357E-5
14-74756999-G-A p.Thr337Ile missense ABCD4 1 83156 1.20256E-5 41578 0 3.97801E-6
14-74757003-T-C p.Ser336Gly missense ABCD4 1 83192 1.20204E-5 41596 0 NA
14-74757005-G-A p.Thr335Met missense ABCD4 10 83192 1.20204E-4 41596 0 1.48324E-4
14-74757018-C-T p.Gly331Ser missense ABCD4 1 83204 1.20187E-5 41602 0 1.19316E-5
14-74757019-C-T p.Leu330Leu synonymous ABCD4 2448 83168 0.0294344 41584 231 0.0631975
14-74757026-C-T p.Arg328Gln missense ABCD4 1 83220 1.20163E-5 41610 0 8.23791E-6
14-74757026-CG-C p.Arg328fs frameshift ABCD4 1 83220 1.20163E-5 41610 0 3.18613E-5
14-74757027-G-A p.Arg328Trp missense ABCD4 1 83220 1.20163E-5 41610 0 1.31804E-4
14-74757031-C-G p.Leu326Phe missense ABCD4 4 83218 4.80665E-5 41609 0 1.27453E-4
14-74757038-G-A p.Thr324Ile missense ABCD4 2 83240 2.40269E-5 41620 0 NA
14-74757047-G-A p.Thr321Ile missense ABCD4 3 83230 3.60447E-5 41615 0 8.23723E-6
14-74757051-C-T p.Gly320Ser missense ABCD4 1 83226 1.20155E-5 41613 0 NA
14-74757052-C-T n.521G>A splice_region ABCD4 3 83224 3.60473E-5 41612 0 1.64745E-5
14-74757070-C-T p.Leu313Leu synonymous ABCD4 2 83226 2.4031E-5 41613 0 NA
14-74757073-GCT-G p.Ser312fs frameshift ABCD4 2 83214 2.40344E-5 41607 0 8.2371E-6
14-74757081-C-T p.Gly310Arg missense ABCD4 1 83208 1.20181E-5 41604 0 NA
14-74757082-C-G p.Glu309Asp missense ABCD4 1 83222 1.20161E-5 41611 0 NA
14-74757084-C-T p.Glu309Lys missense ABCD4 2 83214 2.40344E-5 41607 0 7.15763E-5
14-74757091-C-T p.Lys306Lys synonymous ABCD4 69 83216 8.29167E-4 41608 0 6.25E-4
14-74757110-A-G p.Ile300Thr missense ABCD4 2 83164 2.40489E-5 41582 0 8.23737E-6
14-74757116-G-C p.Pro298Arg missense ABCD4 1 83142 1.20276E-5 41571 0 NA
14-74757127-G-C p.Ser294Ser synonymous ABCD4 1 83088 1.20354E-5 41544 0 3.18654E-5
14-74757128-G-A p.Ser294Phe missense ABCD4 1 83092 1.20349E-5 41546 0 9.88566E-5
14-74757132-G-C p.Pro293Ala missense ABCD4 1 83072 1.20378E-5 41536 0 3.97662E-6
14-74757139-G-A p.Ile290Ile synonymous ABCD4 4 83070 4.81522E-5 41535 0 0.00125
14-74757145-G-T p.Val288Val synonymous ABCD4 1 83050 1.20409E-5 41525 0 NA
14-74757148-C-T p.Arg287Arg synonymous ABCD4 1 83016 1.20459E-5 41508 0 NA
14-74757149-C-A p.Arg287Leu missense ABCD4 1 83002 1.20479E-5 41501 0 NA
14-74757175-T-C p.Pro278Pro synonymous ABCD4 1 82732 1.20872E-5 41366 0 NA
14-74757176-G-A p.Pro278Leu missense ABCD4 1 82714 1.20899E-5 41357 0 NA
14-74757184-C-T p.Ala275Ala synonymous ABCD4 4 82462 4.85072E-5 41231 0 NA
14-74757185-G-A p.Ala275Val missense ABCD4 4 82410 4.85378E-5 41205 0 1.90612E-4
14-74757193-C-G p.Gly272Gly synonymous ABCD4 3 82148 3.65195E-5 41074 0 1.27673E-4
14-74757194-C-T p.Gly272Glu missense ABCD4 1 82110 1.21788E-5 41055 0 NA
14-74758983-T-C c.806+7A>G splice_region ABCD4 1 82004 1.21945E-5 41002 0 3.18552E-5
14-74758987-C-T c.806+3G>A splice_region ABCD4 1 82146 1.21734E-5 41073 0 NA
14-74758989-C-G c.806+1G>C splice_donor ABCD4 1 82194 1.21663E-5 41097 0 8.25069E-6
14-74759006-C-T p.Glu264Lys missense ABCD4 29397 81386 0.361205 40693 5605 0.485383
14-74759012-C-T p.Glu262Lys missense ABCD4 3 82536 3.63478E-5 41268 0 1.99E-5
14-74759015-C-A p.Gly261Cys missense ABCD4 3 82598 3.63205E-5 41299 0 0.0020141
14-74759025-G-A c.*689C>T splice_region ABCD4 22 82678 2.66093E-4 41339 0 6.25E-4
14-74759030-C-T p.Asp256Asn missense ABCD4 2 82760 2.41663E-5 41380 0 NA
14-74759048-T-C p.Met250Val missense ABCD4 3 82792 3.62354E-5 41396 0 5.57094E-5
14-74759052-C-T p.Leu248Leu synonymous ABCD4 16 82762 1.93325E-4 41381 0 3.18451E-5
14-74759059-G-C p.Thr246Arg missense ABCD4 1815 82648 0.0219606 41324 24 0.017968
14-74759059-G-A p.Thr246Met missense ABCD4 9 82692 1.08838E-4 41346 0 6.76687E-5
14-74759065-C-T p.Arg244Gln missense ABCD4 98 82682 0.00118526 41341 0 0.00267499
14-74759065-C-A p.Arg244Leu missense ABCD4 26 82688 3.14435E-4 41344 0 6.36902E-4
14-74759066-G-A p.Arg244Trp missense ABCD4 88 82662 0.00106458 41331 2 0.010625
14-74759068-A-G p.Leu243Pro missense ABCD4 2 82668 2.41932E-5 41334 0 NA
14-74759246-G-A c.716+8C>T splice_region ABCD4 5 82674 6.04785E-5 41337 0 3.41146E-5
14-74759248-C-A c.716+6G>T splice_region ABCD4 334 82698 0.00403879 41349 9 0.00758155
14-74759249-C-T c.716+5G>A splice_region ABCD4 10 82732 1.20872E-4 41366 2 2.03704E-4
14-74759256-G-T p.His238Gln missense+splice_region ABCD4 1 82864 1.2068E-5 41432 0 NA
14-74759259-C-T p.Thr237Thr synonymous ABCD4 173 82850 0.00208811 41425 1 0.00305791
14-74759260-G-A p.Thr237Met missense ABCD4 6 82904 7.23729E-5 41452 0 6.36983E-5
14-74759263-T-C p.Tyr236Cys missense ABCD4 1 82938 1.20572E-5 41469 0 NA
14-74759266-C-A p.Gly235Val missense ABCD4 1 82982 1.20508E-5 41491 0 NA
14-74759273-C-T p.Val233Met missense ABCD4 1 83016 1.20459E-5 41508 0 NA
14-74759284-G-A p.Thr229Met missense ABCD4 4 83118 4.81244E-5 41559 0 2.18937E-4
14-74759286-C-G p.Thr228Thr synonymous ABCD4 1 83112 1.2032E-5 41556 0 1.24382E-4
14-74759286-C-T p.Thr228Thr synonymous ABCD4 1 83112 1.2032E-5 41556 0 1.65843E-5
14-74759286-C-A p.Thr228Thr synonymous ABCD4 1 83112 1.2032E-5 41556 0 NA
14-74759287-G-A p.Thr228Met missense ABCD4 4 83124 4.81209E-5 41562 0 3.18613E-5
14-74759296-T-C p.Asp225Gly missense ABCD4 1 83130 1.20294E-5 41565 0 1.65618E-5
14-74759298-G-A p.Ile224Ile synonymous ABCD4 3 83146 3.60811E-5 41573 0 8.27924E-6
14-74759301-G-T p.Leu223Leu synonymous ABCD4 29938 82672 0.36213 41336 5807 0.48137
14-74759325-G-A p.Tyr215Tyr synonymous ABCD4 1 83182 1.20218E-5 41591 0 NA
14-74759326-T-G p.Tyr215Ser missense ABCD4 1 83192 1.20204E-5 41596 0 NA
14-74759326-T-C p.Tyr215Cys missense ABCD4 1 83192 1.20204E-5 41596 0 6.40533E-5
14-74759335-A-C p.Val212Gly missense ABCD4 1 83196 1.20198E-5 41598 0 8.25832E-6
14-74759340-G-C p.Ala210Ala synonymous ABCD4 1 83204 1.20187E-5 41602 0 3.19081E-5
14-74759341-G-C p.Ala210Gly missense ABCD4 1 83204 1.20187E-5 41602 0 1.1937E-5
14-74759345-TCTGGACAGGATGGGAAGAGGTCAAGCAGGTCTCGACTCGAGCCCACAGACACTGGGCCAAGGACAGAGAGGGACAGCATGTGGGGTGACCAAGAGGGAGTCTCAC-T c.624+1_625-1del splice_acceptor ABCD4 7 83208 8.41265E-5 41604 0 NA
14-74759451-C-T p.Lys208Lys splice_region+synonymous ABCD4 1 83230 1.20149E-5 41615 0 NA
14-74759457-G-A p.Val206Val synonymous ABCD4 2 83246 2.40252E-5 41623 0 3.98454E-6
14-74759477-C-T p.Ala200Thr missense ABCD4 30267 82848 0.365332 41424 5848 0.486908
14-74759489-C-T p.Asp196Asn missense ABCD4 3 83290 3.60187E-5 41645 0 3.18492E-5
14-74759494-T-C p.Tyr194Cys missense ABCD4 4 83294 4.80227E-5 41647 0 6.37267E-5
14-74759501-C-T p.Gly192Arg missense ABCD4 1 83276 1.20083E-5 41638 0 NA
14-74759502-G-A p.Ser191Ser synonymous ABCD4 1 83270 1.20091E-5 41635 0 1.64978E-5
14-74759519-C-T p.Ala186Thr missense ABCD4 2 83280 2.40154E-5 41640 0 1.19338E-5
14-74759520-G-A p.Ile185Ile synonymous ABCD4 10 83282 1.20074E-4 41641 0 1.67062E-4
14-74759526-A-C p.Val183Val synonymous ABCD4 2 83280 2.40154E-5 41640 0 3.18512E-5
14-74759527-A-G p.Val183Ala missense ABCD4 1 83282 1.20074E-5 41641 0 8.24063E-6
14-74759529-G-A p.Tyr182Tyr synonymous ABCD4 2453 83234 0.0294711 41617 229 0.063233
14-74759534-T-C p.Ser181Gly missense ABCD4 2 83264 2.402E-5 41632 0 NA
14-74759539-A-G p.Ile179Thr missense ABCD4 2 83280 2.40154E-5 41640 0 NA
14-74759543-T-C p.Ser178Gly missense ABCD4 1 83280 1.20077E-5 41640 0 6.37227E-5
14-74759570-C-T p.Gly169Ser missense+splice_region ABCD4 1 83238 1.20137E-5 41619 0 4.1246E-5
14-74759571-G-A p.Arg89Trp missense+splice_region ABCD4 5 83232 6.0073E-5 41616 0 5.03525E-4
14-74759575-G-A c.503-3C>T splice_region ABCD4 5 83222 6.00803E-5 41611 0 3.18512E-5
14-74759851-G-A c.502+6C>T splice_region ABCD4 1 83116 1.20314E-5 41558 0 1.9927E-5
14-74759857-T-C p.Ile168Val missense+splice_region ABCD4 2 83156 2.40512E-5 41578 0 3.18522E-5
14-74759887-C-T p.Glu158Lys missense ABCD4 1 83144 1.20273E-5 41572 0 3.9782E-6
14-74759894-G-A p.Pro76Ser missense ABCD4 1 83142 1.20276E-5 41571 0 NA
14-74759896-T-A p.Thr155Ser missense ABCD4 34 83142 4.08939E-4 41571 0 1.98893E-4
14-74759902-G-C p.Leu153Val missense ABCD4 1 83146 1.2027E-5 41573 0 3.97795E-6
14-74759910-T-C p.Gln150Arg missense ABCD4 11 83134 1.32317E-4 41567 0 5.56886E-5
14-74759915-C-T p.Ala69Thr missense ABCD4 4 83106 4.81313E-5 41553 0 3.14228E-4
14-74759915-C-A p.Arg148Ser missense ABCD4 1 83106 1.20328E-5 41553 0 NA
14-74759918-G-T p.Gln68Lys missense ABCD4 2 83074 2.40749E-5 41537 0 NA
14-74759919-C-T p.Arg147His missense ABCD4 46 83060 5.53816E-4 41530 0 2.55662E-4
14-74759920-G-A p.Arg147Cys missense ABCD4 145 83066 0.0017456 41533 0 0.0020141
14-74759932-T-A p.Met143Leu missense ABCD4 1 82992 1.20494E-5 41496 0 3.97883E-6
14-74759933-G-A p.His63Tyr missense ABCD4 1 82970 1.20525E-5 41485 0 NA
14-74759944-G-A p.His139Tyr missense ABCD4 2 82842 2.41423E-5 41421 0 8.25723E-6
14-74759954-G-A p.Gln56* stop_gained ABCD4 1 82656 1.20983E-5 41328 0 NA
14-74759960-G-T p.Pro54Thr missense ABCD4 1 82588 1.21083E-5 41294 0 8.28473E-6
14-74759965-G-C p.Ala52Gly missense ABCD4 1 82410 1.21345E-5 41205 0 2.82017E-4
14-74759976-C-T p.Val48Val synonymous ABCD4 31 82080 3.7768E-4 41040 0 1.59807E-4
14-74759980-G-C p.Pro47Arg missense+splice_region ABCD4 1 81856 1.22166E-5 40928 0 3.18471E-5
14-74760011-C-T c.*157G>A splice_region ABCD4 164 79410 0.00206523 39705 0 0.00384824
14-74760012-G-A c.*156C>T splice_region ABCD4 3 79104 3.79248E-5 39552 0 3.37578E-5
14-74760021-A-G c.*155-8T>C splice_region ABCD4 1 78096 1.28048E-5 39048 0 NA
14-74761845-A-G c.719+6T>C splice_region ABCD4 7 83286 8.40477E-5 41643 0 3.46032E-4
14-74761871-C-T p.Ala233Ala synonymous ABCD4 3 83348 3.59937E-5 41674 0 6.25E-4
14-74761895-C-G p.Lys225Asn missense ABCD4 1 83332 1.20002E-5 41666 0 2.38637E-5
14-74761907-C-A c.669-6G>T splice_region ABCD4 206 83330 0.0024721 41665 2 0.00573321
14-74761907-C-T c.669-6G>A splice_region ABCD4 12 83330 1.44006E-4 41665 0 2.22958E-4
14-74761908-GGACC-G c.669-11_669-8delGGTC splice_region ABCD4 84 83322 0.00100814 41661 2 0.00261344
14-74761908-G-A c.669-7C>T splice_region ABCD4 4 83322 4.80065E-5 41661 0 3.18471E-5
14-74762550-G-A c.407+7C>T splice_region ABCD4 2464 83308 0.029577 41654 232 0.0635882
14-74762552-C-T c.407+5G>A splice_region ABCD4 1 83344 1.19985E-5 41672 0 NA
14-74762574-C-T p.Lys130Lys synonymous ABCD4 1 83372 1.19944E-5 41686 0 NA
14-74762600-C-T p.Val122Met missense ABCD4 2 83382 2.3986E-5 41691 0 NA
14-74762612-T-C p.Met118Val missense ABCD4 1 83364 1.19956E-5 41682 0 3.99907E-6
14-74762614-A-G p.Leu117Ser missense ABCD4 43 83362 5.15823E-4 41681 1 4.9465E-5
14-74762621-T-G p.Lys115Gln missense ABCD4 1 83348 1.19979E-5 41674 0 8.24647E-6
14-74762622-G-C p.Asn114Lys missense ABCD4 1 83344 1.19985E-5 41672 0 NA
14-74762631-G-A p.Thr111Thr synonymous ABCD4 1 83314 1.20028E-5 41657 0 1.48508E-4
14-74762634-C-A p.Gly110Gly synonymous ABCD4 2 83306 2.40079E-5 41653 0 4.01213E-6
14-74762635-C-T p.Gly110Glu missense ABCD4 2 83308 2.40073E-5 41654 0 NA
14-74762642-T-C p.Ile108Val missense ABCD4 1 83282 1.20074E-5 41641 0 1.65175E-5
14-74762644-A-C p.Phe107Cys missense ABCD4 1 83272 1.20088E-5 41636 0 6.36943E-5
14-74762649-C-G p.Gly105Gly synonymous ABCD4 1 83242 1.20132E-5 41621 0 NA
14-74762650-C-A p.Gly105Val missense ABCD4 1 83234 1.20143E-5 41617 0 NA
14-74762652-G-A p.Phe104Phe synonymous ABCD4 2 83222 2.40321E-5 41611 0 0.00125156
14-74762660-T-C p.Ter99Trpext*? stop_lost ABCD4 12 83154 1.44311E-4 41577 0 5.03525E-4
14-74762670-G-A p.Ser96Leu missense ABCD4 5 83074 6.01873E-5 41537 0 1.27502E-4
14-74762670-G-C p.Ser96Trp missense ABCD4 3 83074 3.61124E-5 41537 0 NA
14-74762672-G-A p.Leu98Phe missense ABCD4 1 83070 1.2038E-5 41535 0 NA
14-74762689-TAGAG-T c.282-11_282-8delCTCT splice_region ABCD4 6 82820 7.24463E-5 41410 0 6.44205E-5
14-74763033-CA-C c.281+2delT splice_donor ABCD4 1 83212 1.20175E-5 41606 0 NA
14-74763034-A-T c.281+2T>A splice_donor ABCD4 3 83214 3.60516E-5 41607 0 3.97912E-6
14-74763035-CCTT-C p.Gln93_Ser94delinsHis disruptive_inframe_deletion ABCD4 1 83226 1.20155E-5 41613 0 NA
14-74763050-G-T p.Tyr89* stop_gained ABCD4 1 83222 1.20161E-5 41611 0 1.64807E-5
14-74763057-T-C p.Tyr87Cys missense ABCD4 1 83218 1.20166E-5 41609 0 8.23954E-6
14-74763060-T-A p.Tyr86Phe missense ABCD4 5 83202 6.00947E-5 41601 0 2.78401E-5
14-74763060-T-C p.Tyr86Cys missense ABCD4 1 83202 1.20189E-5 41601 0 9.56572E-4
14-74763064-C-T p.Val85Ile missense ABCD4 2453 83174 0.0294924 41587 231 0.0633012
14-74763067-G-A p.Leu84Phe missense ABCD4 3 83250 3.6036E-5 41625 0 9.5584E-5
14-74763074-C-T p.Arg79His missense ABCD4 3 83218 3.60499E-5 41609 0 9.57121E-5
14-74763075-G-A p.Pro81Leu missense ABCD4 3 83232 3.60438E-5 41616 0 6.37552E-5
14-74763081-A-G p.Ile79Thr missense ABCD4 10 83222 1.20161E-4 41611 0 1.91363E-4
14-74763085-T-G p.Ile78Leu missense ABCD4 7 83234 8.41002E-5 41617 0 3.97722E-5
14-74763086-G-C p.Ser75* stop_gained ABCD4 2450 83196 0.0294485 41598 228 0.0632895
14-74763098-C-A p.Met73Ile missense ABCD4 1 83232 1.20146E-5 41616 0 6.37471E-5
14-74763100-T-C p.Met73Val missense ABCD4 1 83236 1.2014E-5 41618 0 NA
14-74763111-T-A p.Gln69Leu missense ABCD4 2 83236 2.40281E-5 41618 0 NA
14-74763123-C-T p.Arg65Gln missense ABCD4 5 83200 6.00962E-5 41600 0 4.12276E-5
14-74763123-C-A p.Arg65Leu missense ABCD4 3 83200 3.60577E-5 41600 0 8.24552E-6
14-74763125-C-T p.Ser62Asn missense ABCD4 1 83166 1.20241E-5 41583 0 NA
14-74763127-C-T p.Trp61* stop_gained ABCD4 1 83158 1.20253E-5 41579 0 NA
14-74763127-C-G p.Glu64Gln missense ABCD4 2 83158 2.40506E-5 41579 0 3.97839E-6
14-74763130-C-T p.Val63Met missense ABCD4 9 83144 1.08246E-4 41572 0 5.77329E-5
14-74763131-G-A p.Thr60Met missense ABCD4 11 83134 1.32317E-4 41567 0 1.07424E-4
14-74763136-G-A p.Gln61* stop_gained ABCD4 2 83160 2.405E-5 41580 0 3.97858E-6
14-74763144-C-T p.Arg58His missense ABCD4 2 83106 2.40657E-5 41553 0 6.25E-4
14-74763154-T-G c.165-2A>C splice_acceptor ABCD4 1 83100 1.20337E-5 41550 0 NA
14-74764336-G-A c.*417+6C>T splice_region ABCD4 641 29556 0.0216876 14778 1 0.0629585
14-74764342-G-A c.*417C>T splice_region ABCD4 2 30222 6.6177E-5 15111 0 NA
14-74764343-G-T c.*416C>A splice_region ABCD4 1 31044 3.22123E-5 15522 0 NA
14-74764625-G-A c.164+8C>T splice_region ABCD4 3 83148 3.60802E-5 41574 0 1.67031E-5
14-74764626-C-T c.164+7G>A splice_region ABCD4 2 83124 2.40604E-5 41562 0 3.18552E-5
14-74764627-G-A c.164+6C>T splice_region ABCD4 6 83152 7.2157E-5 41576 0 1.83294E-4
14-74764639-T-G p.Asp53Ala missense ABCD4 2 83236 2.40281E-5 41618 0 NA
14-74764641-G-A p.Ile52Ile synonymous ABCD4 1 83256 1.20111E-5 41628 0 4.13887E-5
14-74764651-C-T p.Arg49Gln missense ABCD4 3 83268 3.60282E-5 41634 0 9.55597E-5
14-74764652-G-A p.Arg49Trp missense ABCD4 22 83272 2.64194E-4 41636 0 6.25E-4
14-74764658-C-T p.Val47Met missense ABCD4 1 83290 1.20062E-5 41645 0 7.97664E-6
14-74764660-T-C p.Asn46Ser missense ABCD4 6 83300 7.20288E-5 41650 0 2.48287E-5
14-74764660-T-G p.Asn46Thr missense ABCD4 1 83300 1.20048E-5 41650 0 1.65525E-5
14-74764664-G-A p.Leu45Phe missense ABCD4 1 83304 1.20042E-5 41652 0 6.25E-4
14-74764670-A-C p.Tyr43Asp missense ABCD4 1 83300 1.20048E-5 41650 0 NA
14-74764674-C-T p.Ala41Ala synonymous ABCD4 4 83302 4.80181E-5 41651 0 1.59256E-4
14-74764675-G-A p.Ala41Val missense ABCD4 2459 83260 0.029534 41630 230 0.0635113
14-74764678-C-T p.Arg40His missense ABCD4 1 83290 1.20062E-5 41645 0 1.99146E-5
14-74764679-G-A p.Arg40Cys missense ABCD4 1 83280 1.20077E-5 41640 0 6.37146E-5
14-74764684-C-T p.Arg38Gln missense ABCD4 4 83278 4.80319E-5 41639 0 0.00100705
14-74764684-CG-C p.Arg38fs frameshift ABCD4 1 83278 1.2008E-5 41639 0 NA
14-74764694-G-A p.Leu35Phe missense ABCD4 1 83232 1.20146E-5 41616 0 3.34638E-5
14-74764696-C-T p.Arg34His missense ABCD4 2 83218 2.40333E-5 41609 0 4.18697E-5
14-74764704-G-A p.His31His synonymous ABCD4 2 83146 2.40541E-5 41573 0 6.71468E-5
14-74764716-G-A p.Asp27Asp synonymous ABCD4 1 83142 1.20276E-5 41571 0 1.99254E-5
14-74764733-C-T p.Val22Met missense ABCD4 3 83106 3.60985E-5 41553 0 2.54864E-5
14-74764750-G-A p.Thr16Ile missense ABCD4 1 83044 1.20418E-5 41522 0 1.19705E-5
14-74764752-G-T p.Phe15Leu missense ABCD4 1 83034 1.20433E-5 41517 0 NA
14-74764780-G-A c.25-8C>T splice_region ABCD4 1 82664 1.20972E-5 41332 0 NA
14-74765881-C-T n.719G>A splice_region ABCD4 86 3558 0.0241709 1779 0 0.0507745
14-74766251-C-T p.Thr8Thr splice_region+synonymous ABCD4 1 83288 1.20065E-5 41644 0 8.24131E-6
14-74766260-C-A p.Leu5Leu synonymous ABCD4 1 83286 1.20068E-5 41643 0 NA
14-74766265-C-T p.Val4Ile missense ABCD4 1 83302 1.20045E-5 41651 0 NA
14-74766280-C-G p.Ala86Pro missense ABCD4 1 83316 1.20025E-5 41658 0 3.18634E-5
14-74766287-T-C p.Thr83Thr synonymous ABCD4 7 83316 8.40175E-5 41658 0 9.06394E-5
14-74766290-CAG-C p.Leu82fs frameshift ABCD4 1 83302 1.20045E-5 41651 0 3.29652E-5
14-74766341-A-G p.Ser26Pro missense ABCD4 326 83238 0.00391648 41619 3 0.0100705
14-74766344-G-C p.Gln25Glu missense ABCD4 1 83244 1.20129E-5 41622 0 6.37024E-5
14-74766352-A-G p.Leu22Pro missense ABCD4 29894 82742 0.361292 41371 5738 0.479859
14-74766352-A-C p.Leu62Val missense ABCD4 4 83224 4.80631E-5 41612 0 1.74119E-5
14-74766359-C-G p.Gln59His missense ABCD4 1 83202 1.20189E-5 41601 0 NA
14-74766360-T-C p.Gln59Arg missense ABCD4 2490 83146 0.0299473 41573 230 0.0639349
14-74766364-A-G p.Tyr58His missense ABCD4 1 83180 1.20221E-5 41590 0 NA
14-74766366-A-T p.Ile57Asn missense ABCD4 1 83180 1.20221E-5 41590 0 NA
14-74766385-G-T c.-104-7C>A splice_region ABCD4 11 83114 1.32348E-4 41557 0 2.88705E-5
14-74766845-T-A c.157+8A>T splice_region ABCD4 1 82914 1.20607E-5 41457 0 NA
14-74766846-C-G c.157+7G>C splice_region ABCD4 1 82958 1.20543E-5 41479 0 8.28432E-6
14-74766859-G-C p.Leu51Val missense ABCD4 1 83156 1.20256E-5 41578 0 NA
14-74766864-A-T p.Leu49Gln missense ABCD4 1 83180 1.20221E-5 41590 0 NA
14-74766869-C-G p.Leu47Phe missense ABCD4 74 83210 8.89316E-4 41605 1 0.00876095
14-74766874-G-A p.Leu46Phe missense ABCD4 2 83252 2.40234E-5 41626 0 3.19754E-5
14-74766879-A-T p.Leu44Gln missense ABCD4 1 83240 1.20135E-5 41620 0 1.64929E-5
14-74766912-G-A p.Pro33Leu missense ABCD4 1 83284 1.20071E-5 41642 0 NA
14-74766928-G-A p.Leu28Leu synonymous ABCD4 1 83266 1.20097E-5 41633 0 8.23995E-6
14-74766932-C-T p.Gln26Gln synonymous ABCD4 2 83270 2.40183E-5 41635 0 4.12052E-5
14-74766940-A-G p.Phe24Leu missense ABCD4 1 83246 1.20126E-5 41623 0 3.1904E-5
14-74766943-G-A p.Arg23Trp missense ABCD4 1 83246 1.20126E-5 41623 0 3.19591E-5
14-74766953-T-C p.Gln19Gln synonymous ABCD4 4 83214 4.80688E-5 41607 0 6.25E-4
14-74769582-C-T p.Ala12Thr missense ABCD4 1 81022 1.23423E-5 40511 0 NA
14-74769583-G-A p.Ala10Val missense ABCD4 3 81010 3.70325E-5 40505 0 2.55037E-4
14-74769588-C-A p.Ala10Ser missense ABCD4 1 81038 1.23399E-5 40519 0 8.41383E-6
14-74769591-C-A p.Gly9* stop_gained ABCD4 1 81058 1.23368E-5 40529 0 4.21468E-6
14-74769595-C-G p.Arg6Pro missense ABCD4 1 80974 1.23496E-5 40487 0 9.28781E-6
14-74769595-C-A p.Arg6Leu missense ABCD4 1 80974 1.23496E-5 40487 0 9.28781E-6
14-74769596-G-A p.Ala7Val missense ABCD4 1 80972 1.23499E-5 40486 0 6.37918E-5
14-74769598-G-T p.Pro5Gln missense ABCD4 3 81000 3.7037E-5 40500 0 1.26471E-5
14-74769598-G-A p.Pro5Leu missense ABCD4 1 81000 1.23457E-5 40500 0 4.21571E-6
14-74769600-G-A p.Pro6Ser missense ABCD4 2 80986 2.46956E-5 40493 0 9.23532E-6
14-74769602-C-A p.Gly5Val missense ABCD4 1 81102 1.23302E-5 40551 0 3.69167E-5
14-74769606-C-G p.Ala4Pro missense ABCD4 299 81018 0.00369054 40509 5 0.00711233
14-74769607-G-C p.Ser2Trp missense ABCD4 3 81022 3.7027E-5 40511 0 9.22526E-6
14-74769610-C-T p.Arg1Gln missense ABCD4 1 81230 1.23107E-5 40615 0 0.00101112
14-74769611-G-A p.Ala2Val missense ABCD4 3 81232 3.69313E-5 40616 0 1.64995E-4
14-74769677-G-A c.-62C>T 5_prime_UTR_premature_start_codon_gain ABCD4 1 79900 1.25156E-5 39950 0 NA
14-74769695-G-A c.-80C>T 5_prime_UTR_premature_start_codon_gain ABCD4 7 78490 8.91833E-5 39245 0 9.56145E-5
14-74769721-G-C c.-106C>G 5_prime_UTR_premature_start_codon_gain ABCD4 3 76454 3.92393E-5 38227 0 NA
14-74769723-G-C c.-108C>G 5_prime_UTR_premature_start_codon_gain ABCD4 4 76450 5.23218E-5 38225 0 NA
14-74769734-G-A c.-119C>T 5_prime_UTR_premature_start_codon_gain ABCD4 1 75464 1.32514E-5 37732 0 NA
14-74769736-G-C c.-121C>G 5_prime_UTR_premature_start_codon_gain ABCD4 309 75326 0.00410217 37663 1 0.00813293