Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
1-94883961-C-T c.-74C>T 5_prime_UTR_premature_start_codon_gain ABCD3 1 56032 1.78469E-5 28016 0 NA
1-94883989-C-T c.-46C>T 5_prime_UTR_premature_start_codon_gain ABCD3 2 66660 3.0003E-5 33330 0 6.39018E-5
1-94883992-C-T c.-43C>T 5_prime_UTR_premature_start_codon_gain ABCD3 2 67454 2.96498E-5 33727 1 3.19693E-5
1-94883995-C-T c.-40C>T 5_prime_UTR_premature_start_codon_gain ABCD3 2303 68030 0.0338527 34015 51 0.06223
1-94884011-C-T c.-24C>T 5_prime_UTR_premature_start_codon_gain ABCD3 6 72004 8.33287E-5 36002 0 1.49288E-5
1-94884025-C-T c.-10C>T 5_prime_UTR_premature_start_codon_gain ABCD3 1 73848 1.35413E-5 36924 0 6.38529E-5
1-94884039-C-T p.Ala2Val missense ABCD3 1 74966 1.33394E-5 37483 0 3.19264E-5
1-94884040-G-A p.Ala2Ala synonymous ABCD3 1 74974 1.3338E-5 37487 0 4.37434E-6
1-94884042-C-T p.Ala3Val missense ABCD3 7 74874 9.34904E-5 37437 0 6.97739E-5
1-94884043-C-T p.Ala3Ala synonymous ABCD3 18 75328 2.38955E-4 37664 0 0.00202429
1-94884068-A-T p.Asn12Tyr missense ABCD3 2 76166 2.62584E-5 38083 0 1.27714E-4
1-94884088-C-T c.-129C>T 5_prime_UTR_premature_start_codon_gain ABCD3 3 74962 4.00203E-5 37481 0 1.27381E-5
1-94884094-C-A p.Phe20Leu missense ABCD3 2 74846 2.67215E-5 37423 0 1.11133E-4
1-94884098-C-T c.-119C>T 5_prime_UTR_premature_start_codon_gain ABCD3 3 74594 4.02177E-5 37297 0 5.55067E-5
1-94884101-C-G p.Leu23Val missense ABCD3 8 74316 1.07648E-4 37158 0 3.18857E-5
1-94884103-C-T c.-114C>T 5_prime_UTR_premature_start_codon_gain ABCD3 1 74154 1.34854E-5 37077 0 NA
1-94884114-A-T p.His27Leu missense ABCD3 1 72868 1.37234E-5 36434 0 2.46184E-5
1-94884115-C-G p.His27Gln missense ABCD3 2 72792 2.74755E-5 36396 0 3.19081E-5
1-94884119-C-G p.Arg29Gly missense ABCD3 1 71820 1.39237E-5 35910 0 8.7865E-6
1-94884127-C-T p.Arg31Arg synonymous ABCD3 10 70238 1.42373E-4 35119 0 1.34027E-4
1-94884144-G-T p.Gly37Val missense+splice_region ABCD3 3 67698 4.43145E-5 33849 0 1.54421E-5
1-94884514-T-G n.121+7T>G splice_region ABCD3 1 7004 1.42776E-4 3502 0 3.18857E-5
1-94921305-T-TG p.Arg44fs frameshift ABCD3 1 33956 2.94499E-5 16978 0 6.37186E-5
1-94921316-A-G p.Lys46Lys synonymous ABCD3 1 34180 2.92569E-5 17090 0 1.55904E-5
1-94921319-T-C p.Ser47Ser synonymous ABCD3 1 34228 2.92158E-5 17114 0 NA
1-94921343-T-C p.Thr55Thr synonymous ABCD3 1 34514 2.89737E-5 17257 0 7.80396E-6
1-94921365-G-A c.182+5G>A splice_region ABCD3 1 34592 2.89084E-5 17296 0 3.18654E-5
1-94924174-G-A p.Gly41Glu missense ABCD3 39 83100 4.69314E-4 41550 0 3.50497E-4
1-94924178-A-G p.Lys42Lys synonymous ABCD3 1 83096 1.20343E-5 41548 0 NA
1-94924185-T-G p.Leu45Val missense ABCD3 1 83106 1.20328E-5 41553 0 NA
1-94924193-C-T p.Asn47Asn synonymous ABCD3 2 83094 2.40691E-5 41547 0 3.98314E-6
1-94930332-AAG-A p.Glu51fs frameshift ABCD3 1 83156 1.20256E-5 41578 0 3.19366E-5
1-94930332-A-G p.Lys50Arg missense+splice_region ABCD3 1 83156 1.20256E-5 41578 0 NA
1-94930335-A-G p.Glu51Gly missense ABCD3 2 83170 2.40471E-5 41585 0 3.19183E-5
1-94930338-G-T p.Gly52Val missense ABCD3 198 83188 0.00238015 41594 0 0.00769034
1-94930339-G-GA p.Glu55fs frameshift ABCD3 1 83204 1.20187E-5 41602 0 NA
1-94930340-A-G p.Lys53Glu missense ABCD3 3 83202 3.60568E-5 41601 0 2.47227E-5
1-94930345-G-A p.Lys54Lys synonymous ABCD3 35708 82730 0.431621 41365 8204 0.528125
1-94930345-G-C p.Lys54Asn missense ABCD3 1 83236 1.2014E-5 41618 0 NA
1-94930361-G-A p.Asp60Asn missense ABCD3 1 83260 1.20106E-5 41630 0 NA
1-94930363-C-T p.Asp60Asp synonymous ABCD3 8 83260 9.60846E-5 41630 0 6.38407E-5
1-94930365-A-T p.Lys61Met missense ABCD3 3 83266 3.60291E-5 41633 0 1.59155E-5
1-94930387-A-C p.Ile68Ile synonymous ABCD3 2 83258 2.40217E-5 41629 0 NA
1-94930400-A-G p.Ile73Val missense ABCD3 4 83238 4.8055E-5 41619 0 1.64897E-5
1-94930401-T-C p.Ile73Thr missense ABCD3 1 83232 1.20146E-5 41616 0 NA
1-94930404-T-C p.Met1? start_lost ABCD3 7 83220 8.41144E-5 41610 0 3.18375E-5
1-94930423-T-A p.Cys80* stop_gained ABCD3 3 83130 3.60881E-5 41565 0 1.99033E-5
1-94930432-A-G c.246+3A>G splice_region ABCD3 1 82994 1.20491E-5 41497 0 NA
1-94933477-A-G p.Thr83Thr splice_region+synonymous ABCD3 2 82878 2.41319E-5 41439 0 3.98845E-6
1-94933482-A-T p.Tyr85Phe missense ABCD3 2 82918 2.41202E-5 41459 0 NA
1-94933482-A-G p.Tyr85Cys missense ABCD3 1 82918 1.20601E-5 41459 0 NA
1-94933490-C-T p.Leu88Phe missense ABCD3 2 82978 2.41028E-5 41489 0 8.44595E-5
1-94933491-T-TA p.Ile89fs frameshift ABCD3 1 83004 1.20476E-5 41502 0 NA
1-94933492-T-G p.Leu88Leu synonymous ABCD3 1 83014 1.20462E-5 41507 0 3.18532E-5
1-94933508-G-A p.Val94Met missense ABCD3 3 83062 3.61176E-5 41531 0 5.84795E-5
1-94933512-C-T p.Ser95Phe missense ABCD3 1 83066 1.20386E-5 41533 0 8.34864E-6
1-94933519-A-G p.Thr97Thr synonymous ABCD3 3 83068 3.6115E-5 41534 0 6.36902E-5
1-94933521-A-G p.Tyr98Cys missense ABCD3 1 83072 1.20378E-5 41536 0 NA
1-94933528-T-C p.Asp100Asp synonymous ABCD3 7 83088 8.4248E-5 41544 0 3.18451E-5
1-94933543-A-C p.Gln105His missense ABCD3 1 83054 1.20404E-5 41527 0 NA
1-94933545-A-G p.Asn106Ser missense ABCD3 1 83058 1.20398E-5 41529 0 NA
1-94933563-G-GT c.335_335+1insT splice_donor ABCD3 6 82984 7.23031E-5 41492 3 NA
1-94933567-C-CT c.335+4_335+5insT splice_region ABCD3 4 82938 4.82288E-5 41469 0 6.8348E-5
1-94939335-C-T p.Arg117Cys missense ABCD3 1 83000 1.20482E-5 41500 0 3.98257E-6
1-94939336-G-A p.Arg117His missense ABCD3 2 83010 2.40935E-5 41505 0 3.19346E-5
1-94939344-A-G p.Lys120Glu missense ABCD3 1 83046 1.20415E-5 41523 0 NA
1-94939346-A-C p.Lys120Asn missense ABCD3 1 83046 1.20415E-5 41523 0 NA
1-94939358-A-G p.Arg124Arg synonymous ABCD3 1 83048 1.20412E-5 41524 0 NA
1-94939367-C-G p.Leu127Leu synonymous ABCD3 1 83068 1.20383E-5 41534 0 1.65662E-5
1-94939374-A-G p.Ile130Val missense ABCD3 1 83062 1.20392E-5 41531 0 NA
1-94939376-C-T p.Ile130Ile synonymous ABCD3 1 83056 1.20401E-5 41528 0 3.1953E-5
1-94939377-G-A p.Ala131Thr missense ABCD3 5 83048 6.02061E-5 41524 0 4.14952E-5
1-94939383-A-C p.Met133Leu missense ABCD3 2 83044 2.40836E-5 41522 0 3.98222E-6
1-94940699-A-G p.Ile136Val missense+splice_region ABCD3 1 82324 1.21471E-5 41162 0 NA
1-94940701-C-A p.Ile136Ile splice_region+synonymous ABCD3 1 82380 1.21389E-5 41190 0 NA
1-94940725-G-T p.Lys144Asn missense ABCD3 1 82694 1.20928E-5 41347 0 3.18674E-5
1-94940731-G-T p.Gly146Gly synonymous ABCD3 5 82744 6.04273E-5 41372 0 6.76041E-5
1-94940732-T-C p.Leu147Leu synonymous ABCD3 2 82744 2.41709E-5 41372 0 NA
1-94940749-G-C p.Leu152Leu synonymous ABCD3 1 82720 1.2089E-5 41360 0 NA
1-94940763-G-A p.Arg157Lys missense ABCD3 1 82616 1.21042E-5 41308 0 1.65784E-5
1-94940779-C-T p.Leu162Leu synonymous ABCD3 1 82342 1.21445E-5 41171 0 5.28863E-5
1-94940781-A-G p.Tyr163Cys missense ABCD3 1 82290 1.21521E-5 41145 0 1.32979E-5
1-94940783-G-A p.Glu164Lys missense ABCD3 1 82268 1.21554E-5 41134 0 NA
1-94940788-G-A p.Glu165Glu synonymous ABCD3 30 81986 3.65916E-4 40993 0 5.10106E-4
1-94940795-C-CA p.Glu165fs frameshift ABCD3 2 81728 2.44714E-5 40864 1 NA
1-94941174-T-C p.Phe170Leu missense ABCD3 1 83046 1.20415E-5 41523 0 1.1971E-5
1-94941185-T-C p.Tyr173Tyr synonymous ABCD3 2 83066 2.40772E-5 41533 0 NA
1-94941194-G-A p.Gly176Gly synonymous ABCD3 2 83108 2.40651E-5 41554 0 4.1569E-5
1-94941211-T-C p.Ile182Thr missense ABCD3 2 83112 2.40639E-5 41556 0 3.98416E-6
1-94941221-A-G p.Pro185Pro synonymous ABCD3 8 83116 9.6251E-5 41558 0 7.09096E-4
1-94941224-C-T p.Asp186Asp synonymous ABCD3 1 83106 1.20328E-5 41553 0 5.03525E-4
1-94941225-C-T p.Gln187* stop_gained ABCD3 1 83110 1.20322E-5 41555 0 NA
1-94941244-T-C p.Val193Ala missense ABCD3 4 83096 4.81371E-5 41548 0 2.39143E-5
1-94941251-A-G p.Lys195Lys synonymous ABCD3 1 83070 1.2038E-5 41535 0 NA
1-94941256-G-C p.Cys197Ser missense ABCD3 2 83062 2.40784E-5 41531 0 1.68008E-5
1-94941258-A-T p.Asn198Tyr missense ABCD3 1 83058 1.20398E-5 41529 0 8.4035E-6
1-94941264-G-A p.Val200Ile missense ABCD3 2 83026 2.40888E-5 41513 0 1.27527E-4
1-94941267-G-A p.Val201Ile missense ABCD3 1 83006 1.20473E-5 41503 0 NA
1-94941269-C-T p.Val201Val synonymous ABCD3 2 82986 2.41005E-5 41493 0 1.59609E-5
1-94943825-A-G p.Asp213Gly missense ABCD3 1 81890 1.22115E-5 40945 0 NA
1-94943830-G-A p.Val215Ile missense ABCD3 1 81920 1.2207E-5 40960 0 NA
1-94943839-A-C p.Ile218Leu missense ABCD3 1 81900 1.221E-5 40950 0 NA
1-94943840-T-A p.Ile218Asn missense ABCD3 1 81914 1.22079E-5 40957 0 8.35352E-6
1-94943852-C-T p.Thr222Met missense ABCD3 2 81916 2.44153E-5 40958 0 3.19142E-5
1-94943853-G-A p.Thr222Thr synonymous ABCD3 4 81910 4.88341E-5 40955 0 6.49351E-4
1-94943857-G-A p.Ala224Thr missense ABCD3 4 81952 4.88091E-5 40976 0 2.5043E-5
1-94943860-A-G p.Ile225Val missense ABCD3 8 81990 9.75729E-5 40995 0 5.19854E-5
1-94943866-G-A p.Ala227Thr missense ABCD3 2 82004 2.43891E-5 41002 0 NA
1-94943874-G-C c.684+3G>C splice_region ABCD3 20 81974 2.4398E-4 40987 0 0.0013245
1-94943876-GTC-G c.684+6_684+7delTC splice_region ABCD3 1 81960 1.22011E-5 40980 0 2.52275E-5
1-94944085-T-A p.Leu230Leu synonymous ABCD3 4 78064 5.124E-5 39032 0 7.53012E-4
1-94944095-T-C p.Leu234Leu synonymous ABCD3 1 77736 1.28641E-5 38868 0 1.45256E-5
1-94944097-G-A p.Leu234Leu synonymous ABCD3 1 77650 1.28783E-5 38825 0 4.21774E-6
1-94944105-A-G p.Ter237Ter stop_retained ABCD3 3 77416 3.87517E-5 38708 0 1.38723E-5
1-94944277-G-A c.*171G>A splice_region ABCD3 1 57074 1.75211E-5 28537 0 NA
1-94946020-G-A p.Gly229Ser missense+splice_region ABCD3 2 83008 2.40941E-5 41504 0 NA
1-94946061-A-G p.Leu242Leu synonymous ABCD3 1 83120 1.20308E-5 41560 0 2.47402E-5
1-94946063-T-A p.Phe243Tyr missense ABCD3 2 83122 2.4061E-5 41561 0 NA
1-94946071-C-T p.Arg246* stop_gained ABCD3 1 83086 1.20357E-5 41543 0 NA
1-94946085-C-T p.Pro250Pro synonymous ABCD3 1 83094 1.20346E-5 41547 0 1.64921E-5
1-94946101-A-G p.Ile256Val missense ABCD3 2 83076 2.40743E-5 41538 0 8.24769E-6
1-94946117-A-G p.Tyr261Cys missense ABCD3 1 83038 1.20427E-5 41519 0 3.18431E-5
1-94946125-G-A p.Glu264Lys missense ABCD3 1 83030 1.20438E-5 41515 0 NA
1-94946129-A-AAACAGAAAAATTCGAAAAACAAAACAAAGCAAAACCAAAACCCTGCTT p.Tyr265delinsTerThrGluLysPheGluLysGlnAsnLysAlaLysProLysProCysPhe stop_gained ABCD3 1 82990 1.20496E-5 41495 0 NA
1-94946136-T-C p.Tyr267Tyr synonymous ABCD3 6 82960 7.2324E-5 41480 0 2.38983E-5
1-94946144-C-G p.Ser270Cys missense ABCD3 1 82890 1.20642E-5 41445 0 NA
1-94946162-G-GT c.827_827+1insT splice_donor ABCD3 2 82754 2.4168E-5 41377 1 NA
1-94946162-G-T p.Ser276Ile missense+splice_region ABCD3 1 82754 1.2084E-5 41377 0 NA
1-94946164-TAAAG-T c.827+3_827+6delAAAG splice_region ABCD3 1 82728 1.20878E-5 41364 0 NA
1-94948738-C-T p.Ala280Ala synonymous ABCD3 3 82890 3.61925E-5 41445 0 3.18512E-5
1-94948744-C-A p.Tyr282* stop_gained ABCD3 1 82958 1.20543E-5 41479 0 NA
1-94948746-A-G p.Asn283Ser missense ABCD3 1 82970 1.20525E-5 41485 0 NA
1-94948747-T-C p.Asn283Asn synonymous ABCD3 71 82966 8.55772E-4 41483 0 0.00152886
1-94948751-A-T p.Asn285Tyr missense ABCD3 1 82964 1.20534E-5 41482 0 NA
1-94948752-A-G p.Asn285Ser missense ABCD3 2 82976 2.41034E-5 41488 0 NA
1-94948784-T-C p.Phe296Leu missense ABCD3 1 83058 1.20398E-5 41529 0 NA
1-94948788-G-A p.Arg297Gln missense ABCD3 1 83032 1.20435E-5 41516 0 1.19491E-5
1-94953129-G-A p.Arg310Gln missense ABCD3 1 83150 1.20265E-5 41575 0 3.18918E-5
1-94953137-A-G p.Met313Val missense ABCD3 7 83178 8.41569E-5 41589 0 9.96694E-5
1-94953137-A-C p.Met313Leu missense ABCD3 1 83178 1.20224E-5 41589 0 NA
1-94953146-A-G p.Ile316Val missense ABCD3 1 83186 1.20213E-5 41593 0 1.99192E-5
1-94953157-T-C p.Ile319Ile synonymous ABCD3 72 83190 8.65489E-4 41595 0 0.00156081
1-94953161-G-T p.Ala321Ser missense ABCD3 2 83198 2.4039E-5 41599 0 3.18776E-5
1-94953167-TGTAAGTATATTTTGAAAGAGATGAGATTTGTGGAAAAGGTGAAATACTGTTACTGTTTTAAATCTTACCTGTTTGGTTTCAG-T c.967+1_968-1delGTAAGTATATTTTGAAAGAGATGAGATTTGTGGAAAAGGTGAAATACTGTTACTGTTTTAAATCTTACCTGTTTGGTTTCAG splice_acceptor ABCD3 10 83196 1.20198E-4 41598 4 NA
1-94953174-A-G c.967+7A>G splice_region ABCD3 1 83156 1.20256E-5 41578 0 7.96844E-6
1-94953243-G-A c.968-7G>A splice_region ABCD3 12 83110 1.44387E-4 41555 0 6.51557E-4
1-94953269-T-C p.Gly329Gly synonymous ABCD3 2 83130 2.40587E-5 41565 0 8.24334E-6
1-94953270-T-A p.Tyr330Asn missense ABCD3 1 83126 1.20299E-5 41563 0 NA
1-94953313-G-A p.Arg344Gln missense ABCD3 1 83026 1.20444E-5 41513 0 4.94829E-5
1-94953313-G-C p.Arg344Pro missense ABCD3 2 83026 2.40888E-5 41513 0 5.03525E-4
1-94953325-G-A p.Ser348Asn missense ABCD3 3 82990 3.61489E-5 41495 0 1.64997E-5
1-94953331-A-T p.His350Leu missense ABCD3 2 82974 2.41039E-5 41487 0 7.96407E-6
1-94953334-C-T p.Ser351Leu missense ABCD3 1 82952 1.20552E-5 41476 0 8.25219E-6
1-94953334-C-G p.Ser351Trp missense ABCD3 1 82952 1.20552E-5 41476 0 NA
1-94953345-GAGGTAAACTGATGATAATACAATGAAAATGTAACAGTAAAAATAAAGCCAAATTTTTAGTCATAGAACTATAAGTAAAAACTAATATTTATTTCTATTTA-G p.Glu355fs frameshift ABCD3 10 82946 1.2056E-4 41473 4 NA
1-94953354-T-G c.1065+7T>G splice_region ABCD3 20 82926 2.41179E-4 41463 1 5.09652E-4
1-94953442-T-C c.1066-6T>C splice_region ABCD3 1 82830 1.20729E-5 41415 0 NA
1-94953456-C-T p.Tyr358Tyr synonymous ABCD3 1 82710 1.20904E-5 41355 0 4.99426E-5
1-94953492-T-G p.Ala370Ala synonymous ABCD3 2 82164 2.43416E-5 41082 0 5.03525E-4
1-94953492-T-C p.Ala370Ala synonymous ABCD3 1 82164 1.21708E-5 41082 0 NA
1-94953532-T-G p.Leu384Val missense ABCD3 2 80914 2.47176E-5 40457 0 NA
1-94953532-T-C p.Leu384Leu synonymous ABCD3 2 80914 2.47176E-5 40457 0 NA
1-94953536-C-A p.Ala385Asp missense ABCD3 2 80670 2.47924E-5 40335 0 8.35603E-6
1-94953537-C-T p.Ala385Ala splice_region+synonymous ABCD3 4 80604 4.96253E-5 40302 0 6.25E-4
1-94953539-G-GTTTTACTGCTCGGATTACAGAATTAAT c.1157_1157+1insTTTTACTGCTCGGATTACAGAATTAAT splice_donor ABCD3 2 80526 2.48367E-5 40263 1 NA
1-94953539-G-GTTTTACTGCTCGGATTACAGAATTAATGCAA c.1157_1157+1insTTTTACTGCTCGGATTACAGAATTAATGCAA splice_donor ABCD3 2 80526 2.48367E-5 40263 1 NA
1-94955277-T-G c.1158-4T>G splice_region ABCD3 2 82518 2.42371E-5 41259 0 8.99022E-6
1-94955309-C-G p.Gln396Glu missense ABCD3 1 82608 1.21054E-5 41304 0 NA
1-94955310-A-G p.Gln396Arg missense ABCD3 1 82626 1.21027E-5 41313 0 NA
1-94955311-A-G p.Gln396Gln synonymous ABCD3 1 82628 1.21024E-5 41314 0 5.00183E-5
1-94955336-A-G p.Lys405Glu missense ABCD3 1 82682 1.20945E-5 41341 0 NA
1-94955337-A-G p.Lys405Arg missense ABCD3 4 82694 4.83711E-5 41347 0 2.79405E-5
1-94955346-G-A p.Arg408His missense ABCD3 1 82712 1.20901E-5 41356 0 3.5929E-5
1-94955350-A-G p.Thr409Thr synonymous ABCD3 2 82754 2.4168E-5 41377 0 7.9804E-6
1-94955355-T-C p.Val411Ala missense ABCD3 1 82760 1.20831E-5 41380 0 8.2861E-6
1-94955358-C-T p.Ser412Leu missense ABCD3 1 82794 1.20782E-5 41397 0 NA
1-94955367-A-G p.Glu415Gly missense ABCD3 1 82792 1.20785E-5 41396 0 NA
1-94955371-G-A p.Lys416Lys splice_region+synonymous ABCD3 10 82796 1.20779E-4 41398 0 6.37471E-5
1-94955371-GGGTAAATATGAGTGTCACAGTTTAAGGTCACAATTTTAAGTGTTTGCTGACATAATATGATGCTTTAATACCTATTTTCCATTTAA-G p.Gly417fs frameshift ABCD3 12 82796 1.44935E-4 41398 5 NA
1-94955376-AAT-A c.1249+5_1249+6delAT splice_region ABCD3 3 82794 3.62345E-5 41397 0 1.98738E-4
1-94955380-T-C c.1249+8T>C splice_region ABCD3 1 82816 1.2075E-5 41408 0 1.6567E-5
1-94955459-G-T p.Gly417Val missense+splice_region ABCD3 2 82950 2.41109E-5 41475 0 NA
1-94955477-T-A p.Val423Asp missense ABCD3 1 82920 1.20598E-5 41460 0 3.18817E-5
1-94955479-A-G p.Ile424Val missense ABCD3 1 82904 1.20621E-5 41452 0 NA
1-94955483-C-T p.Pro425Leu missense ABCD3 21 82908 2.53293E-4 41454 0 1.40255E-4
1-94955513-T-C p.Ile435Thr missense ABCD3 1 82750 1.20846E-5 41375 0 3.18715E-5
1-94955516-C-G p.Ala436Gly missense ABCD3 1 82710 1.20904E-5 41355 0 NA
1-94955517-A-G p.Ala436Ala synonymous ABCD3 5 82712 6.04507E-5 41356 0 3.58786E-5
1-94955535-C-T c.1322+4C>T splice_region ABCD3 1 82498 1.21215E-5 41249 0 9.57365E-5
1-94955539-C-G c.1322+8C>G splice_region ABCD3 3 82430 3.63945E-5 41215 0 3.99039E-6
1-94956740-G-A p.Lys441Lys splice_region+synonymous ABCD3 6 82470 7.27537E-5 41235 0 3.44929E-5
1-94956763-C-T p.Thr449Met missense ABCD3 4 82584 4.84355E-5 41292 0 5.90857E-5
1-94956764-G-A p.Thr449Thr synonymous ABCD3 2 82562 2.42242E-5 41281 0 8.39201E-5
1-94956773-A-G p.Gly452Gly synonymous ABCD3 89 82620 0.00107722 41310 1 0.00232766
1-94956787-G-A p.Arg457Gln missense ABCD3 1 82554 1.21133E-5 41277 0 7.99533E-6
1-94956791-C-T p.Asp458Asp synonymous ABCD3 173 82532 0.00209616 41266 0 0.00338032
1-94956795-A-C p.Asn460His missense ABCD3 1 82516 1.21189E-5 41258 0 NA
1-94956797-T-C p.Asn460Asn synonymous ABCD3 13 82512 1.57553E-4 41256 0 2.86716E-4
1-94964154-T-C c.1387-4T>C splice_region ABCD3 6 83072 7.22265E-5 41536 0 2.24921E-4
1-94964161-C-A p.Arg464Arg synonymous ABCD3 1 83100 1.20337E-5 41550 0 NA
1-94964163-A-G p.Arg464Arg synonymous ABCD3 2 83116 2.40628E-5 41558 0 6.27353E-4
1-94964167-G-A p.Gly466Arg missense ABCD3 3 83188 3.60629E-5 41594 0 3.4369E-5
1-94964202-C-T p.Cys477Cys synonymous ABCD3 2 83284 2.40142E-5 41642 0 6.25E-4
1-94964203-G-A p.Gly478Arg missense ABCD3 1 83290 1.20062E-5 41645 0 NA
1-94964220-C-T p.Phe483Phe synonymous ABCD3 1 83296 1.20054E-5 41648 0 NA
1-94964222-G-A p.Arg484His missense ABCD3 1 83298 1.20051E-5 41649 0 NA
1-94964227-C-T p.Leu486Phe missense ABCD3 2 83314 2.40056E-5 41657 0 NA
1-94964235-AGTAAGTACAAGTTGGCCTCAAAATTTTGCAGTCTTATTTTGCCATACTGTCTACCACTTTGTAAATTTTACAATTGTTCTTCTCCCTTCTCTCTCTTTAATAG-A c.1464+1_1465-1del splice_acceptor ABCD3 13 83322 1.56021E-4 41661 6 NA
1-94964240-G-T c.1464+5G>T splice_region ABCD3 1 83294 1.20057E-5 41647 0 NA
1-94964242-A-AAAT c.1464+7_1464+8insAAT splice_region ABCD3 1 83292 1.2006E-5 41646 0 NA
1-94964328-CTCTT-C c.1465-10_1465-7delTCTT splice_region ABCD3 1 83160 1.2025E-5 41580 0 3.98727E-6
1-94964331-T-G c.1465-8T>G splice_region ABCD3 1 83156 1.20256E-5 41578 0 NA
1-94964332-T-C c.1465-7T>C splice_region ABCD3 1 83150 1.20265E-5 41575 0 8.29242E-6
1-94964336-T-C c.1465-3T>C splice_region ABCD3 1 83138 1.20282E-5 41569 0 1.1963E-5
1-94964360-C-T p.Arg496Cys missense ABCD3 7 83008 8.43292E-5 41504 0 6.39713E-5
1-94964361-G-A p.Arg496His missense ABCD3 1 83016 1.20459E-5 41508 0 NA
1-94964382-G-A p.Gly503Glu missense ABCD3 2 82876 2.41324E-5 41438 0 NA
1-94964396-G-A p.Val508Ile missense ABCD3 1 82748 1.20849E-5 41374 0 8.28377E-6
1-94964400-CTCAGGTAAGACCTAGCTTGAGTTATCTTTGATCTAAAGATCTTTTTGTTTATTTATTTTTTCATGTTGCTTCTAATTGACTTTTGCTCTACTACTG-C p.Gln510fs frameshift ABCD3 14 82708 1.6927E-4 41354 7 NA
1-94964407-A-G c.1530+3A>G splice_region ABCD3 1 82642 1.21004E-5 41321 0 NA
1-94964496-G-A c.1531-5G>A splice_region ABCD3 13 82648 1.57294E-4 41324 0 6.78486E-5
1-94964502-G-A p.Arg511Lys missense+splice_region ABCD3 1 82652 1.20989E-5 41326 0 1.19715E-5
1-94964503-A-G p.Arg511Arg splice_region+synonymous ABCD3 1 82644 1.21001E-5 41322 0 3.99026E-6
1-94964510-A-G p.Met514Val missense ABCD3 1 82658 1.2098E-5 41329 0 NA
1-94964529-G-A p.Arg520Gln missense ABCD3 2 82648 2.4199E-5 41324 0 8.28075E-6
1-94964556-G-A p.Arg529Gln missense ABCD3 1 82564 1.21118E-5 41282 0 3.18593E-5
1-94964577-G-C p.Gly536Ala missense ABCD3 1 82364 1.21412E-5 41182 0 NA
1-94965043-G-A c.1621-8G>A splice_region ABCD3 1 83154 1.20259E-5 41577 0 3.98206E-6
1-94965044-C-T c.1621-7C>T splice_region ABCD3 1 83152 1.20262E-5 41576 0 NA
1-94965051-G-T p.Val541Leu missense+splice_region ABCD3 1 83216 1.20169E-5 41608 0 2.54712E-4
1-94965057-A-C p.Lys543Gln missense ABCD3 4 83242 4.80527E-5 41621 0 3.98032E-6
1-94965062-A-G p.Glu544Glu synonymous ABCD3 11 83266 1.32107E-4 41633 0 1.2738E-4
1-94965070-A-G p.Asp547Gly missense ABCD3 2 83290 2.40125E-5 41645 0 3.1841E-5
1-94965073-A-G p.Asn548Ser missense ABCD3 1 83308 1.20036E-5 41654 0 NA
1-94965076-T-G p.Val549Gly missense ABCD3 1 83304 1.20042E-5 41652 0 NA
1-94965089-T-C p.His553His synonymous ABCD3 1 83328 1.20008E-5 41664 0 8.2526E-6
1-94965112-G-A p.Trp561* stop_gained ABCD3 1 83340 1.1999E-5 41670 0 NA
1-94965128-T-C p.Asp566Asp synonymous ABCD3 1 83332 1.20002E-5 41666 0 3.98026E-6
1-94965138-G-A p.Val570Ile missense ABCD3 6 83330 7.20029E-5 41665 0 6.36943E-5
1-94965138-G-T p.Val570Leu missense ABCD3 1 83330 1.20005E-5 41665 0 NA
1-94965140-A-C p.Val570Val synonymous ABCD3 2 83322 2.40033E-5 41661 0 NA
1-94965169-C-T p.Ala580Val missense+splice_region ABCD3 6 83278 7.20478E-5 41639 0 9.56206E-5
1-94965170-GGTAAGTATACTGTGAAGAAGTTGCACAAGA-G c.1740+1_1740+30delGTAAGTATACTGTGAAGAAGTTGCACAAGA splice_donor ABCD3 4 83278 4.80319E-5 41639 2 NA
1-94965170-G-GATGGCAAGATTATTTTATCATAAACCCCAGTTTGCCATTTT c.1740_1740+1insATGGCAAGATTATTTTATCATAAACCCCAGTTTGCCATTTT splice_donor ABCD3 2 83278 2.40159E-5 41639 1 NA
1-94965170-G-GATGGCAAGATTATTTTATCATAAACCCCA c.1740_1740+1insATGGCAAGATTATTTTATCATAAACCCCA splice_donor ABCD3 1 83278 1.2008E-5 41639 0 NA
1-94965170-G-GAT c.1740_1740+1insAT splice_donor ABCD3 2 83278 2.40159E-5 41639 1 NA
1-94965170-G-GATGGCAAGATTATTTTATCATAAACCCCAGTTTGCCATTTTGGAT c.1740_1740+1insATGGCAAGATTATTTTATCATAAACCCCAGTTTGCCATTTTGGAT splice_donor ABCD3 2 83278 2.40159E-5 41639 1 NA
1-94965170-G-A p.Ala580Ala splice_region+synonymous ABCD3 3 83278 3.60239E-5 41639 0 4.12698E-5
1-94972113-A-G p.His587Arg missense ABCD3 1 82220 1.21625E-5 41110 0 NA
1-94972123-G-T p.Gln590His missense ABCD3 1 82392 1.21371E-5 41196 0 NA
1-94972126-T-C p.Phe591Phe synonymous ABCD3 12 82450 1.45543E-4 41225 0 3.18532E-5
1-94972162-C-T p.Val603Val synonymous ABCD3 2 82678 2.41902E-5 41339 0 9.56816E-5
1-94972165-C-T p.Asp604Asp synonymous ABCD3 6 82676 7.25725E-5 41338 1 2.47602E-5
1-94972188-A-G p.His612Arg missense ABCD3 1 82606 1.21057E-5 41303 0 4.12855E-5
1-94972200-T-TTGGCATCACTCTCTTCACTGTGTCTCATAGG c.1845+2_1845+3insTGGCATCACTCTCTTCACTGTGTCTCATAGG splice_region ABCD3 2 82442 2.42595E-5 41221 1 NA
1-94972200-T-TTGGC c.1845+2_1845+3insTGGC splice_region ABCD3 2 82442 2.42595E-5 41221 1 NA
1-94972206-C-T c.1845+8C>T splice_region ABCD3 9 82288 1.09372E-4 41144 0 3.18776E-5
1-94972206-C-G c.1845+8C>G splice_region ABCD3 1 82290 1.21521E-5 41145 0 NA
1-94980697-A-G c.1846-5A>G splice_region ABCD3 1 81984 1.21975E-5 40992 0 1.65793E-5
1-94980709-T-G p.Ile618Ser missense ABCD3 2 82126 2.43528E-5 41063 0 NA
1-94980732-A-C p.Arg626Arg synonymous ABCD3 4 82092 4.87258E-5 41046 0 2.48604E-5
1-94980732-A-G p.Arg626Gly missense ABCD3 1 82092 1.21815E-5 41046 0 NA
1-94980750-C-T p.His632Tyr missense ABCD3 1 82004 1.21945E-5 41002 0 1.19941E-5
1-94982620-A-G p.Met639Val missense ABCD3 1 82392 1.21371E-5 41196 0 3.19061E-5
1-94982624-A-G p.Asp640Gly missense ABCD3 1 82388 1.21377E-5 41194 0 NA
1-94982634-C-G p.Gly643Gly synonymous ABCD3 28 82388 3.39855E-4 41194 0 6.0637E-4
1-94982639-A-G p.Tyr645Cys missense ABCD3 1 82368 1.21406E-5 41184 0 1.64929E-5
1-94982835-A-G c.*150A>G splice_region ABCD3 9 67960 1.32431E-4 33980 0 3.19632E-5
1-94984052-T-A n.3174T>A splice_region ABCD3 1 43686 2.28906E-5 21843 0 NA