Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
3-183637722-T-G c.*1366A>C splice_region ABCC5 3450 44608 0.0773404 22304 142 0.0757044
3-183639103-G-A p.Val1390Val synonymous ABCC5 4 83204 4.80746E-5 41602 0 4.97884E-5
3-183639130-G-C p.Ala1381Ala synonymous ABCC5 1 83352 1.19973E-5 41676 0 3.18573E-5
3-183639133-A-G p.Tyr1380Tyr synonymous ABCC5 1 83356 1.19967E-5 41678 0 NA
3-183639141-G-A p.Arg1378* stop_gained ABCC5 1 83360 1.19962E-5 41680 0 NA
3-183639144-A-T p.Ser1377Thr missense ABCC5 2 83358 2.39929E-5 41679 0 4.02E-6
3-183639150-C-T p.Asp1375Asn missense ABCC5 1 83352 1.19973E-5 41676 0 NA
3-183639151-G-A p.Asn1374Asn synonymous ABCC5 31 83356 3.71899E-4 41678 0 0.00108342
3-183639152-T-C p.Asn1374Ser missense ABCC5 3 83356 3.59902E-5 41678 0 3.18979E-5
3-183639166-C-T p.Ser1369Ser synonymous ABCC5 1 83340 1.1999E-5 41670 0 8.29862E-6
3-183639169-T-C p.Pro1368Pro synonymous ABCC5 4 83346 4.79927E-5 41673 0 3.32044E-5
3-183639172-G-A p.Thr1367Thr synonymous ABCC5 1 83322 1.20016E-5 41661 0 4.032E-6
3-183639180-A-C p.Phe1365Val missense ABCC5 2 83260 2.40211E-5 41630 0 6.37511E-5
3-183639193-C-T c.4084-4G>A splice_region ABCC5 2 83174 2.4046E-5 41587 0 3.65331E-5
3-183639195-AAAG-A c.4084-9_4084-7delCTT splice_region ABCC5 7 83152 8.41832E-5 41576 0 9.23346E-5
3-183643338-G-A c.4083+5C>T splice_region ABCC5 3 83146 3.60811E-5 41573 0 1.65832E-5
3-183643361-C-A p.Met1355Ile missense ABCC5 1 83294 1.20057E-5 41647 0 NA
3-183643372-C-T p.Asp1352Asn missense ABCC5 1 83312 1.20031E-5 41656 0 4.0149E-6
3-183643373-G-A p.Ser1351Ser synonymous ABCC5 2 83322 2.40033E-5 41661 0 3.31241E-5
3-183643388-G-A p.His1346His synonymous ABCC5 6 83354 7.19821E-5 41677 0 4.14031E-5
3-183643389-T-G p.His1346Pro missense ABCC5 1 83354 1.1997E-5 41677 0 NA
3-183643391-C-T p.Leu1345Leu synonymous ABCC5 8 83350 9.59808E-5 41675 0 0.00100705
3-183643393-G-A p.Leu1345Leu synonymous ABCC5 2 83350 2.39952E-5 41675 0 3.31214E-5
3-183643419-C-T p.Cys1336Tyr missense ABCC5 1 83354 1.1997E-5 41677 0 NA
3-183643439-G-A p.Ile1329Ile synonymous ABCC5 121 83334 0.00145199 41667 0 0.00302115
3-183643442-G-A p.Thr1328Thr synonymous ABCC5 37 83316 4.44092E-4 41658 0 0.00453172
3-183643456-A-G p.Leu1324Leu synonymous ABCC5 2 83272 2.40177E-5 41636 0 6.37389E-5
3-183643457-T-C p.Leu1323Leu synonymous ABCC5 1 83274 1.20085E-5 41637 0 4.00757E-6
3-183643465-T-A p.Thr1321Ser missense ABCC5 1 83262 1.20103E-5 41631 0 4.00837E-6
3-183643502-C-G p.Leu1308Leu synonymous ABCC5 5 83122 6.01525E-5 41561 0 8.088E-6
3-183643509-T-TTACA c.3919-3_3919-2insTGTA splice_region ABCC5 10 83040 1.20424E-4 41520 5 NA
3-183645127-G-A p.Arg1303Arg synonymous ABCC5 4 83112 4.81278E-5 41556 0 5.25028E-5
3-183645162-G-A p.Arg1292Trp missense ABCC5 1 83274 1.20085E-5 41637 0 NA
3-183645164-T-TC p.Glu1291fs frameshift ABCC5 2 83306 2.40079E-5 41653 0 NA
3-183645166-C-G p.Gly1290Gly synonymous ABCC5 3 83320 3.60058E-5 41660 0 9.55597E-5
3-183645172-T-G p.Ser1288Ser synonymous ABCC5 1 83304 1.20042E-5 41652 0 NA
3-183645211-T-C p.Lys1275Lys synonymous ABCC5 3 83334 3.59997E-5 41667 0 NA
3-183645238-A-G c.3805-7T>C splice_region ABCC5 2 83226 2.4031E-5 41613 0 1.65281E-5
3-183646530-C-G c.3804+5G>C splice_region ABCC5 1 83130 1.20294E-5 41565 0 NA
3-183646563-G-A p.Ala1259Val missense ABCC5 1 83306 1.20039E-5 41653 0 NA
3-183646578-T-A p.Asp1254Val missense ABCC5 1 83338 1.19993E-5 41669 0 8.28281E-6
3-183646584-G-A p.Thr1252Ile missense ABCC5 9 83346 1.07984E-4 41673 0 9.55414E-5
3-183646585-T-A p.Thr1252Ser missense ABCC5 1 83342 1.19988E-5 41671 0 4.00705E-6
3-183646598-G-A p.Pro1247Pro synonymous ABCC5 1 83320 1.20019E-5 41660 0 NA
3-183646601-G-A p.Asp1246Asp synonymous ABCC5 2 83302 2.4009E-5 41651 0 NA
3-183655683-C-T c.3725+6G>A splice_region ABCC5 1 82520 1.21183E-5 41260 0 1.20631E-5
3-183655691-G-A p.Val1241Val splice_region+synonymous ABCC5 1 82726 1.20881E-5 41363 0 8.33417E-6
3-183655701-C-A p.Ser1238Ile missense ABCC5 2 82820 2.41488E-5 41410 0 3.32541E-5
3-183655712-C-T p.Pro1234Pro synonymous ABCC5 2 82910 2.41225E-5 41455 0 3.18593E-5
3-183655729-T-C p.Ile1229Val missense ABCC5 1 83012 1.20465E-5 41506 0 NA
3-183655751-G-A p.Ala1221Ala synonymous ABCC5 2 83014 2.40923E-5 41507 0 3.18573E-5
3-183655757-G-A p.Gly1219Gly synonymous ABCC5 3 83012 3.61394E-5 41506 0 NA
3-183655776-A-G p.Ter70Argext*? stop_lost ABCC5 1 82918 1.20601E-5 41459 0 NA
3-183655815-A-ATTGGAACTGGAACTTTTGGCCAGGTGCAGTGGCTCGCGCCT p.Leu1200fs frameshift ABCC5 1 82498 1.21215E-5 41249 0 NA
3-183655818-CG-C p.Arg1199fs frameshift ABCC5 1 82388 1.21377E-5 41194 0 NA
3-183655819-G-A p.Arg1199Cys missense ABCC5 1 82360 1.21418E-5 41180 0 8.04369E-6
3-183655832-C-T p.Gly51Glu missense ABCC5 1 81930 1.22055E-5 40965 0 NA
3-183655838-C-T p.Arg49His missense ABCC5 24 81640 2.93974E-4 40820 0 5.4147E-4
3-183655844-C-T p.Ser47Asn missense ABCC5 2 81308 2.45978E-5 40654 0 2.82748E-5
3-183660235-T-G p.Thr41Pro missense ABCC5 159 57316 0.00277409 28658 0 0.00528561
3-183660235-T-C p.Thr41Ala missense ABCC5 2 57320 3.48918E-5 28660 0 NA
3-183660242-C-G p.Glu38Asp missense ABCC5 1 58260 1.71644E-5 29130 0 NA
3-183660265-G-A p.His31Tyr missense ABCC5 1 60486 1.65328E-5 30243 0 6.25E-4
3-183660272-C-T p.Glu28Glu synonymous ABCC5 1 61202 1.63393E-5 30601 0 NA
3-183660278-C-T p.Thr26Thr synonymous ABCC5 1 61790 1.61838E-5 30895 0 2.33245E-4
3-183660279-G-A p.Thr26Met missense ABCC5 2 61818 3.2353E-5 30909 0 2.22973E-4
3-183660289-G-A p.Gln23* stop_gained ABCC5 1 63172 1.58298E-5 31586 0 NA
3-183660292-T-C p.Thr22Ala missense ABCC5 1 63416 1.57689E-5 31708 0 NA
3-183660526-C-T p.Arg1185Gln missense ABCC5 1 83282 1.20074E-5 41641 0 3.32773E-5
3-183660528-C-T p.Gly1184Gly synonymous ABCC5 1 83276 1.20083E-5 41638 0 NA
3-183660562-G-A p.Thr1173Met missense ABCC5 1 83294 1.20057E-5 41647 0 6.25E-4
3-183660581-G-A p.Leu1167Leu synonymous ABCC5 1 83272 1.20088E-5 41636 0 5.03525E-4
3-183660585-G-A p.Leu1165Leu synonymous ABCC5 15006 83044 0.180699 41522 1462 0.204278
3-183660589-G-C p.Pro1164Arg missense ABCC5 2 83246 2.40252E-5 41623 0 NA
3-183660599-C-G p.Glu1161Gln missense ABCC5 1 83216 1.20169E-5 41608 0 1.20245E-5
3-183660601-C-T p.Arg1160Gln missense ABCC5 4 83208 4.80723E-5 41604 0 3.18715E-5
3-183660607-C-T p.Arg1158Lys missense ABCC5 1 83196 1.20198E-5 41598 0 8.28075E-6
3-183660618-G-A p.Asn1154Asn synonymous ABCC5 13 83158 1.56329E-4 41579 0 0.00100705
3-183660632-C-T p.Val1150Met missense ABCC5 1 83108 1.20325E-5 41554 0 NA
3-183660641-C-T p.Glu1147Lys missense ABCC5 1 83066 1.20386E-5 41533 0 8.28363E-6
3-183660653-C-G p.Asp1143His missense ABCC5 1 83010 1.20467E-5 41505 0 NA
3-183660664-G-A p.Ala1139Val missense ABCC5 5 82874 6.03326E-5 41437 0 3.18573E-5
3-183660666-C-G p.Lys1138Asn missense ABCC5 2 82866 2.41354E-5 41433 0 2.00687E-5
3-183660686-G-A p.Pro1132Ser missense ABCC5 1 82694 1.20928E-5 41347 0 8.36778E-6
3-183660690-T-C p.Glu1130Glu synonymous ABCC5 2 82628 2.42049E-5 41314 0 NA
3-183663665-C-T p.Ser1116Ser synonymous ABCC5 1 83242 1.20132E-5 41621 0 NA
3-183663677-A-G p.Ala1112Ala synonymous ABCC5 1 83266 1.20097E-5 41633 0 NA
3-183663694-C-T p.Ala1107Thr missense ABCC5 1 83264 1.201E-5 41632 0 NA
3-183663704-C-T p.Thr1103Thr synonymous ABCC5 2 83242 2.40263E-5 41621 0 8.28212E-6
3-183663705-G-A p.Thr1103Met missense ABCC5 1 83234 1.20143E-5 41617 0 4.0084E-6
3-183663723-G-A p.Thr1097Met missense ABCC5 1 83186 1.20213E-5 41593 0 1.657E-5
3-183663730-G-GGACAGCATAAGAGATGGCGAGACCCGCATAGGCTGGGGGA c.3286-4_3286-3insTCCCCCAGCCTATGCGGGTCTCGCCATCTCTTATGCTGTC splice_region ABCC5 2 83170 2.40471E-5 41585 1 NA
3-183665139-C-T p.Ala1086Ala synonymous ABCC5 6 82546 7.26867E-5 41273 0 1.91156E-4
3-183665142-A-G p.Tyr1085Tyr synonymous ABCC5 1 82632 1.21018E-5 41316 0 1.20748E-5
3-183665152-G-A p.Pro1082Leu missense ABCC5 1 82820 1.20744E-5 41410 0 NA
3-183665155-A-T p.Ile1081Asn missense ABCC5 56 82822 6.76149E-4 41411 0 4.54165E-4
3-183665162-C-T p.Gly1079Arg missense ABCC5 2 82858 2.41377E-5 41429 0 3.18674E-5
3-183665163-G-A p.His1078His synonymous ABCC5 9 82838 1.08646E-4 41419 0 3.18654E-5
3-183665170-A-C p.Leu1076Arg missense ABCC5 1 82862 1.20683E-5 41431 0 3.18532E-5
3-183665172-A-G p.Val1075Val synonymous ABCC5 1 82884 1.20651E-5 41442 0 NA
3-183665174-C-T p.Val1075Ile missense ABCC5 1 82874 1.20665E-5 41437 0 3.18756E-5
3-183665187-C-T p.Thr1070Thr synonymous ABCC5 3 82856 3.62074E-5 41428 0 5.03525E-4
3-183665188-G-T p.Thr1070Lys missense ABCC5 3 82852 3.62091E-5 41426 0 3.18552E-5
3-183665188-G-A p.Thr1070Met missense ABCC5 1 82852 1.20697E-5 41426 0 4.01465E-6
3-183665190-G-C p.Thr1069Thr synonymous ABCC5 77 82850 9.2939E-4 41425 0 0.0019749
3-183665197-A-G p.Ile1067Thr missense ABCC5 2 82792 2.41569E-5 41396 0 3.18674E-5
3-183665202-G-A p.Ala1065Ala synonymous ABCC5 1 82788 1.2079E-5 41394 0 NA
3-183665205-G-A p.Ile1064Ile synonymous ABCC5 14 82788 1.69107E-4 41394 0 1.91217E-4
3-183665209-C-T p.Ser1063Asn missense ABCC5 1 82802 1.2077E-5 41401 0 NA
3-183665211-G-A p.Ile1062Ile synonymous ABCC5 4 82814 4.8301E-5 41407 0 1.67423E-5
3-183665216-G-T p.Leu1061Ile missense ABCC5 1 82794 1.20782E-5 41397 0 8.37198E-6
3-183665224-C-T p.Arg1058Gln missense ABCC5 1 82774 1.20811E-5 41387 0 1.67541E-5
3-183665235-C-A p.Trp1054Cys missense ABCC5 1 82858 1.20688E-5 41429 0 NA
3-183665245-G-A p.Ala1051Val missense ABCC5 3 82742 3.62573E-5 41371 0 3.18837E-5
3-183665250-C-T p.Thr1049Thr synonymous ABCC5 3 82700 3.62757E-5 41350 0 8.58664E-6
3-183665251-G-A p.Thr1049Met missense ABCC5 1 82664 1.20972E-5 41332 0 6.44039E-5
3-183665256-C-CAA p.Leu1047fs frameshift ABCC5 1 82596 1.21071E-5 41298 0 NA
3-183665256-C-CA p.Leu1047fs frameshift ABCC5 3 82562 3.63363E-5 41281 0 9.83903E-4
3-183665256-C-T p.Leu1047Leu synonymous ABCC5 3 82596 3.63214E-5 41298 0 6.88732E-5
3-183665257-A-C p.Leu1047Trp missense ABCC5 1 82576 1.21101E-5 41288 0 NA
3-183665259-A-G p.Phe1046Phe synonymous ABCC5 1 82644 1.21001E-5 41322 0 4.08911E-6
3-183665274-G-A p.Asn1041Asn synonymous ABCC5 1 82396 1.21365E-5 41198 0 NA
3-183665288-G-A p.Leu1037Leu synonymous ABCC5 2 82066 2.43706E-5 41033 0 3.18532E-5
3-183667555-C-T p.Gln1071Gln synonymous ABCC5 16 83366 1.91925E-4 41683 0 0.0010688
3-183667565-T-C p.Asn1068Ser missense ABCC5 46 83370 5.51757E-4 41685 1 0.00957661
3-183667573-G-A p.His1065His synonymous ABCC5 2 83372 2.39889E-5 41686 0 5.7972E-5
3-183667584-C-T p.Ala1062Thr missense ABCC5 1 83374 1.19941E-5 41687 0 NA
3-183667591-C-T p.Gln1059Gln synonymous ABCC5 1 83390 1.19918E-5 41695 0 NA
3-183667601-G-C p.Ser1056Cys missense ABCC5 3 83380 3.59799E-5 41690 0 NA
3-183667603-C-G p.Thr1055Thr synonymous ABCC5 1 83374 1.19941E-5 41687 0 1.04188E-4
3-183667603-C-T p.Thr1055Thr synonymous ABCC5 5 83374 5.99707E-5 41687 0 3.06393E-4
3-183667604-G-A p.Thr1055Met missense ABCC5 14 83376 1.67914E-4 41688 0 3.18492E-5
3-183667605-T-C p.Thr1055Ala missense ABCC5 1 83384 1.19927E-5 41692 0 NA
3-183667631-G-A p.Thr1046Met missense ABCC5 3 83390 3.59755E-5 41695 0 9.55292E-5
3-183667634-A-G p.Ile1045Thr missense ABCC5 2 83386 2.39848E-5 41693 0 1.60287E-5
3-183667635-T-C p.Ile1045Val missense ABCC5 1 83386 1.19924E-5 41693 0 NA
3-183667642-C-T p.Leu1042Leu synonymous ABCC5 2 83384 2.39854E-5 41692 0 NA
3-183667646-C-T p.Arg1041His missense ABCC5 11 83382 1.31923E-4 41691 0 1.07669E-4
3-183667647-G-A p.Arg1041Cys missense ABCC5 1 83382 1.1993E-5 41691 0 6.25E-4
3-183667659-G-A p.Arg1037Trp missense ABCC5 1 83378 1.19936E-5 41689 0 2.00439E-5
3-183667668-CCCTGGAGAGAGAATGAGCTCCGTGTCACAGCACCTACCCAGCAACTGAGGCTTCTCCGTGGCCCCAGCAGACATGAACGCTTCCTATTTA-C p.Val1034fs frameshift ABCC5 12 83354 1.43964E-4 41677 5 NA
3-183667779-C-T p.Val1027Ile missense ABCC5 1 83056 1.20401E-5 41528 0 2.23044E-4
3-183667780-T-C p.Ser1026Ser synonymous ABCC5 1 83068 1.20383E-5 41534 0 4.01216E-6
3-183667787-A-G p.Leu1024Pro missense ABCC5 2 83102 2.40668E-5 41551 0 3.18512E-5
3-183667795-A-G p.Leu1021Leu synonymous ABCC5 1 83136 1.20285E-5 41568 0 8.29586E-6
3-183667798-G-C p.Pro1020Pro synonymous ABCC5 2 83160 2.405E-5 41580 0 1.65983E-5
3-183667801-C-T p.Gly1019Gly synonymous ABCC5 2 83172 2.40466E-5 41586 0 8.3011E-6
3-183667813-A-C p.Leu1015Leu synonymous ABCC5 3 83238 3.60412E-5 41619 0 1.2031E-5
3-183667822-C-T p.Pro1012Pro synonymous ABCC5 1 83242 1.20132E-5 41621 0 7.47657E-5
3-183667823-G-A p.Pro1012Leu missense ABCC5 2 83246 2.40252E-5 41623 0 NA
3-183667836-C-T p.Ala1008Thr missense ABCC5 1 83260 1.20106E-5 41630 0 1.20294E-5
3-183667837-G-A p.Ile1007Ile synonymous ABCC5 1 83268 1.20094E-5 41634 0 8.01905E-6
3-183667845-C-G p.Gly1005Arg missense ABCC5 3 83280 3.60231E-5 41640 0 1.20281E-5
3-183667870-G-A p.Asn996Asn synonymous ABCC5 7 83304 8.40296E-5 41652 0 2.54793E-4
3-183667888-G-A p.Ala990Ala synonymous ABCC5 1 83312 1.20031E-5 41656 0 2.52084E-5
3-183667894-G-C p.Phe988Leu missense ABCC5 1 83304 1.20042E-5 41652 0 NA
3-183667897-C-T p.Pro987Pro synonymous ABCC5 12 83308 1.44044E-4 41654 0 1.91217E-4
3-183667902-G-A p.Leu986Leu synonymous ABCC5 1 83306 1.20039E-5 41653 0 8.48724E-6
3-183667908-C-T p.Val984Met missense ABCC5 3 83272 3.60265E-5 41636 0 2.0272E-5
3-183667909-G-A p.Asp983Asp synonymous ABCC5 6 83274 7.20513E-5 41637 0 0.00100705
3-183667915-T-TTCATCCATGTCTTTGGAAAACCTGTTGAGAATCCTCCCTGTGGGGGTC c.2945-3_2945-2insGACCCCCACAGGGAGGATTCTCAACAGGTTTTCCAAAGACATGGATGA splice_region ABCC5 6 83260 7.20634E-5 41630 3 NA
3-183667915-T-C c.2945-2A>G splice_acceptor ABCC5 1 83260 1.20106E-5 41630 0 NA
3-183669242-T-C p.Lys977Lys synonymous ABCC5 80 83324 9.60108E-4 41662 0 0.00191107
3-183669267-C-A p.Gly969Val missense ABCC5 2 83356 2.39935E-5 41678 0 3.18552E-5
3-183669272-G-C p.Pro967Pro synonymous ABCC5 2 83360 2.39923E-5 41680 0 8.28693E-6
3-183669276-G-T p.Thr966Asn missense ABCC5 2 83366 2.39906E-5 41683 0 3.31428E-5
3-183669278-C-T p.Thr965Thr synonymous ABCC5 1 83360 1.19962E-5 41680 0 3.18654E-5
3-183669279-G-A p.Thr965Met missense ABCC5 4 83358 4.79858E-5 41679 0 9.5584E-5
3-183669281-G-A p.Asp964Asp synonymous ABCC5 1 83362 1.19959E-5 41681 0 3.31395E-5
3-183669282-T-G p.Asp964Ala missense ABCC5 1 83366 1.19953E-5 41683 0 NA
3-183669290-C-A p.Lys961Asn missense ABCC5 6 83362 7.19752E-5 41681 0 5.03525E-4
3-183669303-C-T p.Arg957Gln missense ABCC5 1 83350 1.19976E-5 41675 0 3.18451E-5
3-183669315-C-T p.Arg953Gln missense ABCC5 1 83340 1.1999E-5 41670 0 NA
3-183669316-G-A p.Arg953* stop_gained ABCC5 1 83316 1.20025E-5 41658 0 NA
3-183669326-G-A p.Asp949Asp synonymous ABCC5 5 83286 6.00341E-5 41643 0 6.25782E-4
3-183669336-C-T p.Arg946Gln missense ABCC5 1 83204 1.20187E-5 41602 0 4.00876E-6
3-183669337-G-C p.Arg946Gly missense ABCC5 1 83184 1.20215E-5 41592 0 NA
3-183669350-C-T p.Leu941Leu synonymous ABCC5 1 83122 1.20305E-5 41561 0 2.49314E-5
3-183669353-C-T p.Thr940Thr synonymous ABCC5 1 83062 1.20392E-5 41531 0 3.18471E-5
3-183669353-C-A p.Thr940Thr synonymous ABCC5 2 83062 2.40784E-5 41531 0 3.32568E-5
3-183669354-G-A p.Thr940Met missense ABCC5 4 83050 4.81638E-5 41525 0 5.82024E-5
3-183669359-C-CT c.2815-2_2815-1insA splice_acceptor ABCC5 4 83044 4.81672E-5 41522 2 NA
3-183669668-T-C p.Ile931Val missense ABCC5 1 82720 1.2089E-5 41360 0 NA
3-183669669-G-A p.Ala930Ala synonymous ABCC5 1 82744 1.20855E-5 41372 0 8.02755E-6
3-183669704-C-T p.Ala919Thr missense ABCC5 2 83066 2.40772E-5 41533 0 1.65593E-5
3-183669705-G-A p.Tyr918Tyr synonymous ABCC5 2 83076 2.40743E-5 41538 0 0.00125
3-183669718-T-G p.Tyr914Ser missense ABCC5 1 83144 1.20273E-5 41572 0 NA
3-183669720-G-A p.Tyr913Tyr synonymous ABCC5 4 83158 4.81012E-5 41579 0 1.27429E-4
3-183669741-C-T p.Lys906Lys synonymous ABCC5 1 83226 1.20155E-5 41613 0 6.25E-4
3-183669757-A-G p.Val901Ala missense ABCC5 1 83222 1.20161E-5 41611 0 NA
3-183669759-C-T p.Ser900Ser synonymous ABCC5 282 83226 0.00338836 41613 0 0.00654582
3-183669759-C-A p.Ser900Ser synonymous ABCC5 1 83230 1.20149E-5 41615 0 3.18817E-5
3-183669767-C-T p.Glu898Lys missense ABCC5 2 83188 2.40419E-5 41594 0 3.18695E-5
3-183669771-C-T p.Gly896Gly synonymous ABCC5 3 83184 3.60646E-5 41592 0 4.97727E-5
3-183670876-C-T p.Gly889Arg missense+splice_region ABCC5 3 83214 3.60516E-5 41607 0 2.81559E-5
3-183670876-C-G p.Gly889Arg missense+splice_region ABCC5 1 83214 1.20172E-5 41607 0 4.02227E-6
3-183670877-G-A p.Ser888Ser synonymous ABCC5 1 83216 1.20169E-5 41608 0 1.68014E-5
3-183670901-C-T p.Leu880Leu synonymous ABCC5 3 83314 3.60084E-5 41657 0 3.18593E-5
3-183670905-C-A p.Trp879Leu missense ABCC5 1 83300 1.20048E-5 41650 0 1.65901E-5
3-183670921-C-T p.Ala874Thr missense ABCC5 2 83312 2.40061E-5 41656 0 3.31433E-5
3-183670922-G-A p.Thr873Thr synonymous ABCC5 5 83308 6.00182E-5 41654 0 4.971E-5
3-183670924-T-C p.Thr873Ala missense ABCC5 1 83304 1.20042E-5 41652 0 NA
3-183670928-G-T p.Gly871Gly synonymous ABCC5 1 83310 1.20034E-5 41655 0 3.18573E-5
3-183670967-T-A p.Ala858Ala synonymous ABCC5 1 83238 1.20137E-5 41619 0 4.00805E-6
3-183670999-C-T p.Val848Ile missense ABCC5 3 83200 3.60577E-5 41600 0 8.28391E-6
3-183671003-A-G p.Tyr846Tyr synonymous ABCC5 1 83206 1.20184E-5 41603 0 8.28432E-6
3-183671005-A-G p.Tyr846His missense ABCC5 2 83196 2.40396E-5 41598 0 8.28487E-6
3-183671015-G-C p.Pro842Pro synonymous ABCC5 2 83178 2.40448E-5 41589 0 8.28761E-6
3-183671020-C-T p.Val841Met missense ABCC5 1 83178 1.20224E-5 41589 0 4.01832E-6
3-183671023-A-C p.Ser840Ala missense ABCC5 10 83174 1.2023E-4 41587 0 3.18573E-4
3-183671038-C-T p.Glu835Lys missense ABCC5 6 83108 7.21952E-5 41554 0 2.44397E-5
3-183671052-A-G p.Leu830Pro missense ABCC5 1 83048 1.20412E-5 41524 0 NA
3-183671057-C-T p.Gly828Gly splice_region+synonymous ABCC5 3 82964 3.61603E-5 41482 0 2.56285E-5
3-183677515-C-T c.2482+6G>A splice_region ABCC5 1 83064 1.20389E-5 41532 0 3.18654E-5
3-183677524-C-T p.Glu827Lys missense ABCC5 1 83152 1.20262E-5 41576 0 8.28844E-6
3-183677566-T-G p.Lys813Gln missense ABCC5 1 83248 1.20123E-5 41624 0 NA
3-183677571-C-A p.Gly811Val missense ABCC5 1 83248 1.20123E-5 41624 0 8.28212E-6
3-183677584-ACTT-A p.Lys806del conservative_inframe_deletion ABCC5 1 83198 1.20195E-5 41599 0 1.65651E-5
3-183677585-C-T p.Lys806Lys synonymous ABCC5 2 83210 2.40356E-5 41605 0 6.37918E-5
3-183677620-T-C p.Asn795Asp missense ABCC5 6 82978 7.23083E-5 41489 0 4.49883E-5
3-183677621-G-A p.Ile794Ile splice_region+synonymous ABCC5 1 82952 1.20552E-5 41476 0 8.75248E-5
3-183677624-C-CTCAACTGGCGGTGTCTCTCCCAGCAACAGGTTAT c.2380-2_2380-1insATAACCTGTTGCTGGGAGAGACACCGCCAGTTGA splice_acceptor ABCC5 4 82898 4.82521E-5 41449 2 NA
3-183679303-A-G p.Val792Ala missense ABCC5 1 83304 1.20042E-5 41652 0 4.01085E-6
3-183679310-GT-G p.Pro790fs frameshift ABCC5 1 83304 1.20042E-5 41652 0 NA
3-183679326-C-G p.Leu784Leu synonymous ABCC5 1 83344 1.19985E-5 41672 0 NA
3-183679355-C-A p.Gly775Cys missense ABCC5 6 83350 7.19856E-5 41675 0 8.01488E-6
3-183679377-A-T p.His767Gln missense ABCC5 1 83360 1.19962E-5 41680 0 NA
3-183679392-C-T p.Thr762Thr synonymous ABCC5 2 83346 2.39964E-5 41673 0 3.31241E-5
3-183679397-T-C p.Ile761Val missense ABCC5 1 83352 1.19973E-5 41676 0 8.01526E-6
3-183679398-A-G p.Cys760Cys synonymous ABCC5 7 83356 8.39772E-5 41678 0 6.3678E-5
3-183679404-C-T p.Glu758Glu synonymous ABCC5 25 83348 2.99947E-4 41674 0 0.00125
3-183679411-A-G p.Met756Thr missense ABCC5 1 83336 1.19996E-5 41668 0 NA
3-183679416-G-A p.Ile754Ile synonymous ABCC5 1 83322 1.20016E-5 41661 0 1.65642E-5
3-183679428-A-G p.Cys750Cys synonymous ABCC5 1 83286 1.20068E-5 41643 0 NA
3-183679435-A-G p.Val748Ala missense ABCC5 2 83258 2.40217E-5 41629 0 3.1839E-5
3-183679436-C-T p.Val748Ile missense ABCC5 2 83256 2.40223E-5 41628 0 NA
3-183679437-C-G p.Leu747Leu synonymous ABCC5 1 83260 1.20106E-5 41630 0 NA
3-183679447-A-G c.2236-5T>C splice_region ABCC5 1 83180 1.20221E-5 41590 0 3.1837E-5
3-183681170-T-C c.2235+3A>G splice_region ABCC5 1 83284 1.20071E-5 41642 0 NA
3-183681191-A-G p.Phe739Phe synonymous ABCC5 1 83338 1.19993E-5 41669 0 NA
3-183681202-T-C p.Thr736Ala missense ABCC5 22 83336 2.63992E-4 41668 0 3.18431E-5
3-183681216-T-C p.His731Arg missense ABCC5 1 83354 1.1997E-5 41677 0 NA
3-183681221-C-T p.Arg729Arg synonymous ABCC5 1 83358 1.19964E-5 41679 0 NA
3-183681226-T-C p.Ile728Val missense ABCC5 1 83364 1.19956E-5 41682 0 7.4523E-5
3-183681231-C-A p.Ser726Ile missense ABCC5 2 83366 2.39906E-5 41683 0 NA
3-183681233-A-G p.Asn725Asn synonymous ABCC5 1 83362 1.19959E-5 41681 0 NA
3-183681260-A-G p.Asp716Asp synonymous ABCC5 1 83322 1.20016E-5 41661 0 3.18492E-5
3-183681268-C-T p.Ala714Thr missense ABCC5 1 83306 1.20039E-5 41653 0 4.00776E-6
3-183681281-G-A p.Asp709Asp synonymous ABCC5 2 83268 2.40188E-5 41634 0 6.25E-4
3-183681287-G-C p.Ile707Met missense ABCC5 1 83254 1.20114E-5 41627 0 NA
3-183681295-T-C p.Ile705Val missense ABCC5 2 83220 2.40327E-5 41610 0 NA
3-183681323-A-G p.Leu695Leu synonymous ABCC5 27 83090 3.24949E-4 41545 0 7.00905E-4
3-183681340-G-A p.Arg690Cys missense ABCC5 1 82946 1.2056E-5 41473 0 8.29504E-6
3-183681341-C-T p.Gln689Gln synonymous ABCC5 5 82944 6.02816E-5 41472 0 3.18471E-5
3-183681344-C-A p.Gly688Gly synonymous ABCC5 1 82912 1.2061E-5 41456 0 4.01162E-6
3-183681349-C-T p.Gly687Ser missense ABCC5 1 82860 1.20685E-5 41430 0 3.18492E-5
3-183681350-G-A p.Ser686Ser synonymous ABCC5 3 82826 3.62205E-5 41413 0 6.37024E-5
3-183681357-T-C p.Asn684Ser missense ABCC5 3 82772 3.62441E-5 41386 0 8.31172E-5
3-183681384-A-G c.2032-8T>C splice_region ABCC5 2 81966 2.44004E-5 40983 0 NA
3-183682970-T-C c.2031+3A>G splice_region ABCC5 1 82464 1.21265E-5 41232 0 NA
3-183682976-C-T p.Thr676Thr synonymous ABCC5 2 82528 2.42342E-5 41264 0 3.1837E-5
3-183682984-C-T p.Asp674Asn missense ABCC5 1 82558 1.21127E-5 41279 0 8.30648E-6
3-183682985-G-A p.Ser673Ser synonymous ABCC5 3 82544 3.63443E-5 41272 0 6.25E-4
3-183683000-G-A p.Ala668Ala synonymous ABCC5 1 82656 1.20983E-5 41328 0 8.02878E-6
3-183683030-C-T p.Leu658Leu synonymous ABCC5 1 82718 1.20893E-5 41359 0 NA
3-183683045-TCTGGAGGACACAAAGAGACAGCGTCAGGGACACGGCGGGAGCAGAGCCTGCTGACTAGGGCTGCCTTGCATCTCACGCGGCCAAGATGGAAAGCATGACAGAAGCCAAACATTCCTTGC-T c.1958+1_1959-1del splice_acceptor ABCC5 6 82752 7.25058E-5 41376 0 NA
3-183683157-T-C c.1958+8A>G splice_region ABCC5 1 82388 1.21377E-5 41194 0 1.20761E-5
3-183683174-T-C p.Asp650Gly missense ABCC5 1 82010 1.21936E-5 41005 0 4.03307E-6
3-183683211-T-C p.Thr638Ala missense ABCC5 1 79344 1.26033E-5 39672 0 NA
3-183683212-A-G p.Ala637Ala synonymous ABCC5 1 79252 1.2618E-5 39626 0 NA
3-183683214-C-T p.Ala637Thr missense ABCC5 1 78916 1.26717E-5 39458 0 NA
3-183683216-T-C p.Asn636Ser missense ABCC5 3 78670 3.8134E-5 39335 0 1.21618E-4
3-183683238-C-T p.Ala629Thr missense ABCC5 1 74194 1.34782E-5 37097 0 4.0656E-6
3-183683242-A-G p.Tyr627Tyr synonymous ABCC5 2 73318 2.72784E-5 36659 0 NA
3-183683248-G-A p.Phe625Phe synonymous ABCC5 1 70440 1.41965E-5 35220 0 8.38729E-6
3-183683266-A-G p.Ile619Ile synonymous ABCC5 1 65486 1.52704E-5 32743 0 NA
3-183683271-T-C p.Ser618Gly missense ABCC5 1 63884 1.56534E-5 31942 0 1.67785E-5
3-183683276-T-C p.Glu616Gly missense ABCC5 2 62022 3.22466E-5 31011 0 2.51707E-5
3-183683284-C-T p.Thr613Thr synonymous ABCC5 3 57628 5.2058E-5 28814 0 7.55249E-5
3-183683285-G-A p.Thr613Met missense ABCC5 2 56964 3.51099E-5 28482 0 6.36862E-5
3-183685498-T-G p.Ser606Ser synonymous ABCC5 4 83332 4.80008E-5 41666 0 3.18492E-5
3-183685501-A-G p.Ile605Ile synonymous ABCC5 2 83330 2.4001E-5 41665 0 NA
3-183685511-G-GT p.Thr602fs frameshift ABCC5 2 83314 2.40056E-5 41657 1 NA
3-183685519-A-G p.Ser599Ser synonymous ABCC5 1 83324 1.20013E-5 41662 0 NA
3-183685528-A-G p.Ser596Ser synonymous ABCC5 1 83326 1.20011E-5 41663 0 NA
3-183685534-A-G p.Cys594Cys synonymous ABCC5 49141 82490 0.595721 41245 14924 0.618523
3-183685555-C-CTCTTGGATCTCCAGATCGATGCTG c.1762-2_1762-1insCAGCATCGATCTGGAGATCCAAGA splice_acceptor ABCC5 1 83302 1.20045E-5 41651 0 NA
3-183685556-T-TCTTGGATCTCCAGATCGATGCTGTGCAGTGTCCTCTGTAAGC c.1762-3_1762-2insGCTTACAGAGGACACTGCACAGCATCGATCTGGAGATCCAAG splice_region ABCC5 1 83296 1.20054E-5 41648 0 NA
3-183689343-C-T c.1761+8G>A splice_region ABCC5 2 82760 2.41663E-5 41380 0 NA
3-183689354-T-G p.Gln586His missense ABCC5 1 82910 1.20613E-5 41455 0 1.20846E-5
3-183689362-C-G p.Glu584Gln missense ABCC5 1 82936 1.20575E-5 41468 0 NA
3-183689369-G-T p.Ile581Ile synonymous ABCC5 4 83022 4.818E-5 41511 0 0.00251762
3-183689385-C-T p.Arg576Lys missense ABCC5 1 83082 1.20363E-5 41541 0 4.01007E-6
3-183689394-C-T p.Arg573His missense ABCC5 22 83112 2.64703E-4 41556 0 5.03525E-4
3-183689395-G-A p.Arg573Cys missense ABCC5 6 83106 7.2197E-5 41553 0 2.40548E-5
3-183689399-G-A p.His571His synonymous ABCC5 1 83126 1.20299E-5 41563 0 4.0093E-6
3-183689401-G-A p.His571Tyr missense ABCC5 1 83126 1.20299E-5 41563 0 NA
3-183689413-T-C p.Ile567Val missense ABCC5 2 83134 2.40575E-5 41567 0 3.18715E-5
3-183689427-T-G p.Glu562Ala missense ABCC5 1 83110 1.20322E-5 41555 0 NA
3-183689434-C-T p.Glu560Lys missense ABCC5 1 83042 1.20421E-5 41521 0 3.20734E-5
3-183689441-G-A p.Pro557Pro synonymous ABCC5 1 83062 1.20392E-5 41531 0 NA
3-183689442-G-C p.Pro557Arg missense ABCC5 1 83050 1.20409E-5 41525 0 NA
3-183689449-C-T p.Glu555Lys missense ABCC5 2 83040 2.40848E-5 41520 0 8.28102E-6
3-183689450-G-A p.Asp554Asp synonymous ABCC5 2 83042 2.40842E-5 41521 0 4.00953E-5
3-183689456-G-C p.Asp552Glu missense ABCC5 3 83054 3.61211E-5 41527 0 1.91156E-4
3-183689460-A-G p.Leu551Pro missense ABCC5 2 83052 2.40813E-5 41526 0 NA
3-183689461-G-A p.Leu551Leu synonymous ABCC5 2 83048 2.40825E-5 41524 0 8.28034E-6
3-183689465-G-A p.Leu549Leu synonymous ABCC5 1 83064 1.20389E-5 41532 0 NA
3-183689469-T-C p.His548Arg missense ABCC5 1 83042 1.20421E-5 41521 0 4.00911E-6
3-183689492-C-T p.Ala540Ala synonymous ABCC5 3 83044 3.61254E-5 41522 0 2.23086E-4
3-183689493-G-A p.Ala540Val missense ABCC5 9 83030 1.08395E-4 41515 0 4.47175E-4
3-183689506-T-G p.Thr536Pro missense ABCC5 1 83074 1.20375E-5 41537 0 NA
3-183689507-G-A p.Arg535Arg synonymous ABCC5 1 83066 1.20386E-5 41533 0 8.28102E-6
3-183689508-C-T p.Arg535His missense ABCC5 1 83078 1.20369E-5 41539 0 3.18451E-5
3-183689508-C-A p.Arg535Leu missense ABCC5 1 83078 1.20369E-5 41539 0 6.36902E-5
3-183689509-G-C p.Arg535Gly missense ABCC5 9 83062 1.08353E-4 41531 0 1.60399E-5
3-183689509-G-A p.Arg535Cys missense ABCC5 1 83062 1.20392E-5 41531 0 9.5584E-5
3-183689571-G-A p.Pro514Leu missense ABCC5 19 83100 2.2864E-4 41550 1 0.001875
3-183689586-G-A p.Ser509Leu missense ABCC5 19 83164 2.28464E-4 41582 0 2.40714E-4
3-183689596-T-C p.Ile506Val missense ABCC5 18 83180 2.16398E-4 41590 1 6.25E-4
3-183689605-G-A p.His503Tyr missense ABCC5 1 83170 1.20236E-5 41585 0 6.25E-4
3-183689608-A-T p.Ser502Thr missense ABCC5 1 83174 1.2023E-5 41587 0 NA
3-183689610-G-T p.Ser501Tyr missense ABCC5 256 83162 0.00307833 41581 3 0.00247652
3-183689618-T-C p.Ala498Ala synonymous ABCC5 2 83172 2.40466E-5 41586 0 2.48558E-5
3-183689621-C-G p.Leu497Phe missense ABCC5 1 83180 1.20221E-5 41590 0 NA
3-183689629-C-T p.Ala495Thr missense ABCC5 2 83170 2.40471E-5 41585 0 2.48558E-5
3-183689641-C-T p.Glu491Lys missense ABCC5 2 83176 2.40454E-5 41588 0 8.28542E-6
3-183689662-C-T p.Ala484Thr missense ABCC5 2 83146 2.40541E-5 41573 0 6.25E-4
3-183689681-G-A p.His477His synonymous ABCC5 1 83086 1.20357E-5 41543 0 2.48645E-5
3-183689696-T-G p.Leu472Leu synonymous ABCC5 1 83060 1.20395E-5 41530 0 NA
3-183689813-T-C p.Thr472Ala missense ABCC5 1 78154 1.27953E-5 39077 0 4.69439E-5
3-183689815-G-T p.Ser471Tyr missense ABCC5 1 78066 1.28097E-5 39033 0 NA
3-183689829-G-T c.1405-7C>A splice_region ABCC5 1 77478 1.29069E-5 38739 0 NA
3-183695308-A-G n.952T>C splice_region ABCC5 1 83086 1.20357E-5 41543 0 8.02832E-6
3-183695341-G-A p.Ser456Ser synonymous ABCC5 1 83200 1.20192E-5 41600 0 8.2938E-6
3-183695347-T-C p.Val454Val synonymous ABCC5 2 83208 2.40361E-5 41604 0 NA
3-183695354-A-C p.Phe452Cys missense ABCC5 1 83196 1.20198E-5 41598 0 4.00869E-6
3-183695356-C-T p.Pro451Pro synonymous ABCC5 1 83202 1.20189E-5 41601 0 1.65854E-5
3-183695420-T-C c.1297-8A>G splice_region ABCC5 2 82836 2.41441E-5 41418 0 NA
3-183696297-T-C p.Ala430Ala synonymous ABCC5 1 82246 1.21586E-5 41123 0 8.02794E-6
3-183696308-C-T p.Asp427Asn missense ABCC5 1 82522 1.2118E-5 41261 0 3.31956E-5
3-183696309-G-A p.Phe426Phe synonymous ABCC5 2 82554 2.42266E-5 41277 0 2.4893E-5
3-183696324-A-G p.His421His synonymous ABCC5 1 82880 1.20656E-5 41440 0 NA
3-183696325-T-A p.His421Leu missense ABCC5 1 82902 1.20624E-5 41451 0 2.4874E-5
3-183696344-C-T p.Val415Met missense ABCC5 8 83168 9.61908E-5 41584 0 2.0037E-5
3-183696345-G-A p.Ser414Ser synonymous ABCC5 4 83170 4.80943E-5 41585 0 4.00744E-6
3-183696352-A-G p.Ile412Thr missense ABCC5 1 83248 1.20123E-5 41624 0 NA
3-183696361-A-G p.Val409Ala missense ABCC5 7 83294 8.40397E-5 41647 0 1.59317E-4
3-183696387-G-A p.Ser400Ser synonymous ABCC5 3152 83314 0.0378328 41657 320 0.0803685
3-183696393-GA-TT p.Phe398* stop_gained ABCC5 1 83344 1.19985E-5 41672 0 NA
3-183696402-A-G p.Ala395Ala synonymous ABCC5 49043 82848 0.591964 41424 14767 0.605988
3-183696413-A-G p.Leu392Leu synonymous ABCC5 2 83302 2.4009E-5 41651 0 8.03981E-6
3-183696418-C-T p.Arg390Gln missense ABCC5 3 83272 3.60265E-5 41636 0 4.01868E-6
3-183696419-G-A p.Arg390Trp missense ABCC5 1 83258 1.20109E-5 41629 0 3.18878E-5
3-183696423-C-T p.Glu388Glu synonymous ABCC5 4 83238 4.8055E-5 41619 0 3.18674E-5
3-183696432-G-A p.Arg385Arg synonymous ABCC5 1 83142 1.20276E-5 41571 0 2.42548E-5
3-183696433-C-T p.Arg385His missense ABCC5 3 83116 3.60941E-5 41558 0 8.08238E-6
3-183696434-G-A p.Arg385Cys missense ABCC5 1 83096 1.20343E-5 41548 0 8.39701E-6
3-183699510-C-T c.1147+5G>A splice_region ABCC5 1 83002 1.20479E-5 41501 0 NA
3-183699516-T-C p.Gln382Gln splice_region+synonymous ABCC5 29611 82112 0.360617 41056 5375 0.381168
3-183699522-A-G p.Ser380Ser synonymous ABCC5 1 83108 1.20325E-5 41554 0 4.08507E-6
3-183699523-C-T p.Ser380Asn missense ABCC5 1 83118 1.20311E-5 41559 0 2.03649E-5
3-183699534-T-A p.Ala376Ala synonymous ABCC5 2 83120 2.40616E-5 41560 0 NA
3-183699549-A-G p.Tyr371Tyr synonymous ABCC5 5 83148 6.01337E-5 41574 0 2.40174E-4
3-183699597-G-C p.Val355Val synonymous ABCC5 1 82934 1.20578E-5 41467 0 6.36943E-5
3-183699601-C-T p.Arg354His missense ABCC5 2 82892 2.41278E-5 41446 0 NA
3-183699605-C-G p.Glu353Gln missense ABCC5 2 82878 2.41319E-5 41439 0 NA
3-183699609-C-T p.Thr351Thr synonymous ABCC5 1 82852 1.20697E-5 41426 0 4.8881E-5
3-183699612-G-T p.Ala350Ala synonymous ABCC5 3 82850 3.621E-5 41425 0 3.1839E-5
3-183699613-G-A p.Ala350Val missense ABCC5 2 82828 2.41464E-5 41414 0 1.65876E-5
3-183699614-C-T p.Ala350Thr missense ABCC5 1 82810 1.20758E-5 41405 0 8.29435E-6
3-183699615-G-A p.Ala349Ala synonymous ABCC5 1 82808 1.20761E-5 41404 0 NA
3-183699627-T-C p.Arg345Arg synonymous ABCC5 1 82820 1.20744E-5 41410 0 NA
3-183699642-T-C p.Thr340Thr synonymous ABCC5 1 82804 1.20767E-5 41402 0 9.55353E-5
3-183700242-T-C p.Ala332Ala synonymous ABCC5 1 83040 1.20424E-5 41520 0 NA
3-183700254-G-A p.Leu328Leu synonymous ABCC5 1 83114 1.20317E-5 41557 0 NA
3-183700278-G-A p.Phe320Phe synonymous ABCC5 4 83192 4.80815E-5 41596 0 4.01159E-6
3-183700298-T-G p.Ile314Leu missense ABCC5 4 83222 4.80642E-5 41611 0 1.66409E-5
3-183700309-T-C p.Tyr310Cys missense ABCC5 1 83228 1.20152E-5 41614 0 3.18492E-5
3-183700316-T-C p.Met308Val missense ABCC5 5 83206 6.00918E-5 41603 0 5.61235E-5
3-183700334-C-T p.Val302Ile missense ABCC5 1 83194 1.20201E-5 41597 0 1.2028E-5
3-183700349-G-A p.Leu297Leu synonymous ABCC5 24 83154 2.88621E-4 41577 0 4.90245E-4
3-183700356-G-C p.Gly294Gly synonymous ABCC5 1 83120 1.20308E-5 41560 0 6.26566E-4
3-183700361-C-T p.Val293Ile missense ABCC5 1 83102 1.20334E-5 41551 0 NA
3-183700368-T-C p.Ala290Ala synonymous ABCC5 1 83072 1.20378E-5 41536 0 NA
3-183700392-G-A p.Asn282Asn synonymous ABCC5 2 82886 2.41295E-5 41443 0 NA
3-183700404-G-A p.Asn278Asn synonymous ABCC5 2 82832 2.41453E-5 41416 0 8.31476E-6
3-183700415-A-AT c.826-4_826-3insA splice_region ABCC5 1 82726 1.20881E-5 41363 0 NA
3-183700574-T-C p.Lys271Lys synonymous ABCC5 2 83336 2.39992E-5 41668 0 6.36821E-5
3-183700577-C-T p.Glu270Glu synonymous ABCC5 1 83348 1.19979E-5 41674 0 NA
3-183700585-T-C p.Ile268Val missense ABCC5 1 83354 1.1997E-5 41677 0 4.9701E-5
3-183700586-G-A p.Asn267Asn synonymous ABCC5 2 83358 2.39929E-5 41679 0 9.55414E-5
3-183700592-T-C p.Leu265Leu synonymous ABCC5 2 83366 2.39906E-5 41683 0 NA
3-183700613-T-C p.Ala258Ala synonymous ABCC5 6 83378 7.19614E-5 41689 1 3.18451E-5
3-183700630-C-T p.Ala253Thr missense ABCC5 1 83372 1.19944E-5 41686 0 4.00737E-6
3-183700632-C-G p.Gly252Ala missense ABCC5 2 83380 2.39866E-5 41690 0 8.28048E-6
3-183700635-C-T p.Arg251Gln missense ABCC5 2 83380 2.39866E-5 41690 0 1.65607E-5
3-183700641-C-T p.Arg249His missense ABCC5 1 83382 1.1993E-5 41691 0 8.28048E-6
3-183700648-C-T p.Gly247Ser missense ABCC5 3 83354 3.59911E-5 41677 0 4.14017E-5
3-183700649-G-A p.Thr246Thr synonymous ABCC5 1 83356 1.19967E-5 41678 0 3.18492E-5
3-183700653-C-T p.Arg245Gln missense ABCC5 1 83364 1.19956E-5 41682 0 8.28034E-6
3-183700682-C-T p.Ser235Ser synonymous ABCC5 12 83320 1.44023E-4 41660 0 6.25E-4
3-183700692-C-T p.Arg232Gln missense ABCC5 1 83324 1.20013E-5 41662 0 3.18451E-5
3-183700696-C-T p.Val231Met missense ABCC5 1 83312 1.20031E-5 41656 0 1.60312E-5
3-183700697-G-A p.Ile230Ile synonymous ABCC5 1 83308 1.20036E-5 41654 0 4.00766E-6
3-183700704-G-A p.Thr228Met missense ABCC5 15 83310 1.8005E-4 41655 0 1.2738E-4
3-183700727-C-A p.Leu220Phe missense ABCC5 1 83268 1.20094E-5 41634 0 NA
3-183700759-C-T p.Ala210Thr missense ABCC5 1 83132 1.20291E-5 41566 0 2.48443E-5
3-183700775-G-C p.Leu204Leu synonymous ABCC5 1 83050 1.20409E-5 41525 0 NA
3-183700793-G-A p.Ala198Ala splice_region+synonymous ABCC5 1 82806 1.20764E-5 41403 0 4.01365E-6
3-183700799-C-T c.592-4G>A splice_region ABCC5 12 82658 1.45177E-4 41329 0 2.4888E-5
3-183700802-G-T c.592-7C>A splice_region ABCC5 1 82600 1.21065E-5 41300 0 NA
3-183702600-G-T p.Thr225Lys missense ABCC5 7 80300 8.71731E-5 40150 0 3.64963E-4
3-183702600-G-A p.Thr225Met missense ABCC5 1 80300 1.24533E-5 40150 0 2.91435E-5
3-183702605-G-A p.Cys223Cys synonymous ABCC5 1 80328 1.2449E-5 40164 0 2.62798E-5
3-183702619-T-C p.Ile219Val missense ABCC5 1 80334 1.2448E-5 40167 0 NA
3-183702623-G-C p.Thr217Thr synonymous ABCC5 1 80324 1.24496E-5 40162 0 NA
3-183702623-G-A p.Thr217Thr synonymous ABCC5 2 80324 2.48992E-5 40162 0 NA
3-183702630-T-C p.His215Arg missense ABCC5 1 80306 1.24524E-5 40153 0 3.18532E-5
3-183702637-T-C p.Arg213Gly missense ABCC5 25 80290 3.11371E-4 40145 0 4.09271E-4
3-183702642-C-G p.Gly211Ala missense ABCC5 1 80260 1.24595E-5 40130 0 NA
3-183702652-C-T p.Glu208Lys missense ABCC5 3 80222 3.73962E-5 40111 0 3.18451E-5
3-183702653-G-A p.Ala207Ala synonymous ABCC5 2 80204 2.49364E-5 40102 0 4.61382E-5
3-183702653-G-T p.Ala207Ala synonymous ABCC5 1 80204 1.24682E-5 40102 0 NA
3-183702656-A-G p.Ser206Ser synonymous ABCC5 2 80180 2.49439E-5 40090 0 4.82523E-6
3-183702657-C-T p.Ser206Asn missense ABCC5 1 80182 1.24716E-5 40091 0 NA
3-183702669-T-A p.Asp202Val missense ABCC5 2 80102 2.49682E-5 40051 0 NA
3-183702672-C-T p.Gly201Glu missense ABCC5 4 80092 4.99426E-5 40046 0 6.3678E-5
3-183702681-G-A p.Pro198Leu missense+splice_region ABCC5 1 79992 1.25013E-5 39996 0 NA
3-183702681-G-T p.Pro198His missense+splice_region ABCC5 5 79992 6.25063E-5 39996 0 5.3118E-5
3-183703141-C-T p.Arg206Gln missense ABCC5 1 83086 1.20357E-5 41543 0 NA
3-183703143-C-A p.Leu205Leu synonymous ABCC5 2 83086 2.40714E-5 41543 0 2.78461E-5
3-183703144-A-G p.Leu205Pro missense ABCC5 1 83096 1.20343E-5 41548 0 NA
3-183703145-G-A p.Leu205Leu synonymous ABCC5 3 83106 3.60985E-5 41553 0 NA
3-183703156-T-A p.Asp201Val missense ABCC5 3 83100 3.61011E-5 41550 0 8.23818E-6
3-183703156-T-C p.Asp201Gly missense ABCC5 2 83100 2.40674E-5 41550 0 3.97795E-6
3-183703195-A-AC c.639dupG frameshift ABCC5 2 82808 2.41523E-5 41404 0 NA
3-183703199-C-T p.Leu212Leu synonymous ABCC5 1 82720 1.2089E-5 41360 0 3.1837E-5
3-183703208-T-TC p.Val210fs frameshift ABCC5 1 82436 1.21306E-5 41218 0 1.65049E-5
3-183703208-T-A p.Gly209Gly synonymous ABCC5 1 82438 1.21303E-5 41219 0 1.15534E-4
3-183703213-C-A p.Gly208Trp missense ABCC5 4 82366 4.85637E-5 41183 0 9.55353E-5
3-183703213-C-G p.Gly208Arg missense ABCC5 1 82366 1.21409E-5 41183 0 3.97899E-6
3-183705466-A-T p.Leu228His missense ABCC5 1 81666 1.2245E-5 40833 0 4.71418E-6
3-183705468-C-G p.Gln227His missense ABCC5 1 81684 1.22423E-5 40842 0 NA
3-183705477-A-G p.Gly224Gly synonymous ABCC5 155 81864 0.00189338 40932 1 0.00270438
3-183705482-T-C p.Arg223Gly missense ABCC5 2 81998 2.43908E-5 40999 0 4.27478E-6
3-183705487-C-G p.Cys221Ser missense ABCC5 1 82172 1.21696E-5 41086 0 NA
3-183705492-T-A p.Leu219Phe missense ABCC5 4 82358 4.85684E-5 41179 0 1.53078E-5
3-183705498-T-C p.Thr217Thr synonymous ABCC5 5 82480 6.06208E-5 41240 0 9.57732E-5
3-183705511-C-T p.Arg213Gln missense ABCC5 2 82860 2.41371E-5 41430 0 2.00378E-5
3-183705512-G-A p.Arg213Trp missense ABCC5 2 82892 2.41278E-5 41446 0 9.67979E-6
3-183705517-C-T p.Arg211Gln missense ABCC5 2 82922 2.41191E-5 41461 0 1.19871E-4
3-183705518-G-A p.Arg211Trp missense ABCC5 3 82948 3.61672E-5 41474 0 0.001875
3-183705525-TGGA-T p.Pro208del disruptive_inframe_deletion ABCC5 14 83022 1.6863E-4 41511 0 NA
3-183705530-A-T p.Ser207Thr missense ABCC5 56 83070 6.7413E-4 41535 0 3.2649E-4
3-183705530-A-G p.Ser207Pro missense ABCC5 1 83074 1.20375E-5 41537 0 8.57236E-6
3-183705533-G-A p.Gln206* stop_gained ABCC5 3 83082 3.61089E-5 41541 0 1.59272E-5
3-183705535-C-T p.Arg205Gln missense ABCC5 3 83088 3.61063E-5 41544 0 9.32519E-5
3-183705535-C-A p.Arg205Leu missense ABCC5 1 83088 1.20354E-5 41544 0 NA
3-183705536-G-A p.Arg205* stop_gained ABCC5 7 83126 8.42095E-5 41563 0 1.27421E-4
3-183705540-A-G p.Pro203Pro synonymous ABCC5 1 83150 1.20265E-5 41575 0 3.97975E-6
3-183705543-A-T p.His202Gln missense ABCC5 1 83168 1.20239E-5 41584 0 1.19384E-5
3-183705544-T-C p.His202Arg missense ABCC5 1 83168 1.20239E-5 41584 0 3.18573E-5
3-183705575-C-A p.Ala192Ser missense ABCC5 2 83204 2.40373E-5 41602 0 NA
3-183705594-G-T p.Cys185* stop_gained ABCC5 1 83188 1.2021E-5 41594 0 NA
3-183705596-AC-CA p.ValCys184ValGly missense ABCC5 1 83194 1.20201E-5 41597 0 NA
3-183705597-C-T p.Val184Val synonymous ABCC5 1 83194 1.20201E-5 41597 0 NA
3-183705604-G-C p.Ser182Cys missense ABCC5 2 83192 2.40408E-5 41596 0 NA
3-183705614-G-A p.Leu179Phe missense ABCC5 1 83186 1.20213E-5 41593 0 8.24076E-6
3-183705617-T-C p.Arg178Gly missense ABCC5 1 83182 1.20218E-5 41591 0 3.97899E-6
3-183705618-G-C p.Thr177Thr synonymous ABCC5 2 83184 2.40431E-5 41592 0 NA
3-183705623-G-A p.Arg176Cys missense ABCC5 1 83168 1.20239E-5 41584 0 NA
3-183705631-A-T p.Ile173Asn missense ABCC5 18 83176 2.16409E-4 41588 0 3.18471E-5
3-183705640-A-G p.Val170Ala missense ABCC5 1 83158 1.20253E-5 41579 0 NA
3-183705643-C-T p.Arg169Lys missense ABCC5 4 83180 4.80885E-5 41590 0 6.36862E-5
3-183705646-C-T p.Arg168Gln missense ABCC5 1 83166 1.20241E-5 41583 0 3.29598E-5
3-183705649-A-G p.Leu167Pro missense ABCC5 2 83158 2.40506E-5 41579 0 NA
3-183705650-G-A p.Leu167Leu synonymous ABCC5 3 83160 3.6075E-5 41580 0 7.95938E-6
3-183705660-G-A p.Asp163Asp synonymous ABCC5 2 83096 2.40685E-5 41548 0 1.27429E-4
3-183705693-C-T p.Leu152Leu synonymous ABCC5 1 82770 1.20817E-5 41385 0 3.98454E-6
3-183705696-T-C p.Arg151Arg synonymous ABCC5 1 82708 1.20907E-5 41354 0 NA
3-183705700-T-C p.Glu150Gly missense ABCC5 3 82610 3.63152E-5 41305 0 3.18674E-5
3-183705713-A-G c.444-8T>C splice_region ABCC5 3 82204 3.64946E-5 41102 0 2.4782E-4
3-183706354-G-A c.443+6C>T splice_region ABCC5 3 82614 3.63135E-5 41307 0 8.49401E-6
3-183706364-T-C p.Arg147Gly missense ABCC5 20 82826 2.4147E-4 41413 1 2.54761E-4
3-183706368-G-A p.Asn145Asn synonymous ABCC5 113 82860 0.00136375 41430 0 0.00136969
3-183706387-T-C p.His139Arg missense ABCC5 1 82988 1.20499E-5 41494 0 8.26897E-6
3-183706403-A-G p.Trp134Arg missense ABCC5 1 83070 1.2038E-5 41535 0 NA
3-183706406-C-G p.Val133Leu missense ABCC5 1 83062 1.20392E-5 41531 0 NA
3-183706407-G-A p.Asp132Asp synonymous ABCC5 1 83064 1.20389E-5 41532 0 7.96128E-6
3-183706415-T-C p.Met130Val missense ABCC5 3 83100 3.61011E-5 41550 0 3.18512E-5
3-183706430-T-G p.Lys125Gln missense ABCC5 1 83138 1.20282E-5 41569 0 3.9795E-6
3-183706432-T-C p.Lys124Arg missense ABCC5 1 83134 1.20288E-5 41567 0 8.24742E-6
3-183706444-C-T p.Arg120His missense ABCC5 4 83168 4.80954E-5 41584 0 1.59266E-4
3-183706445-G-A p.Arg120Cys missense ABCC5 2 83170 2.40471E-5 41585 0 1.19413E-5
3-183706464-C-T p.Ser113Ser synonymous ABCC5 2 83206 2.40367E-5 41603 0 1.59198E-5
3-183706464-C-A p.Ser113Ser synonymous ABCC5 2 83206 2.40367E-5 41603 0 3.30038E-5
3-183706465-G-A p.Ser113Leu missense ABCC5 3 83216 3.60508E-5 41608 0 6.37633E-5
3-183706468-A-G p.Phe112Ser missense ABCC5 3 83232 3.60438E-5 41616 0 1.65071E-5
3-183706475-T-C p.Met110Val missense ABCC5 2 83250 2.4024E-5 41625 0 8.25709E-6
3-183706483-A-G p.Phe107Ser missense ABCC5 1 83270 1.20091E-5 41635 0 7.95849E-6
3-183706508-G-A p.His99Tyr missense ABCC5 1 83290 1.20062E-5 41645 0 3.99208E-6
3-183706515-T-TTTGGAAGTAGTCCGGATGGG c.288-1_288insCCCATCCGGACTACTTCCAA splice_acceptor ABCC5 2 83268 2.40188E-5 41634 1 NA
3-183707007-A-G c.287+7T>C splice_region ABCC5 17 83288 2.04111E-4 41644 0 8.85939E-4
3-183707015-T-G p.Lys96Gln missense+splice_region ABCC5 1 83322 1.20016E-5 41661 0 NA
3-183707017-G-A p.Ser95Phe missense ABCC5 1 83328 1.20008E-5 41664 0 4.00029E-6
3-183707021-T-C p.Thr94Ala missense ABCC5 1 83342 1.19988E-5 41671 0 0.00100806
3-183707023-G-A p.Thr93Ile missense ABCC5 1 83338 1.19993E-5 41669 0 NA
3-183707028-G-T p.Ile91Ile synonymous ABCC5 1 83356 1.19967E-5 41678 0 NA
3-183707043-A-G p.Ser86Ser synonymous ABCC5 2 83368 2.399E-5 41684 0 NA
3-183707053-T-C p.His83Arg missense ABCC5 3 83386 3.59773E-5 41693 0 3.18756E-5
3-183707056-T-C p.His82Arg missense ABCC5 2 83396 2.3982E-5 41698 0 4.94568E-5
3-183707079-C-T p.Glu74Glu synonymous ABCC5 15 83366 1.79929E-4 41683 0 0.001875
3-183707081-C-T p.Glu74Lys missense ABCC5 2 83366 2.39906E-5 41683 0 1.64769E-5
3-183707101-G-A p.Ser67Phe missense ABCC5 1 83354 1.1997E-5 41677 0 8.23778E-6
3-183707101-G-C p.Ser67Cys missense ABCC5 1 83354 1.1997E-5 41677 0 NA
3-183707116-T-A p.Asp62Val missense ABCC5 1 83318 1.20022E-5 41659 0 3.18715E-5
3-183707133-G-A p.Ala56Ala synonymous ABCC5 1 83248 1.20123E-5 41624 0 1.5915E-5
3-183707134-G-T p.Ala56Asp missense ABCC5 1 83238 1.20137E-5 41619 0 7.95741E-6
3-183707137-C-T p.Arg55Gln missense ABCC5 1 83232 1.20146E-5 41616 0 1.5916E-5
3-183707138-G-A p.Arg55* stop_gained ABCC5 1 83204 1.20187E-5 41602 0 3.97972E-6
3-183707144-C-T p.Ala53Thr missense ABCC5 3 83156 3.60768E-5 41578 0 8.35641E-5
3-183707154-G-A p.Ala49Ala synonymous ABCC5 1 83068 1.20383E-5 41534 0 NA
3-183707171-A-ACGGTCGAGTTCTCCTGAACTTGGAATCTTCACGGTCT c.130-1_130insAGACCGTGAAGATTCCAAGTTCAGGAGAACTCGACCG splice_acceptor ABCC5 1 82840 1.20715E-5 41420 0 NA
3-183707172-C-CGG c.130-2_130-1insCC splice_acceptor ABCC5 2 82834 2.41447E-5 41417 1 NA
3-183707172-C-CGGTCGAGTTCTCCTGAACTTGGAATCTTCACGGTCTCTG c.130-2_130-1insCAGAGACCGTGAAGATTCCAAGTTCAGGAGAACTCGACC splice_acceptor ABCC5 2 82834 2.41447E-5 41417 1 NA
3-183719028-G-A p.Leu47Leu synonymous ABCC5 2 43982 4.54731E-5 21991 0 3.18471E-5
3-183719039-T-A p.Ser44Cys missense+splice_region ABCC5 1 44360 2.25428E-5 22180 0 NA
3-183727670-C-T c.*56+7G>A splice_region ABCC5 1 46190 2.16497E-5 23095 0 NA
3-183727674-T-G c.*56+3A>C splice_region ABCC5 11 46510 2.36508E-4 23255 0 0.00152207
3-183727743-C-T p.Gly51Asp missense ABCC5 230 45394 0.00506675 22697 1 0.0105408
3-183727760-G-A p.His45His synonymous ABCC5 1 44020 2.27169E-5 22010 0 NA
3-183732045-A-AACT c.129+6_129+7insAGT splice_region ABCC5 2 83320 2.40038E-5 41660 0 1.65377E-5
3-183732052-C-T p.Pro43Pro splice_region+synonymous ABCC5 1 83352 1.19973E-5 41676 0 3.18878E-5
3-183732053-G-A p.Pro43Leu missense+splice_region ABCC5 7 83360 8.39731E-5 41680 0 1.27502E-4
3-183732056-C-T p.Arg42Gln missense ABCC5 35 83362 4.19856E-4 41681 2 0.00251762
3-183732068-A-G p.Phe38Ser missense ABCC5 3 83368 3.5985E-5 41684 0 1.64889E-5
3-183732068-A-C p.Phe38Cys missense ABCC5 1 83368 1.1995E-5 41684 0 NA
3-183732077-T-A p.Asp35Val missense ABCC5 1 83382 1.1993E-5 41691 0 3.18573E-5
3-183732079-T-A p.Glu34Asp missense ABCC5 1 83380 1.19933E-5 41690 0 3.98032E-6
3-183732083-C-T p.Arg33His missense ABCC5 2 83376 2.39877E-5 41688 0 2.78718E-5
3-183732085-G-A p.Asp32Asp synonymous ABCC5 1 83380 1.19933E-5 41690 0 0.00125
3-183732094-C-G p.Thr29Thr synonymous ABCC5 1 83380 1.19933E-5 41690 0 3.98035E-6
3-183732095-G-A p.Thr29Met missense ABCC5 2 83382 2.3986E-5 41691 0 0.00100705
3-183732105-T-C p.Thr26Ala missense ABCC5 2 83380 2.39866E-5 41690 0 NA
3-183732113-C-G p.Arg23Thr missense ABCC5 2 83388 2.39843E-5 41694 0 NA
3-183732123-C-T p.Val20Met missense ABCC5 2 83382 2.3986E-5 41691 0 3.97785E-6
3-183732130-A-G p.Tyr17Tyr synonymous ABCC5 2 83374 2.39883E-5 41687 0 1.98894E-5
3-183732145-G-A p.Ile12Ile synonymous ABCC5 1 83368 1.1995E-5 41684 0 8.23873E-6
3-183732148-G-A p.Ile11Ile synonymous ABCC5 3 83364 3.59868E-5 41682 0 4.94348E-5
3-183732151-A-G p.Tyr10Tyr synonymous ABCC5 1 83372 1.19944E-5 41686 0 8.23981E-6
3-183732157-T-G p.Lys8Asn missense ABCC5 10 83354 1.1997E-4 41677 0 0.00100705
3-183732161-C-T p.Gly7Glu missense ABCC5 1 83354 1.1997E-5 41677 0 8.24498E-6
3-183732166-G-T p.Asp5Glu missense ABCC5 2 83340 2.39981E-5 41670 0 NA
3-183732169-G-A p.Ile4Ile synonymous ABCC5 2 83330 2.4001E-5 41665 0 1.59996E-5
3-183732171-T-C p.Ile4Val missense ABCC5 1 83316 1.20025E-5 41658 0 3.99703E-6
3-183732209-C-T c.-29G>A 5_prime_UTR_premature_start_codon_gain ABCC5 602 82776 0.00727264 41388 6 0.00700531
3-183732225-C-T c.-45G>A 5_prime_UTR_premature_start_codon_gain ABCC5 1 81950 1.22026E-5 40975 0 9.5133E-6
3-183735667-G-A c.-105C>T 5_prime_UTR_premature_start_codon_gain ABCC5 2 2922 6.84463E-4 1461 0 6.36862E-5
3-183735672-T-A c.-110A>T 5_prime_UTR_premature_start_codon_gain ABCC5 2 2934 6.81663E-4 1467 0 NA