Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
12-123414463-C-A p.Ala766Ser missense ABCB9 5 81206 6.15718E-5 40603 0 3.18552E-5
12-123414463-C-G p.Ala766Pro missense ABCB9 7 81204 8.62026E-5 40602 0 5.85275E-5
12-123414463-C-T p.Ala766Thr missense ABCB9 1 81206 1.23144E-5 40603 0 2.92637E-5
12-123414464-C-T p.Lys765Lys synonymous ABCB9 19 81232 2.33898E-4 40616 0 7.96737E-4
12-123414484-C-T p.Val759Ile missense ABCB9 1 81366 1.22901E-5 40683 0 NA
12-123414485-AGGCTCGTTGT-A p.His755fs frameshift ABCB9 30 81398 3.68559E-4 40699 0 6.37227E-4
12-123414485-A-G p.Pro758Pro synonymous ABCB9 2 81400 2.457E-5 40700 0 NA
12-123414488-C-T p.Glu757Glu synonymous ABCB9 1 81338 1.22944E-5 40669 0 NA
12-123414490-C-T p.Glu757Lys missense ABCB9 14 81270 1.72265E-4 40635 0 0.00153218
12-123414490-CGTT-C p.Asn756del conservative_inframe_deletion ABCB9 1 81270 1.23047E-5 40635 0 4.63422E-6
12-123414491-G-A p.Asn756Asn synonymous ABCB9 1 81060 1.23365E-5 40530 0 4.69184E-6
12-123414494-G-A p.His755His synonymous ABCB9 2 81056 2.46743E-5 40528 0 3.52622E-5
12-123414497-G-A p.Gly754Gly synonymous ABCB9 2 80984 2.46962E-5 40492 0 1.75131E-5
12-123414501-G-C p.Ala753Gly missense ABCB9 1 80884 1.23634E-5 40442 0 NA
12-123414514-C-T p.Ala749Thr missense ABCB9 2 80720 2.4777E-5 40360 0 4.32264E-4
12-123414515-G-A p.Ala748Ala synonymous ABCB9 3 80814 3.71223E-5 40407 0 6.45189E-5
12-123414517-C-T p.Ala748Thr missense ABCB9 2 80686 2.47874E-5 40343 0 5.1282E-4
12-123414518-G-A p.Pro747Pro synonymous ABCB9 6 80782 7.4274E-5 40391 0 6.37674E-5
12-123414524-A-G p.Leu745Leu synonymous ABCB9 1 80514 1.24202E-5 40257 0 NA
12-123414526-G-A p.Leu745Phe missense ABCB9 1 80446 1.24307E-5 40223 0 NA
12-123414527-C-T p.Gly744Gly synonymous ABCB9 1 80464 1.24279E-5 40232 0 2.36933E-5
12-123414540-C-T p.Arg740Gln missense ABCB9 1 80502 1.24221E-5 40251 0 5.21757E-5
12-123414541-G-A p.Arg740Trp missense ABCB9 5 80426 6.21689E-5 40213 0 0.00153061
12-123414551-C-T p.Lys736Lys synonymous ABCB9 1 80560 1.24131E-5 40280 0 NA
12-123414555-G-C p.Ala735Gly missense ABCB9 1 80512 1.24205E-5 40256 0 3.18532E-5
12-123414557-G-A p.Tyr734Tyr synonymous ABCB9 1 80576 1.24106E-5 40288 0 1.21102E-4
12-123414560-G-C p.Leu277Leu splice_region+synonymous ABCB9 2 80636 2.48028E-5 40318 0 NA
12-123414565-C-T p.Gly732Ser missense ABCB9 16 80508 1.98738E-4 40254 0 9.63577E-5
12-123414566-G-A p.Gly731Gly synonymous ABCB9 1 80424 1.24341E-5 40212 0 1.63093E-5
12-123414569-C-T p.Gln730Gln synonymous ABCB9 1 80514 1.24202E-5 40257 0 9.55475E-5
12-123414578-C-A p.Leu727Leu synonymous ABCB9 1 80492 1.24236E-5 40246 0 5.44241E-6
12-123414582-T-A p.Gln726Leu missense ABCB9 1 80522 1.2419E-5 40261 0 NA
12-123414604-C-T p.Val719Met missense ABCB9 1 80258 1.24598E-5 40129 0 3.83848E-5
12-123414605-T-G p.Val718Val synonymous ABCB9 2 80224 2.49302E-5 40112 0 5.63285E-6
12-123414607-C-T p.Val718Ile missense ABCB9 8 80158 9.98029E-5 40079 0 6.25E-4
12-123414609-C-T p.Arg717His missense ABCB9 16 80006 1.99985E-4 40003 0 0.00356779
12-123414610-G-A p.Arg717Cys missense ABCB9 1 79924 1.25119E-5 39962 0 3.92311E-5
12-123414616-T-C p.Lys715Glu missense ABCB9 47 79804 5.88943E-4 39902 0 6.78697E-4
12-123414622-GCAC-G p.Val712del conservative_inframe_deletion ABCB9 3 79448 3.77605E-5 39724 0 NA
12-123414622-G-T p.Leu713Met missense ABCB9 1 79448 1.25868E-5 39724 0 1.166E-5
12-123414625-C-A p.Val712Leu missense ABCB9 44 79302 5.54841E-4 39651 0 0.00153061
12-123414630-A-G p.Ile710Thr missense ABCB9 2 79260 2.52334E-5 39630 0 5.90402E-6
12-123414638-C-T p.Ala707Ala synonymous ABCB9 12 78326 1.53206E-4 39163 0 2.25083E-4
12-123414641-G-A p.His706His synonymous ABCB9 3 77970 3.84763E-5 38985 0 6.37186E-5
12-123414642-T-C p.His706Arg missense ABCB9 1 77860 1.28436E-5 38930 0 NA
12-123414650-G-A p.Thr703Thr synonymous ABCB9 3 76664 3.91318E-5 38332 0 1.44676E-4
12-123414660-C-T p.Arg700Gln missense ABCB9 2 75080 2.66383E-5 37540 0 3.18715E-5
12-123414661-G-A p.Arg700Trp missense ABCB9 1 74706 1.33858E-5 37353 0 5.07357E-5
12-123414664-G-A p.His699Tyr missense ABCB9 2 74102 2.69898E-5 37051 0 NA
12-123414665-C-T p.Ala698Ala synonymous ABCB9 6 73716 8.13935E-5 36858 0 2.52851E-5
12-123414666-G-A p.Ala698Val missense ABCB9 1 73256 1.36508E-5 36628 0 1.26707E-5
12-123414668-G-A p.Ile697Ile synonymous ABCB9 1 72862 1.37246E-5 36431 0 5.17759E-5
12-123414680-C-T p.Thr693Thr synonymous ABCB9 3 69904 4.2916E-5 34952 0 5.40716E-5
12-123414699-C-T p.Gly687Asp missense ABCB9 2 66260 3.01841E-5 33130 0 6.51262E-6
12-123414700-C-T p.Gly687Ser missense ABCB9 2 66294 3.01686E-5 33147 0 NA
12-123414723-G-A p.Pro682Leu missense ABCB9 5 62016 8.06244E-5 31008 0 7.49635E-5
12-123415871-CTT-C c.*1696_*17331delAA splice_region ABCB9 1 20 0.05 10 0 2.8238E-4
12-123415871-CTTT-C c.*1695_*17331delAAA splice_region ABCB9 1 20 0.05 10 0 NA
12-123416732-G-A c.2040+7C>T splice_region ABCB9 8 81200 9.85222E-5 40600 0 3.39905E-4
12-123416753-C-T p.Glu676Lys missense ABCB9 2 81352 2.45845E-5 40676 0 3.18532E-5
12-123416754-G-A p.Ala675Ala synonymous ABCB9 1 81358 1.22914E-5 40679 0 1.25857E-5
12-123416759-C-G p.Asp674His missense ABCB9 1 81372 1.22892E-5 40686 0 6.28583E-6
12-123416766-G-A p.Ser671Ser synonymous ABCB9 3 81366 3.68704E-5 40683 0 4.79616E-5
12-123416788-A-C p.Leu664Arg missense ABCB9 2 81382 2.45755E-5 40691 0 NA
12-123416793-T-TG p.Val663fs frameshift ABCB9 1 81380 1.2288E-5 40690 0 NA
12-123416798-GG-AA p.AsnPro660AsnSer missense ABCB9 1 81376 1.22886E-5 40688 0 NA
12-123416803-C-T p.Arg659Gln missense ABCB9 2 81338 2.45888E-5 40669 0 6.25E-4
12-123416804-G-A p.Arg659Trp missense ABCB9 1 81334 1.2295E-5 40667 0 4.84402E-5
12-123416805-C-T p.Val658Val synonymous ABCB9 1 81342 1.22938E-5 40671 0 0.001606
12-123416815-C-T p.Arg655Gln missense ABCB9 1 81338 1.22944E-5 40669 0 4.4681E-5
12-123416830-C-A p.Arg650Leu missense ABCB9 3 81310 3.68958E-5 40655 0 3.18492E-5
12-123416830-C-T p.Arg650Gln missense ABCB9 1 81310 1.22986E-5 40655 0 3.18492E-5
12-123416838-C-G p.Gln647His missense ABCB9 1 81292 1.23013E-5 40646 0 3.18552E-5
12-123416852-G-A p.Leu643Leu synonymous ABCB9 24 81244 2.95406E-4 40622 0 5.41263E-4
12-123416858-C-T p.Ala641Thr missense ABCB9 2 81164 2.46415E-5 40582 0 NA
12-123416859-G-A p.Gly640Gly synonymous ABCB9 2 81142 2.46481E-5 40571 0 1.40937E-4
12-123416868-C-T p.Gly637Gly synonymous ABCB9 1 81114 1.23283E-5 40557 0 NA
12-123419813-C-T c.1903+6G>A splice_region ABCB9 1 82294 1.21516E-5 41147 0 NA
12-123419816-C-T c.1903+3G>A splice_region ABCB9 3 82322 3.64423E-5 41161 0 2.58289E-5
12-123419845-A-G p.Met626Thr missense ABCB9 1 82548 1.21142E-5 41274 0 NA
12-123419846-T-C p.Met626Val missense ABCB9 1 82548 1.21142E-5 41274 0 1.08719E-5
12-123419850-G-A p.Phe624Phe synonymous ABCB9 1 82554 1.21133E-5 41277 0 3.18532E-5
12-123419851-A-G p.Phe624Ser missense ABCB9 2 82560 2.42248E-5 41280 0 NA
12-123419855-C-T p.Gly623Ser missense ABCB9 5 82570 6.05547E-5 41285 0 3.18573E-5
12-123419856-G-A p.His622His synonymous ABCB9 3 82596 3.63214E-5 41298 0 6.25E-4
12-123419859-G-C p.Ala621Ala synonymous ABCB9 6 82632 7.26111E-5 41316 0 9.64116E-6
12-123419870-T-C p.Lys618Glu missense ABCB9 2 82692 2.41861E-5 41346 0 NA
12-123419872-T-G p.Gln617Pro missense ABCB9 1 82706 1.2091E-5 41353 0 NA
12-123419876-C-T p.Ala616Thr missense ABCB9 2 82704 2.41826E-5 41352 0 2.77455E-4
12-123419877-G-A p.Ala615Ala synonymous ABCB9 1 82700 1.20919E-5 41350 0 4.00176E-6
12-123419883-C-T p.Val613Val synonymous ABCB9 2 82768 2.41639E-5 41384 0 3.9938E-6
12-123419884-A-G p.Val613Ala missense ABCB9 1 82762 1.20828E-5 41381 0 3.5933E-5
12-123419892-C-G p.Glu610Asp missense ABCB9 2 82824 2.41476E-5 41412 0 3.18573E-5
12-123419895-G-A p.Phe609Phe synonymous ABCB9 10 82838 1.20718E-4 41419 0 1.91168E-4
12-123419906-T-C p.Thr606Ala missense ABCB9 1 82910 1.20613E-5 41455 0 2.51716E-5
12-123419916-G-A p.Tyr602Tyr synonymous ABCB9 10 82994 1.20491E-4 41497 0 5.04032E-4
12-123419931-C-T p.Thr597Thr synonymous ABCB9 1 83032 1.20435E-5 41516 0 3.33545E-5
12-123419932-G-T p.Thr597Lys missense ABCB9 1 83030 1.20438E-5 41515 0 1.66717E-5
12-123419932-G-A p.Thr597Met missense ABCB9 3 83030 3.61315E-5 41515 0 6.25E-4
12-123419936-T-C p.Ile596Val missense ABCB9 2 83014 2.40923E-5 41507 0 3.18654E-5
12-123419942-G-A p.Arg594Cys missense ABCB9 4 82924 4.82369E-5 41462 0 6.25391E-4
12-123419946-G-T p.Phe592Leu missense ABCB9 2 82882 2.41307E-5 41441 0 3.18573E-5
12-123419949-C-A p.Leu591Leu synonymous ABCB9 1 82878 1.20659E-5 41439 0 3.18634E-5
12-123419955-G-A p.Pro589Pro synonymous ABCB9 4 82744 4.83419E-5 41372 0 4.18151E-5
12-123419970-C-T p.Leu584Leu synonymous ABCB9 90 82516 0.0010907 41258 0 6.33581E-4
12-123419976-G-A p.Ile582Ile splice_region+synonymous ABCB9 1 82402 1.21356E-5 41201 0 1.68705E-5
12-123419980-T-TGGGGAGGAGGGAGCATG c.1744-3_1744-2insCATGCTCCCTCCTCCCC splice_region ABCB9 1 82346 1.21439E-5 41173 0 NA
12-123424681-C-T p.Asp574Asn missense ABCB9 1 82626 1.21027E-5 41313 0 3.18593E-5
12-123424682-G-A p.Tyr573Tyr synonymous ABCB9 19 82644 2.29902E-4 41322 0 4.67491E-4
12-123424687-C-T p.Ala572Thr missense ABCB9 1 82652 1.20989E-5 41326 0 1.62261E-5
12-123424688-G-A p.Ser571Ser synonymous ABCB9 1 82652 1.20989E-5 41326 0 2.19606E-5
12-123424702-C-T p.Gly567Ser missense ABCB9 5 82690 6.04668E-5 41345 0 4.03969E-5
12-123424712-C-T p.Val563Val synonymous ABCB9 1 82706 1.2091E-5 41353 0 NA
12-123424716-C-T p.Arg562Gln missense ABCB9 6 82734 7.25216E-5 41367 0 6.04454E-5
12-123424717-G-A p.Arg562Trp missense ABCB9 1 82732 1.20872E-5 41366 0 8.0479E-6
12-123424719-C-T p.Gly561Asp missense ABCB9 4 82738 4.83454E-5 41369 0 NA
12-123424730-G-C p.Pro557Pro synonymous ABCB9 1 82714 1.20899E-5 41357 0 1.40181E-4
12-123424731-G-T p.Pro557His missense ABCB9 1 82732 1.20872E-5 41366 0 8.96909E-6
12-123424732-G-A p.Pro557Ser missense ABCB9 1 82730 1.20875E-5 41365 0 8.01064E-6
12-123424733-G-A p.Tyr556Tyr synonymous ABCB9 1 82740 1.20861E-5 41370 0 6.23453E-5
12-123424741-T-A p.Asn554Tyr missense ABCB9 3 82798 3.62328E-5 41399 0 1.74627E-5
12-123424748-G-A p.Ile551Ile synonymous ABCB9 1 82858 1.20688E-5 41429 0 1.59854E-5
12-123424778-C-T p.Ser541Ser synonymous ABCB9 1 82954 1.20549E-5 41477 0 6.37186E-5
12-123424788-A-G p.Val538Ala missense ABCB9 1 82998 1.20485E-5 41499 0 NA
12-123424796-C-T p.Thr535Thr synonymous ABCB9 4 83022 4.818E-5 41511 0 5.03525E-4
12-123424807-C-T p.Gly532Ser missense ABCB9 4 83028 4.81765E-5 41514 0 9.55962E-5
12-123424807-C-CG p.Gly532fs frameshift ABCB9 1 83028 1.20441E-5 41514 0 NA
12-123424817-G-C p.Ser528Arg missense ABCB9 1 83000 1.20482E-5 41500 0 6.37064E-5
12-123424823-G-A p.Ser526Ser synonymous ABCB9 1 82970 1.20525E-5 41485 0 NA
12-123424824-G-C p.Ser526Cys missense ABCB9 6 82966 7.23188E-5 41483 0 2.9078E-4
12-123424826-G-A p.Val525Val synonymous ABCB9 1 82948 1.20557E-5 41474 0 NA
12-123425346-G-A c.1569+8C>T splice_region ABCB9 25 81376 3.07216E-4 40688 0 1.91801E-4
12-123425347-C-T c.1569+7G>A splice_region ABCB9 1 81446 1.22781E-5 40723 0 4.36998E-6
12-123425353-C-T c.1569+1G>A splice_donor ABCB9 1 81626 1.2251E-5 40813 0 2.40477E-5
12-123425355-T-C p.Gln523Arg missense+splice_region ABCB9 1 81606 1.2254E-5 40803 0 NA
12-123425370-T-A p.His518Leu missense ABCB9 31 81832 3.78825E-4 40916 0 2.87228E-4
12-123425376-C-A p.Arg516Leu missense ABCB9 1 81884 1.22124E-5 40942 0 NA
12-123425377-G-A p.Arg516Trp missense ABCB9 2 81948 2.44057E-5 40974 0 4.0997E-6
12-123425379-G-A p.Thr515Ile missense ABCB9 5 81988 6.09845E-5 40994 0 3.15245E-5
12-123425380-T-G p.Thr515Pro missense ABCB9 2 81948 2.44057E-5 40974 0 NA
12-123425382-C-T p.Arg514His missense ABCB9 1 82006 1.21942E-5 41003 0 5.20627E-5
12-123425385-T-G p.Tyr513Ser missense ABCB9 2 82044 2.43772E-5 41022 0 NA
12-123425385-T-C p.Tyr513Cys missense ABCB9 2 82044 2.43772E-5 41022 0 NA
12-123425390-G-A p.Phe511Phe synonymous ABCB9 1 82102 1.218E-5 41051 0 NA
12-123425398-C-G p.Val509Leu missense ABCB9 2 82184 2.43356E-5 41092 0 NA
12-123425415-C-T p.Arg503Gln missense ABCB9 2 82122 2.4354E-5 41061 0 2.4391E-5
12-123425428-G-T p.His499Asn missense ABCB9 1 81998 1.21954E-5 40999 0 NA
12-123425431-C-T p.Asp498Asn missense ABCB9 1 81992 1.21963E-5 40996 0 3.87717E-5
12-123425437-C-T p.Ala496Thr missense ABCB9 1 82078 1.21835E-5 41039 0 4.06802E-6
12-123425445-C-A p.Gly493Val missense ABCB9 1 82122 1.2177E-5 41061 0 NA
12-123425449-C-T p.Asp492Asn missense ABCB9 2 82096 2.43617E-5 41048 0 5.05051E-4
12-123425449-C-A p.Asp492Tyr missense ABCB9 1 82096 1.21809E-5 41048 0 1.21738E-5
12-123425450-G-A p.His491His synonymous ABCB9 8 82106 9.7435E-5 41053 0 9.56694E-5
12-123425452-G-A p.His491Tyr missense ABCB9 1 82106 1.21794E-5 41053 0 NA
12-123425456-C-T p.Met489Ile missense ABCB9 1 82132 1.21755E-5 41066 0 2.03024E-5
12-123425462-C-T p.Pro487Pro synonymous ABCB9 1 82096 1.21809E-5 41048 0 4.07106E-6
12-123425463-G-A p.Pro487Leu missense ABCB9 1 82132 1.21755E-5 41066 0 3.85557E-5
12-123425469-C-T p.Arg485Gln missense ABCB9 4 82184 4.86713E-5 41092 0 3.19E-5
12-123425470-G-A p.Arg485Trp missense ABCB9 1 82178 1.21687E-5 41089 0 3.84645E-5
12-123425473-C-T p.Asp484Asn missense ABCB9 2 82170 2.43398E-5 41085 0 1.92215E-5
12-123425486-C-T p.Val479Val synonymous ABCB9 5 82168 6.08509E-5 41084 0 9.57983E-6
12-123425498-A-G p.Ala475Ala synonymous ABCB9 2 82070 2.43694E-5 41035 0 3.22846E-5
12-123425500-C-A p.Ala475Ser missense ABCB9 1 82048 1.2188E-5 41024 0 NA
12-123425504-C-T p.Val473Val synonymous ABCB9 9 82078 1.09652E-4 41039 0 3.00778E-4
12-123425505-A-G p.Val473Ala missense ABCB9 1 82010 1.21936E-5 41005 0 NA
12-123425509-C-T p.Gly472Arg missense ABCB9 2 82084 2.43653E-5 41042 0 1.94678E-5
12-123425510-C-T p.Gln471Gln synonymous ABCB9 1 82092 1.21815E-5 41046 0 NA
12-123425518-G-C p.Leu469Val missense ABCB9 1 82004 1.21945E-5 41002 0 NA
12-123425524-T-C p.Ser467Gly missense ABCB9 7 81946 8.54221E-5 40973 0 6.3743E-5
12-123425530-C-T p.Val465Ile missense ABCB9 4 81794 4.89033E-5 40897 0 3.18695E-5
12-123425534-G-A p.Gly463Gly synonymous ABCB9 1 81642 1.22486E-5 40821 0 NA
12-123425539-C-T p.Val462Met missense ABCB9 2 81416 2.45652E-5 40708 0 6.37267E-5
12-123425540-G-A p.Ser461Ser splice_region+synonymous ABCB9 1 81384 1.22874E-5 40692 0 5.07099E-4
12-123425545-G-A c.1381-3C>T splice_region ABCB9 2 81218 2.46251E-5 40609 0 NA
12-123425548-G-A c.1381-6C>T splice_region ABCB9 1 81062 1.23362E-5 40531 0 NA
12-123428931-C-T c.1380+7G>A splice_region ABCB9 1 82452 1.21283E-5 41226 0 3.99179E-6
12-123428938-C-T p.Glu460Glu splice_region+synonymous ABCB9 1 82494 1.21221E-5 41247 0 3.9867E-6
12-123428942-A-G p.Met459Thr missense ABCB9 1 82496 1.21218E-5 41248 0 5.03525E-4
12-123428942-A-T p.Met459Lys missense ABCB9 1 82496 1.21218E-5 41248 0 NA
12-123428947-A-G p.Asp457Asp synonymous ABCB9 17 82504 2.06051E-4 41252 0 1.40691E-4
12-123428955-G-C p.Leu455Val missense ABCB9 1 82566 1.21115E-5 41283 0 8.25614E-6
12-123428965-G-A p.Tyr451Tyr synonymous ABCB9 1 82570 1.21109E-5 41285 0 5.17434E-5
12-123428970-T-A p.Ile450Phe missense ABCB9 1 82604 1.2106E-5 41302 0 NA
12-123428979-C-A p.Ala447Ser missense ABCB9 2 82604 2.42119E-5 41302 0 3.18715E-5
12-123428979-C-T p.Ala447Thr missense ABCB9 9 82604 1.08954E-4 41302 0 6.36725E-5
12-123428980-G-A p.Ile446Ile synonymous ABCB9 1 82616 1.21042E-5 41308 0 3.97915E-6
12-123428991-C-T p.Gly443Ser missense ABCB9 36 82644 4.35603E-4 41322 1 0.0025
12-123429016-A-G p.Leu434Leu synonymous ABCB9 1 82712 1.20901E-5 41356 0 NA
12-123429019-G-A p.His433His synonymous ABCB9 5 82722 6.04434E-5 41361 0 5.56992E-5
12-123429025-C-G p.Gly431Gly synonymous ABCB9 2 82656 2.41967E-5 41328 0 NA
12-123429026-C-T p.Gly431Glu missense ABCB9 1 82650 1.20992E-5 41325 0 3.97886E-6
12-123429028-G-A p.Tyr430Tyr synonymous ABCB9 2 82670 2.41926E-5 41335 0 9.55292E-5
12-123429035-A-C p.Leu428Arg missense ABCB9 1 82682 1.20945E-5 41341 0 NA
12-123429049-G-T p.Val423Val synonymous ABCB9 5 82534 6.05811E-5 41267 0 4.12398E-5
12-123429086-G-A p.Ser18Phe missense ABCB9 1 82036 1.21898E-5 41018 0 NA
12-123429095-C-T p.Arg15Gln missense ABCB9 1 81708 1.22387E-5 40854 0 7.58802E-5
12-123429096-G-T p.Arg15Arg synonymous ABCB9 2 81662 2.44912E-5 40831 0 NA
12-123429101-G-A p.Ser13Phe missense ABCB9 1 81500 1.22699E-5 40750 0 1.21162E-5
12-123429108-G-A p.Leu11Leu synonymous ABCB9 5 81074 6.1672E-5 40537 0 3.25749E-5
12-123429117-C-T p.Val8Met missense ABCB9 1 80686 1.23937E-5 40343 0 NA
12-123429119-A-G p.Met7Thr missense ABCB9 19 80504 2.36013E-4 40252 0 4.46144E-4
12-123429129-C-T p.Gly4Arg missense ABCB9 2 80156 2.49513E-5 40078 0 NA
12-123429138-T-A p.Met1? initiator_codon ABCB9 61 79252 7.69697E-4 39626 0 8.92288E-4
12-123429193-C-A c.-55G>T 5_prime_UTR_premature_start_codon_gain ABCB9 1 71290 1.40272E-5 35645 0 6.37308E-5
12-123429194-G-A c.-56C>T 5_prime_UTR_premature_start_codon_gain ABCB9 1 71048 1.4075E-5 35524 0 NA
12-123430564-G-A c.1251+8C>T splice_region ABCB9 1 74396 1.34416E-5 37198 0 NA
12-123430567-C-T c.1251+5G>A splice_region ABCB9 1 75274 1.32848E-5 37637 0 8.08309E-6
12-123430568-G-A c.1251+4C>T splice_region ABCB9 1 75530 1.32398E-5 37765 0 4.51215E-5
12-123430575-G-A p.Ser416Ser synonymous ABCB9 6 76844 7.80803E-5 38422 0 9.66489E-5
12-123430585-A-G p.Val413Ala missense ABCB9 1 78946 1.26669E-5 39473 0 3.19142E-5
12-123430586-C-T p.Val413Ile missense ABCB9 4 79192 5.05102E-5 39596 0 6.37918E-5
12-123430595-T-C p.Met410Val missense ABCB9 2 80708 2.47807E-5 40354 0 8.44737E-6
12-123430597-T-G p.Tyr409Ser missense ABCB9 41 80892 5.06849E-4 40446 0 3.54281E-4
12-123430610-C-T p.Glu405Lys missense ABCB9 2 81922 2.44135E-5 40961 0 NA
12-123430614-C-T p.Arg403Arg synonymous ABCB9 1 82158 1.21717E-5 41079 0 NA
12-123430616-T-C p.Arg403Gly missense ABCB9 1 82226 1.21616E-5 41113 0 3.19224E-5
12-123430622-G-C p.Leu401Val missense ABCB9 3 82404 3.6406E-5 41202 0 3.19285E-5
12-123430628-A-G p.Tyr399His missense ABCB9 1 82534 1.21162E-5 41267 0 NA
12-123430646-G-A p.Arg393Trp missense ABCB9 1 82794 1.20782E-5 41397 0 6.38203E-5
12-123430653-C-T p.Val390Val synonymous ABCB9 7 82858 8.44819E-5 41429 0 3.18857E-5
12-123430655-C-G p.Val390Leu missense ABCB9 2 82886 2.41295E-5 41443 0 NA
12-123430656-C-T p.Glu389Glu synonymous ABCB9 1 82894 1.20636E-5 41447 0 3.97972E-6
12-123430658-C-G p.Glu389Gln missense ABCB9 1 82910 1.20613E-5 41455 0 8.26979E-6
12-123430662-C-T p.Glu387Glu synonymous ABCB9 2 82954 2.41097E-5 41477 0 6.38203E-5
12-123430667-C-T p.Glu386Lys missense ABCB9 1 83006 1.20473E-5 41503 0 NA
12-123430674-A-G p.Asn383Asn synonymous ABCB9 1 83038 1.20427E-5 41519 0 6.38937E-5
12-123430680-G-A p.Phe381Phe synonymous ABCB9 2 83038 2.40854E-5 41519 0 1.15653E-4
12-123430687-C-T p.Arg379Gln missense ABCB9 3 83062 3.61176E-5 41531 0 4.13005E-5
12-123430702-G-A p.Ala374Val missense ABCB9 1 83098 1.2034E-5 41549 0 1.98915E-5
12-123430707-G-T p.Ile372Ile synonymous ABCB9 9 83096 1.08308E-4 41548 0 2.47807E-5
12-123430719-C-T p.Ala368Ala synonymous ABCB9 5 83086 6.01786E-5 41543 0 1.91205E-4
12-123430722-C-T p.Thr367Thr synonymous ABCB9 1 83074 1.20375E-5 41537 0 0.00100705
12-123430723-G-A p.Thr367Met missense ABCB9 2 83078 2.40738E-5 41539 1 1.19343E-5
12-123430726-T-C p.Asn366Ser missense ABCB9 1 83066 1.20386E-5 41533 0 3.18634E-5
12-123430732-G-A p.Ala364Val missense ABCB9 1 83052 1.20406E-5 41526 0 7.95697E-6
12-123430746-A-G p.Asn359Asn synonymous ABCB9 3 83010 3.61402E-5 41505 0 6.37267E-5
12-123430777-C-T c.1054-8G>A splice_region ABCB9 2 82710 2.41809E-5 41355 0 3.58774E-5
12-123430870-C-T c.-170G>A 5_prime_UTR_premature_start_codon_gain ABCB9 1 72970 1.37043E-5 36485 0 NA
12-123432078-C-T c.-32G>A 5_prime_UTR_premature_start_codon_gain ABCB9 2 8828 2.26552E-4 4414 0 5.20942E-4
12-123432227-G-A c.-181C>T 5_prime_UTR_premature_start_codon_gain ABCB9 1 4366 2.29043E-4 2183 0 1.5951E-4
12-123432238-G-A c.-192C>T 5_prime_UTR_premature_start_codon_gain ABCB9 1 3774 2.64971E-4 1887 0 NA
12-123432256-G-A c.-210C>T 5_prime_UTR_premature_start_codon_gain ABCB9 1 3976 2.51509E-4 1988 0 3.18898E-5
12-123432814-C-A c.-768G>T 5_prime_UTR_premature_start_codon_gain ABCB9 1 532 0.0018797 266 0 NA
12-123433031-G-A c.-985C>T 5_prime_UTR_premature_start_codon_gain ABCB9 5 69554 7.18866E-5 34777 0 9.55353E-5
12-123433080-C-T c.-1034G>A 5_prime_UTR_premature_start_codon_gain ABCB9 2 79832 2.50526E-5 39916 0 NA
12-123433165-G-C c.1053+6C>G splice_region ABCB9 9 82414 1.09205E-4 41207 0 1.80112E-4
12-123433173-T-C p.Lys351Glu missense+splice_region ABCB9 1 82662 1.20975E-5 41331 0 4.05016E-6
12-123433180-C-T p.Lys348Lys synonymous ABCB9 1 82796 1.20779E-5 41398 0 6.85711E-5
12-123433185-C-T p.Gly347Ser missense ABCB9 1 82870 1.20671E-5 41435 0 3.18532E-5
12-123433186-G-A p.Tyr346Tyr synonymous ABCB9 18 82878 2.17187E-4 41439 0 1.59236E-4
12-123433192-G-A p.Asn344Asn synonymous ABCB9 2 82940 2.41138E-5 41470 0 9.55475E-5
12-123433193-T-C p.Asn344Ser missense ABCB9 1 82950 1.20555E-5 41475 0 NA
12-123433203-T-A p.Ter146Cysext*? stop_lost ABCB9 1 83016 1.20459E-5 41508 0 8.50456E-6
12-123433216-G-GA p.Ile338fs frameshift ABCB9 1 83054 1.20404E-5 41527 0 3.99144E-6
12-123433233-C-A p.Val331Phe missense ABCB9 3 83064 3.61167E-5 41532 0 3.59012E-5
12-123433269-C-G p.Val319Leu missense ABCB9 1 83110 1.20322E-5 41555 0 8.32431E-6
12-123433275-C-T p.Val317Met missense ABCB9 9 83094 1.08311E-4 41547 0 6.37146E-5
12-123433279-C-T p.Thr315Thr synonymous ABCB9 1 83110 1.20322E-5 41555 0 3.18613E-5
12-123433298-C-T p.Arg309Gln missense ABCB9 1 83048 1.20412E-5 41524 0 3.18552E-5
12-123433299-G-A p.Arg309Trp missense ABCB9 2 83040 2.40848E-5 41520 0 NA
12-123433304-A-T p.Phe307Tyr missense ABCB9 1 83048 1.20412E-5 41524 0 6.36983E-5
12-123433310-T-C p.Asn305Ser missense ABCB9 5 83000 6.0241E-5 41500 0 6.25E-4
12-123433315-G-A p.Asn303Asn synonymous ABCB9 1 82982 1.20508E-5 41491 0 3.40849E-5
12-123433333-G-A p.Ser297Ser synonymous ABCB9 1 82776 1.20808E-5 41388 0 8.68598E-6
12-123433339-C-T p.Met1? start_lost ABCB9 1 82718 1.20893E-5 41359 0 NA
12-123433351-C-A c.-10G>T 5_prime_UTR_premature_start_codon_gain ABCB9 51 82486 6.18287E-4 41243 0 5.27549E-4
12-123433351-C-T p.Ser291Ser synonymous ABCB9 3 82488 3.63689E-5 41244 0 0.00100705
12-123433361-C-T p.Arg288His missense ABCB9 1 82172 1.21696E-5 41086 0 NA
12-123433365-A-T p.Ser287Thr missense ABCB9 2 82100 2.43605E-5 41050 0 NA
12-123433379-G-A c.848-3C>T splice_region ABCB9 13 81322 1.59858E-4 40661 0 1.27478E-4
12-123433380-GA-G c.848-5delT splice_region ABCB9 1 81234 1.23101E-5 40617 0 NA
12-123433385-C-T c.-44G>A 5_prime_UTR_premature_start_codon_gain ABCB9 2 80856 2.47353E-5 40428 0 6.71669E-5
12-123433387-C-T c.-46G>A 5_prime_UTR_premature_start_codon_gain ABCB9 4 80610 4.96216E-5 40305 0 9.64543E-5
12-123433390-G-A c.-49C>T 5_prime_UTR_premature_start_codon_gain ABCB9 2 80100 2.49688E-5 40050 0 3.18857E-5
12-123433415-G-A c.-74C>T 5_prime_UTR_premature_start_codon_gain ABCB9 1 76264 1.31123E-5 38132 0 NA
12-123433475-G-A c.-134C>T 5_prime_UTR_premature_start_codon_gain ABCB9 7 56882 1.23062E-4 28441 0 3.20307E-5
12-123433495-G-A c.-154C>T 5_prime_UTR_premature_start_codon_gain ABCB9 20 52132 3.83642E-4 26066 0 9.57488E-5
12-123433635-G-A c.-294C>T 5_prime_UTR_premature_start_codon_gain ABCB9 1 7128 1.40292E-4 3564 0 9.56389E-5
12-123433636-T-C c.-295A>G 5_prime_UTR_premature_start_codon_gain ABCB9 2 6902 2.89771E-4 3451 0 3.18756E-5
12-123433838-G-A c.-497C>T 5_prime_UTR_premature_start_codon_gain ABCB9 2 316 0.00632911 158 0 6.05713E-4
12-123434339-G-T p.Arg281Arg synonymous ABCB9 1 83304 1.20042E-5 41652 0 8.24076E-6
12-123434340-C-T p.Arg281His missense ABCB9 13 83300 1.56062E-4 41650 0 1.07408E-4
12-123434341-G-A p.Arg281Cys missense ABCB9 6 83308 7.20219E-5 41654 0 9.55718E-5
12-123434354-G-T p.Phe276Leu missense ABCB9 4 83338 4.79973E-5 41669 0 NA
12-123434382-C-T p.Arg267His missense ABCB9 5 83328 6.00038E-5 41664 0 6.37146E-5
12-123434383-G-A p.Arg267Cys missense ABCB9 2 83332 2.40004E-5 41666 0 6.59033E-5
12-123434394-T-C p.Asn263Ser missense ABCB9 3 83342 3.59963E-5 41671 0 3.97652E-6
12-123434397-C-T p.Arg262Gln missense ABCB9 2 83352 2.39946E-5 41676 0 3.18634E-5
12-123434398-G-C p.Arg262Gly missense ABCB9 1 83352 1.19973E-5 41676 0 1.98821E-5
12-123434402-G-A p.Pro256Ser missense ABCB9 4 83354 4.79881E-5 41677 0 2.47121E-5
12-123434404-G-A p.Arg260Cys missense ABCB9 1 83354 1.1997E-5 41677 0 8.23723E-6
12-123434428-G-A p.Leu252Phe missense ABCB9 1 83368 1.1995E-5 41684 0 1.64753E-5
12-123434440-C-T p.Gly248Ser missense ABCB9 11 83358 1.31961E-4 41679 1 5.04032E-4
12-123434441-G-A p.Arg243Trp missense ABCB9 1 83366 1.19953E-5 41683 0 4.77194E-5
12-123434446-G-A p.Arg246Trp missense ABCB9 1 83358 1.19964E-5 41679 0 NA
12-123434449-T-C p.Ile91Val missense+splice_region ABCB9 4 83354 4.79881E-5 41677 0 1.86894E-4
12-123434455-C-T p.Ala243Thr missense ABCB9 1 83344 1.19985E-5 41672 0 3.97652E-6
12-123434463-G-T p.Ser240* stop_gained ABCB9 1 83332 1.20002E-5 41666 0 NA
12-123435020-C-T p.Val232Met missense ABCB9 4 82798 4.83103E-5 41399 0 6.25E-4
12-123435025-A-G p.Val230Ala missense ABCB9 1 82864 1.2068E-5 41432 0 8.69414E-6
12-123435026-C-T p.Val230Ile missense ABCB9 6 82856 7.24148E-5 41428 0 1.2747E-4
12-123435027-G-A p.Ser80Leu missense ABCB9 2 82876 2.41324E-5 41438 0 1.20189E-5
12-123435030-A-C p.Leu79Arg missense ABCB9 3 82898 3.61891E-5 41449 0 NA
12-123435062-T-G p.Ile218Leu missense ABCB9 1 82858 1.20688E-5 41429 0 8.50948E-6
12-123435063-G-A p.Ser68Leu missense ABCB9 1 82840 1.20715E-5 41420 0 NA
12-123435065-C-T p.Val217Ile missense ABCB9 1 82820 1.20744E-5 41410 0 3.18512E-5
12-123435068-T-C p.Ile216Val missense ABCB9 1 82804 1.20767E-5 41402 0 8.53679E-6
12-123435076-A-G p.Ile213Thr missense ABCB9 2 82714 2.41797E-5 41357 0 3.18552E-5
12-123435081-G-A p.Ala62Val missense ABCB9 22 82544 2.66525E-4 41272 0 5.03525E-4
12-123435082-C-T p.Arg211His missense ABCB9 1 82508 1.212E-5 41254 0 8.64409E-6
12-123435083-G-T p.Arg211Ser missense ABCB9 1 82460 1.21271E-5 41230 0 4.00689E-6
12-123435083-G-A p.Arg211Cys missense ABCB9 1 82460 1.21271E-5 41230 0 1.73271E-5
12-123435087-C-T p.Arg60Gln missense ABCB9 9 82272 1.09393E-4 41136 0 1.2197E-4
12-123435087-C-G p.Arg60Pro missense ABCB9 1 82272 1.21548E-5 41136 0 4.01023E-6
12-123435088-G-A p.Thr209Met missense ABCB9 4 82258 4.86275E-5 41129 0 3.49571E-5
12-123435092-A-G p.Tyr208His missense ABCB9 2 82180 2.43368E-5 41090 0 NA
12-123435096-G-A p.Pro57Leu missense ABCB9 1 82056 1.21868E-5 41028 0 NA
12-123435102-G-A p.Ser55Phe missense ABCB9 1 81816 1.22225E-5 40908 0 NA
12-123435104-AG-A p.Phe204fs frameshift ABCB9 1 81676 1.22435E-5 40838 0 NA
12-123435141-G-A c.-91C>T 5_prime_UTR_premature_start_codon_gain ABCB9 19 76638 2.47919E-4 38319 0 3.18756E-5
12-123435196-C-T c.-146G>A 5_prime_UTR_premature_start_codon_gain ABCB9 2 55656 3.5935E-5 27828 0 NA
12-123435219-G-A c.-169C>T 5_prime_UTR_premature_start_codon_gain ABCB9 1 45324 2.20634E-5 22662 0 6.37633E-5
12-123435237-G-A c.-187C>T 5_prime_UTR_premature_start_codon_gain ABCB9 2 37088 5.39258E-5 18544 0 9.56084E-5
12-123435435-G-A c.-385C>T 5_prime_UTR_premature_start_codon_gain ABCB9 3 1428 0.00210084 714 0 2.55053E-4
12-123444175-T-C c.601+7A>G splice_region ABCB9 1 81562 1.22606E-5 40781 0 1.86258E-5
12-123444188-C-T p.Ala199Thr missense ABCB9 2 81860 2.4432E-5 40930 0 NA
12-123444194-C-T p.Val197Met missense ABCB9 2 81962 2.44016E-5 40981 0 3.1841E-5
12-123444195-G-A p.Ser47Leu missense ABCB9 2 82018 2.43849E-5 41009 0 9.20251E-6
12-123444197-T-G p.Ile196Leu missense ABCB9 1 82034 1.21901E-5 41017 0 NA
12-123444198-G-A p.Ser46Leu missense ABCB9 2 82046 2.43766E-5 41023 0 NA
12-123444200-GGAA-G p.Ser45del disruptive_inframe_deletion ABCB9 1 82088 1.2182E-5 41044 0 1.83513E-5
12-123444210-G-A p.Pro42Leu missense ABCB9 1 82128 1.21761E-5 41064 0 9.13159E-6
12-123444212-C-T p.Ala191Thr missense ABCB9 3 82066 3.65559E-5 41033 0 3.18512E-5
12-123444213-G-A p.Pro41Leu missense ABCB9 3 82148 3.65195E-5 41074 0 3.18471E-5
12-123444219-G-A p.Ser39Leu missense ABCB9 5 82234 6.08021E-5 41117 0 0.00125
12-123444230-C-T p.Val185Met missense ABCB9 1 82300 1.21507E-5 41150 0 8.60324E-5
12-123444231-G-A p.Thr35Met missense ABCB9 1 82304 1.21501E-5 41152 0 0.0025
12-123444242-T-G p.Thr181Pro missense ABCB9 1 82296 1.21513E-5 41148 0 NA
12-123444246-G-A p.Pro30Leu missense ABCB9 1 82288 1.21524E-5 41144 0 1.21103E-5
12-123444254-G-A p.Leu177Leu synonymous ABCB9 11 82194 1.3383E-4 41097 1 1.21124E-5
12-123444260-G-T p.Cys25* stop_gained ABCB9 1 82038 1.21895E-5 41019 0 5.03525E-4
12-123444265-G-A p.Thr173Met missense ABCB9 7 81918 8.54513E-5 40959 0 6.85636E-5
12-123444276-C-T p.Arg20His missense ABCB9 7 81580 8.58053E-5 40790 0 6.25782E-4
12-123444289-G-A p.Pro165Leu missense ABCB9 1 81130 1.23259E-5 40565 0 6.11268E-5
12-123444290-G-T p.Pro165Thr missense ABCB9 1 81102 1.23302E-5 40551 0 NA
12-123444291-T-G p.His15Pro missense ABCB9 1 81010 1.23442E-5 40505 0 NA
12-123444296-G-A p.Arg163Trp missense ABCB9 3 81004 3.70352E-5 40502 0 4.37239E-5
12-123444299-C-T p.Gly162Ser missense ABCB9 2 81014 2.46871E-5 40507 0 1.14619E-4
12-123444300-G-A p.Ala12Val missense ABCB9 3 80920 3.70737E-5 40460 0 7.00084E-5
12-123444315-C-A p.Glu156Asp missense ABCB9 1 81068 1.23353E-5 40534 0 NA
12-123444323-C-T p.Glu154Lys missense ABCB9 5 80722 6.1941E-5 40361 0 2.05919E-5
12-123444324-G-A p.Pro4Leu missense ABCB9 2 80714 2.47788E-5 40357 0 3.18634E-5
12-123444330-C-T p.Arg2Gln missense ABCB9 1 80698 1.23919E-5 40349 0 3.18715E-5
12-123444331-G-A p.Ala151Val missense ABCB9 4 80606 4.96241E-5 40303 0 9.74348E-5
12-123444352-G-A p.Thr144Ile missense ABCB9 1 81012 1.23439E-5 40506 0 8.77732E-6
12-123444360-C-T p.Arg141Arg synonymous ABCB9 1 81086 1.23326E-5 40543 0 NA
12-123444361-C-T p.Arg141Gln missense ABCB9 10 81106 1.23295E-4 40553 0 1.39985E-4
12-123444365-C-T p.Val140Met missense ABCB9 8 81132 9.86047E-5 40566 0 6.11172E-5
12-123444366-G-A p.Thr139Thr synonymous ABCB9 2 81210 2.46275E-5 40605 0 3.48663E-5
12-123444368-T-C p.Thr139Ala missense ABCB9 5 81260 6.15309E-5 40630 0 8.13544E-6
12-123444369-G-T p.Ser138Ser synonymous ABCB9 1 81306 1.22992E-5 40653 0 4.06428E-6
12-123444384-G-C p.Leu133Leu synonymous ABCB9 2 81592 2.45122E-5 40796 0 NA
12-123444388-A-G p.Leu132Pro missense ABCB9 1 81706 1.2239E-5 40853 0 NA
12-123444398-C-T p.Ala129Thr missense ABCB9 1 81792 1.22261E-5 40896 0 1.71083E-5
12-123444401-C-T p.Gly128Ser missense ABCB9 1 81880 1.2213E-5 40940 0 9.56389E-5
12-123444402-G-T p.Leu127Leu synonymous ABCB9 8 81906 9.76729E-5 40953 0 1.04867E-4
12-123444402-G-A p.Leu127Leu synonymous ABCB9 7 81906 8.54638E-5 40953 0 0.00151362
12-123444404-G-C p.Leu127Val missense ABCB9 1 81996 1.21957E-5 40998 0 NA
12-123444414-C-T p.Thr123Thr synonymous ABCB9 34 82128 4.13988E-4 41064 0 2.63596E-4
12-123444414-C-G p.Thr123Thr synonymous ABCB9 3 82128 3.65283E-5 41064 0 4.02515E-5
12-123444418-C-T p.Trp122* stop_gained ABCB9 1 82248 1.21584E-5 41124 0 NA
12-123444420-C-T p.Val121Val synonymous ABCB9 8 82272 9.72384E-5 41136 0 2.86807E-4
12-123444422-C-T p.Val121Met missense ABCB9 72 82292 8.74933E-4 41146 0 0.00201816
12-123444422-C-A p.Val121Leu missense ABCB9 4 82294 4.86062E-5 41147 0 1.01835E-4
12-123444442-G-A p.Pro114Leu missense ABCB9 3 82476 3.63742E-5 41238 0 3.18674E-5
12-123444444-G-A p.Asp113Asp synonymous ABCB9 4 82446 4.85166E-5 41223 0 2.00668E-5
12-123444448-C-T p.Arg112Gln missense ABCB9 8 82450 9.70285E-5 41225 0 6.37349E-5
12-123444449-G-A p.Arg112Trp missense ABCB9 6 82470 7.27537E-5 41235 0 1.43649E-4
12-123444452-T-A p.Ile111Phe missense ABCB9 1 82482 1.21239E-5 41241 0 4.00892E-6
12-123444468-T-G p.Ser105Ser synonymous ABCB9 2 82534 2.42324E-5 41267 0 NA
12-123444470-A-G p.Ser105Pro missense ABCB9 1 82568 1.21112E-5 41284 0 NA
12-123444480-C-T p.Leu101Leu synonymous ABCB9 1 82532 1.21165E-5 41266 0 3.18532E-5
12-123444487-A-G p.Val99Ala missense ABCB9 2 82482 2.42477E-5 41241 0 4.00275E-6
12-123444489-C-T p.Met98Ile missense ABCB9 1 82476 1.21247E-5 41238 0 NA
12-123444491-T-C p.Met98Val missense ABCB9 4 82464 4.8506E-5 41232 0 6.73525E-5
12-123444506-C-T p.Val93Met missense ABCB9 9 82208 1.09478E-4 41104 0 7.57729E-5
12-123444506-C-A p.Val93Leu missense ABCB9 1 82208 1.21643E-5 41104 0 3.18593E-5
12-123444507-G-T p.Phe92Leu missense ABCB9 1042 82204 0.0126758 41102 4 0.0101347
12-123444519-G-A p.Leu88Leu synonymous ABCB9 68 82184 8.27412E-4 41092 1 0.006875
12-123444523-G-A p.Thr87Ile missense ABCB9 1 82152 1.21726E-5 41076 0 4.00728E-6
12-123444538-G-A p.Ser82Leu missense ABCB9 1 82086 1.21823E-5 41043 0 8.45051E-6
12-123444544-C-T p.Arg80Gln missense ABCB9 7 82042 8.53221E-5 41021 0 1.9118E-4
12-123444545-G-A p.Arg80Trp missense ABCB9 3 82014 3.65791E-5 41007 0 0.0015121
12-123444551-G-A p.Arg78Trp missense ABCB9 3 81950 3.66077E-5 40975 0 6.37146E-5
12-123444554-G-A p.Arg77Trp missense ABCB9 2 82064 2.43712E-5 41032 0 3.18593E-5
12-123444554-G-T p.Arg77Arg synonymous ABCB9 4 82064 4.87424E-5 41032 0 1.69025E-5
12-123444564-C-T p.Ala73Ala synonymous ABCB9 2 82058 2.4373E-5 41029 0 3.18552E-5
12-123444564-C-A p.Ala73Ala synonymous ABCB9 2 82058 2.4373E-5 41029 0 4.00333E-6
12-123444565-G-A p.Ala73Val missense ABCB9 10 82098 1.21806E-4 41049 1 0.0015121
12-123444566-C-T p.Ala73Thr missense ABCB9 1 82146 1.21734E-5 41073 0 NA
12-123444570-G-C p.Asn71Lys missense ABCB9 1 82244 1.21589E-5 41122 0 NA
12-123444579-C-A p.Val68Val synonymous ABCB9 1 82248 1.21584E-5 41124 0 NA
12-123444586-A-G p.Ile66Thr missense ABCB9 1 82264 1.2156E-5 41132 0 7.98965E-6
12-123444615-G-A p.Tyr56Tyr synonymous ABCB9 1 82302 1.21504E-5 41151 0 NA
12-123444615-G-T p.Tyr56* stop_gained ABCB9 1 82302 1.21504E-5 41151 0 NA
12-123444619-A-G p.Leu55Pro missense ABCB9 2 82324 2.42943E-5 41162 0 NA
12-123444620-G-A p.Leu55Leu synonymous ABCB9 3 82308 3.64485E-5 41154 0 6.37064E-5
12-123444630-C-G p.Trp51Cys missense ABCB9 1 82258 1.21569E-5 41129 0 NA
12-123444639-C-T p.Leu48Leu synonymous ABCB9 1 82362 1.21415E-5 41181 0 8.36484E-6
12-123444644-C-T p.Val47Met missense ABCB9 1 82390 1.21374E-5 41195 0 5.03525E-4
12-123444645-C-T p.Ser46Ser synonymous ABCB9 1 82416 1.21336E-5 41208 0 2.50727E-5
12-123444646-G-A p.Ser46Leu missense ABCB9 1 82410 1.21345E-5 41205 0 7.98225E-6
12-123444648-G-A p.Asp45Asp synonymous ABCB9 2 82484 2.42471E-5 41242 0 NA
12-123444652-A-G p.Phe44Ser missense ABCB9 1 82614 1.21045E-5 41307 0 3.98867E-6
12-123444667-C-T p.Arg39His missense ABCB9 7 82664 8.46801E-5 41332 0 5.03525E-4
12-123444668-G-A p.Arg39Cys missense ABCB9 3 82692 3.62792E-5 41346 0 8.33848E-6
12-123444668-G-C p.Arg39Gly missense ABCB9 2 82692 2.41861E-5 41346 0 7.97544E-6
12-123444683-G-C p.Leu34Val missense ABCB9 1 82802 1.2077E-5 41401 0 3.98619E-6
12-123444688-C-T p.Arg32His missense ABCB9 1 82772 1.20814E-5 41386 0 5.03525E-4
12-123444699-G-A p.Ser28Ser synonymous ABCB9 1 82760 1.20831E-5 41380 0 NA
12-123444708-A-T p.Tyr25* stop_gained ABCB9 1 82780 1.20802E-5 41390 0 NA
12-123444710-A-T p.Tyr25Asn missense ABCB9 3 82768 3.62459E-5 41384 0 8.3485E-6
12-123444718-G-A p.Thr22Met missense ABCB9 3 82596 3.63214E-5 41298 0 1.59246E-4
12-123444726-G-A p.Cys19Cys synonymous ABCB9 2 82378 2.42783E-5 41189 0 1.91131E-4
12-123444738-A-G p.Ser15Ser synonymous ABCB9 1 82066 1.21853E-5 41033 0 7.99476E-5
12-123444745-A-G p.Phe13Ser missense ABCB9 10 81792 1.22261E-4 40896 0 2.22916E-4
12-123444747-G-T p.Ala12Ala synonymous ABCB9 1 81698 1.22402E-5 40849 0 2.40327E-5
12-123444765-C-T p.Ala6Ala synonymous ABCB9 2 80574 2.48219E-5 40287 0 3.1841E-5
12-123444766-G-A p.Ala6Val missense ABCB9 2 80342 2.48936E-5 40171 0 8.97392E-6
12-123444778-C-T p.Arg2Gln missense ABCB9 6 79974 7.50244E-5 39987 0 5.40404E-5
12-123444779-G-A p.Arg2Trp missense ABCB9 16 79854 2.00366E-4 39927 0 0.00151362
12-123444830-C-T c.-48G>A 5_prime_UTR_premature_start_codon_gain ABCB9 1 75132 1.33099E-5 37566 0 2.09144E-5
12-123444831-G-A c.-49C>T 5_prime_UTR_premature_start_codon_gain ABCB9 1 74892 1.33526E-5 37446 0 3.18512E-5
12-123444860-G-A c.-78C>T 5_prime_UTR_premature_start_codon_gain ABCB9 5 68878 7.25921E-5 34439 0 NA
12-123444870-C-T c.-87-1G>A splice_acceptor ABCB9 37 66366 5.57514E-4 33183 0 1.27389E-4
12-123444873-T-A c.-87-4A>T splice_region ABCB9 2 65444 3.05605E-5 32722 0 NA
12-123450836-G-C c.-90C>G splice_region ABCB9 1 1022 9.78474E-4 511 0 0.00140297
12-123451014-G-A c.-268C>T 5_prime_UTR_premature_start_codon_gain ABCB9 1 1070 9.34579E-4 535 0 NA
12-123459058-G-C c.-204+4C>G splice_region ABCB9 1 2132 4.69043E-4 1066 0 3.18613E-5
12-123459459-G-A c.-285C>T 5_prime_UTR_premature_start_codon_gain ABCB9 1 3146 3.17864E-4 1573 0 NA
12-123459588-A-C c.-414T>G 5_prime_UTR_premature_start_codon_gain ABCB9 1 18086 5.52914E-5 9043 0 NA
12-123459617-G-A c.-443C>T 5_prime_UTR_premature_start_codon_gain ABCB9 10 26888 3.71913E-4 13444 0 1.59226E-4
12-123459624-A-G c.-450T>C 5_prime_UTR_premature_start_codon_gain ABCB9 7 30554 2.29103E-4 15277 0 9.5584E-5
12-123459704-G-C c.-530C>G 5_prime_UTR_premature_start_codon_gain ABCB9 2 55326 3.61494E-5 27663 0 3.18512E-5
12-123459750-G-A c.-576C>T 5_prime_UTR_premature_start_codon_gain ABCB9 1 59318 1.68583E-5 29659 0 NA
12-123463416-CCACCGGGCCTTTGTGGTCAAATACG-C c.-88+4_-88+28delCGTATTTGACCACAAAGGCCCGGTG splice_region ABCB9 1 80780 1.23793E-5 40390 0 6.37755E-5
12-123463440-C-T c.-88+5G>A splice_region ABCB9 2 81882 2.44254E-5 40941 0 6.37308E-5
12-123463441-G-A c.-88+4C>T splice_region ABCB9 2 81866 2.44302E-5 40933 0 1.27462E-4
12-123463442-C-T c.-88+3G>A splice_region ABCB9 2 81918 2.44147E-5 40959 0 NA
12-123463445-C-T c.-88G>A splice_region ABCB9 1 81986 1.21972E-5 40993 0 1.76769E-5
12-123463446-G-C c.-89C>G splice_region ABCB9 1 82026 1.21913E-5 41013 0 2.64518E-5
12-123463457-T-A c.-100A>T 5_prime_UTR_premature_start_codon_gain ABCB9 14 82238 1.70238E-4 41119 0 7.82377E-5
12-123463474-T-C c.-117A>G 5_prime_UTR_premature_start_codon_gain ABCB9 2 82720 2.41779E-5 41360 0 3.40466E-5
12-123463474-T-A c.-117A>T 5_prime_UTR_premature_start_codon_gain ABCB9 1 82720 1.2089E-5 41360 0 8.51165E-6
12-123463486-G-A c.-129C>T 5_prime_UTR_premature_start_codon_gain ABCB9 2 82758 2.41668E-5 41379 0 4.43498E-5
12-123463499-A-T c.-142T>A 5_prime_UTR_premature_start_codon_gain ABCB9 7 82800 8.45411E-5 41400 0 4.03011E-5
12-123463499-A-G c.-142T>C 5_prime_UTR_premature_start_codon_gain ABCB9 1 82800 1.20773E-5 41400 0 1.20903E-5
12-123463514-A-G c.-157T>C 5_prime_UTR_premature_start_codon_gain ABCB9 3 82750 3.62538E-5 41375 0 3.18796E-5
12-123463633-C-T c.-276G>A 5_prime_UTR_premature_start_codon_gain ABCB9 16 81886 1.95394E-4 40943 1 9.62902E-5
12-123463633-C-A c.-276G>T 5_prime_UTR_premature_start_codon_gain ABCB9 1 81886 1.22121E-5 40943 0 NA
12-123463668-C-T c.-311G>A 5_prime_UTR_premature_start_codon_gain ABCB9 44 82002 5.36572E-4 41001 0 0.00127149
12-123463669-G-A c.-312C>T 5_prime_UTR_premature_start_codon_gain ABCB9 1 82012 1.21933E-5 41006 0 3.18817E-5
12-123463694-G-A c.-337C>T 5_prime_UTR_premature_start_codon_gain ABCB9 3 82194 3.6499E-5 41097 0 4.48175E-5
12-123463699-G-A c.-342C>T 5_prime_UTR_premature_start_codon_gain ABCB9 1 82254 1.21575E-5 41127 0 4.06802E-6
12-123463718-G-A c.-361C>T 5_prime_UTR_premature_start_codon_gain ABCB9 5 82482 6.06193E-5 41241 0 1.62121E-5
12-123463739-G-A c.-382C>T 5_prime_UTR_premature_start_codon_gain ABCB9 9 82596 1.08964E-4 41298 0 5.03525E-4
12-123463763-G-C c.-406C>G 5_prime_UTR_premature_start_codon_gain ABCB9 2 82704 2.41826E-5 41352 0 2.01868E-5
12-123463805-G-A c.-448C>T 5_prime_UTR_premature_start_codon_gain ABCB9 4 82868 4.82695E-5 41434 0 4.19992E-5
12-123463807-G-C c.-450C>G 5_prime_UTR_premature_start_codon_gain ABCB9 1 82876 1.20662E-5 41438 0 3.18654E-5
12-123463813-G-A c.-456C>T 5_prime_UTR_premature_start_codon_gain ABCB9 2 82816 2.41499E-5 41408 0 1.68039E-5
12-123463837-G-A c.-480C>T 5_prime_UTR_premature_start_codon_gain ABCB9 6 82716 7.25374E-5 41358 0 5.05544E-5
12-123463853-G-A c.-496C>T 5_prime_UTR_premature_start_codon_gain ABCB9 8 82556 9.69039E-5 41278 0 5.03525E-4
12-123463853-G-C c.-496C>G 5_prime_UTR_premature_start_codon_gain ABCB9 1 82556 1.2113E-5 41278 0 8.48868E-6
12-123463855-G-C c.-498C>G 5_prime_UTR_premature_start_codon_gain ABCB9 3 82554 3.63399E-5 41277 0 6.25E-4
12-123463868-C-T c.-511G>A 5_prime_UTR_premature_start_codon_gain ABCB9 4 82336 4.85814E-5 41168 0 1.28811E-4
12-123463869-G-A c.-512C>T 5_prime_UTR_premature_start_codon_gain ABCB9 5 82320 6.07386E-5 41160 0 2.57794E-5
12-123463939-G-A c.-582C>T 5_prime_UTR_premature_start_codon_gain ABCB9 1 79024 1.26544E-5 39512 0 9.8342E-6
12-123464000-G-A c.-643C>T 5_prime_UTR_premature_start_codon_gain ABCB9 2 61130 3.27172E-5 30565 0 NA
12-123464088-G-A c.-731C>T 5_prime_UTR_premature_start_codon_gain ABCB9 1 32128 3.11255E-5 16064 0 NA
12-123464151-G-A c.-794C>T 5_prime_UTR_premature_start_codon_gain ABCB9 1 20494 4.87948E-5 10247 0 6.37389E-5
12-123464162-G-A c.-805C>T 5_prime_UTR_premature_start_codon_gain ABCB9 1 19166 5.21757E-5 9583 0 NA
12-123464219-C-G c.-862G>C 5_prime_UTR_premature_start_codon_gain ABCB9 1 9384 1.06564E-4 4692 0 NA
12-123464557-A-C c.-1200T>G 5_prime_UTR_premature_start_codon_gain ABCB9 1 15256 6.5548E-5 7628 0 NA
12-123464594-T-A c.-1237A>T 5_prime_UTR_premature_start_codon_gain ABCB9 1 19766 5.05919E-5 9883 0 NA
12-123464758-C-G c.-1401G>C 5_prime_UTR_premature_start_codon_gain ABCB9 1 27554 3.62924E-5 13777 0 NA
12-123464781-G-C c.-1424C>G 5_prime_UTR_premature_start_codon_gain ABCB9 15 28576 5.24916E-4 14288 0 0.00229372
12-123464912-C-A c.-1555G>T 5_prime_UTR_premature_start_codon_gain ABCB9 1 37158 2.69121E-5 18579 0 2.39607E-5
12-123464933-G-A c.-1576C>T 5_prime_UTR_premature_start_codon_gain ABCB9 1 38440 2.60146E-5 19220 0 1.59337E-4
12-123464956-G-A c.-1599C>T 5_prime_UTR_premature_start_codon_gain ABCB9 10 39680 2.52016E-4 19840 0 0.00146534
12-123465009-G-A c.-1652C>T 5_prime_UTR_premature_start_codon_gain ABCB9 1 39414 2.53717E-5 19707 0 NA
12-123465125-G-C c.-1768C>G 5_prime_UTR_premature_start_codon_gain ABCB9 1 38250 2.61438E-5 19125 0 7.83699E-4
12-123465205-C-A c.-1848G>T 5_prime_UTR_premature_start_codon_gain ABCB9 1 37696 2.6528E-5 18848 0 3.19632E-5
12-123465250-G-A c.-1893C>T 5_prime_UTR_premature_start_codon_gain ABCB9 4 36608 1.09266E-4 18304 0 NA
12-123465265-G-A c.-1908C>T 5_prime_UTR_premature_start_codon_gain ABCB9 4 36142 1.10675E-4 18071 0 6.39223E-5
12-123465282-G-A c.-1925C>T 5_prime_UTR_premature_start_codon_gain ABCB9 1 35776 2.79517E-5 17888 0 NA
12-123465307-G-T c.-1950C>A 5_prime_UTR_premature_start_codon_gain ABCB9 6 35406 1.69463E-4 17703 0 6.39468E-5
12-123465332-G-A c.-1975C>T 5_prime_UTR_premature_start_codon_gain ABCB9 2 34100 5.8651E-5 17050 0 6.39223E-5
12-123465456-G-A c.-2099C>T 5_prime_UTR_premature_start_codon_gain ABCB9 326 38394 0.00849091 19197 8 0.0238034
12-123465483-C-A c.-2126G>T 5_prime_UTR_premature_start_codon_gain ABCB9 2 40350 4.95663E-5 20175 0 NA
12-123465490-G-A c.-2133C>T 5_prime_UTR_premature_start_codon_gain ABCB9 1 40596 2.4633E-5 20298 0 NA
12-123465516-G-A c.-2159C>T 5_prime_UTR_premature_start_codon_gain ABCB9 3 41612 7.20946E-5 20806 0 3.19061E-5
12-123465611-C-T c.-2254G>A 5_prime_UTR_premature_start_codon_gain ABCB9 3 47096 6.36997E-5 23548 0 NA
12-123465622-C-A c.-2265G>T 5_prime_UTR_premature_start_codon_gain ABCB9 2 47892 4.17606E-5 23946 0 NA
12-123465633-G-A c.-2276C>T 5_prime_UTR_premature_start_codon_gain ABCB9 4 49072 8.15129E-5 24536 0 6.38081E-5
12-123465637-T-A c.-2280A>T 5_prime_UTR_premature_start_codon_gain ABCB9 1 49836 2.00658E-5 24918 0 NA
12-123465695-C-G c.-2338G>C 5_prime_UTR_premature_start_codon_gain ABCB9 44 59956 7.33871E-4 29978 0 0.00146684
12-123465800-C-A c.-2443G>T 5_prime_UTR_premature_start_codon_gain ABCB9 1 69824 1.43217E-5 34912 0 NA
12-123465891-G-A c.-2534C>T 5_prime_UTR_premature_start_codon_gain ABCB9 7 76826 9.1115E-5 38413 0 3.19061E-5
12-123465926-G-A c.-2569C>T 5_prime_UTR_premature_start_codon_gain ABCB9 1 77314 1.29343E-5 38657 0 NA
12-123466020-A-C c.-2663T>G 5_prime_UTR_premature_start_codon_gain ABCB9 1 78656 1.27136E-5 39328 0 NA
12-123466085-G-A c.-2728C>T 5_prime_UTR_premature_start_codon_gain ABCB9 19 78758 2.41245E-4 39379 0 6.39223E-4
12-123466123-C-T c.-2766G>A 5_prime_UTR_premature_start_codon_gain ABCB9 2 78734 2.5402E-5 39367 0 NA
12-123466131-C-A c.-2774G>T 5_prime_UTR_premature_start_codon_gain ABCB9 30 78752 3.80943E-4 39376 0 3.29012E-5
12-123466163-G-A c.-2806C>T 5_prime_UTR_premature_start_codon_gain ABCB9 2 78494 2.54797E-5 39247 0 3.55215E-5