Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
16-16043532-G-C c.-77G>C 5_prime_UTR_premature_start_codon_gain ABCC1 19 18234 0.00104201 9117 0 0.00166945
16-16043537-C-T c.-72C>T 5_prime_UTR_premature_start_codon_gain ABCC1 2 20120 9.94036E-5 10060 0 2.03683E-4
16-16043565-C-T c.-44C>T 5_prime_UTR_premature_start_codon_gain ABCC1 2 26760 7.47384E-5 13380 0 NA
16-16043641-C-T p.Gly11Gly synonymous ABCC1 103 29424 0.00350054 14712 1 0.00853357
16-16043661-G-A c.48+5G>A splice_region ABCC1 36 29290 0.00122909 14645 0 0.00388849
16-16043661-G-C c.48+5G>C splice_region ABCC1 3 29292 1.02417E-4 14646 0 NA
16-16043662-T-C c.48+6T>C splice_region ABCC1 2 29288 6.82874E-5 14644 0 NA
16-16043664-C-T c.48+8C>T splice_region ABCC1 1 29296 3.41344E-5 14648 0 NA
16-16101669-G-A c.49-4G>A splice_region ABCC1 1 83138 1.20282E-5 41569 0 3.18695E-5
16-16101673-GA-TT p.Asp17Phe missense+splice_region ABCC1 1 83238 1.20137E-5 41619 0 NA
16-16101687-G-A p.Thr21Thr synonymous ABCC1 1 83330 1.20005E-5 41665 0 6.37308E-5
16-16101692-A-T p.Asn23Ile missense ABCC1 3 83352 3.59919E-5 41676 0 3.18776E-5
16-16101696-C-T p.Thr24Thr synonymous ABCC1 1 83364 1.19956E-5 41682 0 NA
16-16101705-C-T p.Pro27Pro synonymous ABCC1 6 83368 7.19701E-5 41684 0 6.25E-4
16-16101714-C-T p.Thr30Thr synonymous ABCC1 1 83388 1.19921E-5 41694 0 NA
16-16101723-T-G p.Phe33Leu missense ABCC1 1 83396 1.1991E-5 41698 0 1.65818E-5
16-16101726-G-A p.Gln34Gln synonymous ABCC1 1 83396 1.1991E-5 41698 0 NA
16-16101731-C-T p.Thr36Met missense ABCC1 4 83402 4.79605E-5 41701 0 2.41204E-5
16-16101732-G-A p.Thr36Thr synonymous ABCC1 2 83398 2.39814E-5 41699 0 5.03525E-4
16-16101738-C-T p.Leu38Leu synonymous ABCC1 1 83406 1.19895E-5 41703 0 8.28349E-6
16-16101739-G-A p.Val39Met missense ABCC1 3 83406 3.59686E-5 41703 0 1.65667E-5
16-16101753-T-C p.Cys43Cys synonymous ABCC1 1 83406 1.19895E-5 41703 0 8.03058E-6
16-16101766-G-T p.Ala48Ser missense ABCC1 2 83402 2.39802E-5 41701 0 NA
16-16101769-T-C p.Cys49Arg missense ABCC1 2 83408 2.39785E-5 41704 0 4.0223E-6
16-16101769-T-G p.Cys49Gly missense ABCC1 3 83408 3.59678E-5 41704 0 NA
16-16101782-A-G p.Tyr53Cys missense ABCC1 3 83384 3.59781E-5 41692 0 1.28189E-4
16-16101791-A-C p.Tyr56Ser missense ABCC1 1 83360 1.19962E-5 41680 0 8.2824E-6
16-16101793-C-G p.Leu57Val missense ABCC1 35 83360 4.19866E-4 41680 0 1.53285E-4
16-16101799-C-T p.Arg59* stop_gained ABCC1 1 83342 1.19988E-5 41671 0 1.28115E-4
16-16101809-G-A p.Arg62Gln missense ABCC1 40 83198 4.80781E-4 41599 1 0.00147597
16-16101815-A-G p.Tyr64Cys missense ABCC1 3 83150 3.60794E-5 41575 0 6.42963E-5
16-16101816-C-T p.Tyr64Tyr synonymous ABCC1 1 83140 1.20279E-5 41570 0 8.25641E-6
16-16101826-A-G p.Thr68Ala missense ABCC1 36 82834 4.34604E-4 41417 0 2.49901E-4
16-16101831-T-G p.Pro69Pro synonymous ABCC1 7 82588 8.47581E-5 41294 0 1.93773E-4
16-16101842-C-T p.Thr73Ile missense ABCC1 25 82034 3.04752E-4 41017 1 5.68981E-4
16-16101850-GTAAGT-G c.225+2_225+6delTAAGT splice_donor ABCC1 6 81548 7.35763E-5 40774 3 NA
16-16103634-C-T p.Ala76Val missense+splice_region ABCC1 1 82848 1.20703E-5 41424 0 NA
16-16103653-G-T p.Trp82Cys missense ABCC1 5 83022 6.0225E-5 41511 0 9.56694E-5
16-16103656-C-T p.Ile83Ile synonymous ABCC1 6 82942 7.23397E-5 41471 0 2.49221E-5
16-16103657-G-A p.Val84Ile missense ABCC1 3 83032 3.61306E-5 41516 0 3.29739E-5
16-16103657-G-T p.Val84Phe missense ABCC1 3 83032 3.61306E-5 41516 0 5.04541E-4
16-16103680-C-T p.Tyr91Tyr synonymous ABCC1 1 83214 1.20172E-5 41607 0 NA
16-16103682-C-T p.Ser92Phe missense ABCC1 45 83228 5.40683E-4 41614 0 0.00124394
16-16103686-C-A p.Phe93Leu missense ABCC1 1 83236 1.2014E-5 41618 0 NA
16-16103699-C-T p.Arg98Trp missense ABCC1 5 83232 6.0073E-5 41616 0 3.64355E-5
16-16103700-G-A p.Arg98Gln missense ABCC1 2 83234 2.40286E-5 41617 0 NA
16-16103705-A-G p.Ile100Val missense ABCC1 3 83236 3.60421E-5 41618 0 1.61994E-5
16-16103739-C-T p.Thr111Ile missense ABCC1 1 83096 1.20343E-5 41548 0 NA
16-16103758-G-GCTGCTTGCTACCTTTTTAATTCAGCTGGAGAGGAGGAAGGGA c.351_351+1insCTGCTTGCTACCTTTTTAATTCAGCTGGAGAGGAGGAAGGGA splice_donor ABCC1 2 82678 2.41902E-5 41339 1 NA
16-16108354-G-A p.Ala120Thr missense ABCC1 1 83256 1.20111E-5 41628 0 NA
16-16108372-C-T p.Leu126Leu synonymous ABCC1 1 83308 1.20036E-5 41654 0 NA
16-16108375-G-C p.Glu127Gln missense ABCC1 2 83326 2.40021E-5 41663 0 NA
16-16108386-G-C p.Lys130Asn missense ABCC1 1 83352 1.19973E-5 41676 0 NA
16-16108413-C-T p.Leu139Leu synonymous ABCC1 1 83382 1.1993E-5 41691 0 3.18593E-5
16-16108428-A-G p.Val144Val synonymous ABCC1 2 83382 2.3986E-5 41691 0 8.2802E-6
16-16108431-C-T p.Ala145Ala synonymous ABCC1 1 83378 1.19936E-5 41689 0 NA
16-16108436-T-C p.Val147Ala missense ABCC1 1 83380 1.19933E-5 41690 0 NA
16-16108444-C-G p.Leu150Val missense ABCC1 1 83360 1.19962E-5 41680 0 NA
16-16108472-C-T p.Thr159Ile missense ABCC1 1 83302 1.20045E-5 41651 0 NA
16-16108475-C-G p.Ala160Gly missense ABCC1 1 83278 1.2008E-5 41639 0 NA
16-16108480-A-G p.Lys162Glu missense ABCC1 8 83240 9.61076E-5 41620 0 2.56822E-4
16-16108486-GTA-G c.489+2_489+3delTA splice_donor ABCC1 1 83192 1.20204E-5 41596 0 NA
16-16108486-G-A c.489+1G>A splice_donor ABCC1 1 83192 1.20204E-5 41596 0 4.01316E-6
16-16108493-G-T c.489+8G>T splice_region ABCC1 2 83124 2.40604E-5 41562 0 9.12136E-5
16-16110355-T-C p.Asp164Asp splice_region+synonymous ABCC1 2 83314 2.40056E-5 41657 0 1.20239E-5
16-16110361-G-A p.Gln166Gln synonymous ABCC1 1 83332 1.20002E-5 41666 0 NA
16-16110364-G-T p.Val167Val synonymous ABCC1 1 83336 1.19996E-5 41668 0 NA
16-16110373-T-C p.Phe170Phe synonymous ABCC1 3 83350 3.59928E-5 41675 0 8.28295E-6
16-16110374-C-T p.Arg171Cys missense ABCC1 3 83344 3.59954E-5 41672 0 3.18695E-5
16-16110383-A-G p.Thr174Ala missense ABCC1 1 83362 1.19959E-5 41681 0 NA
16-16110387-T-A p.Phe175Tyr missense ABCC1 1 83372 1.19944E-5 41686 0 3.18532E-5
16-16110388-C-T p.Phe175Phe synonymous ABCC1 2 83374 2.39883E-5 41687 0 8.28144E-6
16-16110391-C-T p.Tyr176Tyr synonymous ABCC1 2 83370 2.39894E-5 41685 0 3.31252E-5
16-16110406-C-T p.Leu181Leu synonymous ABCC1 7 83386 8.39469E-5 41693 0 3.3123E-5
16-16110410-C-T p.Leu183Phe missense ABCC1 1 83382 1.1993E-5 41691 0 4.00673E-6
16-16110413-A-G p.Ile184Val missense ABCC1 2 83378 2.39871E-5 41689 0 4.0067E-6
16-16110428-TC-T p.Cys190fs frameshift ABCC1 2 83390 2.39837E-5 41695 0 8.01327E-6
16-16110431-T-C p.Cys190Arg missense ABCC1 2 83390 2.39837E-5 41695 0 NA
16-16110437-T-C p.Ser192Pro missense ABCC1 1 83380 1.19933E-5 41690 0 NA
16-16110442-T-A p.Asp193Glu missense ABCC1 1 83380 1.19933E-5 41690 0 NA
16-16110444-G-A p.Arg194His missense ABCC1 2 83372 2.39889E-5 41686 0 4.00686E-6
16-16110445-C-A p.Arg194Arg synonymous ABCC1 10 83376 1.19939E-4 41688 0 3.18431E-5
16-16110449-C-T p.Pro196Ser missense ABCC1 1 83376 1.19939E-5 41688 0 8.28171E-6
16-16110449-C-A p.Pro196Thr missense ABCC1 1 83376 1.19939E-5 41688 0 NA
16-16110459-C-T p.Ser199Leu missense ABCC1 5 83374 5.99707E-5 41687 0 6.36943E-5
16-16110460-G-A p.Ser199Ser synonymous ABCC1 1 83370 1.19947E-5 41685 0 4.1414E-5
16-16110472-C-T p.His203His synonymous ABCC1 3 83362 3.59876E-5 41681 0 4.40808E-5
16-16110473-G-T p.Asp204Tyr missense ABCC1 1 83370 1.19947E-5 41685 0 NA
16-16110474-A-G p.Asp204Gly missense ABCC1 1 83372 1.19944E-5 41686 0 1.60305E-5
16-16126970-C-G p.Pro207Arg missense ABCC1 1 83240 1.20135E-5 41620 0 3.18451E-5
16-16126974-C-T p.Cys208Cys synonymous ABCC1 1 83244 1.20129E-5 41622 0 NA
16-16126984-A-G p.Ser212Gly missense ABCC1 1 83270 1.20091E-5 41635 0 4.0076E-6
16-16126986-C-T p.Ser212Ser synonymous ABCC1 7 83270 8.40639E-5 41635 0 3.14715E-4
16-16126987-G-T p.Ala213Ser missense ABCC1 2 83260 2.40211E-5 41630 0 8.28185E-6
16-16126996-C-G p.Leu216Val missense ABCC1 8 83256 9.60892E-5 41628 0 9.55414E-5
16-16127001-G-A p.Ser217Ser synonymous ABCC1 20 83244 2.40258E-4 41622 0 0.00135025
16-16127015-G-C p.Trp222Ser missense ABCC1 1 83168 1.20239E-5 41584 0 3.18492E-5
16-16127026-GGGTAAGGCCAGGCCCCCCAGACCTCAGGGAGGTGGTGGGGAGTGAATGAATGAATGAATGAACGAATGAACATGCTCAGCTCCCCCTCCCCAACTTCTCCCTCCTTTGCTCTTCTGCA-G p.Leu227fs frameshift ABCC1 1 83076 1.20372E-5 41538 0 NA
16-16130322-G-T c.678-7G>T splice_region ABCC1 2 82824 2.41476E-5 41412 0 1.70114E-5
16-16130329-G-A p.Gly226Gly splice_region+synonymous ABCC1 1 82956 1.20546E-5 41478 0 8.4468E-6
16-16130332-G-T p.Leu227Phe missense ABCC1 1 82982 1.20508E-5 41491 0 2.02086E-5
16-16130334-T-C p.Ile228Thr missense ABCC1 1 83002 1.20479E-5 41501 0 1.60046E-4
16-16130336-G-C p.Val229Leu missense ABCC1 4 83044 4.81672E-5 41522 0 3.18634E-5
16-16130339-C-T p.Arg230Trp missense ABCC1 3 83062 3.61176E-5 41531 0 0.00117902
16-16130340-G-A p.Arg230Gln missense ABCC1 70 83062 8.42744E-4 41531 1 0.00261313
16-16130340-G-C p.Arg230Pro missense ABCC1 8 83066 9.6309E-5 41533 0 7.25368E-5
16-16130341-G-A p.Arg230Arg synonymous ABCC1 3 83072 3.61133E-5 41536 0 4.14329E-4
16-16130342-G-T p.Gly231Cys missense ABCC1 21 83078 2.52775E-4 41539 0 3.0982E-4
16-16130348-C-T p.Arg233Cys missense ABCC1 2 83140 2.40558E-5 41570 0 3.18573E-5
16-16130348-C-A p.Arg233Ser missense ABCC1 1 83140 1.20279E-5 41570 0 NA
16-16130356-C-G p.Pro235Pro synonymous ABCC1 16 83208 1.92289E-4 41604 3 6.25E-4
16-16130357-C-T p.Leu236Leu synonymous ABCC1 608 83210 0.00730681 41605 11 0.0176411
16-16130360-G-A p.Glu237Lys missense ABCC1 1 83244 1.20129E-5 41622 0 6.25E-4
16-16130360-G-C p.Glu237Gln missense ABCC1 1 83244 1.20129E-5 41622 0 NA
16-16130374-C-G p.Leu241Leu synonymous ABCC1 1 83296 1.20054E-5 41648 0 3.18451E-5
16-16130377-G-T p.Trp242Cys missense ABCC1 2 83314 2.40056E-5 41657 0 0.00125078
16-16130379-C-T p.Ser243Phe missense ABCC1 1 83312 1.20031E-5 41656 0 NA
16-16130398-G-A p.Thr249Thr synonymous ABCC1 1 83346 1.19982E-5 41673 0 8.02021E-6
16-16130410-C-T p.Val253Val synonymous ABCC1 4 83356 4.79869E-5 41678 0 4.41147E-5
16-16130410-C-G p.Val253Val synonymous ABCC1 1 83356 1.19967E-5 41678 0 NA
16-16130411-G-A p.Val254Met missense ABCC1 3 83362 3.59876E-5 41681 0 1.60408E-5
16-16130411-G-T p.Val254Leu missense ABCC1 1 83362 1.19959E-5 41681 0 NA
16-16130416-T-C p.Pro255Pro synonymous ABCC1 1 83370 1.19947E-5 41685 0 8.28885E-6
16-16130420-T-C p.Leu257Leu synonymous ABCC1 2 83366 2.39906E-5 41683 0 4.97315E-5
16-16130423-G-A p.Val258Ile missense ABCC1 1 83364 1.19956E-5 41682 0 4.01027E-6
16-16130426-A-C p.Lys259Gln missense ABCC1 9 83368 1.07955E-4 41684 0 NA
16-16130428-G-A p.Lys259Lys synonymous ABCC1 1 83366 1.19953E-5 41683 0 6.37024E-5
16-16130434-G-A p.Trp261* stop_gained ABCC1 1 83364 1.19956E-5 41682 0 NA
16-16130446-C-T p.Cys265Cys synonymous ABCC1 3 83346 3.59945E-5 41673 0 3.61335E-5
16-16130447-G-A p.Ala266Thr missense ABCC1 1 83348 1.19979E-5 41674 0 1.66392E-5
16-16130450-A-C p.Lys267Gln missense ABCC1 12 83342 1.43985E-4 41671 0 0.00125
16-16130463-A-G c.809+3A>G splice_region ABCC1 1 83290 1.20062E-5 41645 0 4.0257E-6
16-16138303-C-G c.810-4C>G splice_region ABCC1 7 82600 8.47458E-5 41300 0 0.00106279
16-16138304-C-T c.810-3C>T splice_region ABCC1 1 82630 1.21021E-5 41315 0 4.04093E-6
16-16138307-G-A p.Lys270Lys splice_region+synonymous ABCC1 4 82648 4.8398E-5 41324 0 2.82728E-5
16-16138311-C-T p.Pro272Ser missense ABCC1 10 82738 1.20863E-4 41369 0 1.37266E-4
16-16138312-C-T p.Pro272Leu missense ABCC1 7 82736 8.46065E-5 41368 0 1.42019E-4
16-16138313-G-A p.Pro272Pro synonymous ABCC1 4175 82540 0.0505815 41270 109 0.0823232
16-16138319-G-A p.Lys274Lys synonymous ABCC1 68 82882 8.20443E-4 41441 0 8.27815E-4
16-16138322-T-C p.Val275Val synonymous ABCC1 27267 80906 0.337021 40453 4879 0.409619
16-16138323-G-A p.Val276Met missense ABCC1 1 82926 1.20589E-5 41463 0 NA
16-16138325-G-A p.Val276Val synonymous ABCC1 4 82966 4.82125E-5 41483 0 0.00125
16-16138333-C-T p.Ser279Phe missense ABCC1 1 83084 1.2036E-5 41542 0 4.14491E-5
16-16138351-C-T p.Pro285Leu missense ABCC1 21 83260 2.52222E-4 41630 0 7.32484E-4
16-16138374-G-A p.Ala293Thr missense ABCC1 1 83354 1.1997E-5 41677 0 NA
16-16138375-C-T p.Ala293Val missense ABCC1 5 83354 5.99851E-5 41677 0 5.03525E-4
16-16138377-A-C p.Asn294His missense ABCC1 13 83358 1.55954E-4 41679 0 1.59236E-4
16-16138379-T-A p.Asn294Lys missense ABCC1 1 83364 1.19956E-5 41682 0 NA
16-16138385-G-A p.Glu296Glu synonymous ABCC1 2 83364 2.39912E-5 41682 0 NA
16-16138405-A-G p.Lys303Arg missense ABCC1 1 83392 1.19916E-5 41696 0 3.1841E-5
16-16138407-T-A p.Ser304Thr missense ABCC1 3 83390 3.59755E-5 41695 0 2.48423E-5
16-16138421-G-C p.Glu308Asp missense ABCC1 2 83396 2.3982E-5 41698 0 8.01391E-6
16-16138452-A-G p.Lys319Glu missense ABCC1 1 83388 1.19921E-5 41694 0 NA
16-16138463-G-A p.Gly322Gly synonymous ABCC1 7 83358 8.39751E-5 41679 0 3.18532E-5
16-16138468-A-G p.Tyr324Cys missense ABCC1 3 83358 3.59893E-5 41679 0 3.18817E-5
16-16138472-C-T p.Phe325Phe synonymous ABCC1 1 83354 1.1997E-5 41677 0 NA
16-16138483-T-G p.Phe329Cys missense ABCC1 8 83334 9.59992E-5 41667 0 6.25E-4
16-16138490-C-G p.Phe331Leu missense ABCC1 2 83310 2.40067E-5 41655 0 4.00789E-6
16-16138502-C-T p.His335His synonymous ABCC1 11 83252 1.32129E-4 41626 0 5.03525E-4
16-16138519-C-T p.Ser341Phe missense ABCC1 13 83104 1.5643E-4 41552 0 9.63337E-5
16-16138520-C-T p.Ser341Ser synonymous ABCC1 2 83106 2.40657E-5 41553 0 1.59236E-4
16-16138526-G-A p.Pro343Pro synonymous ABCC1 8 83000 9.63855E-5 41500 0 0.00100705
16-16138538-G-A c.1040+1G>A splice_donor ABCC1 1 82852 1.20697E-5 41426 0 NA
16-16138543-A-AC c.1040+6_1040+7insC splice_region ABCC1 14 82702 1.69282E-4 41351 0 1.50371E-4
16-16139699-C-T p.Leu349Leu synonymous ABCC1 5 82278 6.07696E-5 41139 0 6.52153E-4
16-16139708-C-T p.Phe352Phe synonymous ABCC1 7 82446 8.49041E-5 41223 0 5.03525E-4
16-16139709-G-A p.Val353Met missense ABCC1 2 82474 2.42501E-5 41237 0 8.4219E-6
16-16139714-T-C p.Asn354Asn synonymous ABCC1 28311 82006 0.345231 41003 5399 0.407959
16-16139714-T-G p.Asn354Lys missense ABCC1 1 82618 1.21039E-5 41309 0 NA
16-16139715-G-A p.Asp355Asn missense ABCC1 2 82634 2.42031E-5 41317 0 NA
16-16139719-C-G p.Thr356Arg missense ABCC1 7 82736 8.46065E-5 41368 0 1.66661E-5
16-16139720-G-A p.Thr356Thr synonymous ABCC1 1083 82762 0.0130857 41381 30 0.0265354
16-16139720-G-T p.Thr356Thr synonymous ABCC1 1 82768 1.2082E-5 41384 0 1.66636E-5
16-16139730-G-T p.Asp360Tyr missense ABCC1 1 82868 1.20674E-5 41434 0 8.32737E-6
16-16139732-C-T p.Asp360Asp synonymous ABCC1 19 82882 2.29242E-4 41441 0 3.1837E-4
16-16139753-C-T p.Thr367Thr synonymous ABCC1 6 82930 7.23502E-5 41465 0 3.18451E-5
16-16139754-G-A p.Val368Met missense ABCC1 1 82888 1.20645E-5 41444 0 4.1614E-5
16-16139765-T-C p.Phe371Phe synonymous ABCC1 7 83008 8.43292E-5 41504 0 3.82141E-4
16-16139777-C-T p.Cys375Cys synonymous ABCC1 1 83028 1.20441E-5 41514 0 4.01075E-6
16-16139786-C-T p.Thr378Thr synonymous ABCC1 2 83062 2.40784E-5 41531 0 NA
16-16139789-C-T p.Leu379Leu synonymous ABCC1 2 83056 2.40801E-5 41528 0 4.15856E-5
16-16139795-G-A p.Leu381Leu synonymous ABCC1 1 83068 1.20383E-5 41534 0 NA
16-16139798-C-G p.His382Gln missense ABCC1 1 83084 1.2036E-5 41542 0 3.18492E-5
16-16139815-G-A p.Cys388Tyr missense ABCC1 1 83084 1.2036E-5 41542 0 NA
16-16139819-C-T p.Phe389Phe synonymous ABCC1 1 83082 1.20363E-5 41541 0 0.00100705
16-16139843-C-T p.Thr397Thr synonymous ABCC1 1 82964 1.20534E-5 41482 0 2.0057E-5
16-16139851-T-C p.Ile400Thr missense ABCC1 11 82918 1.32661E-4 41459 0 5.03525E-4
16-16139865-C-T p.Arg405Trp missense ABCC1 1 82706 1.2091E-5 41353 0 3.18715E-5
16-16139869-A-AGGCCCTGGTGATCACCAATTCAGCCAGAAAATCCTCCAC p.His386_Ile387insAlaLeuValIleThrAsnSerAlaArgLysSerSerThr conservative_inframe_insertion ABCC1 6 82594 7.26445E-5 41297 3 NA
16-16139873-A-AG c.1218+3_1218+4insG splice_region ABCC1 1 82452 1.21283E-5 41226 0 NA
16-16139878-A-G c.1218+8A>G splice_region ABCC1 26528 80114 0.331128 40057 4698 0.400728
16-16139878-AC-GT c.1218+8_1218+9delACinsGT splice_region ABCC1 1 82258 1.21569E-5 41129 0 NA
16-16141991-T-A c.1219-8T>A splice_region ABCC1 1 83068 1.20383E-5 41534 0 NA
16-16141992-C-T c.1219-7C>T splice_region ABCC1 1 83078 1.20369E-5 41539 0 8.02968E-6
16-16142008-A-T p.Ile410Phe missense ABCC1 1 83182 1.20218E-5 41591 0 NA
16-16142011-A-G p.Thr411Ala missense ABCC1 1 83176 1.20227E-5 41588 0 NA
16-16142015-A-G p.Asn412Ser missense ABCC1 26 83212 3.12455E-4 41606 0 7.64916E-4
16-16142033-C-T p.Ser418Phe missense ABCC1 1 83276 1.20083E-5 41638 0 3.18492E-5
16-16142037-G-A p.Thr419Thr synonymous ABCC1 1 83292 1.2006E-5 41646 0 3.18552E-5
16-16142040-C-T p.Val420Val synonymous ABCC1 6 83308 7.20219E-5 41654 0 3.18613E-5
16-16142049-T-G p.Ile423Met missense ABCC1 1 83328 1.20008E-5 41664 0 4.00741E-6
16-16142054-A-C p.Asn425Thr missense ABCC1 1 83342 1.19988E-5 41671 0 NA
16-16142055-C-T p.Asn425Asn synonymous ABCC1 2 83340 2.39981E-5 41670 0 NA
16-16142065-G-C p.Val429Leu missense ABCC1 1 83360 1.19962E-5 41680 0 4.00692E-6
16-16142069-A-G p.Asp430Gly missense ABCC1 1 83354 1.1997E-5 41677 0 NA
16-16142070-C-T p.Asp430Asp synonymous ABCC1 1 83358 1.19964E-5 41679 0 3.31203E-5
16-16142072-C-G p.Ala431Gly missense ABCC1 1 83362 1.19959E-5 41681 0 8.2802E-6
16-16142079-G-T p.Arg433Ser missense ABCC1 762 83350 0.00914217 41675 3 0.00938975
16-16142096-C-T p.Thr439Met missense ABCC1 2 83378 2.39871E-5 41689 0 2.48402E-5
16-16142097-G-A p.Thr439Thr synonymous ABCC1 1 83380 1.19933E-5 41690 0 3.31203E-5
16-16142112-C-A p.Ile444Ile synonymous ABCC1 1 83384 1.19927E-5 41692 0 1.60295E-5
16-16142119-G-GC p.Leu449fs frameshift ABCC1 1 83372 1.19944E-5 41686 0 NA
16-16142120-C-T p.Ala447Val missense ABCC1 1 83376 1.19939E-5 41688 0 8.28034E-6
16-16142124-C-A p.Pro448Pro synonymous ABCC1 2 83376 2.39877E-5 41688 0 5.03525E-4
16-16142136-C-G p.Ile452Met missense ABCC1 19 83372 2.27894E-4 41686 0 0.001875
16-16142136-C-A p.Ile452Ile synonymous ABCC1 1 83372 1.19944E-5 41686 0 NA
16-16142151-C-T p.Leu457Leu synonymous ABCC1 1 83348 1.19979E-5 41674 0 NA
16-16142156-G-A p.Trp459* stop_gained ABCC1 1 83336 1.19996E-5 41668 0 NA
16-16142163-G-T c.1380+3G>T splice_region ABCC1 1 83274 1.20085E-5 41637 0 NA
16-16142164-T-G c.1380+4T>G splice_region ABCC1 3 83266 3.60291E-5 41633 0 3.3189E-5
16-16146576-C-G c.1381-5C>G splice_region ABCC1 956 83358 0.0114686 41679 21 0.0175182
16-16146595-C-T p.Ser465Ser synonymous ABCC1 1 83392 1.19916E-5 41696 0 9.55657E-5
16-16146612-C-T p.Ala471Val missense ABCC1 1 83384 1.19927E-5 41692 0 3.18735E-5
16-16146613-G-A p.Ala471Ala synonymous ABCC1 19 83386 2.27856E-4 41693 0 4.73155E-4
16-16146632-C-A p.Pro478Thr missense ABCC1 1 83318 1.20022E-5 41659 0 8.28583E-6
16-16146634-C-T p.Pro478Pro synonymous ABCC1 4 83336 4.79985E-5 41668 0 5.03525E-4
16-16146636-T-C p.Val479Ala missense ABCC1 1 83322 1.20016E-5 41661 0 NA
16-16146644-G-A p.Val482Met missense ABCC1 1 83340 1.1999E-5 41670 0 4.00769E-6
16-16146651-C-T p.Ala484Val missense ABCC1 3 83334 3.59997E-5 41667 0 2.40541E-5
16-16146666-C-T p.Thr489Met missense ABCC1 24 83334 2.87998E-4 41667 0 7.96584E-4
16-16146667-G-A p.Thr489Thr synonymous ABCC1 8 83338 9.59946E-5 41669 0 1.16282E-4
16-16146669-A-T p.Tyr490Phe missense ABCC1 1 83342 1.19988E-5 41671 0 NA
16-16146675-T-TGGCCCACATGAAGAGCAAAGACAATCGGATCAAGCTGATGAACGAAATTCTC c.1473+2_1473+3insGGCCCACATGAAGAGCAAAGACAATCGGATCAAGCTGATGAACGAAATTCTC splice_region ABCC1 8 83316 9.602E-5 41658 4 NA
16-16146680-C-T c.1473+7C>T splice_region ABCC1 1 83286 1.20068E-5 41643 0 1.65843E-5
16-16146681-A-G c.1473+8A>G splice_region ABCC1 1 83278 1.2008E-5 41639 0 NA
16-16149974-A-G p.Asn500Ser missense ABCC1 1 83164 1.20244E-5 41582 0 3.18776E-5
16-16149993-C-T p.Asn506Asn synonymous ABCC1 7 83146 8.41893E-5 41573 0 1.49078E-4
16-16149996-A-G p.Glu507Glu synonymous ABCC1 1 83162 1.20247E-5 41581 0 NA
16-16150004-A-G p.Asn510Ser missense ABCC1 6 83166 7.21449E-5 41583 0 9.56755E-5
16-16150012-A-C p.Lys513Gln missense ABCC1 2 83194 2.40402E-5 41597 0 8.01693E-6
16-16150016-T-G p.Val514Gly missense ABCC1 1 83198 1.20195E-5 41599 0 NA
16-16150023-G-A p.Lys516Lys synonymous ABCC1 1 83230 1.20149E-5 41615 0 NA
16-16150051-G-A p.Asp526Asn missense ABCC1 2 83188 2.40419E-5 41594 0 4.00869E-6
16-16150055-A-G p.Lys527Arg missense ABCC1 1 83202 1.20189E-5 41601 0 NA
16-16150084-A-G p.Lys537Glu missense ABCC1 1 83088 1.20354E-5 41544 0 8.02021E-6
16-16150086-G-C p.Lys537Asn missense ABCC1 1 83104 1.20331E-5 41552 0 1.20304E-5
16-16150114-G-A p.Ala547Thr missense ABCC1 1 82988 1.20499E-5 41494 0 8.3022E-6
16-16150116-C-T p.Ala547Ala synonymous ABCC1 19 82956 2.29037E-4 41478 0 3.82093E-4
16-16150117-G-A p.Val548Met missense ABCC1 1 82956 1.20546E-5 41478 0 NA
16-16150117-G-T p.Val548Leu missense ABCC1 1 82956 1.20546E-5 41478 0 8.30468E-6
16-16150124-C-T p.Thr550Ile missense ABCC1 2 82904 2.41243E-5 41452 0 6.3678E-5
16-16150135-G-A p.Val554Ile missense ABCC1 3 82792 3.62354E-5 41396 0 3.18329E-5
16-16150137-C-T p.Val554Val synonymous ABCC1 1 82774 1.20811E-5 41387 0 8.33056E-6
16-16150143-G-A p.Thr556Thr synonymous ABCC1 1 82612 1.21048E-5 41306 0 3.18512E-5
16-16150154-T-C c.1677+2T>C splice_donor ABCC1 1 82406 1.2135E-5 41203 0 NA
16-16150155-G-A c.1677+3G>A splice_region ABCC1 2 82374 2.42795E-5 41187 0 8.3956E-6
16-16162006-C-T c.1678-7C>T splice_region ABCC1 1 83050 1.20409E-5 41525 0 4.01062E-6
16-16162009-G-T c.1678-4G>T splice_region ABCC1 2 83084 2.4072E-5 41542 0 NA
16-16162019-T-C p.Leu562Leu synonymous ABCC1 66633 82320 0.809439 41160 27028 0.842134
16-16162021-G-C p.Leu562Phe missense ABCC1 1 83216 1.20169E-5 41608 0 NA
16-16162034-G-A p.Val567Ile missense ABCC1 1 83274 1.20085E-5 41637 0 8.27842E-6
16-16162038-A-G p.Tyr568Cys missense ABCC1 2 83284 2.40142E-5 41642 0 NA
16-16162039-C-T p.Tyr568Tyr synonymous ABCC1 6300 83148 0.0757685 41574 285 0.0668727
16-16162047-T-C p.Ile571Thr missense ABCC1 2 83324 2.40027E-5 41662 0 5.03525E-4
16-16162053-A-G p.Glu573Gly missense ABCC1 3 83338 3.5998E-5 41669 0 1.20208E-5
16-16162061-A-T p.Ile576Phe missense ABCC1 1 83362 1.19959E-5 41681 0 4.00676E-6
16-16162072-C-T p.Ala579Ala synonymous ABCC1 2 83366 2.39906E-5 41683 0 NA
16-16162081-C-T p.Ala582Ala synonymous ABCC1 1 83362 1.19959E-5 41681 0 NA
16-16162085-G-T p.Val584Leu missense ABCC1 1 83364 1.19956E-5 41682 0 NA
16-16162085-G-A p.Val584Met missense ABCC1 1 83364 1.19956E-5 41682 0 4.0068E-6
16-16162096-C-T p.Ala587Ala synonymous ABCC1 1 83356 1.19967E-5 41678 0 1.65579E-5
16-16162111-C-T p.Leu592Leu synonymous ABCC1 1 83324 1.20013E-5 41662 0 NA
16-16162113-G-A p.Arg593Gln missense ABCC1 1 83310 1.20034E-5 41655 0 3.18654E-5
16-16162127-A-G p.Ile598Val missense ABCC1 1 83280 1.20077E-5 41640 0 4.00744E-6
16-16162132-C-T p.Leu599Leu synonymous ABCC1 4 83268 4.80377E-5 41634 0 1.20229E-5
16-16162149-G-A p.Ser605Asn missense ABCC1 1 83114 1.20317E-5 41557 0 4.14065E-5
16-16162157-C-G p.Gln608Glu missense+splice_region ABCC1 1 82970 1.20525E-5 41485 0 NA
16-16162160-G-GCGAGTGTCTCCCTCAAACGCCTGAGGATCTTTC c.1824+1_1824+2insCGAGTGTCTCCCTCAAACGCCTGAGGATCTTTC splice_donor ABCC1 2 82922 2.41191E-5 41461 1 NA
16-16162160-G-GCGAGTGTCTCCCTCAAACGCCTGAGGATCTTTCTCTCCCA c.1824+1_1824+2insCGAGTGTCTCCCTCAAACGCCTGAGGATCTTTCTCTCCCA splice_donor ABCC1 1 82924 1.20592E-5 41462 0 NA
16-16162163-C-A c.1824+4C>A splice_region ABCC1 3 82848 3.62109E-5 41424 0 4.14195E-5
16-16162164-A-G c.1824+5A>G splice_region ABCC1 1 82822 1.20741E-5 41411 0 3.19163E-5
16-16162164-A-C c.1824+5A>C splice_region ABCC1 2 82822 2.41482E-5 41411 0 1.27665E-4
16-16165491-C-G c.1825-8C>G splice_region ABCC1 2 83012 2.40929E-5 41506 0 1.88253E-5
16-16165493-G-A c.1825-6G>A splice_region ABCC1 2 83000 2.40964E-5 41500 0 9.55718E-5
16-16165501-G-A p.Ala609Ala splice_region+synonymous ABCC1 1 83056 1.20401E-5 41528 0 1.79414E-5
16-16165515-A-G p.Lys614Arg missense ABCC1 1 83080 1.20366E-5 41540 0 2.61789E-5
16-16165517-C-T p.Arg615Cys missense ABCC1 2 83072 2.40755E-5 41536 0 3.18512E-5
16-16165532-C-T p.Leu620Phe missense ABCC1 1 83100 1.20337E-5 41550 0 NA
16-16165537-C-T p.Ser621Ser synonymous ABCC1 30 83124 3.60907E-4 41562 0 3.18674E-4
16-16165541-G-A p.Glu623Lys missense ABCC1 1 83114 1.20317E-5 41557 0 NA
16-16165564-C-T p.Ile630Ile synonymous ABCC1 3 83084 3.6108E-5 41542 0 1.20621E-5
16-16165565-G-T p.Glu631* stop_gained ABCC1 1 83074 1.20375E-5 41537 0 NA
16-16165571-C-T p.Arg633Trp missense ABCC1 2 83000 2.40964E-5 41500 0 NA
16-16165572-G-A p.Arg633Gln missense ABCC1 158 82986 0.00190394 41493 0 0.00201594
16-16165578-T-A p.Val635Asp missense ABCC1 2 82922 2.41191E-5 41461 0 8.06621E-5
16-16165579-C-A p.Val635Val synonymous ABCC1 19 82912 2.29159E-4 41456 0 5.63264E-5
16-16165585-C-T p.Asp637Asp splice_region+synonymous ABCC1 66 82828 7.96832E-4 41414 1 0.00352823
16-16165586-G-A p.Gly638Ser missense+splice_region ABCC1 2 82822 2.41482E-5 41411 0 4.20256E-6
16-16165586-GGTGT-G c.1912+1_1912+4delGTGT splice_donor ABCC1 1 82822 1.20741E-5 41411 0 NA
16-16165589-G-A c.1912+3G>A splice_region ABCC1 1 82794 1.20782E-5 41397 0 4.18764E-6
16-16170184-C-T p.Gly638Gly splice_region+synonymous ABCC1 1 83016 1.20459E-5 41508 0 3.18756E-5
16-16170185-G-T p.Gly639Trp missense+splice_region ABCC1 6 83030 7.2263E-5 41515 0 6.25E-4
16-16170185-G-A p.Gly639Arg missense+splice_region ABCC1 2 83030 2.40877E-5 41515 0 8.48652E-6
16-16170188-G-T p.Gly640Cys missense ABCC1 12 83002 1.44575E-4 41501 0 6.25E-4
16-16170192-C-T p.Thr641Met missense ABCC1 2 82948 2.41115E-5 41474 0 4.22669E-5
16-16170197-A-G p.Ser643Gly missense ABCC1 3 82966 3.61594E-5 41483 0 1.68725E-5
16-16170205-C-T p.Thr645Thr synonymous ABCC1 2 83012 2.40929E-5 41506 0 6.37105E-5
16-16170208-G-A p.Val646Val synonymous ABCC1 2 83006 2.40946E-5 41503 0 NA
16-16170215-G-A p.Ala649Thr missense ABCC1 1 83016 1.20459E-5 41508 0 3.18573E-5
16-16170231-C-T p.Ala654Val missense ABCC1 2 82924 2.41185E-5 41462 0 2.55672E-5
16-16170232-C-T p.Ala654Ala synonymous ABCC1 3 82950 3.61664E-5 41475 0 4.05476E-6
16-16170238-C-T p.Ser656Ser synonymous ABCC1 6 82878 7.23956E-5 41439 0 6.25E-4
16-16170242-C-T p.Pro658Ser missense ABCC1 1 82868 1.20674E-5 41434 0 8.59107E-6
16-16170243-C-T p.Pro658Leu missense ABCC1 1 82888 1.20645E-5 41444 0 NA
16-16170246-C-T p.Pro659Leu missense ABCC1 1 82848 1.20703E-5 41424 0 NA
16-16170251-C-G p.Leu661Val missense ABCC1 1 82818 1.20747E-5 41409 0 NA
16-16170255-A-G p.Asn662Ser missense ABCC1 2 82780 2.41604E-5 41390 0 6.37105E-5
16-16170258-G-GCATCACCTTCTCCATCCCCGAAGGTGCTTTGGTGGCCGTGGTGGGCCAGGT c.1988_1988+1insCATCACCTTCTCCATCCCCGAAGGTGCTTTGGTGGCCGTGGTGGGCCAGGT splice_donor ABCC1 2 82776 2.41616E-5 41388 1 NA
16-16170265-C-T c.1988+7C>T splice_region ABCC1 12 82630 1.45226E-4 41315 0 9.55536E-5
16-16170266-G-A c.1988+8G>A splice_region ABCC1 4 82592 4.84308E-5 41296 0 2.7171E-5
16-16173201-C-T c.1989-8C>T splice_region ABCC1 2 82996 2.40975E-5 41498 0 3.18593E-5
16-16173202-G-A c.1989-7G>A splice_region ABCC1 17 83022 2.04765E-4 41511 0 2.69449E-4
16-16173221-C-T p.Ser667Ser synonymous ABCC1 1159 83146 0.0139393 41573 13 0.0162205
16-16173227-C-T p.Pro669Pro synonymous ABCC1 47 83210 5.64836E-4 41605 0 0.00240373
16-16173228-G-A p.Glu670Lys missense ABCC1 3 83196 3.60594E-5 41598 0 3.18552E-5
16-16173232-G-T p.Gly671Val missense ABCC1 3452 83120 0.0415303 41560 92 0.0393049
16-16173237-T-C p.Leu673Leu synonymous ABCC1 8 83206 9.61469E-5 41603 0 1.27502E-4
16-16173245-C-A p.Ala675Ala synonymous ABCC1 8 83198 9.61562E-5 41599 0 2.86825E-4
16-16173246-G-A p.Val676Met missense ABCC1 1 83194 1.20201E-5 41597 0 3.18613E-5
16-16173256-A-C p.Gln679Pro missense ABCC1 2 83192 2.40408E-5 41596 0 2.40285E-4
16-16173267-G-A p.Gly683Arg missense ABCC1 1 83122 1.20305E-5 41561 0 8.28761E-6
16-16173275-G-A p.Ser685Ser synonymous ABCC1 1 83038 1.20427E-5 41519 0 8.29009E-6
16-16173293-C-T p.Leu691Leu synonymous ABCC1 1 82760 1.20831E-5 41380 0 1.66058E-5
16-16173297-G-A p.Ala693Thr missense ABCC1 1 82680 1.20948E-5 41340 0 8.30634E-6
16-16173303-A-G p.Met695Val missense ABCC1 1 82576 1.21101E-5 41288 0 NA
16-16173323-C-T p.His701His synonymous ABCC1 4 81784 4.89093E-5 40892 0 5.04032E-4
16-16173330-A-C p.Ile704Leu missense ABCC1 1 81144 1.23238E-5 40572 0 NA
16-16173335-G-GGTAGGA c.2115_2115+1insGTAGGA splice_donor ABCC1 110 80782 0.00136169 40391 0 0.00131984
16-16173336-G-GGC c.2115+1_2115+2insGC splice_donor ABCC1 1 80674 1.23956E-5 40337 0 NA
16-16177217-A-C c.2116-6A>C splice_region ABCC1 2 82726 2.41762E-5 41363 0 8.35813E-6
16-16177224-G-A p.Gly706Asp missense+splice_region ABCC1 2 82804 2.41534E-5 41402 0 NA
16-16177225-C-A p.Gly706Gly splice_region+synonymous ABCC1 1 82818 1.20747E-5 41409 0 NA
16-16177228-C-T p.Ser707Ser synonymous ABCC1 3 82834 3.6217E-5 41417 0 1.20407E-5
16-16177229-G-A p.Val708Met missense ABCC1 2 82884 2.41301E-5 41442 0 2.49476E-5
16-16177231-G-C p.Val708Val synonymous ABCC1 2 82936 2.4115E-5 41468 0 8.31006E-6
16-16177255-G-A p.Trp716* stop_gained ABCC1 1 83090 1.20351E-5 41545 0 NA
16-16177265-G-A p.Asp720Asn missense ABCC1 3 83162 3.60742E-5 41581 0 2.4045E-5
16-16177271-C-G p.Leu722Val missense ABCC1 1 83202 1.20189E-5 41601 0 4.00731E-6
16-16177275-G-A p.Arg723Gln missense ABCC1 1092 83180 0.0131282 41590 20 0.023483
16-16177294-A-G p.Gly729Gly synonymous ABCC1 2 83254 2.40229E-5 41627 0 NA
16-16177297-T-G p.Cys730Trp missense ABCC1 1 83244 1.20129E-5 41622 0 NA
16-16177300-G-C p.Gln731His missense ABCC1 9 83252 1.08106E-4 41626 0 1.15938E-4
16-16177312-A-G p.Pro735Pro synonymous ABCC1 1 83264 1.201E-5 41632 0 3.1837E-5
16-16177313-T-C p.Tyr736His missense ABCC1 1 83266 1.20097E-5 41633 0 NA
16-16177322-T-A p.Ser739Thr missense ABCC1 1 83256 1.20111E-5 41628 0 NA
16-16177324-C-T p.Ser739Ser synonymous ABCC1 3 83252 3.60352E-5 41626 0 1.24219E-4
16-16177325-G-A p.Val740Met missense ABCC1 3 83246 3.60378E-5 41623 0 3.1837E-5
16-16177328-A-G p.Ile741Val missense ABCC1 1 83264 1.201E-5 41632 0 NA
16-16177336-C-G p.Ala743Ala synonymous ABCC1 1 83252 1.20117E-5 41626 0 NA
16-16177342-C-A p.Ala745Ala synonymous ABCC1 1 83226 1.20155E-5 41613 0 1.60304E-5
16-16177350-C-G p.Pro748Arg missense ABCC1 1 83212 1.20175E-5 41606 0 4.96952E-5
16-16177351-A-T p.Pro748Pro synonymous ABCC1 2 83198 2.4039E-5 41599 0 1.27389E-4
16-16177379-C-T p.Arg758Trp missense ABCC1 2 82952 2.41103E-5 41476 0 4.14821E-5
16-16177380-G-A p.Arg758Gln missense ABCC1 1 82914 1.20607E-5 41457 0 2.80838E-5
16-16177380-G-C p.Arg758Pro missense ABCC1 1 82914 1.20607E-5 41457 0 NA
16-16177381-G-C p.Arg758Arg synonymous ABCC1 1 82916 1.20604E-5 41458 0 1.60503E-5
16-16177393-C-T p.Gly762Gly synonymous ABCC1 43 82556 5.20859E-4 41278 1 0.00127389
16-16177399-G-GGGCGTGAACCT c.2292_2292+1insGGCGTGAACCT splice_donor ABCC1 1 82372 1.214E-5 41186 0 NA
16-16177407-T-A c.2292+8T>A splice_region ABCC1 1 81770 1.22294E-5 40885 0 4.03454E-6
16-16180683-C-T p.Gly765Gly splice_region+synonymous ABCC1 1 82362 1.21415E-5 41181 0 8.37339E-6
16-16180710-G-A p.Gln774Gln synonymous ABCC1 1 82922 1.20595E-5 41461 0 NA
16-16180712-G-A p.Arg775His missense ABCC1 1 82918 1.20601E-5 41459 0 3.32447E-5
16-16180713-C-T p.Arg775Arg synonymous ABCC1 8 82932 9.64646E-5 41466 0 4.15462E-5
16-16180724-C-G p.Ala779Gly missense ABCC1 1 83060 1.20395E-5 41530 0 3.1841E-5
16-16180731-C-T p.Ala781Ala synonymous ABCC1 3 83108 3.60976E-5 41554 0 3.18431E-5
16-16180732-G-A p.Val782Met missense ABCC1 4 83132 4.81162E-5 41566 0 4.40546E-5
16-16180740-C-T p.Ser784Ser synonymous ABCC1 2 83208 2.40361E-5 41604 0 4.00458E-6
16-16180742-A-G p.Asn785Ser missense ABCC1 1 83220 1.20163E-5 41610 0 NA
16-16180743-C-T p.Asn785Asn synonymous ABCC1 1 83224 1.20158E-5 41612 0 3.1839E-5
16-16180744-G-A p.Ala786Thr missense ABCC1 3 83218 3.60499E-5 41609 0 6.3678E-5
16-16180750-A-G p.Ile788Val missense ABCC1 1 83242 1.20132E-5 41621 0 8.40962E-5
16-16180755-C-T p.Tyr789Tyr synonymous ABCC1 1 83242 1.20132E-5 41621 0 4.00497E-6
16-16180761-C-T p.Phe791Phe synonymous ABCC1 2 83248 2.40246E-5 41624 0 7.61041E-5
16-16180767-T-C p.Asp793Asp synonymous ABCC1 1 83238 1.20137E-5 41619 0 1.27364E-4
16-16180774-T-A p.Ser796Thr missense ABCC1 1 83230 1.20149E-5 41615 0 NA
16-16180781-T-C p.Val798Ala missense ABCC1 2 83210 2.40356E-5 41605 0 NA
16-16180794-G-A p.Val802Val synonymous ABCC1 2 83154 2.40518E-5 41577 0 NA
16-16180794-G-T p.Val802Val synonymous ABCC1 2 83154 2.40518E-5 41577 0 NA
16-16180819-A-G p.Ile811Val missense ABCC1 1 82968 1.20528E-5 41484 0 NA
16-16180825-C-T p.Pro813Ser missense ABCC1 2 82902 2.41249E-5 41451 0 NA
16-16180829-A-AGGGGATGCTGAAGAACAAG p.His801fs frameshift ABCC1 3 82842 3.62135E-5 41421 0 NA
16-16180833-G-T p.Gly815Gly synonymous ABCC1 1 82782 1.20799E-5 41391 0 NA
16-16180833-G-A p.Gly815Gly synonymous ABCC1 2 82782 2.41598E-5 41391 0 8.33014E-6
16-16180839-G-A p.Leu817Leu synonymous ABCC1 1 82618 1.21039E-5 41309 0 8.34766E-6
16-16180847-A-AGACGCGGATCTT p.Glu808_Asn809insArgGlySerTer stop_gained ABCC1 1 82494 1.21221E-5 41247 0 NA
16-16184264-G-A p.Thr821Thr splice_region+synonymous ABCC1 1 82272 1.21548E-5 41136 0 8.44887E-6
16-16184266-G-A p.Arg822Gln missense ABCC1 1 82406 1.2135E-5 41203 0 NA
16-16184279-G-A p.Thr826Thr synonymous ABCC1 2 82622 2.42066E-5 41311 0 5.05051E-4
16-16184282-C-T p.His827His synonymous ABCC1 1 82718 1.20893E-5 41359 0 1.22348E-5
16-16184283-A-G p.Ser828Gly missense ABCC1 2 82708 2.41815E-5 41354 0 NA
16-16184289-A-C p.Ser830Arg missense ABCC1 1 82810 1.20758E-5 41405 0 8.10714E-6
16-16184293-A-G p.Tyr831Cys missense ABCC1 4 82844 4.82835E-5 41422 1 6.06718E-5
16-16184298-C-G p.Pro833Ala missense ABCC1 1 82862 1.20683E-5 41431 0 NA
16-16184299-C-T p.Pro833Leu missense ABCC1 1 82870 1.20671E-5 41435 0 8.64513E-6
16-16184300-G-A p.Pro833Pro synonymous ABCC1 1 82840 1.20715E-5 41420 0 2.5875E-5
16-16184303-G-C p.Gln834His missense ABCC1 2 82878 2.41319E-5 41439 0 NA
16-16184309-C-T p.Asp836Asp synonymous ABCC1 6 82914 7.23641E-5 41457 0 3.1837E-5
16-16184313-A-G p.Ile838Val missense ABCC1 2 82974 2.41039E-5 41487 0 5.05051E-4
16-16184314-T-C p.Ile838Thr missense ABCC1 1 82980 1.20511E-5 41490 0 6.36862E-5
16-16184316-A-G p.Ile839Val missense ABCC1 1 82988 1.20499E-5 41494 0 NA
16-16184318-C-T p.Ile839Ile synonymous ABCC1 1 82982 1.20508E-5 41491 0 3.38158E-5
16-16184321-C-G p.Val840Val synonymous ABCC1 1 82996 1.20488E-5 41498 0 3.1841E-5
16-16184323-T-C p.Met841Thr missense ABCC1 2 83010 2.40935E-5 41505 0 3.18309E-5
16-16184324-G-C p.Met841Ile missense ABCC1 1 83014 1.20462E-5 41507 0 NA
16-16184330-C-T p.Gly843Gly synonymous ABCC1 3 82922 3.61786E-5 41461 0 6.36821E-5
16-16184331-G-A p.Gly844Ser missense ABCC1 23 82938 2.77316E-4 41469 0 1.85635E-4
16-16184345-G-A p.Glu848Glu synonymous ABCC1 1 82798 1.20776E-5 41399 0 NA
16-16184354-C-G p.Ser851Ser synonymous ABCC1 1 82878 1.20659E-5 41439 0 NA
16-16184357-C-A p.Tyr852* stop_gained ABCC1 1 82866 1.20677E-5 41433 0 4.01945E-6
16-16184361-G-C p.Glu854Gln missense ABCC1 7 82852 8.4488E-5 41426 0 2.52521E-5
16-16184366-G-T p.Leu855Leu synonymous ABCC1 231 82844 0.00278837 41422 1 0.00958628
16-16184369-G-C p.Leu856Leu synonymous ABCC1 1 82886 1.20648E-5 41443 0 NA
16-16184373-C-T p.Arg858* stop_gained ABCC1 1 82828 1.20732E-5 41414 0 4.02275E-6
16-16184374-G-A p.Arg858Gln missense ABCC1 1 82742 1.20858E-5 41371 0 1.68816E-5
16-16184378-C-T p.Asp859Asp synonymous ABCC1 3 82774 3.62433E-5 41387 0 2.81667E-5
16-16184379-G-A p.Gly860Ser missense ABCC1 1 82772 1.20814E-5 41386 0 3.18471E-5
16-16184381-C-T p.Gly860Gly synonymous ABCC1 2 82738 2.41727E-5 41369 0 8.44409E-6
16-16184384-C-T p.Ala861Ala synonymous ABCC1 1 82796 1.20779E-5 41398 0 1.77299E-4
16-16184387-C-T p.Phe862Phe synonymous ABCC1 2 82818 2.41493E-5 41409 0 3.62158E-5
16-16184397-C-T p.Leu866Leu synonymous ABCC1 1 82908 1.20616E-5 41454 0 3.18532E-5
16-16184400-C-T p.Arg867Cys missense ABCC1 10 82866 1.20677E-4 41433 0 6.37146E-5
16-16184401-G-A p.Arg867His missense ABCC1 3 82874 3.61995E-5 41437 0 1.20802E-5
16-16184403-A-T p.Thr868Ser missense ABCC1 1 82862 1.20683E-5 41431 0 4.02826E-6
16-16184417-A-G p.Thr872Thr synonymous ABCC1 1 82842 1.20712E-5 41421 0 4.06326E-6
16-16184446-G-GGGTCACGGGCGTCAGCGGTCCAGGGAAGGAAGCAAAGCAAA c.2644+1_2644+2insGGTCACGGGCGTCAGCGGTCCAGGGAAGGAAGCAAAGCAAA splice_donor ABCC1 1 82366 1.21409E-5 41183 0 NA
16-16184447-TAG-T c.2644+3_2644+4delAG splice_region ABCC1 1 82294 1.21516E-5 41147 0 NA
16-16184450-G-T c.2644+5G>T splice_region ABCC1 1 82232 1.21607E-5 41116 0 NA
16-16192735-A-T p.Thr884Ser missense ABCC1 3 77604 3.86578E-5 38802 0 3.18552E-5
16-16192742-T-C p.Met886Thr missense ABCC1 1 77600 1.28866E-5 38800 0 8.86635E-6
16-16192746-C-T p.Asp887Asp synonymous ABCC1 143 77590 0.00184302 38795 1 0.004375
16-16192757-C-T p.Ala891Val missense+splice_region ABCC1 2 77602 2.57725E-5 38801 0 6.25E-4
16-16192759-G-C p.Gly892Arg missense+splice_region ABCC1 1 77598 1.28869E-5 38799 0 8.71802E-6
16-16192767-C-T c.2674+8C>T splice_region ABCC1 7 77594 9.02132E-5 38797 0 6.20688E-5
16-16196481-C-T c.2645-3C>T splice_region ABCC1 1 81626 1.2251E-5 40813 0 5.31881E-6
16-16196488-C-T p.Val883Val synonymous ABCC1 4 81660 4.89836E-5 40830 0 NA
16-16196490-C-T p.Thr884Met missense ABCC1 4 81662 4.89824E-5 40831 0 0.00253293
16-16196491-G-A p.Thr884Thr synonymous ABCC1 1 81648 1.22477E-5 40824 0 7.15973E-5
16-16196493-G-T p.Gly885Val missense ABCC1 2 81668 2.44894E-5 40834 0 3.48359E-5
16-16196494-C-T p.Gly885Gly synonymous ABCC1 288 81662 0.00352673 40831 4 0.00754921
16-16196495-G-A p.Val886Ile missense ABCC1 4 81688 4.89668E-5 40844 0 6.25E-4
16-16196497-C-T p.Val886Val synonymous ABCC1 4 81686 4.8968E-5 40843 0 0.00312142
16-16196498-A-T p.Ser887Cys missense ABCC1 1 81698 1.22402E-5 40849 0 4.96559E-6
16-16196500-C-T p.Ser887Ser synonymous ABCC1 3 81700 3.67197E-5 40850 0 2.60671E-4
16-16196501-G-A p.Gly888Ser missense ABCC1 1 81692 1.22411E-5 40846 0 3.18492E-5
16-16196514-A-C p.Glu892Ala missense ABCC1 1 81738 1.22342E-5 40869 0 8.62515E-5
16-16196515-A-G p.Glu892Glu synonymous ABCC1 1 81740 1.22339E-5 40870 0 NA
16-16196532-A-G p.Asn898Ser missense ABCC1 1 81734 1.22348E-5 40867 0 6.37349E-5
16-16196533-T-C p.Asn898Asn synonymous ABCC1 8 81730 9.78833E-5 40865 0 8.02302E-4
16-16196534-G-A p.Gly899Ser missense ABCC1 2 81732 2.44702E-5 40866 0 NA
16-16196540-C-T p.Leu1? initiator_codon+non_canonical_start_codon ABCC1 2 81702 2.44792E-5 40851 0 NA
16-16196547-C-T p.Thr903Met missense ABCC1 2 81664 2.44906E-5 40832 0 1.47452E-5
16-16196548-G-A p.Thr903Thr synonymous ABCC1 2 81658 2.44924E-5 40829 0 1.14338E-4
16-16196553-G-C p.Ser905Thr missense ABCC1 2 81684 2.44846E-5 40842 0 5.75076E-5
16-16196568-T-C p.Leu910Pro missense ABCC1 2 81576 2.4517E-5 40788 0 1.07594E-5
16-16196570-C-G p.Gln911Glu missense ABCC1 1 81558 1.22612E-5 40779 0 NA
16-16196575-G-A c.2735+1G>A splice_donor ABCC1 1 81516 1.22675E-5 40758 0 NA
16-16196582-C-T c.2735+8C>T splice_region ABCC1 1 81390 1.22865E-5 40695 0 9.5645E-5
16-16199255-A-G c.36-2A>G splice_acceptor ABCC1 6 16 0.375 8 1 0.526316
16-16200582-T-TTTGCTTCTCCAGACAGCTCAGCAGCTCCTCCTCCTA p.Tyr920_Ser921insCysPheSerArgGlnLeuSerSerSerSerSerTyr conservative_inframe_insertion ABCC1 1 82142 1.2174E-5 41071 0 8.31338E-6
16-16200601-C-T p.Leu914Leu synonymous ABCC1 1 82482 1.21239E-5 41241 0 NA
16-16200604-C-T p.Ser915Ser synonymous ABCC1 1 82504 1.21206E-5 41252 0 NA
16-16200610-C-T p.Ser917Ser synonymous ABCC1 3 82588 3.63249E-5 41294 0 3.18735E-5
16-16200621-G-C p.Ser921Thr missense ABCC1 1 82730 1.20875E-5 41365 0 NA
16-16200631-C-T p.Ile924Ile synonymous ABCC1 1 82782 1.20799E-5 41391 0 NA
16-16200645-A-G p.Asn929Ser missense ABCC1 3 82876 3.61987E-5 41438 0 3.18695E-5
16-16200652-C-T p.Thr931Thr synonymous ABCC1 7 82894 8.44452E-5 41447 0 1.27494E-4
16-16200653-G-A p.Ala932Thr missense ABCC1 3 82906 3.61856E-5 41453 0 3.18735E-5
16-16200654-C-T p.Ala932Val missense ABCC1 3 82928 3.6176E-5 41464 0 3.31411E-5
16-16200667-A-G p.Lys936Lys synonymous ABCC1 8 82900 9.65018E-5 41450 0 1.27421E-4
16-16200674-G-C p.Ala939Pro missense ABCC1 4 82842 4.82847E-5 41421 0 2.56822E-4
16-16200676-CAAG-C p.Lys941del conservative_inframe_deletion ABCC1 1 82876 1.20662E-5 41438 0 1.65689E-5
16-16200680-A-G p.Lys941Glu missense ABCC1 3 82858 3.62065E-5 41429 0 1.20276E-5
16-16200681-A-G p.Lys941Arg missense ABCC1 1 82850 1.207E-5 41425 0 8.28555E-6
16-16200688-G-T p.Glu943Asp missense ABCC1 2 82770 2.41633E-5 41385 0 2.15442E-4
16-16200690-C-T p.Thr944Ile missense ABCC1 1 82754 1.2084E-5 41377 0 4.00975E-6
16-16200690-C-G p.Thr944Ser missense ABCC1 2 82754 2.4168E-5 41377 0 NA
16-16200701-A-T p.Met948Leu missense ABCC1 1 82660 1.20978E-5 41330 0 4.01033E-6
16-16200703-G-A p.Met948Ile missense ABCC1 1 82616 1.21042E-5 41308 0 3.18451E-5
16-16200706-G-A p.Glu949Glu synonymous ABCC1 2 82574 2.42207E-5 41287 0 8.28789E-5
16-16200716-G-C p.Ala953Pro missense ABCC1 146 82372 0.00177245 41186 0 0.00101112
16-16200718-G-A p.Ala953Ala synonymous ABCC1 2 82310 2.42984E-5 41155 0 5.62091E-5
16-16205236-A-G p.Lys959Arg missense ABCC1 15 83168 1.80358E-4 41584 0 0.00125
16-16205244-G-A p.Val962Met missense ABCC1 2 83210 2.40356E-5 41605 0 1.65629E-5
16-16205246-G-A p.Val962Val synonymous ABCC1 1 83232 1.20146E-5 41616 0 4.00728E-6
16-16205248-AC-A p.Trp964fs frameshift ABCC1 1 83230 1.20149E-5 41615 0 NA
16-16205259-A-G p.Met967Val missense ABCC1 1 83280 1.20077E-5 41640 0 NA
16-16205270-C-T p.Ile970Ile synonymous ABCC1 6 83332 7.20012E-5 41666 0 6.25E-4
16-16205271-G-A p.Gly971Arg missense ABCC1 2 83336 2.39992E-5 41668 0 NA
16-16205284-C-T p.Ser975Phe missense ABCC1 1 83364 1.19956E-5 41682 0 NA
16-16205288-C-T p.Phe976Phe synonymous ABCC1 1 83358 1.19964E-5 41679 0 4.00657E-6
16-16205289-C-T p.Leu977Phe missense ABCC1 1 83360 1.19962E-5 41680 0 2.40398E-5
16-16205298-T-A p.Phe980Ile missense ABCC1 1 83366 1.19953E-5 41683 0 3.18492E-5
16-16205302-T-C p.Leu981Pro missense ABCC1 1 83370 1.19947E-5 41685 0 3.18573E-5
16-16205306-C-T p.Phe982Phe synonymous ABCC1 1 83352 1.19973E-5 41676 0 3.31186E-5
16-16205307-A-G p.Met983Val missense ABCC1 1 83358 1.19964E-5 41679 0 3.18796E-5
16-16205315-C-T p.Asn985Asn synonymous ABCC1 1 83350 1.19976E-5 41675 0 4.0066E-6
16-16205318-T-C n.1198T>C splice_region ABCC1 60 83350 7.19856E-4 41675 1 0.00165584
16-16205324-C-T p.Ser988Ser synonymous ABCC1 7 83338 8.39953E-5 41669 0 1.27372E-4
16-16205325-G-A p.Ala989Thr missense ABCC1 38 83330 4.56018E-4 41665 0 3.8865E-4
16-16205326-C-T p.Ala989Val missense ABCC1 2 83334 2.39998E-5 41667 0 1.65599E-5
16-16205327-G-A p.Ala989Ala synonymous ABCC1 7 83342 8.39913E-5 41671 0 1.59297E-4
16-16205327-G-T p.Ala989Ala synonymous ABCC1 1 83342 1.19988E-5 41671 0 8.27979E-6
16-16205338-A-G p.Asn993Ser missense ABCC1 2 83318 2.40044E-5 41659 0 9.55901E-5
16-16205373-G-A p.Val1005Ile missense ABCC1 3 83214 3.60516E-5 41607 0 5.03525E-4
16-16205377-A-G p.Asn1006Ser missense ABCC1 5 83196 6.0099E-5 41598 0 1.27397E-4
16-16205378-C-T p.Asn1006Asn synonymous ABCC1 34 83190 4.08703E-4 41595 0 0.00152876
16-16205379-G-A p.Gly1007Arg missense ABCC1 40 83180 4.80885E-4 41590 0 5.41298E-4
16-16205403-C-T p.Arg1015Trp missense ABCC1 1 83062 1.20392E-5 41531 0 8.02066E-6
16-16205411-C-T p.Ser1017Ser synonymous ABCC1 5 82870 6.03355E-5 41435 0 3.21076E-5
16-16205412-G-A p.Val1018Ile missense ABCC1 2 82838 2.41435E-5 41419 0 8.39391E-6
16-16205416-A-G p.Tyr1019Cys missense ABCC1 1 82762 1.20828E-5 41381 0 4.01448E-5
16-16205425-T-A p.Leu1022Gln missense ABCC1 1 82474 1.2125E-5 41237 0 NA
16-16205440-G-GGATCGCCGTGT c.3079+1_3079+2insGATCGCCGTGT splice_donor ABCC1 1 81934 1.22049E-5 40967 0 NA
16-16208621-A-G c.3080-2A>G splice_acceptor ABCC1 1 81178 1.23186E-5 40589 0 NA
16-16208627-C-T p.Ile1028Ile synonymous ABCC1 2 81236 2.46196E-5 40618 0 9.10852E-5
16-16208629-C-T p.Ala1029Val missense ABCC1 1 81288 1.23019E-5 40644 0 NA
16-16208631-G-A p.Val1030Met missense ABCC1 1 81480 1.2273E-5 40740 0 3.18471E-5
16-16208651-C-T p.Ala1036Ala synonymous ABCC1 2 81864 2.44308E-5 40932 0 3.39553E-5
16-16208652-G-A p.Val1037Met missense ABCC1 1 81916 1.22076E-5 40958 0 1.694E-5
16-16208660-C-T p.Ile1039Ile synonymous ABCC1 19 82100 2.31425E-4 41050 0 3.36978E-5
16-16208663-G-T p.Gly1040Gly synonymous ABCC1 44 82168 5.35488E-4 41084 1 3.19659E-4
16-16208663-G-A p.Gly1040Gly synonymous ABCC1 1 82168 1.21702E-5 41084 0 8.38982E-6
16-16208670-T-C p.Leu1043Leu synonymous ABCC1 1 82294 1.21516E-5 41147 0 NA
16-16208683-G-C p.Cys1047Ser missense ABCC1 540 82350 0.00655738 41175 15 0.0157305
16-16208683-G-T p.Cys1047Phe missense ABCC1 1 82362 1.21415E-5 41181 0 NA
16-16208683-G-A p.Cys1047Tyr missense ABCC1 1 82362 1.21415E-5 41181 0 3.18431E-5
16-16208690-C-T p.His1049His synonymous ABCC1 9 82464 1.09139E-4 41232 0 6.37064E-5
16-16208691-G-A p.Val1050Met missense ABCC1 2 82496 2.42436E-5 41248 0 1.20924E-5
16-16208706-A-C p.Ser1055Arg missense ABCC1 1 82764 1.20825E-5 41382 0 NA
16-16208707-G-T p.Ser1055Ile missense ABCC1 5 82754 6.042E-5 41377 0 NA
16-16208711-C-A p.Ile1056Ile synonymous ABCC1 1 82828 1.20732E-5 41414 0 NA
16-16208714-G-A p.Leu1057Leu synonymous ABCC1 344 82858 0.00415168 41429 2 0.0036175
16-16208715-C-T p.Arg1058Trp missense ABCC1 7 82824 8.45166E-5 41412 0 5.03719E-5
16-16208738-G-C p.Glu1065Asp missense ABCC1 1 82986 1.20502E-5 41493 0 3.18451E-5
16-16208739-C-T p.Arg1066Trp missense ABCC1 129 83006 0.0015541 41503 1 0.00654582
16-16208740-G-A p.Arg1066Gln missense ABCC1 2 83022 2.409E-5 41511 0 6.37064E-5
16-16208765-C-T p.Asn1074Asn synonymous ABCC1 1 83132 1.20291E-5 41566 0 NA
16-16208766-C-T p.Arg1075Cys missense ABCC1 4 83134 4.81151E-5 41567 0 8.42744E-6
16-16208767-G-A p.Arg1075His missense ABCC1 1 83146 1.2027E-5 41573 0 NA
16-16208771-C-T p.Phe1076Phe synonymous ABCC1 2 83154 2.40518E-5 41577 0 8.41609E-6
16-16208776-A-G p.Lys1078Arg missense ABCC1 1 83174 1.2023E-5 41587 0 6.36983E-5
16-16208780-G-T p.Glu1079Asp missense ABCC1 1 83188 1.2021E-5 41594 0 4.01674E-6
16-16208799-A-G p.Met1086Val missense ABCC1 30 83160 3.6075E-4 41580 0 0.001875
16-16208811-GTCA-G p.Ile1091del disruptive_inframe_deletion ABCC1 1 83130 1.20294E-5 41565 0 8.35031E-6
16-16208814-A-G p.Ile1091Val missense ABCC1 1 83134 1.20288E-5 41567 0 NA
16-16208826-A-G p.Met1095Val missense ABCC1 1 83122 1.20305E-5 41561 0 NA
16-16208834-C-T p.Ser1097Ser synonymous ABCC1 4 83108 4.81301E-5 41554 0 4.98662E-5
16-16208834-C-G p.Ser1097Ser synonymous ABCC1 1 83108 1.20325E-5 41554 0 NA
16-16208837-G-A p.Leu1098Leu synonymous ABCC1 1 83124 1.20302E-5 41562 0 NA
16-16208843-C-T p.Asn1100Asn synonymous ABCC1 1 83126 1.20299E-5 41563 0 3.32138E-5
16-16208846-C-T p.Val1101Val synonymous ABCC1 2 83146 2.40541E-5 41573 0 NA
16-16208848-T-C p.Ile1102Thr missense ABCC1 2 83146 2.40541E-5 41573 0 5.03525E-4
16-16208851-G-A p.Gly1103Asp missense ABCC1 69 83124 8.30085E-4 41562 0 0.00110372
16-16208858-C-T p.Cys1105Cys synonymous ABCC1 2 83124 2.40604E-5 41562 0 8.29655E-6
16-16208860-T-C p.Ile1106Thr missense ABCC1 12 83138 1.44338E-4 41569 0 1.4103E-4
16-16208861-C-T p.Ile1106Ile synonymous ABCC1 2 83140 2.40558E-5 41570 0 8.29559E-6
16-16208862-G-A p.Val1107Ile missense ABCC1 1 83144 1.20273E-5 41572 0 NA
16-16208867-C-T p.Ile1108Ile synonymous ABCC1 4 83158 4.81012E-5 41579 0 8.01558E-6
16-16208879-G-A p.Thr1112Thr synonymous ABCC1 5 83046 6.02076E-5 41523 0 4.00837E-5
16-16208879-G-T p.Thr1112Thr synonymous ABCC1 1 83046 1.20415E-5 41523 0 8.01674E-6
16-16208885-C-T p.Ile1114Ile synonymous ABCC1 8 83042 9.63368E-5 41521 0 0.00151057
16-16208885-C-A p.Ile1114Ile synonymous ABCC1 1 83042 1.20421E-5 41521 0 2.8059E-5
16-16208886-G-A p.Ala1115Thr missense ABCC1 3 83014 3.61385E-5 41507 0 1.65948E-5
16-16208887-C-T p.Ala1115Val missense ABCC1 3 83048 3.61237E-5 41524 0 6.37024E-5
16-16208888-C-T p.Ala1115Ala synonymous ABCC1 2 83046 2.4083E-5 41523 0 2.405E-5
16-16208889-G-A p.Ala1116Thr missense ABCC1 103 83034 0.00124046 41517 0 0.00302115
16-16208889-G-T p.Ala1116Ser missense ABCC1 1 83034 1.20433E-5 41517 0 NA
16-16208890-C-T p.Ala1116Val missense ABCC1 2 83030 2.40877E-5 41515 0 3.18431E-5
16-16208900-C-T p.Ile1119Ile synonymous ABCC1 1 82954 1.20549E-5 41477 0 NA
16-16208902-C-T p.Pro1120Leu missense ABCC1 2 82930 2.41167E-5 41465 0 1.66168E-5
16-16208903-G-A p.Pro1120Pro synonymous ABCC1 3 82896 3.61899E-5 41448 0 3.18492E-5
16-16208923-T-A p.Phe1127Tyr missense ABCC1 1 82498 1.21215E-5 41249 0 NA
16-16208928-G-A p.Val1129Ile missense ABCC1 125 82362 0.00151769 41181 0 0.0025
16-16208941-G-A c.3390+8G>A splice_region ABCC1 65 82052 7.92181E-4 41026 1 0.00337472
16-16215824-T-C c.3391-8T>C splice_region ABCC1 3 82104 3.6539E-5 41052 0 3.18613E-5
16-16215827-C-T c.3391-5C>T splice_region ABCC1 1 82172 1.21696E-5 41086 0 NA
16-16215829-C-T c.3391-3C>T splice_region ABCC1 1 82210 1.2164E-5 41105 0 4.02836E-6
16-16215841-G-A p.Val1134Met missense ABCC1 1 82362 1.21415E-5 41181 0 3.18532E-5
16-16215854-G-A p.Arg1138Gln missense ABCC1 2 82468 2.42518E-5 41234 0 4.0201E-6
16-16215870-C-T p.Leu1143Leu synonymous ABCC1 2 82762 2.41657E-5 41381 0 2.49551E-5
16-16215876-G-A p.Ser1145Ser synonymous ABCC1 7 82862 8.44778E-5 41431 0 4.15386E-5
16-16215876-G-C p.Ser1145Ser synonymous ABCC1 1 82862 1.20683E-5 41431 0 NA
16-16215877-G-A p.Val1146Ile missense ABCC1 190 82884 0.00229236 41442 2 0.00531949
16-16215884-G-A p.Arg1148His missense ABCC1 5 82956 6.02729E-5 41478 0 3.18573E-5
16-16215885-C-T p.Arg1148Arg synonymous ABCC1 1 82980 1.20511E-5 41490 0 6.25E-4
16-16215890-C-T p.Pro1150Leu missense ABCC1 1 83078 1.20369E-5 41539 0 4.00917E-6
16-16215891-G-A p.Pro1150Pro synonymous ABCC1 4 83092 4.81394E-5 41546 0 1.65859E-5
16-16215896-A-C p.Tyr1152Ser missense ABCC1 3 83192 3.60612E-5 41596 0 3.18878E-5
16-16215907-A-C p.Asn1156His missense ABCC1 1 83280 1.20077E-5 41640 0 NA
16-16215908-A-G p.Asn1156Ser missense ABCC1 1 83286 1.20068E-5 41643 0 NA
16-16215910-G-A p.Glu1157Lys missense ABCC1 1 83276 1.20083E-5 41638 0 NA
16-16215913-A-G p.Thr1158Ala missense ABCC1 2 83292 2.40119E-5 41646 0 NA
16-16215921-G-A p.Leu1160Leu synonymous ABCC1 1 83316 1.20025E-5 41658 0 8.285E-6
16-16215931-G-A p.Val1164Ile missense ABCC1 7 83316 8.40175E-5 41658 0 6.25E-4
16-16215937-C-A p.Arg1166Arg synonymous ABCC1 1 83326 1.20011E-5 41663 0 NA
16-16215938-G-A p.Arg1166Gln missense ABCC1 4 83322 4.80065E-5 41661 0 8.00878E-6
16-16215940-G-A p.Ala1167Thr missense ABCC1 1 83334 1.19999E-5 41667 0 3.18552E-5
16-16215945-C-T p.Phe1168Phe synonymous ABCC1 3 83318 3.60066E-5 41659 0 6.40707E-5
16-16215946-G-A p.Glu1169Lys missense ABCC1 1 83320 1.20019E-5 41660 0 8.28295E-6
16-16215948-G-A p.Glu1169Glu synonymous ABCC1 1 83332 1.20002E-5 41666 0 NA
16-16215955-G-A p.Glu1172Lys missense ABCC1 1 83334 1.19999E-5 41667 0 4.00497E-6
16-16215958-C-T p.Arg1173Cys missense ABCC1 1 83316 1.20025E-5 41658 0 4.00516E-6
16-16215960-C-T n.996C>T splice_region ABCC1 56 83322 6.72091E-4 41661 0 0.00136951
16-16215963-C-T p.Phe1174Phe synonymous ABCC1 10 83324 1.20013E-4 41662 0 3.31345E-5
16-16215987-G-A p.Val1182Val synonymous ABCC1 1 83274 1.20085E-5 41637 0 3.18532E-5
16-16215990-C-T p.Asp1183Asp synonymous ABCC1 4 83262 4.80411E-5 41631 0 2.486E-5
16-16215993-G-C p.Glu1184Asp missense ABCC1 2 83256 2.40223E-5 41628 0 3.18532E-5
16-16215998-A-G p.Gln1186Arg missense ABCC1 2 83216 2.40338E-5 41608 0 2.48682E-5
16-16216007-A-G p.Tyr1189Cys missense ABCC1 1 83116 1.20314E-5 41558 0 1.20278E-5
16-16216011-C-T p.Tyr1190Tyr synonymous ABCC1 1 83076 1.20372E-5 41538 0 NA
16-16216015-A-G p.Ser1192Gly missense ABCC1 1 83040 1.20424E-5 41520 0 8.29848E-6
16-16216026-CA-C p.Asn1196fs frameshift ABCC1 1 82780 1.20802E-5 41390 0 NA
16-16216037-C-T c.3590+6C>T splice_region ABCC1 2 82476 2.42495E-5 41238 0 NA
16-16216038-A-G c.3590+7A>G splice_region ABCC1 5 82420 6.06649E-5 41210 0 4.01694E-6
16-16218640-G-A c.3591-6G>A splice_region ABCC1 1 83110 1.20322E-5 41555 0 1.60344E-5
16-16218641-C-T c.3591-5C>T splice_region ABCC1 89 83120 0.00107074 41560 1 0.00121011
16-16218641-C-A c.3591-5C>A splice_region ABCC1 1 83122 1.20305E-5 41561 0 NA
16-16218642-G-A c.3591-4G>A splice_region ABCC1 6 83120 7.21848E-5 41560 0 9.55231E-5
16-16218643-C-A c.3591-3C>A splice_region ABCC1 1 83144 1.20273E-5 41572 0 NA
16-16218646-G-A p.Arg1197Arg splice_region+synonymous ABCC1 1 83164 1.20244E-5 41582 0 3.1841E-5
16-16218655-C-T p.Ala1200Ala synonymous ABCC1 51 83180 6.13128E-4 41590 0 0.0011462
16-16218656-G-A p.Val1201Met missense ABCC1 8 83194 9.61608E-5 41597 0 3.1837E-5
16-16218660-G-A p.Arg1202Gln missense ABCC1 6 83180 7.21327E-5 41590 0 9.55171E-5
16-16218661-G-C p.Arg1202Arg synonymous ABCC1 1 83202 1.20189E-5 41601 0 NA
16-16218667-G-A p.Glu1204Glu synonymous ABCC1 1 83204 1.20187E-5 41602 0 3.31225E-5
16-16218681-G-T p.Cys1209Phe missense ABCC1 1 83254 1.20114E-5 41627 0 NA
16-16218685-C-T p.Ile1210Ile synonymous ABCC1 9 83238 1.08124E-4 41619 0 6.25E-4
16-16218686-G-A p.Val1211Ile missense ABCC1 4 83252 4.80469E-5 41626 0 7.45206E-5
16-16218708-C-T p.Ala1218Val missense ABCC1 8 83286 9.60546E-5 41643 0 1.59246E-4
16-16218709-G-T p.Ala1218Ala synonymous ABCC1 12 83300 1.44058E-4 41650 0 2.22916E-4
16-16218709-G-A p.Ala1218Ala synonymous ABCC1 12 83302 1.44054E-4 41651 0 0.00100705
16-16218721-G-A p.Arg1222Arg synonymous ABCC1 1 83304 1.20042E-5 41652 0 NA
16-16218740-T-C p.Leu1229Leu synonymous ABCC1 1 83320 1.20019E-5 41660 0 4.00696E-6
16-16218742-G-A p.Leu1229Leu synonymous ABCC1 1 83316 1.20025E-5 41658 0 NA
16-16218745-G-A p.Val1230Val synonymous ABCC1 15 83296 1.80081E-4 41648 0 6.36983E-4
16-16218757-G-A p.Val1234Val synonymous ABCC1 1 83304 1.20042E-5 41652 0 NA
16-16219674-C-T p.Thr1242Met missense ABCC1 1 83330 1.20005E-5 41665 0 5.03525E-4
16-16219675-G-A p.Thr1242Thr synonymous ABCC1 4 83332 4.80008E-5 41666 0 1.91424E-4
16-16219678-C-T p.Tyr1243Tyr synonymous ABCC1 2 83340 2.39981E-5 41670 0 8.02497E-5
16-16219723-C-T p.Ile1258Ile synonymous ABCC1 1 83334 1.19999E-5 41667 0 0.00100705
16-16219729-C-T p.Ala1260Ala synonymous ABCC1 440 83304 0.00528186 41652 9 0.0125295
16-16219730-G-A p.Val1261Met missense ABCC1 2 83310 2.40067E-5 41655 0 3.18796E-5
16-16219730-G-T p.Val1261Leu missense ABCC1 1 83310 1.20034E-5 41655 0 8.35366E-6
16-16219738-G-A p.Arg1263Arg synonymous ABCC1 22 83280 2.64169E-4 41640 0 9.24156E-4
16-16219747-G-A p.Glu1266Glu synonymous ABCC1 2 83268 2.40188E-5 41634 0 8.38729E-6
16-16219776-A-G c.3819+8A>G splice_region ABCC1 4 83022 4.818E-5 41511 0 6.38692E-5
16-16225638-G-A c.3820-8G>A splice_region ABCC1 2 82472 2.42507E-5 41236 0 2.55028E-5
16-16225638-G-T c.3820-8G>T splice_region ABCC1 1 82474 1.2125E-5 41237 0 6.37186E-5
16-16225641-C-T c.3820-5C>T splice_region ABCC1 8 82546 9.69157E-5 41273 0 7.67664E-5
16-16225641-C-G c.3820-5C>G splice_region ABCC1 4 82546 4.84578E-5 41273 0 1.27453E-4
16-16225642-G-A c.3820-4G>A splice_region ABCC1 1 82598 1.21068E-5 41299 0 1.61507E-5
16-16225647-C-T p.Ala1274Val missense+splice_region ABCC1 1 82724 1.20884E-5 41362 0 5.05051E-4
16-16225648-G-A p.Ala1274Ala splice_region+synonymous ABCC1 21 82770 2.53715E-4 41385 0 5.41746E-4
16-16225650-C-G p.Pro1275Arg missense ABCC1 1 82876 1.20662E-5 41438 0 NA
16-16225660-C-A p.Ile1278Ile synonymous ABCC1 1 83026 1.20444E-5 41513 0 1.66864E-5
16-16225669-A-C p.Thr1281Thr synonymous ABCC1 1 83084 1.2036E-5 41542 0 3.18512E-5
16-16225674-C-T p.Pro1283Leu missense ABCC1 8 83122 9.62441E-5 41561 0 0.00100908
16-16225675-G-A p.Pro1283Pro synonymous ABCC1 7 83132 8.42034E-5 41566 0 4.41324E-5
16-16225683-G-C p.Ser1286Thr missense ABCC1 1 83182 1.20218E-5 41591 0 8.31089E-6
16-16225684-C-G p.Ser1286Arg missense ABCC1 1 83182 1.20218E-5 41591 0 NA
16-16225696-G-A p.Val1290Val synonymous ABCC1 1 83220 1.20163E-5 41610 0 NA
16-16225711-C-T p.Phe1295Phe synonymous ABCC1 2 83254 2.40229E-5 41627 0 NA
16-16225712-C-T p.Arg1296Trp missense ABCC1 32 83248 3.84394E-4 41624 0 5.04032E-4
16-16225713-G-A p.Arg1296Gln missense ABCC1 42 83248 5.04517E-4 41624 0 0.00352823
16-16225715-A-G p.Asn1297Asp missense ABCC1 1 83244 1.20129E-5 41622 0 NA
16-16225723-C-T p.Cys1299Cys synonymous ABCC1 1 83246 1.20126E-5 41623 0 6.36983E-5
16-16225727-C-T p.Arg1301Cys missense ABCC1 53 83236 6.36744E-4 41618 0 8.27973E-4
16-16225733-C-T p.Arg1303* stop_gained ABCC1 3 83236 3.60421E-5 41618 0 1.65873E-5
16-16225734-G-A p.Arg1303Gln missense ABCC1 5 83232 6.0073E-5 41616 0 3.3173E-5
16-16225735-A-G p.Arg1303Arg synonymous ABCC1 1 83236 1.2014E-5 41618 0 4.0085E-6
16-16225736-G-C p.Glu1304Gln missense ABCC1 2 83232 2.40292E-5 41616 0 3.31719E-5
16-16225740-A-G p.Asp1305Gly missense ABCC1 1 83210 1.20178E-5 41605 0 3.18715E-5
16-16225750-C-T p.Phe1308Phe synonymous ABCC1 9 83208 1.08163E-4 41604 0 4.41044E-5
16-16225751-G-A p.Val1309Ile missense ABCC1 2 83194 2.40402E-5 41597 0 6.37267E-5
16-16225760-C-T p.His1312Tyr missense ABCC1 1 83192 1.20204E-5 41596 0 NA
16-16225762-C-T p.His1312His synonymous ABCC1 1 83186 1.20213E-5 41593 0 6.37105E-5
16-16225765-C-A p.Ile1313Ile synonymous ABCC1 1 83170 1.20236E-5 41585 0 8.30261E-6
16-16225766-A-G p.Asn1314Asp missense ABCC1 1 83172 1.20233E-5 41586 0 8.30289E-6
16-16225767-A-G p.Asn1314Ser missense ABCC1 3 83172 3.60698E-5 41586 0 1.66072E-5
16-16225772-A-G p.Thr1316Ala missense ABCC1 1 83136 1.20285E-5 41568 0 3.18674E-5
16-16225775-A-G p.Ile1317Val missense ABCC1 1 83104 1.20331E-5 41552 0 NA
16-16225779-A-T p.Asn1318Ile missense ABCC1 1 83074 1.20375E-5 41537 0 4.01519E-6
16-16225779-A-G p.Asn1318Ser missense ABCC1 1 83074 1.20375E-5 41537 0 4.01519E-6
16-16225782-G-A p.Gly1319Glu missense ABCC1 1 83050 1.20409E-5 41525 0 NA
16-16225792-G-C p.Lys1322Asn missense+splice_region ABCC1 2 82916 2.41208E-5 41458 0 NA
16-16225793-G-A c.3966+1G>A splice_donor ABCC1 1 82892 1.20639E-5 41446 0 NA
16-16225797-G-A c.3966+5G>A splice_region ABCC1 2 82778 2.4161E-5 41389 0 2.51408E-5
16-16225799-A-G c.3966+7A>G splice_region ABCC1 1 82690 1.20934E-5 41345 0 8.06127E-6
16-16228201-C-G c.3967-6C>G splice_region ABCC1 1 82136 1.21749E-5 41068 0 NA
16-16228209-C-T p.Val1323Val splice_region+synonymous ABCC1 5 82236 6.08006E-5 41118 0 9.55597E-5
16-16228210-G-A p.Gly1324Ser missense ABCC1 6 82274 7.2927E-5 41137 0 9.55414E-5
16-16228215-C-T p.Ile1325Ile synonymous ABCC1 3 82458 3.63822E-5 41229 0 3.18552E-5
16-16228223-G-A p.Arg1328Gln missense ABCC1 5 82578 6.05488E-5 41289 0 5.80547E-5
16-16228224-G-T p.Arg1328Arg synonymous ABCC1 1 82602 1.21062E-5 41301 0 8.29311E-6
16-16228224-G-A p.Arg1328Arg synonymous ABCC1 11 82602 1.33169E-4 41301 1 5.21322E-5
16-16228227-G-T p.Thr1329Thr synonymous ABCC1 1 82646 1.20998E-5 41323 0 8.29229E-6
16-16228227-G-A p.Thr1329Thr synonymous ABCC1 1 82646 1.20998E-5 41323 0 3.18776E-5
16-16228242-G-A p.Ser1334Ser synonymous ABCC1 19271 82288 0.23419 41144 2389 0.248936
16-16228246-C-T p.Leu1336Leu synonymous ABCC1 1 82894 1.20636E-5 41447 0 NA
16-16228251-C-T p.Thr1337Thr synonymous ABCC1 3 82950 3.61664E-5 41475 0 0.00100705
16-16228260-A-G p.Leu1340Leu synonymous ABCC1 1 82962 1.20537E-5 41481 0 NA
16-16228264-C-T p.Arg1342Trp missense ABCC1 1 82970 1.20525E-5 41485 0 3.18817E-5
16-16228271-A-G p.Asn1344Ser missense ABCC1 2 83010 2.40935E-5 41505 0 9.56145E-5
16-16228272-C-T p.Asn1344Asn synonymous ABCC1 1 82980 1.20511E-5 41490 0 3.18817E-5
16-16228277-C-T p.Ser1346Phe missense ABCC1 1 82992 1.20494E-5 41496 0 4.97265E-5
16-16228278-T-A p.Ser1346Ser synonymous ABCC1 1 82996 1.20488E-5 41498 0 3.3151E-5
16-16228281-C-T p.Ala1347Ala synonymous ABCC1 1 83002 1.20479E-5 41501 0 1.20222E-5
16-16228282-G-A p.Glu1348Lys missense ABCC1 19 83028 2.28838E-4 41514 0 0.00100806
16-16228290-G-A p.Glu1350Glu synonymous ABCC1 3 83030 3.61315E-5 41515 0 2.4869E-5
16-16228290-G-C p.Glu1350Asp missense ABCC1 3 83030 3.61315E-5 41515 0 4.00734E-6
16-16228293-C-T p.Ile1351Ile synonymous ABCC1 1 83024 1.20447E-5 41512 0 1.65793E-5
16-16228297-A-G p.Ile1353Val missense ABCC1 3 83028 3.61324E-5 41514 0 8.29064E-6
16-16228300-G-A p.Asp1354Asn missense ABCC1 1 83016 1.20459E-5 41508 0 4.00757E-6
16-16228310-A-G p.Asn1357Ser missense ABCC1 7 82958 8.438E-5 41479 0 5.03525E-4
16-16228312-A-G p.Ile1358Val missense ABCC1 2 82962 2.41074E-5 41481 0 1.20246E-5
16-16228317-C-G p.Ala1359Ala synonymous ABCC1 4 82908 4.82462E-5 41454 0 6.25E-4
16-16228323-C-T p.Ile1361Ile synonymous ABCC1 7 82834 8.45064E-5 41417 0 9.12924E-5
16-16228323-C-A p.Ile1361Ile synonymous ABCC1 2 82834 2.41447E-5 41417 0 4.00978E-5
16-16228324-G-C p.Gly1362Arg missense ABCC1 1 82794 1.20782E-5 41397 0 NA
16-16228332-C-T p.His1364His synonymous ABCC1 2 82636 2.42025E-5 41318 0 3.2085E-5
16-16228333-G-T p.Asp1365Tyr missense ABCC1 2 82590 2.4216E-5 41295 0 1.66124E-5
16-16228333-G-A p.Asp1365Asn missense ABCC1 4 82590 4.8432E-5 41295 0 9.5645E-5
16-16228339-C-T p.Arg1367Cys missense ABCC1 1 82400 1.21359E-5 41200 0 4.01146E-6
16-16228344-C-T p.Phe1368Phe synonymous ABCC1 4 82200 4.86618E-5 41100 0 9.55475E-5
16-16228346-A-G p.Lys1369Arg missense ABCC1 1 82158 1.21717E-5 41079 0 8.31822E-6
16-16228353-C-T p.Thr1371Thr synonymous ABCC1 1 81926 1.22061E-5 40963 0 3.18573E-5
16-16228362-C-T p.Pro1374Pro synonymous ABCC1 2 81650 2.44948E-5 40825 0 NA
16-16230332-C-T c.4126-3C>T splice_region ABCC1 1 82134 1.21752E-5 41067 0 2.50547E-5
16-16230350-T-C p.Ser1381Pro missense ABCC1 1 82532 1.21165E-5 41266 0 NA
16-16230351-C-T p.Ser1381Leu missense ABCC1 2 82568 2.42225E-5 41284 0 2.00805E-5
16-16230353-G-A p.Gly1382Ser missense ABCC1 3 82618 3.63117E-5 41309 0 NA
16-16230363-G-A p.Arg1385Gln missense ABCC1 48 82874 5.79193E-4 41437 0 0.0013703
16-16230371-C-G p.Leu1388Val missense ABCC1 1 83018 1.20456E-5 41509 0 NA
16-16230371-C-A p.Leu1388Met missense ABCC1 2 83018 2.40912E-5 41509 0 3.18552E-5
16-16230376-C-T p.Asp1389Asp synonymous ABCC1 1 83078 1.20369E-5 41539 0 NA
16-16230394-G-A p.Ser1395Ser synonymous ABCC1 1 83196 1.20198E-5 41598 0 3.18593E-5
16-16230411-C-T p.Thr1401Met missense ABCC1 31 83226 3.7248E-4 41613 1 8.28025E-4
16-16230412-G-A p.Thr1401Thr synonymous ABCC1 3 83228 3.60456E-5 41614 1 8.30868E-6
16-16230415-C-T p.Ser1402Ser synonymous ABCC1 5 83216 6.00846E-5 41608 0 1.2738E-4
16-16230418-G-A p.Leu1403Leu synonymous ABCC1 1 83222 1.20161E-5 41611 0 4.00901E-6
16-16230422-C-G p.Leu1405Val missense ABCC1 1 83214 1.20172E-5 41607 0 NA
16-16230427-C-T p.Ala1406Ala synonymous ABCC1 336 83190 0.00403895 41595 4 0.0115811
16-16230431-C-T p.Leu1408Leu synonymous ABCC1 2 83190 2.40414E-5 41595 0 5.03525E-4
16-16230431-C-G p.Leu1408Val missense ABCC1 1 83192 1.20204E-5 41596 0 NA
16-16230434-A-C p.Lys1409Gln missense ABCC1 1 83184 1.20215E-5 41592 0 NA
16-16230442-C-T p.Phe1411Phe synonymous ABCC1 55 83158 6.61392E-4 41579 0 0.00168801
16-16230458-G-C p.Asp1417His missense ABCC1 1 83132 1.20291E-5 41566 0 8.35659E-6
16-16230462-A-G p.Lys1418Arg missense ABCC1 1 83110 1.20322E-5 41555 0 NA
16-16230464-C-T p.Leu1419Leu synonymous ABCC1 1 83058 1.20398E-5 41529 0 NA
16-16230470-C-T p.His1421Tyr missense ABCC1 3 83002 3.61437E-5 41501 0 1.20383E-5
16-16230476-T-A p.Cys1423Ser missense ABCC1 31 82892 3.73981E-4 41446 0 3.8236E-4
16-16230486-G-T p.Gly1426Val missense ABCC1 1 82700 1.20919E-5 41350 0 NA
16-16230487-C-G p.Gly1426Gly synonymous ABCC1 1 82668 1.20966E-5 41334 0 NA
16-16230492-A-AGAACCTCAGGTAGGCGGGGGT p.Lys1409_Asp1410insGlyArgArgGlyTerThrSer stop_gained ABCC1 1 82564 1.21118E-5 41282 0 NA
16-16230494-A-AGTGGACGGCATGTGACACCTGTGTCATGCTGACATGGATGG p.Asn1429fs frameshift ABCC1 1 82532 1.21165E-5 41266 0 NA
16-16230501-G-GT c.4292_4292+1insT splice_donor ABCC1 2 82418 2.42665E-5 41209 1 NA
16-16230507-C-T c.4292+6C>T splice_region ABCC1 176 82096 0.00214383 41048 0 0.00472089
16-16230507-CG-C c.4292+7delG splice_region ABCC1 8 82102 9.74398E-5 41051 0 3.18979E-5
16-16230508-G-A c.4292+7G>A splice_region ABCC1 3 82024 3.65747E-5 41012 0 1.29592E-4
16-16232213-C-T c.4125-8C>T splice_region ABCC1 1 82678 1.20951E-5 41339 0 6.41102E-5
16-16232215-G-A c.4125-6G>A splice_region ABCC1 1 82728 1.20878E-5 41364 0 3.1957E-5
16-16232224-C-T p.Val1376Val synonymous ABCC1 17 82908 2.05047E-4 41454 0 0.001875
16-16232231-C-T p.Arg1379Cys missense ABCC1 2 82958 2.41086E-5 41479 0 2.54846E-5
16-16232232-G-A p.Arg1379His missense ABCC1 1