Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
17-48712247-C-T c.-51C>T 5_prime_UTR_premature_start_codon_gain ABCC3 1 33940 2.94638E-5 16970 0 NA
17-48712298-A-G p.Met1? start_lost ABCC3 1 35766 2.79595E-5 17883 0 3.19346E-5
17-48712309-G-A p.Leu4Leu synonymous ABCC3 1 35904 2.7852E-5 17952 0 NA
17-48712319-G-A p.Gly8Arg missense ABCC3 2 35806 5.58566E-5 17903 0 NA
17-48712329-G-A p.Gly11Asp missense ABCC3 3 35534 8.44262E-5 17767 0 0.00967742
17-48712336-G-C p.Lys13Asn missense ABCC3 288 35490 0.00811496 17745 4 0.0360866
17-48712348-G-A c.45+6G>A splice_region ABCC3 1 35272 2.83511E-5 17636 0 NA
17-48712568-G-T c.46-8G>T splice_region ABCC3 1 25218 3.96542E-5 12609 0 NA
17-48712594-A-T p.Ser22Cys missense ABCC3 1 23286 4.29443E-5 11643 0 1.58248E-5
17-48712596-T-C p.Ser22Ser synonymous ABCC3 2 23092 8.66101E-5 11546 0 1.27714E-4
17-48712600-G-A p.Glu24Lys missense ABCC3 1 22900 4.36681E-5 11450 0 3.18573E-5
17-48712601-A-T p.Glu24Val missense ABCC3 3 22790 1.31637E-4 11395 0 4.55789E-5
17-48712630-A-AGTGC p.Trp36fs frameshift ABCC3 1 20058 4.98554E-5 10029 0 NA
17-48712631-G-T p.Ser34Ile missense ABCC3 1 19936 5.01605E-5 9968 0 NA
17-48712634-C-A p.Ala35Glu missense ABCC3 1 19450 5.14139E-5 9725 0 2.55037E-4
17-48712638-G-A p.Trp36* stop_gained ABCC3 1 19110 5.23286E-5 9555 0 NA
17-48712654-C-G p.Pro42Ala missense ABCC3 1 16600 6.0241E-5 8300 0 5.93067E-5
17-48712672-C-G p.Arg48Gly missense ABCC3 1 14656 6.82314E-5 7328 0 NA
17-48712696-A-G p.Ile56Val missense ABCC3 1 12358 8.09192E-5 6179 0 5.05919E-5
17-48712705-G-A p.Gly59Arg missense ABCC3 4582 9008 0.508659 4504 971 0.783163
17-48712711-C-G p.Leu61Val missense ABCC3 4833 7772 0.621848 3886 1364 0.851277
17-48712714-A-T p.Met62Leu missense ABCC3 1 11514 8.68508E-5 5757 0 NA
17-48712750-G-C c.214+6G>C splice_region ABCC3 6 10688 5.61377E-4 5344 0 4.54545E-4
17-48712898-T-C p.Ter77Argext*? stop_lost ABCC3 11 10224 0.0010759 5112 0 0.00258225
17-48720929-C-A p.Thr22Asn missense ABCC3 1 9570 1.04493E-4 4785 0 3.18451E-5
17-48720971-C-T p.Thr36Met missense ABCC3 8 9576 8.35422E-4 4788 0 0.00833642
17-48721027-G-T c.*26+5G>T splice_region ABCC3 26 9572 0.00271626 4786 0 0.00515989
17-48733187-C-T c.46-6C>T splice_region ABCC3 447 82832 0.00539647 41416 2 0.00547847
17-48733187-C-G c.46-6C>G splice_region ABCC3 5 82850 6.035E-5 41425 0 3.18532E-4
17-48733189-C-T c.46-4C>T splice_region ABCC3 1 82870 1.20671E-5 41435 0 3.98893E-6
17-48733196-T-G p.Ser17Ala missense ABCC3 1 82968 1.20528E-5 41484 0 NA
17-48733207-T-C p.Ser20Ser synonymous ABCC3 1 83052 1.20406E-5 41526 0 NA
17-48733209-T-C p.Val21Ala missense ABCC3 14 83044 1.68585E-4 41522 0 9.56084E-5
17-48733215-C-G p.Thr23Arg missense ABCC3 4 83112 4.81278E-5 41556 0 6.37146E-5
17-48733223-C-A p.Pro26Thr missense ABCC3 1 83160 1.2025E-5 41580 0 NA
17-48733225-G-A p.Pro26Pro synonymous ABCC3 3 83176 3.60681E-5 41588 0 6.37755E-5
17-48733226-G-A p.Asp27Asn missense ABCC3 1 83176 1.20227E-5 41588 0 1.64878E-5
17-48733235-C-T p.Pro30Ser missense ABCC3 1 83240 1.20135E-5 41620 0 NA
17-48733238-T-G p.Cys31Gly missense ABCC3 1 83264 1.201E-5 41632 0 NA
17-48733266-T-TGCCCTGCATCTACCTGTGGGTC p.Pro50fs frameshift ABCC3 1 83302 1.20045E-5 41651 0 7.41497E-5
17-48733268-C-T p.Pro41Ser missense ABCC3 2 83308 2.40073E-5 41654 0 7.95355E-6
17-48733269-C-T p.Pro41Leu missense ABCC3 1 83312 1.20031E-5 41656 0 NA
17-48733271-T-G p.Cys42Gly missense ABCC3 1 83308 1.20036E-5 41654 0 NA
17-48733277-T-G p.Tyr44Asp missense ABCC3 1 83314 1.20028E-5 41657 0 1.64772E-5
17-48733282-G-T p.Leu45Leu synonymous ABCC3 10 83322 1.20016E-4 41661 0 2.78357E-4
17-48733285-G-A p.Trp46* stop_gained ABCC3 2 83320 2.40038E-5 41660 0 NA
17-48733288-C-T p.Val47Val synonymous ABCC3 95 83306 0.00114037 41653 0 0.0013017
17-48733289-G-A p.Ala48Thr missense ABCC3 7 83300 8.40336E-5 41650 0 6.76116E-5
17-48733289-G-T p.Ala48Ser missense ABCC3 2 83300 2.40096E-5 41650 0 4.94356E-5
17-48733295-C-T p.Pro50Ser missense ABCC3 1 83312 1.20031E-5 41656 0 6.37267E-5
17-48733297-C-CT p.Cys51fs frameshift ABCC3 1 83326 1.20011E-5 41663 0 NA
17-48733316-C-T p.Arg57Trp missense ABCC3 5 83326 6.00053E-5 41663 0 8.23873E-5
17-48733317-G-A p.Arg57Gln missense ABCC3 6 83324 7.20081E-5 41662 1 9.88647E-5
17-48733328-C-T p.Arg61Cys missense ABCC3 1 83328 1.20008E-5 41664 0 2.47182E-5
17-48733341-T-G p.Ile65Ser missense ABCC3 1 83300 1.20048E-5 41650 0 NA
17-48733345-C-T p.Leu66Leu synonymous ABCC3 1 83314 1.20028E-5 41657 0 NA
17-48733345-CTCCCACCTGTCCAAGCTCAAGA-C p.Ser67fs frameshift ABCC3 2 83314 2.40056E-5 41657 0 3.97883E-6
17-48733349-C-T p.His68Tyr missense ABCC3 677 83320 0.0081253 41660 2 0.01
17-48733352-C-G p.Leu69Val missense ABCC3 1 83326 1.20011E-5 41663 0 2.23001E-4
17-48733352-C-A p.Leu69Met missense ABCC3 1 83326 1.20011E-5 41663 0 NA
17-48733356-C-G p.Ser70Cys missense ABCC3 2 83324 2.40027E-5 41662 0 NA
17-48733360-G-A p.Lys71Lys synonymous ABCC3 2 83334 2.39998E-5 41667 0 6.25E-4
17-48733368-T-C p.Met74Thr missense+splice_region ABCC3 1 83326 1.20011E-5 41663 0 NA
17-48734058-C-T c.223-5C>T splice_region ABCC3 1 83290 1.20062E-5 41645 0 8.58089E-6
17-48734065-C-T p.Val75Val splice_region+synonymous ABCC3 1 83292 1.2006E-5 41646 0 8.49762E-6
17-48734086-C-T p.Cys82Cys synonymous ABCC3 1 83230 1.20149E-5 41615 0 4.16653E-5
17-48734087-G-A p.Val83Ile missense ABCC3 1 83208 1.20181E-5 41604 0 2.49721E-5
17-48734093-T-C p.Trp85Arg missense ABCC3 1 83202 1.20189E-5 41601 0 6.37064E-5
17-48734097-C-T p.Ala86Val missense ABCC3 3 83140 3.60837E-5 41570 0 5.03525E-4
17-48734098-G-A p.Ala86Ala synonymous ABCC3 8 83124 9.62418E-5 41562 0 4.97554E-5
17-48734100-AC-A p.Leu88fs frameshift ABCC3 1 83100 1.20337E-5 41550 0 3.98527E-6
17-48734101-C-A p.Asp87Glu missense ABCC3 1 83102 1.20334E-5 41551 0 1.6573E-5
17-48734114-T-TTCCATGGCCTGG p.Leu95_Gly98dup disruptive_inframe_insertion ABCC3 1 82930 1.20584E-5 41465 0 8.27952E-6
17-48734119-T-C p.His93His synonymous ABCC3 3 82788 3.62371E-5 41394 0 3.18608E-5
17-48734135-C-T p.Arg99Trp missense ABCC3 1 82358 1.21421E-5 41179 0 6.36983E-5
17-48734135-C-G p.Arg99Gly missense ABCC3 1 82358 1.21421E-5 41179 0 2.48855E-5
17-48734135-C-CG p.Ala100fs frameshift ABCC3 1 82358 1.21421E-5 41179 0 NA
17-48734136-G-A p.Arg99Gln missense ABCC3 377 82234 0.00458448 41117 3 0.0104485
17-48734139-C-A p.Ala100Asp missense ABCC3 1 82180 1.21684E-5 41090 0 NA
17-48734141-C-T p.Pro101Ser missense ABCC3 1 82102 1.218E-5 41051 0 3.98753E-6
17-48734144-G-A p.Ala102Thr missense ABCC3 6 81974 7.31939E-5 40987 0 6.37186E-5
17-48734162-AC-A p.Leu110fs frameshift ABCC3 2 81328 2.45918E-5 40664 0 1.6833E-5
17-48734177-G-T p.Gly113Trp missense ABCC3 1 80842 1.23698E-5 40421 0 1.02337E-4
17-48734415-C-A p.Ala119Ala synonymous ABCC3 1 83280 1.20077E-5 41640 0 1.66295E-5
17-48734416-A-AC p.Leu121fs frameshift ABCC3 4 83284 4.80284E-5 41642 0 6.79044E-5
17-48734418-C-T p.Thr120Thr synonymous ABCC3 1 83292 1.2006E-5 41646 0 NA
17-48734424-G-A p.Leu122Leu synonymous ABCC3 2 83322 2.40033E-5 41661 0 8.28089E-6
17-48734437-C-T p.Arg127Trp missense ABCC3 1 83330 1.20005E-5 41665 0 1.65218E-5
17-48734438-G-A p.Arg127Gln missense ABCC3 2 83332 2.40004E-5 41666 0 1.19411E-5
17-48734442-G-A p.Leu128Leu synonymous ABCC3 2 83332 2.40004E-5 41666 0 8.25191E-6
17-48734446-G-A p.Gly130Ser missense ABCC3 1 83344 1.19985E-5 41672 0 3.97874E-6
17-48734446-GGCGTACAGTCT-G p.Gly130fs frameshift ABCC3 1 83344 1.19985E-5 41672 0 NA
17-48734447-G-A p.Gly130Asp missense ABCC3 2 83334 2.39998E-5 41667 0 3.18593E-5
17-48734448-C-T p.Gly130Gly synonymous ABCC3 8 83332 9.60015E-5 41666 0 7.01042E-4
17-48734448-C-A p.Gly130Gly synonymous ABCC3 1 83332 1.20002E-5 41666 0 8.24756E-6
17-48734449-G-A p.Val131Ile missense ABCC3 3 83350 3.59928E-5 41675 0 5.17273E-5
17-48734452-C-T p.Gln132* stop_gained ABCC3 6 83360 7.1977E-5 41680 0 1.27405E-4
17-48734460-G-A p.Ser134Ser synonymous ABCC3 1 83350 1.19976E-5 41675 0 1.59109E-5
17-48734475-CT-C p.Phe140fs frameshift ABCC3 1 83388 1.19921E-5 41694 0 NA
17-48734481-G-A p.Trp141* stop_gained ABCC3 1 83384 1.19927E-5 41692 0 NA
17-48734487-G-A p.Leu143Leu synonymous ABCC3 1 83386 1.19924E-5 41693 0 NA
17-48734492-T-C p.Val145Ala missense ABCC3 39 83384 4.67716E-4 41692 0 0.00114745
17-48734493-G-A p.Val145Val synonymous ABCC3 11 83384 1.3192E-4 41692 0 4.61475E-4
17-48734499-C-T p.Cys147Cys synonymous ABCC3 1 83382 1.1993E-5 41691 0 1.64821E-5
17-48734502-C-CA p.Ile149fs frameshift ABCC3 1 83392 1.19916E-5 41696 0 3.97753E-6
17-48734504-T-C p.Ile149Thr missense ABCC3 1 83394 1.19913E-5 41697 0 NA
17-48734505-C-A p.Ile149Ile synonymous ABCC3 2 83396 2.3982E-5 41698 0 NA
17-48734506-G-A p.Val150Ile missense ABCC3 1 83396 1.1991E-5 41698 0 3.18532E-5
17-48734515-C-T p.Arg153Cys missense ABCC3 1 83386 1.19924E-5 41693 0 6.36862E-5
17-48734516-G-A p.Arg153His missense ABCC3 8 83382 9.5944E-5 41691 0 4.14092E-4
17-48734527-C-A p.Leu157Ile missense ABCC3 1 83374 1.19941E-5 41687 0 3.9808E-6
17-48734551-T-C c.486+7T>C splice_region ABCC3 2 83300 2.40096E-5 41650 0 3.3423E-5
17-48735464-C-T p.Arg170Cys missense ABCC3 3 83350 3.59928E-5 41675 0 9.06021E-5
17-48735465-G-A p.Arg170His missense ABCC3 1 83346 1.19982E-5 41673 0 5.03525E-4
17-48735475-C-G p.Thr173Thr synonymous ABCC3 1 83356 1.19967E-5 41678 0 7.95279E-6
17-48735494-C-G p.Leu180Val missense ABCC3 3 83364 3.59868E-5 41682 0 3.18512E-5
17-48735507-C-T p.Ala184Val missense ABCC3 8 83352 9.59785E-5 41676 0 1.98821E-5
17-48735514-C-T p.Ile186Ile synonymous ABCC3 1 83350 1.19976E-5 41675 0 7.95279E-6
17-48735517-G-T p.Leu187Phe missense ABCC3 1 83336 1.19996E-5 41668 0 NA
17-48735532-G-T p.Glu192Asp missense ABCC3 1 83312 1.20031E-5 41656 0 NA
17-48735550-C-T p.Ser198Ser synonymous ABCC3 10 83238 1.20137E-4 41619 0 0.00151057
17-48735551-G-T p.Ala199Ser missense ABCC3 4 83238 4.8055E-5 41619 0 9.57365E-5
17-48735551-G-A p.Ala199Thr missense ABCC3 1 83238 1.20137E-5 41619 0 6.25E-4
17-48735559-T-C p.Asn201Asn synonymous ABCC3 1 83228 1.20152E-5 41614 0 NA
17-48735562-C-T p.Val202Val synonymous ABCC3 1 83198 1.20195E-5 41599 0 1.64739E-5
17-48735798-C-A p.Asn205Lys missense+splice_region ABCC3 1 83224 1.20158E-5 41612 0 8.23642E-6
17-48735799-C-T p.Pro206Ser missense ABCC3 1 83228 1.20152E-5 41614 0 NA
17-48735811-A-C p.Thr210Pro missense ABCC3 1 83232 1.20146E-5 41616 0 NA
17-48735816-C-T p.Ser211Ser synonymous ABCC3 26 83230 3.12387E-4 41615 0 0.00124461
17-48735817-G-A p.Ala212Thr missense ABCC3 20 83214 2.40344E-4 41607 0 6.25E-4
17-48735817-G-T p.Ala212Ser missense ABCC3 2 83214 2.40344E-5 41607 0 5.03525E-4
17-48735832-C-T p.Arg217Cys missense ABCC3 1 83236 1.2014E-5 41618 0 2.78352E-5
17-48735833-G-A p.Arg217His missense ABCC3 3 83226 3.60464E-5 41613 0 6.37308E-5
17-48735834-C-T p.Arg217Arg synonymous ABCC3 1 83234 1.20143E-5 41617 0 NA
17-48735837-G-A p.Leu218Leu synonymous ABCC3 103 83216 0.00123774 41608 0 0.0029631
17-48735837-G-T p.Leu218Leu synonymous ABCC3 1 83230 1.20149E-5 41615 0 NA
17-48735856-A-G p.Lys225Glu missense+splice_region ABCC3 1 83170 1.20236E-5 41585 0 3.97649E-6
17-48736546-G-A p.Leu226Leu synonymous ABCC3 1 82258 1.21569E-5 41129 0 3.18776E-5
17-48736547-C-T p.Leu227Leu synonymous ABCC3 2 82280 2.43072E-5 41140 0 2.02244E-5
17-48736552-C-A p.Asn228Lys missense ABCC3 1 82390 1.21374E-5 41195 0 4.02911E-6
17-48736553-C-G p.Pro229Ala missense ABCC3 1 82438 1.21303E-5 41219 0 4.02437E-6
17-48736561-T-G p.Pro231Pro synonymous ABCC3 44 82496 5.33359E-4 41248 0 0.00105223
17-48736565-C-T p.Arg233Trp missense ABCC3 5 82564 6.05591E-5 41282 0 6.01468E-5
17-48736566-G-A p.Arg233Gln missense ABCC3 3 82586 3.63258E-5 41293 0 3.40281E-5
17-48736579-G-A p.Pro237Pro synonymous ABCC3 1 82746 1.20852E-5 41373 0 8.37549E-6
17-48736586-A-G p.Thr240Ala missense ABCC3 1 82792 1.20785E-5 41396 0 7.97226E-6
17-48736590-C-T p.Ser241Phe missense ABCC3 1 82866 1.20677E-5 41433 0 8.34181E-6
17-48736593-C-A p.Pro242His missense ABCC3 1 82828 1.20732E-5 41414 0 3.98349E-6
17-48736594-C-T c.675-4C>T splice_region ABCC3 18 82832 2.17307E-4 41416 0 6.25782E-4
17-48736594-C-G c.675-4C>G splice_region ABCC3 15 82828 1.81098E-4 41414 0 0.00125078
17-48736594-C-A c.675-4C>A splice_region ABCC3 3 82832 3.62179E-5 41416 0 5.57716E-5
17-48736596-A-C c.675-2A>C splice_acceptor ABCC3 2 82792 2.41569E-5 41396 0 6.37714E-5
17-48736617-C-T p.Arg232Trp missense ABCC3 22 82824 2.65624E-4 41412 0 2.31757E-4
17-48736617-C-A p.Pro250Gln missense ABCC3 1 82824 1.20738E-5 41412 0 NA
17-48736618-G-A p.Arg232Gln missense ABCC3 16 82764 1.93321E-4 41382 0 0.00100705
17-48736629-G-A p.Glu236Lys missense ABCC3 1 82896 1.20633E-5 41448 0 NA
17-48736640-C-G p.Asp239Glu missense ABCC3 1 82944 1.20563E-5 41472 0 NA
17-48736649-C-G p.Pro261Ala missense ABCC3 1 83042 1.20421E-5 41521 0 NA
17-48736666-G-T p.Arg248Ile missense ABCC3 1 83130 1.20294E-5 41565 0 NA
17-48736673-G-T p.Gln250His missense ABCC3 1 83142 1.20276E-5 41571 0 3.97902E-6
17-48736674-A-G p.Met251Val missense ABCC3 2 83132 2.40581E-5 41566 0 NA
17-48736675-T-C p.Met251Thr missense ABCC3 1 83130 1.20294E-5 41565 0 7.95976E-6
17-48736679-G-A p.Gly271Ser missense ABCC3 2 83146 2.40541E-5 41573 0 NA
17-48736687-A-T p.Gln255Leu missense ABCC3 3 83174 3.6069E-5 41587 0 6.25E-4
17-48736695-G-A p.Glu258Lys missense ABCC3 19 83220 2.2831E-4 41610 0 1.35368E-4
17-48736698-G-A p.Ala259Thr missense ABCC3 2 83228 2.40304E-5 41614 0 5.03525E-4
17-48736705-G-T p.Arg261Met missense ABCC3 1 83226 1.20155E-5 41613 0 3.98346E-6
17-48736712-G-C p.Gln263His missense ABCC3 1 83220 1.20163E-5 41610 0 NA
17-48736723-C-T p.Thr267Met missense ABCC3 7 83186 8.41488E-5 41593 0 5.98645E-5
17-48736724-G-A p.Gly286Ser missense ABCC3 4 83180 4.80885E-5 41590 0 3.18796E-5
17-48736724-G-T p.Gly286Cys missense ABCC3 1 83180 1.20221E-5 41590 0 3.18796E-5
17-48736726-C-G p.Ala268Gly missense ABCC3 1 83154 1.20259E-5 41577 0 NA
17-48736727-A-ACGACACAAGGCTTCAGCAGCACCTGGGAAAAATGCCTC p.Glu246fs frameshift ABCC3 1 83146 1.2027E-5 41573 0 NA
17-48736728-C-T p.Arg269* stop_gained ABCC3 4 83130 4.81174E-5 41565 0 3.18796E-5
17-48736728-C-G p.Arg269Gly missense+splice_region ABCC3 1 83130 1.20294E-5 41565 0 1.67224E-5
17-48736729-G-A p.Arg269Gln missense+splice_region ABCC3 3 83120 3.60924E-5 41560 0 6.37471E-5
17-48736734-G-A c.806+5G>A splice_region ABCC3 1 83072 1.20378E-5 41536 0 NA
17-48738278-G-T c.807-6G>T splice_region ABCC3 1 80940 1.23548E-5 40470 0 3.18613E-5
17-48738287-C-G p.His270Gln missense ABCC3 1 81470 1.22745E-5 40735 0 NA
17-48738288-A-G p.Lys271Glu missense ABCC3 1 81578 1.22582E-5 40789 0 4.28471E-6
17-48738317-C-A p.Leu299Ile missense ABCC3 1 82330 1.21462E-5 41165 0 NA
17-48738320-C-T p.Arg300Trp missense ABCC3 3 82320 3.64431E-5 41160 0 3.18532E-5
17-48738321-G-A p.Gly282Ser missense ABCC3 5 82322 6.07371E-5 41161 0 0.00100705
17-48738323-C-T p.Arg301* stop_gained ABCC3 2 82304 2.43002E-5 41152 0 1.69638E-5
17-48738326-G-A p.Gly302Arg missense ABCC3 1 82446 1.21292E-5 41223 0 2.00338E-5
17-48738328-A-C p.Asp284Ala missense ABCC3 2 82442 2.42595E-5 41221 0 NA
17-48738329-C-T p.Arg303* stop_gained ABCC3 4 82462 4.85072E-5 41231 0 5.03651E-5
17-48738330-G-A p.Glu285Lys missense ABCC3 34 82484 4.12201E-4 41242 0 0.00251762
17-48738331-A-G p.Glu285Gly missense ABCC3 1 82480 1.21242E-5 41240 0 3.20064E-5
17-48738336-C-T p.Ala305Val missense ABCC3 1 82478 1.21244E-5 41239 0 NA
17-48738348-C-T p.Arg291Trp missense ABCC3 21 82496 2.54558E-4 41248 0 0.00151057
17-48738349-G-A p.Arg291Gln missense ABCC3 2 82524 2.42354E-5 41262 0 8.32681E-6
17-48738352-C-T p.Pro292Leu missense ABCC3 1 82536 1.21159E-5 41268 0 NA
17-48738353-C-T p.Gln311* stop_gained ABCC3 4 82552 4.84543E-5 41276 0 3.99221E-6
17-48738354-A-C p.Gln311Pro missense ABCC3 2 82566 2.4223E-5 41283 0 NA
17-48738360-C-G p.Arg295Gly missense ABCC3 1 82630 1.21021E-5 41315 0 NA
17-48738361-G-A p.Arg295Gln missense ABCC3 6 82624 7.26181E-5 41312 0 7.98034E-6
17-48738363-A-G p.Lys296Glu missense ABCC3 2 82640 2.42014E-5 41320 0 7.97493E-6
17-48738368-C-G p.Leu316Val missense ABCC3 1 82730 1.20875E-5 41365 0 NA
17-48738380-G-A p.Gly320Ser missense ABCC3 3 82810 3.62275E-5 41405 0 3.98226E-6
17-48738384-C-T p.Pro321Leu missense ABCC3 1 82820 1.20744E-5 41410 0 NA
17-48738392-C-T p.His324Tyr missense ABCC3 1 82870 1.20671E-5 41435 0 8.27349E-6
17-48738398-C-T p.Arg326Trp missense ABCC3 1 82920 1.20598E-5 41460 0 5.78886E-5
17-48738399-G-A p.Gly308Ser missense ABCC3 30 82890 3.61925E-4 41445 0 5.03525E-4
17-48738407-C-G p.Ser310Arg missense ABCC3 2 82896 2.41266E-5 41448 0 NA
17-48738418-G-T p.Ser314Ile missense ABCC3 14 82960 1.68756E-4 41480 0 3.82068E-4
17-48738457-T-C p.Ile327Thr missense ABCC3 15 82792 1.81177E-4 41396 0 0.00151057
17-48738460-A-G p.Asn328Ser missense ABCC3 1 82774 1.20811E-5 41387 0 3.19122E-5
17-48738482-C-T c.998+7C>T splice_region ABCC3 2 82298 2.43019E-5 41149 0 3.18451E-5
17-48741034-C-T c.999-8C>T splice_region ABCC3 1 83292 1.2006E-5 41646 0 7.46863E-5
17-48741060-C-T p.Leu358Phe missense ABCC3 22 83390 2.63821E-4 41695 1 4.45243E-4
17-48741072-G-A p.Met343Ile missense ABCC3 1 83394 1.19913E-5 41697 0 NA
17-48741074-C-T p.Ala344Val missense ABCC3 1 83390 1.19918E-5 41695 0 NA
17-48741077-C-T p.Pro345Leu missense ABCC3 2 83400 2.39808E-5 41700 0 2.47154E-5
17-48741080-C-T p.Ser346Phe missense ABCC3 492 83396 0.00589956 41698 2 0.00855992
17-48741089-G-A p.Gly349Asp missense ABCC3 1 83406 1.19895E-5 41703 0 8.23764E-6
17-48741094-C-G p.Leu351Val missense ABCC3 1 83406 1.19895E-5 41703 0 3.18451E-5
17-48741100-G-A p.Ala353Thr missense ABCC3 3 83402 3.59704E-5 41701 0 NA
17-48741105-G-A p.Ala373Thr missense ABCC3 1 83402 1.19901E-5 41701 0 3.18512E-5
17-48741111-G-A p.Met356Ile missense ABCC3 10 83402 1.19901E-4 41701 0 3.50408E-4
17-48741128-T-C p.Met362Thr missense ABCC3 1 83404 1.19898E-5 41702 0 3.9764E-6
17-48741135-G-A p.Ala383Thr missense ABCC3 1 83394 1.19913E-5 41697 0 7.15774E-5
17-48741138-G-T p.Asp384Tyr missense ABCC3 1 83396 1.1991E-5 41698 0 NA
17-48741160-T-A p.Tyr373Asn missense ABCC3 1 83392 1.19916E-5 41696 0 NA
17-48741165-C-A p.Leu393Ile missense ABCC3 6 83384 7.19563E-5 41692 0 3.18613E-5
17-48741171-G-C p.Asp395His missense ABCC3 2 83362 2.39917E-5 41681 0 5.76578E-5
17-48741178-G-T p.Val379Leu missense ABCC3 4 83364 4.79823E-5 41682 0 9.54502E-5
17-48741178-G-C p.Val379Leu missense ABCC3 2 83364 2.39912E-5 41682 0 3.18573E-5
17-48741183-G-T p.Lys380Asn missense ABCC3 2 83366 2.39906E-5 41683 0 NA
17-48741188-G-A p.Arg382His missense ABCC3 5 83364 5.99779E-5 41682 0 6.37308E-5
17-48741200-T-G p.Met386Arg missense ABCC3 7 83352 8.39812E-5 41676 0 1.27502E-4
17-48741209-T-C p.Ile389Thr missense ABCC3 1 83328 1.20008E-5 41664 0 NA
17-48741213-C-T p.Gln409* stop_gained ABCC3 2 83320 2.40038E-5 41660 0 7.95437E-6
17-48741217-AAGGTCAGCTGGAGCAGGGCCCAGGGGAAAGGCTGGCCCTGGGCAGCTTGCAAGAGGCTCGCAGCCAAGTCCACCCACTACTGTCTACCTGC-A p.Ala393fs frameshift ABCC3 3 83314 3.60084E-5 41657 0 NA
17-48741227-G-C c.1176+8G>C splice_region ABCC3 3 83272 3.60265E-5 41636 0 4.94226E-5
17-48741303-A-G c.1177-8A>G splice_region ABCC3 1 83350 1.19976E-5 41675 0 NA
17-48741318-T-C p.Val395Ala missense ABCC3 2 83366 2.39906E-5 41683 0 1.64739E-5
17-48741336-A-G p.Lys401Arg missense ABCC3 1 83364 1.19956E-5 41682 0 NA
17-48741343-G-A p.Val422Ile missense ABCC3 19 83366 2.27911E-4 41683 1 0.00100705
17-48741350-G-A p.Val406Met missense ABCC3 5 83378 5.99679E-5 41689 0 9.56023E-5
17-48741352-G-C p.Gly425Arg missense ABCC3 1 83374 1.19941E-5 41687 0 8.23683E-6
17-48741354-G-A p.Gly407Glu missense ABCC3 1 83380 1.19933E-5 41690 0 NA
17-48741357-A-G p.Glu408Gly missense ABCC3 35 83378 4.19775E-4 41689 0 0.00151057
17-48741366-A-G p.Asn411Ser missense ABCC3 6 83386 7.19545E-5 41693 0 8.23669E-6
17-48741373-G-A p.Met413Ile missense ABCC3 1 83380 1.19933E-5 41690 0 7.95248E-6
17-48741377-G-A p.Val415Met missense ABCC3 1 83376 1.19939E-5 41688 0 NA
17-48741389-C-T p.Arg419Cys missense ABCC3 3 83356 3.59902E-5 41678 0 5.03525E-4
17-48741390-G-A p.Arg419His missense ABCC3 49 83356 5.8784E-4 41678 1 0.00130631
17-48741396-T-C p.Met421Thr missense ABCC3 1 83348 1.19979E-5 41674 0 NA
17-48741417-A-G p.Asn428Ser missense ABCC3 4 83298 4.80204E-5 41649 0 3.18134E-5
17-48741424-G-A p.Val449Met missense ABCC3 1 83252 1.20117E-5 41626 0 7.95412E-6
17-48741429-C-G p.Ser432* stop_gained ABCC3 1 83214 1.20172E-5 41607 0 NA
17-48741440-C-A p.Gln436Lys missense ABCC3 107 83078 0.00128795 41539 0 8.63338E-4
17-48741453-C-T p.Ala440Val missense ABCC3 5 82720 6.04449E-5 41360 0 6.60939E-5
17-48741454-G-A p.Asp459Asn missense ABCC3 1 82692 1.20931E-5 41346 0 1.65232E-5
17-48741454-G-T p.Asp459Tyr missense ABCC3 1 82692 1.20931E-5 41346 0 NA
17-48741463-C-T p.Pro462Ser missense ABCC3 1 82278 1.21539E-5 41139 0 NA
17-48741470-C-CAGAACCT c.1338_1338+1insAACCTAG splice_donor ABCC3 1 81744 1.22333E-5 40872 0 NA
17-48742508-C-T c.1339-6C>T splice_region ABCC3 1 83314 1.20028E-5 41657 0 3.97744E-6
17-48742512-A-C c.1339-2A>C splice_acceptor ABCC3 1 83316 1.20025E-5 41658 0 NA
17-48742513-G-T c.1339-1G>T splice_acceptor ABCC3 43 83314 5.1612E-4 41657 0 0.00146497
17-48742525-C-A p.Leu469Ile missense ABCC3 1 83328 1.20008E-5 41664 0 NA
17-48742543-C-T p.Arg475Cys missense ABCC3 1 83318 1.20022E-5 41659 0 4.11828E-5
17-48742544-G-A p.Ala457Thr missense ABCC3 3 83320 3.60058E-5 41660 0 4.37445E-5
17-48742547-T-G p.Phe458Val missense ABCC3 1 83326 1.20011E-5 41663 0 3.29462E-5
17-48742550-A-G p.Met459Val missense ABCC3 2 83322 2.40033E-5 41661 0 7.95292E-6
17-48742553-G-A p.Val460Ile missense ABCC3 3 83324 3.6004E-5 41662 0 6.37064E-5
17-48742553-G-T p.Val460Phe missense ABCC3 2 83324 2.40027E-5 41662 0 8.23655E-6
17-48742573-C-T p.Arg485Trp missense ABCC3 7 83264 8.40699E-5 41632 0 3.18431E-5
17-48742585-C-T p.Arg489Cys missense ABCC3 9 83218 1.0815E-4 41609 0 1.59175E-4
17-48742595-C-G p.Arg474Gly missense ABCC3 1 83146 1.2027E-5 41573 0 1.65161E-5
17-48742597-C-T p.Arg493Cys missense ABCC3 2 83092 2.40697E-5 41546 0 3.18552E-5
17-48742598-G-A p.Ala475Thr missense ABCC3 3 83072 3.61133E-5 41536 0 3.18471E-5
17-48742605-A-C p.Gln477Pro missense+splice_region ABCC3 1 83000 1.20482E-5 41500 0 8.29036E-6
17-48742608-T-TAAAGCAAATGAAATTGA c.1431+2_1431+3insAAAGCAAATGAAATTGA splice_region ABCC3 7 82960 8.4378E-5 41480 2 NA
17-48744940-C-T p.Ser486Leu missense ABCC3 4 83084 4.8144E-5 41542 0 5.1773E-5
17-48744941-G-A p.Ala505Thr missense ABCC3 6 83094 7.22074E-5 41547 0 6.25E-4
17-48744942-C-T p.Arg487Cys missense ABCC3 2 83092 2.40697E-5 41546 0 8.28363E-6
17-48744943-G-A p.Arg487His missense ABCC3 2 83104 2.40662E-5 41552 0 NA
17-48744953-G-C p.Asp509His missense ABCC3 471 83148 0.0056646 41574 4 0.0102236
17-48744961-A-G p.Ter511Trpext*? stop_lost ABCC3 1 83192 1.20204E-5 41596 0 3.18532E-5
17-48744971-C-T p.Asn496Asn synonymous ABCC3 5 83192 6.01019E-5 41596 0 1.98934E-5
17-48744972-G-A p.Gly497Ser missense ABCC3 1 83180 1.20221E-5 41590 0 5.03525E-4
17-48744972-G-C p.Gly497Arg missense ABCC3 1 83180 1.20221E-5 41590 0 NA
17-48744975-A-G p.Ile498Val missense ABCC3 1 83196 1.20198E-5 41598 0 9.55718E-5
17-48744986-G-A p.Leu501Leu synonymous ABCC3 1 83204 1.20187E-5 41602 0 NA
17-48744990-C-G p.Leu503Val missense ABCC3 1 83204 1.20187E-5 41602 0 NA
17-48744990-C-T p.Leu503Leu synonymous ABCC3 1 83204 1.20187E-5 41602 0 NA
17-48744995-C-T p.Tyr504Tyr synonymous ABCC3 54 83184 6.49163E-4 41592 1 0.00906344
17-48744996-G-T p.Ala505Ser missense ABCC3 1 83176 1.20227E-5 41588 0 NA
17-48745020-C-A p.Gln513Lys missense ABCC3 3 83148 3.60802E-5 41574 0 3.18715E-5
17-48745026-G-A p.Glu515Lys missense ABCC3 1 83140 1.20279E-5 41570 0 6.37308E-5
17-48745029-G-A p.Gly516Ser missense ABCC3 1 83124 1.20302E-5 41562 0 3.18695E-5
17-48745035-A-C p.Arg518Arg synonymous ABCC3 1215 83074 0.0146255 41537 11 0.0198399
17-48745042-G-T p.Gly520Val missense ABCC3 1 83072 1.20378E-5 41536 0 3.98007E-6
17-48745055-G-A p.Leu524Leu synonymous ABCC3 1 83028 1.20441E-5 41514 0 NA
17-48745059-C-T p.Arg526Cys missense ABCC3 6 82994 7.22944E-5 41497 0 2.22945E-4
17-48745060-G-A p.Arg526His missense ABCC3 1 82988 1.20499E-5 41494 0 3.18857E-5
17-48745063-C-T p.Thr527Met missense ABCC3 1 83002 1.20479E-5 41501 0 8.25696E-6
17-48745064-G-A p.Thr527Thr synonymous ABCC3 9 82986 1.08452E-4 41493 0 6.37186E-5
17-48745064-G-T p.Thr527Thr synonymous ABCC3 1 82986 1.20502E-5 41493 0 8.25723E-6
17-48745066-C-T p.Ala528Val missense ABCC3 4 82972 4.8209E-5 41486 0 3.18735E-5
17-48745067-G-A p.Ala528Ala synonymous ABCC3 1 82974 1.2052E-5 41487 0 1.19463E-5
17-48745069-C-G p.Ala529Gly missense ABCC3 1 82962 1.20537E-5 41481 0 NA
17-48745069-C-T p.Ala529Val missense ABCC3 1 82960 1.2054E-5 41480 0 NA
17-48745075-T-G p.Leu531Arg missense ABCC3 4 82972 4.8209E-5 41486 0 1.15601E-4
17-48745087-C-T p.Thr535Ile missense ABCC3 1 83002 1.20479E-5 41501 0 8.262E-6
17-48745088-C-T p.Thr535Thr synonymous ABCC3 1 83000 1.20482E-5 41500 0 3.9814E-6
17-48745089-A-G p.Thr536Ala missense ABCC3 2 82994 2.40981E-5 41497 0 3.19183E-5
17-48745092-T-G p.Phe537Val missense ABCC3 1 83012 1.20465E-5 41506 0 NA
17-48745095-A-C p.Thr538Pro missense ABCC3 1 82982 1.20508E-5 41491 0 3.98143E-6
17-48745096-C-T p.Thr538Ile missense ABCC3 1 82994 1.20491E-5 41497 0 NA
17-48745101-A-T p.Met540Leu missense ABCC3 2 82986 2.41005E-5 41493 0 NA
17-48745117-TGGTGAGGCTTGGCACAGGGCTGGGTCCCTGCCTCCAGGGCTCTGGGTGCCCAGGCATGGCCAGGGCTCATTGGACTCTACCCTGACACCACCTCCACGCTGCTCA-T p.Val546fs frameshift ABCC3 7 83014 8.43231E-5 41507 0 NA
17-48745130-C-A p.Gly549Gly synonymous ABCC3 2 82960 2.4108E-5 41480 0 NA
17-48745134-G-C p.Gly551Arg missense ABCC3 1 82950 1.20555E-5 41475 0 NA
17-48745136-G-A p.Gly551Gly synonymous ABCC3 9 82926 1.0853E-4 41463 0 1.91229E-4
17-48745139-G-A p.Leu552Leu synonymous ABCC3 1 82954 1.20549E-5 41477 0 NA
17-48745150-TCCAGGGCTCTGGGTGCCCAGGCATGG-T p.Gly560fs frameshift ABCC3 2 82946 2.41121E-5 41473 0 6.3743E-5
17-48745161-G-C p.Gly560Arg missense ABCC3 4 82946 4.82241E-5 41473 0 4.22476E-5
17-48745169-A-G p.Pro562Pro synonymous ABCC3 3 82960 3.6162E-5 41480 0 NA
17-48745175-G-A p.Met564Ile missense ABCC3 2 82984 2.4101E-5 41492 0 8.02324E-6
17-48745181-G-A p.Arg566Arg synonymous ABCC3 4 83002 4.81916E-5 41501 0 8.4809E-6
17-48745187-T-C p.His568His synonymous ABCC3 8 83030 9.63507E-5 41515 0 4.46144E-4
17-48745197-C-T p.Pro572Ser missense ABCC3 3 83056 3.61202E-5 41528 0 1.69748E-5
17-48745220-T-G c.1636-4T>G splice_region ABCC3 1 83138 1.20282E-5 41569 0 NA
17-48745231-T-A p.Leu548Gln missense ABCC3 101 83200 0.00121394 41600 0 0.00125183
17-48745238-C-T p.Thr550Thr synonymous ABCC3 1 83204 1.20187E-5 41602 0 NA
17-48745247-G-A p.Val553Val synonymous ABCC3 1 83238 1.20137E-5 41619 0 NA
17-48745249-A-T p.Tyr554Phe missense ABCC3 3 83246 3.60378E-5 41623 0 3.98337E-6
17-48745250-C-T p.Tyr554Tyr synonymous ABCC3 1 83250 1.2012E-5 41625 0 3.34448E-5
17-48745251-G-A p.Val555Met missense ABCC3 9 83256 1.081E-4 41628 0 3.18674E-5
17-48745256-C-T p.Tyr556Tyr synonymous ABCC3 3 83254 3.60343E-5 41627 0 6.37471E-5
17-48745276-TG-T p.Asp564fs frameshift ABCC3 1 83308 1.20036E-5 41654 0 NA
17-48745280-C-T p.Asp564Asp synonymous ABCC3 5 83326 6.00053E-5 41663 0 9.56084E-5
17-48745283-C-T c.*81C>T splice_region ABCC3 31 83328 3.72024E-4 41664 0 5.03525E-4
17-48745284-G-A p.Glu566Lys missense ABCC3 1 83336 1.19996E-5 41668 0 7.95824E-6
17-48745290-G-A p.Ala568Thr missense ABCC3 1 83340 1.1999E-5 41670 0 1.19347E-5
17-48745301-T-C p.Ser571Ser synonymous ABCC3 1 83362 1.19959E-5 41681 0 3.97735E-6
17-48745302-G-C p.Val572Leu missense ABCC3 1 83364 1.19956E-5 41682 0 NA
17-48745313-T-C p.Phe575Phe synonymous ABCC3 1 83358 1.19964E-5 41679 0 NA
17-48745315-ATATCT-A p.Ile577fs frameshift ABCC3 3 83358 3.59893E-5 41679 0 3.97728E-6
17-48745340-G-C p.Met584Ile missense ABCC3 1 83326 1.20011E-5 41663 0 NA
17-48745343-GC-G p.Gln587fs frameshift ABCC3 4 83318 4.80088E-5 41659 0 3.18492E-5
17-48745344-C-T p.Pro586Ser missense ABCC3 1 83316 1.20025E-5 41658 0 8.25614E-6
17-48745358-C-A p.Ser590Arg missense ABCC3 1 83278 1.2008E-5 41639 0 8.28075E-6
17-48745360-A-G p.Asn591Ser missense ABCC3 1 83268 1.20094E-5 41634 0 6.3743E-5
17-48745370-G-GGCCA c.1782_1782+1insGCCA splice_donor ABCC3 1 83200 1.20192E-5 41600 0 NA
17-48745371-G-GCCAGTGTGTCTCTGAAACGGATCCAGCAATTCCTGAGCCAAGAGGAACT c.1782+1_1782+2insCCAGTGTGTCTCTGAAACGGATCCAGCAATTCCTGAGCCAAGAGGAACT splice_donor ABCC3 5 83190 6.01034E-5 41595 1 NA
17-48745376-C-A c.1782+6C>A splice_region ABCC3 1 83142 1.20276E-5 41571 0 3.98391E-6
17-48745786-C-T c.1783-5C>T splice_region ABCC3 4 83130 4.81174E-5 41565 0 4.13189E-5
17-48745787-G-A c.1783-4G>A splice_region ABCC3 1065 83128 0.0128116 41564 35 0.0235674
17-48745788-T-C c.1783-3T>C splice_region ABCC3 20 83160 2.405E-4 41580 0 1.23871E-4
17-48745794-AGT-A p.Leu599fs frameshift ABCC3 1 83218 1.20166E-5 41609 0 NA
17-48745809-C-T p.Arg601Trp missense ABCC3 1 83272 1.20088E-5 41636 0 2.3866E-5
17-48745810-G-A p.Arg601Gln missense ABCC3 5 83266 6.00485E-5 41633 0 5.03525E-4
17-48745817-G-C p.Gln603His missense ABCC3 1 83292 1.2006E-5 41646 0 1.64878E-5
17-48745828-G-A p.Ser607Asn missense ABCC3 580 83286 0.00696396 41643 10 0.0135316
17-48745845-C-A p.Pro613Thr missense ABCC3 2 83296 2.40108E-5 41648 0 7.95526E-6
17-48745846-C-G p.Pro613Arg missense ABCC3 2 83296 2.40108E-5 41648 0 NA
17-48745847-C-G p.Pro613Pro synonymous ABCC3 3 83292 3.60179E-5 41646 0 3.29897E-5
17-48745849-A-G p.Gln614Arg missense ABCC3 1 83294 1.20057E-5 41647 0 5.171E-5
17-48745861-GA-G p.Lys619fs frameshift ABCC3 1 83276 1.20083E-5 41638 0 NA
17-48745872-TC-T p.Pro623fs frameshift ABCC3 2 83232 2.40292E-5 41616 0 NA
17-48746224-C-T p.Ile627Ile synonymous ABCC3 2 82310 2.42984E-5 41155 0 1.68011E-5
17-48746226-C-T p.Thr628Ile missense ABCC3 1 82338 1.21451E-5 41169 0 NA
17-48746233-C-G p.His630Gln missense ABCC3 1 82430 1.21315E-5 41215 0 NA
17-48746235-G-T p.Ser631Ile missense ABCC3 1 82426 1.21321E-5 41213 0 3.98521E-6
17-48746252-G-T p.Ala637Ser missense ABCC3 1 82606 1.21057E-5 41303 0 3.18979E-5
17-48746252-G-A p.Ala637Thr missense ABCC3 1 82606 1.21057E-5 41303 0 6.6517E-5
17-48746269-C-A p.Pro642Pro synonymous ABCC3 395 82736 0.00477422 41368 5 0.00654582
17-48746273-C-A p.Leu644Met missense ABCC3 1 82780 1.20802E-5 41390 0 NA
17-48746499-A-G c.1938-2A>G splice_acceptor ABCC3 1 80898 1.23612E-5 40449 0 NA
17-48746517-C-G p.Pro652Ala missense ABCC3 1 81706 1.2239E-5 40853 0 NA
17-48746518-C-T p.Pro652Leu missense ABCC3 1 81698 1.22402E-5 40849 0 3.18695E-5
17-48746526-G-A p.Ala655Thr missense ABCC3 1 82120 1.21773E-5 41060 0 8.32882E-6
17-48746537-C-T p.Ala658Ala synonymous ABCC3 3 82406 3.64051E-5 41203 0 8.26993E-5
17-48746538-G-A p.Val659Met missense ABCC3 1 82472 1.21253E-5 41236 0 3.18654E-5
17-48746541-G-A p.Val660Met missense ABCC3 3 82510 3.63592E-5 41255 0 1.65226E-5
17-48746543-G-T p.Val660Val synonymous ABCC3 2 82552 2.42272E-5 41276 0 8.24389E-6
17-48746550-G-A p.Val663Met missense ABCC3 4 82734 4.83477E-5 41367 0 6.49156E-5
17-48746557-G-A p.Cys665Tyr missense ABCC3 1 82866 1.20677E-5 41433 0 NA
17-48746564-G-C p.Lys667Asn missense ABCC3 1 82976 1.20517E-5 41488 0 8.24633E-6
17-48746565-T-C p.Ser668Pro missense ABCC3 1 82972 1.20523E-5 41486 0 NA
17-48746581-C-T p.Ala673Val missense ABCC3 2 83104 2.40662E-5 41552 0 NA
17-48746581-C-A p.Ala673Asp missense ABCC3 1 83104 1.20331E-5 41552 0 NA
17-48746590-G-A p.Gly676Glu missense ABCC3 1 83164 1.20244E-5 41582 0 NA
17-48746603-G-A p.Lys680Lys synonymous ABCC3 40 83196 4.80792E-4 41598 0 0.00100705
17-48746611-G-C p.Gly683Ala missense ABCC3 2 83220 2.40327E-5 41610 0 NA
17-48746616-G-A p.Val685Met missense ABCC3 1 83232 1.20146E-5 41616 0 NA
17-48746621-C-T p.His686His synonymous ABCC3 1 83210 1.20178E-5 41605 0 NA
17-48746624-GA-G p.Lys688fs frameshift ABCC3 1 83214 1.20172E-5 41607 0 NA
17-48746625-AAGGTGAGAGAGGCAGGGGCTCCTGGGCAGGGTGTGGGGCTCAGCCAGGCCTTGGGCAAGCCCCGAGGTAAATTTCTCCTGTGGCC-A p.Lys688fs frameshift ABCC3 11 83214 1.32189E-4 41607 5 NA
17-48746627-G-A p.Lys688Lys splice_region+synonymous ABCC3 1 83214 1.20172E-5 41607 0 3.98086E-6
17-48746716-T-C p.Ser690Pro missense ABCC3 1 83278 1.2008E-5 41639 0 NA
17-48746719-G-A p.Val691Met missense ABCC3 2 83290 2.40125E-5 41645 0 1.40063E-4
17-48746726-A-G p.Tyr693Cys missense ABCC3 1 83314 1.20028E-5 41657 0 3.18532E-5
17-48746736-G-A p.Gln696Gln synonymous ABCC3 1 83322 1.20016E-5 41661 0 NA
17-48746754-C-T p.Asn702Asn synonymous ABCC3 6 83324 7.20081E-5 41662 0 3.18532E-5
17-48746767-G-A p.Glu707Lys missense ABCC3 3 83332 3.60006E-5 41666 0 5.76625E-5
17-48746781-C-T p.Phe711Phe synonymous ABCC3 3 83324 3.6004E-5 41662 0 6.36983E-5
17-48746789-C-A p.Ala714Asp missense ABCC3 1 83316 1.20025E-5 41658 0 NA
17-48746790-C-T p.Ala714Ala synonymous ABCC3 2 83322 2.40033E-5 41661 0 NA
17-48746792-T-C p.Leu715Pro missense ABCC3 1 83314 1.20028E-5 41657 0 NA
17-48746801-A-T p.Lys718Met missense ABCC3 9 83304 1.08038E-4 41652 0 6.58989E-5
17-48746803-C-T p.Arg719Cys missense ABCC3 7 83306 8.40276E-5 41653 0 8.2375E-6
17-48746804-G-T p.Arg719Leu missense ABCC3 8 83298 9.60407E-5 41649 0 7.95323E-5
17-48746804-G-A p.Arg719His missense ABCC3 1 83300 1.20048E-5 41650 0 0.00125
17-48746823-G-T p.Glu725Asp missense ABCC3 6 83270 7.20548E-5 41635 0 1.59175E-4
17-48746852-T-C p.Met735Thr missense ABCC3 1 83168 1.20239E-5 41584 0 NA
17-48746860-G-A p.Gly738Ser missense ABCC3 2 83088 2.40709E-5 41544 0 NA
17-48746866-GA-G p.Asp740fs frameshift ABCC3 2 83016 2.40917E-5 41508 0 NA
17-48746873-C-T p.Thr742Ile missense ABCC3 1 82908 1.20616E-5 41454 0 NA
17-48746873-C-CA p.Glu743fs frameshift ABCC3 2 82908 2.41231E-5 41454 0 5.57139E-5
17-48746880-T-G p.Ile744Met missense ABCC3 2 82754 2.4168E-5 41377 0 3.18715E-5
17-48746891-TAC-T c.2241+3_2241+4delAC splice_region ABCC3 1 82396 1.21365E-5 41198 0 NA
17-48746893-C-G c.2241+4C>G splice_region ABCC3 3 82316 3.64449E-5 41158 0 3.30235E-5
17-48746894-A-G c.2241+5A>G splice_region ABCC3 3 82304 3.64502E-5 41152 0 NA
17-48746897-G-A c.2241+8G>A splice_region ABCC3 1 82102 1.218E-5 41051 0 NA
17-48750328-C-T c.2242-4C>T splice_region ABCC3 1 82722 1.20887E-5 41361 0 NA
17-48750333-G-A p.Gly748Asp missense+splice_region ABCC3 2 82764 2.41651E-5 41382 0 8.39123E-6
17-48750335-A-C p.Ile749Leu missense ABCC3 1 82810 1.20758E-5 41405 0 3.19834E-5
17-48750357-G-A p.Arg756Gln missense ABCC3 4 82784 4.83185E-5 41392 0 2.50723E-5
17-48750362-C-T p.Arg758Trp missense ABCC3 1 82802 1.2077E-5 41401 0 1.66711E-5
17-48750362-CGGGTCAGTCT-C p.Val759fs frameshift ABCC3 1 82802 1.2077E-5 41401 0 NA
17-48750363-G-A p.Arg758Gln missense ABCC3 2 82818 2.41493E-5 41409 0 2.7884E-5
17-48750377-C-T p.Arg763* stop_gained ABCC3 1 82874 1.20665E-5 41437 0 8.27212E-6
17-48750378-G-A p.Arg763Gln missense ABCC3 1 82866 1.20677E-5 41433 0 NA
17-48750383-G-C p.Val765Leu missense ABCC3 612 82986 0.00737474 41493 12 0.014027
17-48750388-C-T p.Thr19Ile missense ABCC3 1 83028 1.20441E-5 41514 0 NA
17-48750391-T-A p.Ser767Arg missense ABCC3 1 83062 1.20392E-5 41531 0 8.2526E-6
17-48750396-C-A p.Ala769Asp missense ABCC3 1 83070 1.2038E-5 41535 0 8.25055E-6
17-48750398-G-A p.Asp770Asn missense ABCC3 1 83078 1.20369E-5 41539 0 0.00100806
17-48750402-T-A p.Ile771Asn missense ABCC3 2 83100 2.40674E-5 41550 0 8.24892E-6
17-48750427-C-T p.Pro32Leu missense ABCC3 14 83016 1.68642E-4 41508 0 3.19E-4
17-48750428-G-A p.Ala780Thr missense ABCC3 2 83018 2.40912E-5 41509 0 3.18857E-5
17-48750431-G-A p.Val781Met missense ABCC3 6 83016 7.22752E-5 41508 0 8.24606E-6
17-48750431-GT-G p.Val781fs frameshift ABCC3 2 83016 2.40917E-5 41508 0 NA
17-48750442-T-C p.Met37Thr missense ABCC3 4 83044 4.81672E-5 41522 0 6.59794E-5
17-48750442-T-G p.His784Gln missense ABCC3 1 83044 1.20418E-5 41522 0 3.29897E-5
17-48750447-C-T p.Ala786Val missense ABCC3 9 83042 1.08379E-4 41521 0 6.37146E-5
17-48750451-G-T p.Lys787Asn missense ABCC3 1 83040 1.20424E-5 41520 0 NA
17-48750454-C-T p.Thr41Ile missense ABCC3 1 83034 1.20433E-5 41517 0 NA
17-48750463-C-G p.Asp791Glu missense ABCC3 3 82976 3.6155E-5 41488 0 8.25518E-6
17-48750466-C-T p.Thr45Met missense ABCC3 1 82966 1.20531E-5 41483 0 9.54844E-5
17-48750467-G-A p.Val793Ile missense ABCC3 9 82970 1.08473E-4 41485 0 1.27502E-4
17-48750472-C-T p.Ser47Leu missense ABCC3 7 82908 8.44309E-5 41454 0 9.9108E-5
17-48750474-G-A p.Gly795Glu missense ABCC3 1 82908 1.20616E-5 41454 0 NA
17-48750475-G-A p.Gly48Asp missense ABCC3 1 82864 1.2068E-5 41432 0 NA
17-48750478-A-G p.Gln49Arg missense ABCC3 1 82876 1.20662E-5 41438 0 4.13175E-5
17-48750483-G-T p.Gly798Val missense ABCC3 1 82828 1.20732E-5 41414 0 6.25E-4
17-48750484-C-A p.Ala51Glu missense ABCC3 2 82822 2.41482E-5 41411 0 NA
17-48750485-G-A p.Val799Met missense ABCC3 7 82798 8.45431E-5 41399 0 3.58354E-5
17-48750492-C-T p.Gln54* stop_gained ABCC3 4 82678 4.83805E-5 41339 0 6.37146E-5
17-48750502-G-A c.2409+3G>A splice_region ABCC3 3 82574 3.63311E-5 41287 0 NA
17-48750832-G-A p.Thr804Thr splice_region+synonymous ABCC3 1 82948 1.20557E-5 41474 0 NA
17-48750833-C-T p.Arg805* stop_gained ABCC3 3 82976 3.6155E-5 41488 0 3.19468E-5
17-48750846-C-T p.Thr809Met missense ABCC3 39 83076 4.6945E-4 41538 0 0.00102576
17-48750848-C-G p.His810Asp missense ABCC3 1 83092 1.20349E-5 41546 0 NA
17-48750850-C-T p.His810His synonymous ABCC3 7 83126 8.42095E-5 41563 0 5.03525E-4
17-48750851-G-A p.Gly811Ser missense ABCC3 27 83140 3.24753E-4 41570 0 0.0025
17-48750865-GC-G p.Gln817fs frameshift ABCC3 1 83262 1.20103E-5 41631 0 3.18857E-5
17-48750865-GCC-G p.Gln817fs frameshift ABCC3 1 83262 1.20103E-5 41631 0 8.24688E-6
17-48750865-G-T p.Leu815Leu synonymous ABCC3 1 83262 1.20103E-5 41631 0 1.64938E-5
17-48750872-A-G p.Thr818Ala missense ABCC3 1 83290 1.20062E-5 41645 0 NA
17-48750877-C-A p.Asp819Glu missense ABCC3 2 83312 2.40061E-5 41656 0 1.27478E-4
17-48750905-G-C p.Val829Leu missense ABCC3 1 83350 1.19976E-5 41675 0 8.2394E-6
17-48750920-C-T p.Pro834Ser missense ABCC3 1 83358 1.19964E-5 41679 0 1.19297E-5
17-48750922-G-A p.Pro834Pro synonymous ABCC3 3 83362 3.59876E-5 41681 0 6.25E-4
17-48750924-AC-A p.Pro836fs frameshift ABCC3 3 83358 3.59893E-5 41679 0 5.03525E-4
17-48750929-G-A p.Ala837Thr missense ABCC3 3 83358 3.59893E-5 41679 0 3.97655E-6
17-48750946-C-T p.Asn842Asn synonymous ABCC3 7 83360 8.39731E-5 41680 0 6.25E-4
17-48750960-A-C p.Asn847Thr missense ABCC3 1 83336 1.19996E-5 41668 0 NA
17-48750970-C-A p.Cys850* stop_gained ABCC3 3 83344 3.59954E-5 41672 0 NA
17-48750972-A-G p.Asn851Ser missense ABCC3 2 83346 2.39964E-5 41673 0 1.19302E-5
17-48750975-A-G p.Tyr852Cys missense ABCC3 4 83352 4.79893E-5 41676 0 3.97687E-6
17-48750977-GC-G p.Asp855fs frameshift ABCC3 2 83346 2.39964E-5 41673 0 NA
17-48750978-C-A p.Ala853Asp missense ABCC3 28 83340 3.35973E-4 41670 0 2.23029E-4
17-48750978-C-T p.Ala853Val missense ABCC3 1 83340 1.1999E-5 41670 0 NA
17-48750980-C-T p.Pro854Ser missense ABCC3 2 83340 2.39981E-5 41670 0 3.18634E-5
17-48750982-C-T p.Pro854Pro synonymous ABCC3 4 83338 4.79973E-5 41669 0 0.00125
17-48750989-G-A p.Asp857Asn missense ABCC3 1 83310 1.20034E-5 41655 0 NA
17-48751011-G-C p.Ser864Thr missense ABCC3 1 83240 1.20135E-5 41620 0 NA
17-48751014-G-A p.Trp865* stop_gained ABCC3 1 83224 1.20158E-5 41612 0 NA
17-48751018-C-T p.Thr866Thr splice_region+synonymous ABCC3 3 83190 3.6062E-5 41595 0 6.63185E-5
17-48751019-G-GCGTTGGAAGGTGCAGAGGATAAGGAGGCACTGCTGATTGAA c.2599_2599+1insCGTTGGAAGGTGCAGAGGATAAGGAGGCACTGCTGATTGAA splice_donor ABCC3 3 83194 3.60603E-5 41597 1 NA
17-48751019-G-A p.Ala867Thr missense+splice_region ABCC3 2 83194 2.40402E-5 41597 0 4.14518E-5
17-48751024-C-T c.2599+5C>T splice_region ABCC3 4 83104 4.81325E-5 41552 0 NA
17-48752720-C-T c.2600-3C>T splice_region ABCC3 4 83080 4.81464E-5 41540 0 1.62978E-4
17-48752724-G-A p.Ala867Ala splice_region+synonymous ABCC3 2 83110 2.40645E-5 41555 0 6.37267E-5
17-48752724-G-T p.Ala867Ala splice_region+synonymous ABCC3 3 83110 3.60967E-5 41555 0 NA
17-48752732-G-T p.Gly870Val missense ABCC3 6 83178 7.21345E-5 41589 0 3.18492E-5
17-48752739-G-GT p.Asp873fs frameshift ABCC3 1 83210 1.20178E-5 41605 0 NA
17-48752740-G-T p.Asp873Tyr missense ABCC3 1 83204 1.20187E-5 41602 0 8.38799E-6
17-48752741-A-ATC p.Lys874fs frameshift ABCC3 1 83194 1.20201E-5 41597 0 NA
17-48752749-G-T p.Ala876Ser missense ABCC3 1 83260 1.20106E-5 41630 0 NA
17-48752758-A-T p.Ile879Phe missense ABCC3 3 83276 3.60248E-5 41638 0 8.30151E-6
17-48752761-GA-G p.Asp881fs frameshift ABCC3 1 83288 1.20065E-5 41644 0 NA
17-48752766-C-G p.Asp881Glu missense ABCC3 4 83290 4.8025E-5 41645 0 4.14388E-5
17-48752766-C-T p.Asp881Asp synonymous ABCC3 2 83290 2.40125E-5 41645 0 3.98042E-6
17-48752775-CA-C p.Asn885fs frameshift ABCC3 1 83298 1.20051E-5 41649 0 NA
17-48752781-C-T p.His886His synonymous ABCC3 8 83300 9.60384E-5 41650 0 3.18431E-5
17-48752783-C-T p.Thr887Met missense ABCC3 9 83292 1.08054E-4 41646 0 5.03525E-4
17-48752788-CTG-C p.Leu889fs frameshift ABCC3 1 83298 1.20051E-5 41649 0 3.18492E-5
17-48752796-C-A p.Asp891Glu missense ABCC3 4 83298 4.80204E-5 41649 0 2.78645E-5
17-48752817-G-C p.Val898Val synonymous ABCC3 1 83304 1.20042E-5 41652 0 NA
17-48752830-T-C p.Phe903Leu missense ABCC3 1 83288 1.20065E-5 41644 0 NA
17-48752835-G-A p.Met904Ile missense+splice_region ABCC3 57 83292 6.84339E-4 41646 0 0.00101891
17-48752837-G-A p.Arg905Lys missense+splice_region ABCC3 8 83288 9.60523E-5 41644 0 0.00133784
17-48752842-G-A c.2714+5G>A splice_region ABCC3 2 83278 2.40159E-5 41639 0 1.20849E-5
17-48752991-G-A c.2715-1G>A splice_acceptor ABCC3 1 81900 1.221E-5 40950 0 NA
17-48752995-G-A p.Gln906Gln synonymous ABCC3 313 81856 0.00382379 40928 1 0.00591191
17-48753005-C-G p.Leu910Val missense ABCC3 1 81906 1.22091E-5 40953 0 5.52621E-6
17-48753011-T-C p.Ser912Pro missense ABCC3 1 81882 1.22127E-5 40941 0 NA
17-48753019-G-T p.Gly914Gly synonymous ABCC3 66 81818 8.06668E-4 40909 0 0.00251256
17-48753028-G-T p.Gln917His missense ABCC3 2 81826 2.44421E-5 40913 0 3.54862E-5
17-48753028-G-C p.Gln917His missense ABCC3 1 81826 1.22211E-5 40913 0 NA
17-48753032-C-T p.Arg919Trp missense ABCC3 1 81676 1.22435E-5 40838 0 0.00101215
17-48753033-G-A p.Arg919Gln missense ABCC3 2 81694 2.44816E-5 40847 0 0.00101215
17-48753035-C-T p.Pro920Ser missense ABCC3 1343 81660 0.0164462 40830 70 0.0383929
17-48753037-T-G p.Pro920Pro synonymous ABCC3 5 81732 6.11755E-5 40866 0 3.22113E-5
17-48753038-G-A p.Val921Ile missense ABCC3 1 81724 1.22363E-5 40862 0 NA
17-48753043-C-T p.Pro922Pro synonymous ABCC3 1 81730 1.22354E-5 40865 0 NA
17-48753045-G-A p.Arg923Gln missense ABCC3 393 81684 0.00481122 40842 1 0.00611041
17-48753051-A-G p.His925Arg missense ABCC3 1 81660 1.22459E-5 40830 0 3.51989E-5
17-48753052-C-A p.His925Gln missense ABCC3 9 81668 1.10202E-4 40834 2 0.00202634
17-48753087-C-T p.Ala937Val missense ABCC3 1 81614 1.22528E-5 40807 0 7.54717E-5
17-48753128-A-G p.Ile951Val missense ABCC3 4 81912 4.88329E-5 40956 0 6.99056E-5
17-48753136-TGTGAGTCGGTGGGGCAAGAGGGGCTGGAGGGGATGGACAGGCAGGCCCCAGCAGCCCCAGGGTTTATGGAGTCCCCTGTCCCTGACTGCCATGGCTGCTCCCTACAG-T c.2859+1_2860-1del splice_acceptor ABCC3 12 81904 1.46513E-4 40952 6 NA
17-48753144-G-A c.2859+8G>A splice_region ABCC3 1 81878 1.22133E-5 40939 0 2.11454E-5
17-48753241-C-T c.2860-3C>T splice_region ABCC3 1 82738 1.20863E-5 41369 0 NA
17-48753243-G-A c.2860-1G>A splice_acceptor ABCC3 3 82756 3.62511E-5 41378 0 NA
17-48753247-G-A p.Glu955Lys missense ABCC3 1 82826 1.20735E-5 41413 0 NA
17-48753258-G-A p.Val958Val synonymous ABCC3 1 82966 1.20531E-5 41483 0 NA
17-48753266-A-G p.Asp961Gly missense ABCC3 1 83042 1.20421E-5 41521 0 2.54639E-4
17-48753279-C-T p.Ala965Ala synonymous ABCC3 1 83078 1.20369E-5 41539 0 2.4777E-5
17-48753280-G-A p.Val966Met missense ABCC3 6 83076 7.2223E-5 41538 0 9.55718E-5
17-48753296-C-T p.Thr971Met missense ABCC3 3 83144 3.6082E-5 41572 0 6.25E-4
17-48753297-G-T p.Thr971Thr synonymous ABCC3 2 83138 2.40564E-5 41569 0 8.24565E-6
17-48753297-G-A p.Thr971Thr synonymous ABCC3 6 83138 7.21692E-5 41569 0 0.0025
17-48753324-TC-T p.Gln981fs frameshift ABCC3 1 83180 1.20221E-5 41590 0 1.6484E-5
17-48753332-C-T p.Ala983Val missense ABCC3 2 83174 2.4046E-5 41587 0 2.47255E-5
17-48753332-C-A p.Ala983Glu missense ABCC3 1 83174 1.2023E-5 41587 0 NA
17-48753333-G-A p.Ala983Ala synonymous ABCC3 1 83182 1.20218E-5 41591 0 5.03525E-4
17-48753344-G-A p.Gly987Glu missense ABCC3 1 83216 1.20169E-5 41608 0 NA
17-48753350-A-G p.Asn989Ser missense ABCC3 10 83196 1.20198E-4 41598 0 1.2747E-4
17-48753352-G-A p.Val990Met missense ABCC3 2 83212 2.4035E-5 41606 0 6.37146E-5
17-48753377-A-G p.Asp998Gly missense ABCC3 1 83250 1.2012E-5 41625 0 7.95349E-6
17-48753391-A-G p.Ser1003Gly missense ABCC3 10 83248 1.20123E-4 41624 0 2.30707E-4
17-48753402-C-T p.Asn1006Asn synonymous ABCC3 1 83248 1.20123E-5 41624 0 3.29614E-5
17-48753405-C-G p.Asn1007Lys missense ABCC3 1 83246 1.20126E-5 41623 0 NA
17-48753417-GC-G p.Leu1012fs frameshift ABCC3 1 83200 1.20192E-5 41600 0 1.2329E-4
17-48753423-C-T p.Gly1013Gly synonymous ABCC3 6589 82992 0.0793932 41496 347 0.0981425
17-48753431-C-G p.Ala1016Gly missense ABCC3 1 83204 1.20187E-5 41602 0 NA
17-48753438-A-G p.Leu1018Leu synonymous ABCC3 1 83192 1.20204E-5 41596 0 3.18634E-5
17-48753442-A-G p.Ile1020Val missense ABCC3 2 83164 2.40489E-5 41582 0 1.65475E-5
17-48753632-C-G c.3068-7C>G splice_region ABCC3 1 82528 1.21171E-5 41264 0 3.18715E-5
17-48753662-A-G p.Met1031Val missense ABCC3 2 82708 2.41815E-5 41354 0 NA
17-48753675-C-T p.Ala1035Val missense ABCC3 2 82698 2.41844E-5 41349 0 3.18857E-5
17-48753676-G-A p.Ala1035Ala synonymous ABCC3 1 82702 1.20916E-5 41351 0 3.18776E-5
17-48753688-G-A p.Gln1039Gln synonymous ABCC3 2 82778 2.4161E-5 41389 0 3.98476E-6
17-48753695-C-T p.Arg1042Cys missense ABCC3 3 82810 3.62275E-5 41405 0 3.18756E-5
17-48753696-G-A p.Arg1042His missense ABCC3 1 82828 1.20732E-5 41414 0 3.18695E-5
17-48753705-A-G p.His1045Arg missense ABCC3 1 82880 1.20656E-5 41440 0 3.29701E-5
17-48753719-CACA-C p.Asn1051del disruptive_inframe_deletion ABCC3 1 83048 1.20412E-5 41524 0 NA
17-48753726-A-T p.Lys1052Met missense ABCC3 1 83114 1.20317E-5 41557 0 NA
17-48753731-C-T p.Arg1054Cys missense ABCC3 5 83148 6.01337E-5 41574 0 8.23805E-5
17-48753732-G-A p.Arg1054His missense ABCC3 2 83134 2.40575E-5 41567 0 1.59086E-5
17-48753735-C-T p.Ser1055Leu missense ABCC3 2 83176 2.40454E-5 41588 0 NA
17-48753736-G-A p.Ser1055Ser synonymous ABCC3 9 83164 1.0822E-4 41582 0 6.25E-4
17-48753756-C-G p.Thr1062Ser missense ABCC3 2 83236 2.40281E-5 41618 0 NA
17-48753758-A-G p.Thr1063Ala missense ABCC3 1 83236 1.2014E-5 41618 0 3.97655E-6
17-48753767-G-T p.Gly1066Cys missense ABCC3 4 83254 4.80457E-5 41627 0 3.18613E-5
17-48753770-C-T p.Arg1067Cys missense ABCC3 1 83252 1.20117E-5 41626 0 6.37146E-5
17-48753789-C-T p.Ser1073Phe missense ABCC3 1 83228 1.20152E-5 41614 0 8.2371E-6
17-48753791-A-G p.Lys1074Glu missense ABCC3 1 83218 1.20166E-5 41609 0 1.64739E-5
17-48753794-G-C p.Asp1075His missense ABCC3 1 83204 1.20187E-5 41602 0 NA
17-48753796-C-T p.Asp1075Asp synonymous ABCC3 6 83208 7.21085E-5 41604 0 1.59205E-4
17-48753801-A-G p.Tyr1077Cys missense ABCC3 1 83206 1.20184E-5 41603 0 8.2371E-6
17-48753802-T-C p.Tyr1077Tyr synonymous ABCC3 3 83202 3.60568E-5 41601 0 3.29484E-5
17-48753806-G-A p.Val1079Ile missense ABCC3 1 83170 1.20236E-5 41585 0 1.64742E-5
17-48753823-C-T p.Ala1084Ala synonymous ABCC3 1 83050 1.20409E-5 41525 0 8.2371E-6
17-48753829-C-T p.Val1086Val synonymous ABCC3 1 83040 1.20424E-5 41520 0 NA
17-48753845-A-C p.Asn1092His missense ABCC3 5 82914 6.03034E-5 41457 0 1.98883E-5
17-48753859-C-T p.Asn1096Asn synonymous ABCC3 2 82802 2.4154E-5 41401 0 6.37186E-5
17-48753860-G-A p.Ala1097Thr missense ABCC3 1 82732 1.20872E-5 41366 0 1.64766E-5
17-48753862-C-T p.Ala1097Ala synonymous ABCC3 1 82770 1.20817E-5 41385 0 8.23845E-6
17-48753875-G-T p.Val1102Leu missense ABCC3 1 82710 1.20904E-5 41355 0 1.19319E-5
17-48753877-G-A p.Val1102Val synonymous ABCC3 2 82706 2.4182E-5 41353 0 8.24294E-6
17-48753896-C-CCGCT p.Phe1111fs frameshift ABCC3 2 82398 2.42724E-5 41199 0 3.97883E-6
17-48753897-C-T p.Pro1109Leu missense ABCC3 10 82384 1.21383E-4 41192 0 6.5496E-4
17-48753898-G-T p.Pro1109Pro synonymous ABCC3 7 82282 8.50733E-5 41141 0 4.37821E-5
17-48753898-G-A p.Pro1109Pro synonymous ABCC3 7 82282 8.50733E-5 41141 0 1.9118E-4
17-48753914-A-C p.Ile1115Leu missense ABCC3 1 81982 1.21978E-5 40991 0 3.18695E-5
17-48753916-C-T p.Ile1115Ile synonymous ABCC3 1 81902 1.22097E-5 40951 0 3.98953E-6
17-48753931-G-A p.Val1120Val synonymous ABCC3 1 81022 1.23423E-5 40511 0 3.41233E-5
17-48753932-C-T p.Leu1121Phe missense ABCC3 2 80978 2.46981E-5 40489 0 NA
17-48753947-C-A p.Gln1126Lys missense+splice_region ABCC3 1 79474 1.25827E-5 39737 0 NA
17-48753952-G-A c.3378+3G>A splice_region ABCC3 2 78864 2.53601E-5 39432 0 1.7445E-5
17-48753952-G-C c.3378+3G>C splice_region ABCC3 1 78866 1.26797E-5 39433 0 4.16091E-6
17-48755113-T-C p.Tyr1129Tyr synonymous ABCC3 4 82630 4.84086E-5 41315 0 3.18715E-5
17-48755122-A-G p.Thr1132Thr synonymous ABCC3 1 82842 1.20712E-5 41421 0 8.28212E-6
17-48755127-G-A p.Arg1134Gln missense ABCC3 12 82860 1.44823E-4 41430 0 0.00100705
17-48755131-A-G p.Gln1135Gln synonymous ABCC3 1 82972 1.20523E-5 41486 0 NA
17-48755139-G-A p.Arg1138Gln missense ABCC3 4 83062 4.81568E-5 41531 0 2.78605E-5
17-48755143-G-A p.Leu1139Leu synonymous ABCC3 1 83118 1.20311E-5 41559 0 3.18674E-5
17-48755146-ATCAG-A p.Val1142fs frameshift ABCC3 2 83126 2.40599E-5 41563 0 1.19359E-5
17-48755156-C-T p.Arg1144Cys missense ABCC3 2 83178 2.40448E-5 41589 0 3.30055E-5
17-48755157-G-A p.Arg1144His missense ABCC3 2 83184 2.40431E-5 41592 0 8.25001E-6
17-48755165-A-G p.Ile1147Val missense ABCC3 2 83308 2.40073E-5 41654 0 3.18959E-5
17-48755170-C-T p.Tyr1148Tyr synonymous ABCC3 1 83324 1.20013E-5 41662 0 3.97671E-6
17-48755176-C-T p.His1150His synonymous ABCC3 1 83338 1.19993E-5 41669 0 NA
17-48755180-T-A p.Ser1152Thr missense ABCC3 5 83330 6.00024E-5 41665 0 0.00100705
17-48755180-T-G p.Ser1152Ala missense ABCC3 1 83332 1.20002E-5 41666 0 NA
17-48755181-C-T p.Ser1152Leu missense ABCC3 1 83328 1.20008E-5 41664 0 5.76958E-5
17-48755182-G-A p.Ser1152Ser synonymous ABCC3 4 83336 4.79985E-5 41668 0 1.31867E-4
17-48755194-T-C p.Thr1156Thr synonymous ABCC3 2 83348 2.39958E-5 41674 0 3.18735E-5
17-48755222-C-T p.Arg1166Cys missense ABCC3 18 83368 2.1591E-4 41684 0 0.00100705
17-48755222-C-A p.Arg1166Ser missense ABCC3 2 83368 2.399E-5 41684 0 2.38576E-5
17-48755223-G-A p.Arg1166His missense ABCC3 1 83368 1.1995E-5 41684 0 7.41449E-5
17-48755227-C-G p.Ser1167Arg missense ABCC3 1 83368 1.1995E-5 41684 0 NA
17-48755228-C-T p.Arg1168Trp missense ABCC3 3 83366 3.59859E-5 41683 0 8.23818E-6
17-48755229-G-A p.Arg1168Gln missense ABCC3 2 83368 2.399E-5 41684 0 4.11916E-5
17-48755237-G-C p.Glu1171Gln missense ABCC3 1 83366 1.19953E-5 41683 0 1.64758E-5
17-48755246-A-G p.Ser1174Gly missense ABCC3 1 83374 1.19941E-5 41687 0 NA
17-48755260-G-A p.Val1178Val synonymous ABCC3 1 83340 1.1999E-5 41670 0 3.18715E-5
17-48755280-G-C p.Cys1185Ser missense ABCC3 3 83306 3.60118E-5 41653 0 NA
17-48755291-A-T p.Ile1189Phe missense ABCC3 1 83254 1.20114E-5 41627 0 1.89463E-4
17-48755303-C-T p.Arg1193Trp missense+splice_region ABCC3 3 83216 3.60508E-5 41608 0 8.23832E-6
17-48755303-CGGTCAGAAGCCGCCTCCCTCGCTCCCTGCTCCTCCAGGAATTCCCAGCAGGCTCTCTGGTGTTCAGGGTCCTTGTCCCTCCTTTCCCCTAAGCAGAAAACTGGCCCTGCCCTGCCCCTGCCCCATTTCCTCCTCATCTGATCCCCCATA-C p.Trp1194fs frameshift ABCC3 1 83216 1.20169E-5 41608 0 NA
17-48755304-G-A p.Arg1193Gln missense+splice_region ABCC3 5 83200 6.00962E-5 41600 0 1.27575E-4
17-48755314-C-T p.Ala1196Ala synonymous ABCC3 2 83184 2.40431E-5 41592 0 9.06379E-5
17-48755315-G-A p.Ala1197Thr missense ABCC3 1 83170 1.20236E-5 41585 0 1.15371E-4
17-48755323-C-T p.Leu1199Leu synonymous ABCC3 10 83186 1.20213E-4 41593 0 1.59378E-4
17-48755326-T-C p.Ala1200Ala synonymous ABCC3 4 83176 4.80908E-5 41588 0 NA
17-48755335-C-T p.Ser1203Ser synonymous ABCC3 1 83166 1.20241E-5 41583 0 3.98057E-6
17-48755343-A-T p.Asn1206Ile missense ABCC3 4 83166 4.80966E-5 41583 0 NA
17-48755368-A-G p.Ser1214Ser synonymous ABCC3 17 83164 2.04415E-4 41582 0 3.29723E-5
17-48755374-C-T p.Ser1216Ser synonymous ABCC3 20 83172 2.40466E-4 41586 0 1.87096E-4
17-48755388-C-T p.Ser1221Phe missense ABCC3 5970 83082 0.0718567 41541 249 0.0850351
17-48755390-C-T p.Pro1222Ser missense ABCC3 1 83206 1.20184E-5 41603 0 NA
17-48755391-C-T p.Pro1222Leu missense ABCC3 5 83202 6.00947E-5 41601 0 6.25E-4
17-48755406-G-GCCCTGCCCTGC p.His1234fs frameshift ABCC3 24 83204 2.88448E-4 41602 1 9.24627E-4
17-48755411-G-GCCCTGC p.Leu1232_Pro1233dup disruptive_inframe_insertion ABCC3 1 83210 1.20178E-5 41605 0 3.98454E-6
17-48755411-G-T p.Ala1229Ser missense ABCC3 3 83212 3.60525E-5 41606 0 0.00125
17-48755435-C-T p.Leu1237Phe missense ABCC3 20 83308 2.40073E-4 41654 0 3.18573E-4
17-48755436-T-C p.Leu1237Pro missense ABCC3 1 83300 1.20048E-5 41650 0 4.00606E-6
17-48755450-A-G c.3579-4A>G splice_region ABCC3 88 83328 0.00105607 41664 2 0.00380774
17-48755455-T-G p.Trp1194Gly missense+splice_region ABCC3 3 83348 3.59937E-5 41674 0 1.2239E-5
17-48755478-C-T p.Phe1201Phe synonymous ABCC3 2 83362 2.39917E-5 41681 0 1.74608E-5
17-48755480-T-C p.Val1202Ala missense ABCC3 1 83368 1.1995E-5 41684 0 4.26967E-6
17-48755491-G-A p.Val1206Met missense ABCC3 1 83366 1.19953E-5 41683 0 1.77377E-5
17-48755492-T-C p.Val1206Ala missense ABCC3 1 83368 1.1995E-5 41684 0 NA
17-48755494-G-T p.Val1207Leu missense ABCC3 6 83360 7.1977E-5 41680 0 6.25E-4
17-48755508-A-C p.Ala1211Ala synonymous ABCC3 1 83350 1.19976E-5 41675 0 NA
17-48755511-A-G p.Leu1212Leu synonymous ABCC3 1 83354 1.1997E-5 41677 0 NA
17-48755517-C-T p.Ala1214Ala synonymous ABCC3 21 83330 2.5201E-4 41665 0 5.10725E-4
17-48755518-G-A p.Val1215Ile missense ABCC3 11 83320 1.32021E-4 41660 0 0.00125
17-48755523-C-T p.Ile1216Ile synonymous ABCC3 5 83298 6.00254E-5 41649 0 6.25E-4
17-48755526-G-A p.Gly1217Gly synonymous ABCC3 1 83294 1.20057E-5 41647 0 NA
17-48755532-C-A p.Ser1219Arg missense ABCC3 3 83284 3.60213E-5 41642 0 2.71179E-5
17-48755541-C-T p.Asn1222Asn synonymous ABCC3 4 83248 4.80492E-5 41624 0 2.87761E-4
17-48755543-C-T p.Pro1223Leu missense ABCC3 4 83230 4.80596E-5 41615 0 3.68189E-5
17-48755544-G-A p.Pro1223Pro synonymous ABCC3 11 83232 1.32161E-4 41616 0 6.39632E-5
17-48755547-G-T p.Gly1224Gly synonymous ABCC3 1 83210 1.20178E-5 41605 0 NA
17-48755552-T-C p.Val1226Ala missense ABCC3 1 83166 1.20241E-5 41583 0 5.36067E-6
17-48755553-G-A p.Val1226Val synonymous ABCC3 1 83166 1.20241E-5 41583 0 1.1818E-4
17-48755570-A-C p.Tyr1232Ser missense ABCC3 1 82966 1.20531E-5 41483 0 4.43287E-5
17-48755580-G-A p.Gln1235Gln splice_region+synonymous ABCC3 1 82808 1.20761E-5 41404 0 NA
17-48757154-G-C c.3706-5G>C splice_region ABCC3 13 83272 1.56115E-4 41636 0 4.14145E-4
17-48757186-C-T p.Arg1245* stop_gained ABCC3 11 83336 1.31996E-4 41668 0 9.14622E-5
17-48757191-G-T p.Met1246Ile missense ABCC3 18 83326 2.16019E-4 41663 0 6.25E-4
17-48757215-C-T p.Ile1254Ile synonymous ABCC3 1 83326 1.20011E-5 41663 0 1.64791E-5
17-48757220-C-G p.Ala1256Gly missense ABCC3 11 83320 1.32021E-4 41660 0 1.91168E-4
17-48757227-G-A p.Glu1258Glu synonymous ABCC3 1 83316 1.20025E-5 41658 0 NA
17-48757231-G-A p.Val1260Ile missense ABCC3 3 83296 3.60161E-5 41648 0 NA
17-48757257-A-G p.Thr1268Thr synonymous ABCC3 14 83176 1.68318E-4 41588 0 7.56171E-5
17-48757261-G-T c.3807+1G>T splice_donor ABCC3 2 83154 2.40518E-5 41577 0 NA
17-48757264-G-A c.3807+4G>A splice_region ABCC3 2 83124 2.40604E-5 41562 0 3.98387E-6
17-48757268-C-T c.3807+8C>T splice_region ABCC3 1 83072 1.20378E-5 41536 0 NA
17-48760967-C-T c.3808-4C>T splice_region ABCC3 3 81850 3.66524E-5 40925 0 NA
17-48760972-C-A p.Ala1270Glu missense+splice_region ABCC3 7 81980 8.53867E-5 40990 0 9.10382E-5
17-48760972-C-G p.Ala1270Gly missense+splice_region ABCC3 1 81982 1.21978E-5 40991 0 1.4811E-5
17-48760973-G-A p.Ala1270Ala splice_region+synonymous ABCC3 2 82064 2.43712E-5 41032 0 3.62957E-5
17-48760977-TG-T p.Val1273fs frameshift ABCC3 10 82214 1.21634E-4 41107 0 5.40083E-5
17-48760979-G-T p.Trp1272Cys missense ABCC3 2 82268 2.43108E-5 41134 0 NA
17-48760980-G-A p.Val1273Met missense ABCC3 1 82308 1.21495E-5 41154 0 8.96861E-6
17-48760987-A-G p.Glu1275Gly missense ABCC3 3 82498 3.63645E-5 41249 0 6.22709E-5
17-48760993-G-A p.Ser1277Asn missense ABCC3 1 82634 1.21016E-5 41317 0 8.8199E-6
17-48760995-C-T p.Arg1278Cys missense ABCC3 1 82656 1.20983E-5 41328 0 1.75812E-5
17-48760996-G-A p.Arg1278His missense ABCC3 2 82698 2.41844E-5 41349 0 8.7535E-6
17-48761003-C-T p.Pro1280Pro synonymous ABCC3 1 82820 1.20744E-5 41410 0 1.27616E-5
17-48761005-A-G p.Glu1281Gly missense ABCC3 2 82864 2.41359E-5 41432 0 1.72132E-5
17-48761014-C-A p.Pro1284His missense ABCC3 1 82962 1.20537E-5 41481 0 NA
17-48761019-C-G p.Arg1286Gly missense ABCC3 51 82974 6.1465E-4 41487 0 0.00194764
17-48761019-C-T p.Arg1286Cys missense ABCC3 5 82980 6.02555E-5 41490 0 1.69555E-5
17-48761020-G-A p.Arg1286His missense ABCC3 3 83018 3.61367E-5 41509 0 5.07477E-5
17-48761022-G-A p.Gly1287Arg missense ABCC3 1 83080 1.20366E-5 41540 0 NA
17-48761025-G-A p.Glu1288Lys missense ABCC3 1 83098 1.2034E-5 41549 0 8.26706E-6
17-48761029-T-C p.Val1289Ala missense ABCC3 2 83060 2.4079E-5 41530 0 8.40209E-6
17-48761037-C-T p.Arg1292Trp missense ABCC3 1 83134 1.20288E-5 41567 0 4.17781E-5
17-48761038-G-A p.Arg1292Gln missense ABCC3 24 83148 2.88642E-4 41574 0 2.87081E-4
17-48761052-C-T p.Arg1297Cys missense ABCC3 4 83218 4.80665E-5 41609 0 3.27177E-5
17-48761053-G-A p.Arg1297His missense ABCC3 4268 83098 0.051361 41549 122 0.0639476
17-48761058-C-T p.Arg1299Trp missense ABCC3 7 83234 8.41002E-5 41617 0 2.00257E-4
17-48761059-G-A p.Arg1299Gln missense ABCC3 3 83228 3.60456E-5 41614 0 1.27567E-4
17-48761062-C-T p.Pro1300Leu missense ABCC3 57 83228 6.84866E-4 41614 0 6.25E-4
17-48761063-G-A p.Pro1300Pro synonymous ABCC3 8 83240 9.61076E-5 41620 0 0.00125
17-48761074-T-G p.Leu1304Arg missense ABCC3 1 83252 1.20117E-5 41626 0 NA
17-48761077-T-A p.Val1305Glu missense ABCC3 4 83250 4.8048E-5 41625 0 3.31098E-5
17-48761077-T-C p.Val1305Ala missense ABCC3 1 83250 1.2012E-5 41625 0 NA
17-48761084-A-C p.Arg1307Ser missense ABCC3 2 83248 2.40246E-5 41624 0 NA
17-48761088-C-T p.Leu1309Leu synonymous ABCC3 5 83254 6.00572E-5 41627 0 3.18878E-5
17-48761098-A-G p.His1312Arg missense ABCC3 1 83248 1.20123E-5 41624 0 4.12082E-5
17-48761102-G-A p.Val1313Val synonymous ABCC3 1 83232 1.20146E-5 41616 0 2.48587E-5
17-48761105-C-T p.His1314His synonymous ABCC3 19694 82962 0.237386 41481 2474 0.267267
17-48761106-G-T p.Gly1315Cys missense ABCC3 1 83218 1.20166E-5 41609 0 4.14814E-5
17-48761106-G-A p.Gly1315Ser missense ABCC3 2 83218 2.40333E-5 41609 0 4.14834E-5
17-48761106-G-C p.Gly1315Arg missense ABCC3 2 83218 2.40333E-5 41609 0 NA
17-48761111-C-A p.Gly1316Gly synonymous ABCC3 3 83170 3.60707E-5 41585 0 NA
17-48761111-C-T p.Gly1316Gly synonymous ABCC3 1 83170 1.20236E-5 41585 0 8.30813E-6
17-48761112-G-A p.Glu1317Lys missense ABCC3 2 83196 2.40396E-5 41598 0 3.18573E-5
17-48761119-T-TGGGGATCGTGGGCCGCACTGGGGCTGGCAAGTCTTCCATG c.3954+2_3954+3insGGGGATCGTGGGCCGCACTGGGGCTGGCAAGTCTTCCATG splice_region ABCC3 4 83164 4.80977E-5 41582 2 NA
17-48761121-C-T c.3954+4C>T splice_region ABCC3 4 83146 4.81081E-5 41573 0 3.18918E-5
17-48761122-G-C c.3954+5G>C splice_region ABCC3 9 83132 1.08262E-4 41566 0 2.49771E-5
17-48761122-G-A c.3954+5G>A splice_region ABCC3 1 83132 1.20291E-5 41566 0 3.34462E-5
17-48761124-G-A c.3954+7G>A splice_region ABCC3 2 83132 2.40581E-5 41566 0 6.37471E-5
17-48761303-C-T c.3955-7C>T splice_region ABCC3 5 82976 6.02584E-5 41488 0 4.99284E-5
17-48761304-G-A c.3955-6G>A splice_region ABCC3 4 82978 4.82055E-5 41489 0 2.55216E-4
17-48761309-G-T c.3955-1G>T splice_acceptor ABCC3 1 83010 1.20467E-5 41505 0 NA
17-48761319-G-A p.Val1322Met missense ABCC3 1 83026 1.20444E-5 41513 0 5.04032E-4
17-48761322-G-A p.Gly1323Ser missense ABCC3 2 83046 2.4083E-5 41523 0 NA
17-48761325-C-T p.Arg1324Cys missense ABCC3 1 83054 1.20404E-5 41527 0 5.04541E-4
17-48761326-G-A p.Arg1324His missense ABCC3 38 83050 4.57556E-4 41525 0 8.29452E-4
17-48761334-GC-G p.Ala1327fs frameshift ABCC3 1 83094 1.20346E-5 41547 0 NA
17-48761336-T-G p.Ala1327Ala synonymous ABCC3 1 83102 1.20334E-5 41551 0 NA
17-48761354-C-T p.Thr1333Thr synonymous ABCC3 1 83072 1.20378E-5 41536 0 NA
17-48761363-G-A p.Leu1336Leu synonymous ABCC3 503 83064 0.00605557 41532 5 0.00542431
17-48761375-G-T p.Leu1340Leu synonymous ABCC3 1 83082 1.20363E-5 41541 0 1.6015E-5
17-48761376-G-A p.Glu1341Lys missense ABCC3 1 83074 1.20375E-5 41537 0 NA
17-48761378-G-A p.Glu1341Glu synonymous ABCC3 1 83068 1.20383E-5 41534 0 NA
17-48761382-G-A p.Ala1343Thr missense ABCC3 2 83040 2.40848E-5 41520 0 NA
17-48761385-A-G p.Lys1344Glu missense ABCC3 85 83056 0.00102341 41528 0 0.004375
17-48761397-C-T p.Arg1348Cys missense ABCC3 569 83054 0.00685096 41527 12 0.0119883
17-48761398-G-C p.Arg1348Pro missense ABCC3 1 83070 1.2038E-5 41535 0 NA
17-48761409-C-T p.Leu1352Phe missense ABCC3 59 83068 7.10261E-4 41534 0 0.00201613
17-48761414-T-C p.Asn1353Asn synonymous ABCC3 12 83070 1.44456E-4 41535 0 3.50631E-4
17-48761416-T-C p.Val1354Ala missense ABCC3 2 83072 2.40755E-5 41536 0 3.99754E-6
17-48761431-T-A p.Leu1359His missense ABCC3 1 83000 1.20482E-5 41500 0 NA
17-48761435-T-A p.His1360Gln missense ABCC3 2 82960 2.4108E-5 41480 0 2.49356E-5
17-48761446-C-G p.Ser1364Cys missense ABCC3 1 82872 1.20668E-5 41436 0 NA
17-48761449-A-G p.Gln1365Arg missense ABCC3 103 82834 0.00124345 41417 1 0.00453629
17-48761471-A-G c.4113+3A>G splice_region ABCC3 2 82372 2.42801E-5 41186 0 NA
17-48761473-G-A c.4113+5G>A splice_region ABCC3 9 82298 1.09359E-4 41149 0 6.37471E-5
17-48762070-G-T p.Asp1372Tyr missense+splice_region ABCC3 1 82590 1.2108E-5 41295 0 NA
17-48762082-T-C p.Phe1376Leu missense ABCC3 1 82948 1.20557E-5 41474 0 NA
17-48762086-C-T p.Ser1377Leu missense ABCC3 1 83010 1.20467E-5 41505 0 9.55779E-5
17-48762087-G-A p.Ser1377Ser synonymous ABCC3 1 83048 1.20412E-5 41524 0 7.96191E-6
17-48762090-G-A p.Gly1378Gly synonymous ABCC3 2 83074 2.40749E-5 41537 0 NA
17-48762097-C-T p.Arg1381Cys missense ABCC3 3 83142 3.60828E-5 41571 0 1.11437E-4
17-48762097-C-A p.Arg1381Ser missense ABCC3 1 83142 1.20276E-5 41571 0 1.65218E-5
17-48762098-G-A p.Arg1381His missense ABCC3 1 83156 1.20256E-5 41578 0 8.25996E-6
17-48762102-G-A p.Met1382Ile missense ABCC3 2 83190 2.40414E-5 41595 0 3.97871E-6
17-48762104-A-G p.Asn1383Ser missense ABCC3 1 83200 1.20192E-5 41600 0 3.97817E-5
17-48762105-C-T p.Asn1383Asn synonymous ABCC3 2 83204 2.40373E-5 41602 0 NA
17-48762117-C-T p.Phe1387Phe synonymous ABCC3 1 83252 1.20117E-5 41626 0 8.25028E-6
17-48762123-C-T p.Ser1389Ser synonymous ABCC3 1 83292 1.2006E-5 41646 0 NA
17-48762136-G-T p.Asp1394Tyr missense ABCC3 1 83304 1.20042E-5 41652 0 NA
17-48762172-A-T p.Thr1406Ser missense ABCC3 1 83254 1.20114E-5 41627 0 6.37999E-5
17-48762173-C-T p.Thr1406Met missense ABCC3 41 83254 4.92469E-4 41627 0 0.00125
17-48762174-G-A p.Thr1406Thr synonymous ABCC3 4 83266 4.80388E-5 41633 0 4.94731E-5
17-48762175-T-G p.Phe1407Val missense ABCC3 1 83270 1.20091E-5 41635 0 NA
17-48762177-T-C p.Phe1407Phe synonymous ABCC3 1 83262 1.20103E-5 41631 0 3.97725E-6
17-48762188-A-T p.Gln1411Leu missense ABCC3 1 83234 1.20143E-5 41617 0 NA