Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
7-150725511-T-A c.-92T>A 5_prime_UTR_premature_start_codon_gain ABCB8 1 80726 1.23876E-5 40363 0 6.6357E-5
7-150725527-G-T c.-76G>T 5_prime_UTR_premature_start_codon_gain ABCB8 2 81452 2.45543E-5 40726 0 6.09682E-5
7-150725563-A-G p.Lys4Glu missense ABCB8 2 82328 2.42931E-5 41164 0 9.48641E-6
7-150725566-C-G p.Leu5Val missense ABCB8 9 82394 1.09231E-4 41197 0 3.6521E-4
7-150725569-C-G p.Leu6Val missense ABCB8 2 82512 2.42389E-5 41256 0 NA
7-150725570-T-C p.Leu6Pro missense ABCB8 1 82540 1.21153E-5 41270 0 8.98465E-6
7-150725571-A-C p.Leu6Leu synonymous ABCB8 8 82530 9.69344E-5 41265 0 2.42272E-4
7-150725573-T-G p.Leu7Trp missense ABCB8 3 82546 3.63434E-5 41273 0 3.18532E-5
7-150725573-T-C p.Leu7Ser missense ABCB8 4 82544 4.8459E-5 41272 0 3.28793E-4
7-150725574-G-A p.Leu7Leu synonymous ABCB8 2 82556 2.4226E-5 41278 0 2.29043E-5
7-150725575-C-T p.Pro8Ser missense ABCB8 1 82546 1.21145E-5 41273 0 2.24235E-5
7-150725576-C-T p.Pro8Leu missense ABCB8 3 82558 3.63381E-5 41279 0 6.39986E-5
7-150725578-G-A p.Ala9Thr missense ABCB8 16 82566 1.93784E-4 41283 0 0.00219401
7-150725580-G-C p.Ala9Ala synonymous ABCB8 1 82562 1.21121E-5 41281 0 NA
7-150725582-C-G p.Ala10Gly missense ABCB8 1 82522 1.2118E-5 41261 0 4.22422E-6
7-150725583-T-C p.Ala10Ala synonymous ABCB8 2 82542 2.42301E-5 41271 1 3.18715E-5
7-150725584-C-T p.Pro11Ser missense ABCB8 3 82560 3.63372E-5 41280 0 5.3009E-4
7-150725587-GT-G p.Leu13fs frameshift ABCB8 1 82546 1.21145E-5 41273 0 3.18654E-5
7-150725589-T-C p.Val12Val synonymous ABCB8 2 82548 2.42283E-5 41274 0 1.35921E-5
7-150725594-C-T p.Pro14Leu missense ABCB8 2 82596 2.42142E-5 41298 0 1.22558E-5
7-150725595-G-C p.Pro14Pro synonymous ABCB8 66 82574 7.99283E-4 41287 0 0.00875
7-150725596-C-T p.Arg15Cys missense ABCB8 1 82614 1.21045E-5 41307 0 8.15581E-6
7-150725611-G-A p.Ala20Thr missense ABCB8 2 82776 2.41616E-5 41388 0 NA
7-150725612-C-T p.His4Tyr missense ABCB8 1 82770 1.20817E-5 41385 0 NA
7-150725629-G-T p.Asp26Tyr missense ABCB8 2 82862 2.41365E-5 41431 0 3.18593E-5
7-150725631-T-C p.Ile10Thr missense ABCB8 5 82854 6.03471E-5 41427 0 2.54858E-4
7-150725634-G-A p.Arg11Gln missense ABCB8 2 82858 2.41377E-5 41429 0 8.00141E-6
7-150725636-G-A p.Gly12Ser missense ABCB8 1 82876 1.20662E-5 41438 0 1.59908E-5
7-150725636-G-C p.Gly12Arg missense ABCB8 1 82876 1.20662E-5 41438 0 NA
7-150725641-C-A p.Pro30Thr missense ABCB8 2 82830 2.41458E-5 41415 0 2.24735E-4
7-150725642-C-T p.Pro14Ser missense ABCB8 1 82876 1.20662E-5 41438 0 5.17857E-5
7-150725648-C-T p.Pro16Ser missense ABCB8 2 82856 2.41383E-5 41428 0 1.71901E-5
7-150725657-C-T p.Ala35Val missense ABCB8 1 82680 1.20948E-5 41340 0 8.59121E-6
7-150725669-C-G p.Leu23Val missense ABCB8 3 82416 3.64007E-5 41208 0 6.36902E-5
7-150725669-C-T p.Leu23Phe missense ABCB8 2 82416 2.42671E-5 41208 0 3.99623E-6
7-150725671-C-T p.Pro40Ser missense ABCB8 5 82364 6.07061E-5 41182 0 5.59517E-5
7-150725671-C-G p.Pro40Ala missense ABCB8 1 82364 1.21412E-5 41182 0 NA
7-150725690-G-A p.Ala30Thr missense ABCB8 1 81830 1.22205E-5 40915 0 NA
7-150725698-G-GT c.95+2dupT splice_region ABCB8 2 81500 2.45399E-5 40750 0 NA
7-150725872-C-G p.Thr34Ser missense ABCB8 1 77382 1.29229E-5 38691 0 NA
7-150725874-C-T p.Pro35Ser missense ABCB8 7 77312 9.05422E-5 38656 0 1.14705E-4
7-150725880-G-T p.Ala37Ser missense ABCB8 1 77054 1.29779E-5 38527 0 6.12452E-6
7-150725886-A-G c.96-2A>G splice_acceptor ABCB8 1 77008 1.29857E-5 38504 0 3.18654E-5
7-150725895-C-T p.Leu35Leu synonymous ABCB8 1 76918 1.30009E-5 38459 0 NA
7-150725901-C-T p.Leu37Leu synonymous ABCB8 1 76876 1.3008E-5 38438 0 5.36705E-6
7-150725906-G-A p.Gln38Gln synonymous ABCB8 1 76826 1.30164E-5 38413 0 NA
7-150725909-G-A p.Pro39Pro synonymous ABCB8 1 76834 1.30151E-5 38417 0 3.62476E-5
7-150725912-T-C p.Arg40Arg synonymous ABCB8 15 76832 1.95231E-4 38416 0 1.386E-4
7-150725924-G-A p.Lys44Lys synonymous ABCB8 1 76808 1.30195E-5 38404 0 3.18492E-5
7-150725936-C-T p.Leu48Leu synonymous ABCB8 2 76764 2.60539E-5 38382 0 2.88884E-5
7-150725947-A-ACCACGC p.His53_Ala54dup disruptive_inframe_insertion ABCB8 1 76758 1.3028E-5 38379 0 NA
7-150725952-G-T p.Ala54Ser missense ABCB8 1 76772 1.30256E-5 38386 0 NA
7-150725953-C-G p.Ala54Gly missense ABCB8 21 76770 2.73544E-4 38385 0 6.37105E-5
7-150725953-C-T p.Ala54Val missense ABCB8 1 76770 1.30259E-5 38385 0 2.753E-5
7-150725962-C-T p.Ala57Val missense ABCB8 45 76728 5.86487E-4 38364 0 0.00187735
7-150725965-TCCCGACCGGGGGTC-T p.Thr60fs frameshift ABCB8 6 76736 7.81902E-5 38368 0 2.08773E-5
7-150725968-C-T p.Pro59Leu missense ABCB8 11 76726 1.43367E-4 38363 0 9.55353E-5
7-150725968-C-A p.Pro59Gln missense ABCB8 1 76726 1.30334E-5 38363 0 NA
7-150725969-G-A p.Pro59Pro synonymous ABCB8 1 76698 1.30381E-5 38349 0 NA
7-150725972-C-T p.Thr60Thr synonymous ABCB8 10631 76414 0.139124 38207 785 0.187322
7-150725972-C-CG p.Pro63fs frameshift ABCB8 1 76710 1.30361E-5 38355 0 NA
7-150725977-G-T p.Gly62Val missense ABCB8 4 76686 5.21608E-5 38343 0 6.26566E-4
7-150725980-C-T p.Pro63Leu missense ABCB8 1 76686 1.30402E-5 38343 0 NA
7-150725981-C-T p.Pro63Pro synonymous ABCB8 18 76676 2.34754E-4 38338 0 1.32573E-4
7-150725983-T-A p.Leu64His missense ABCB8 1 76692 1.30392E-5 38346 0 NA
7-150725992-C-G p.Pro67Arg missense ABCB8 1 76630 1.30497E-5 38315 0 NA
7-150726003-T-A c.206+5T>A splice_region ABCB8 2 76586 2.61144E-5 38293 0 4.59897E-5
7-150726081-C-T n.512+7C>T splice_region ABCB8 1 75384 1.32654E-5 37692 0 NA
7-150728321-C-T c.96-7C>T splice_region ABCB8 5 76936 6.49891E-5 38468 0 6.31624E-6
7-150728327-G-A c.96-1G>A splice_acceptor ABCB8 1 77126 1.29658E-5 38563 0 NA
7-150728334-A-G p.Thr34Thr synonymous ABCB8 1 77258 1.29436E-5 38629 0 1.02817E-4
7-150728338-C-T p.Arg36Cys missense ABCB8 10 77306 1.29356E-4 38653 0 6.25E-4
7-150728339-G-A p.Arg36His missense ABCB8 9 77332 1.16381E-4 38666 0 2.02286E-4
7-150728340-T-G p.Arg36Arg synonymous ABCB8 1 77380 1.29232E-5 38690 0 1.00442E-4
7-150728345-G-A p.Gly38Glu missense ABCB8 1 77450 1.29116E-5 38725 0 NA
7-150728366-A-C p.Lys45Thr missense ABCB8 2 77598 2.57739E-5 38799 0 9.77422E-5
7-150728369-CAGA-C p.Glu47del disruptive_inframe_deletion ABCB8 2 77612 2.57692E-5 38806 0 NA
7-150728384-C-T c.146+6C>T splice_region ABCB8 130 77598 0.0016753 38799 2 0.00308957
7-150728385-G-A c.146+7G>A splice_region ABCB8 3 77608 3.86558E-5 38804 0 1.4979E-4
7-150729928-CA-C n.162-2delA splice_acceptor ABCB8 1 49176 2.03351E-5 24588 0 NA
7-150729933-G-A p.Cys33Tyr missense+splice_region ABCB8 2 49668 4.02674E-5 24834 0 NA
7-150729940-G-A p.Glu35Glu synonymous ABCB8 1 50066 1.99736E-5 25033 0 NA
7-150729950-G-A p.Val39Ile missense ABCB8 1 50332 1.98681E-5 25166 0 3.9335E-5
7-150729957-C-T p.Ala41Val missense ABCB8 6 49870 1.20313E-4 24935 0 5.9952E-4
7-150729966-C-T p.Ala44Val missense ABCB8 3 50352 5.95806E-5 25176 0 5.29661E-4
7-150729970-G-A p.Arg45Arg synonymous ABCB8 1 50470 1.98138E-5 25235 0 NA
7-150730110-CAGCTCTCTT-C n.530_*3delTCTTAGCTC splice_region ABCB8 1 51376 1.94643E-5 25688 0 NA
7-150730120-A-G n.534A>G splice_region ABCB8 1 51382 1.94621E-5 25691 0 7.42942E-6
7-150730530-A-G n.162A>G splice_region ABCB8 1 56164 1.7805E-5 28082 0 NA
7-150730688-A-T c.147-4A>T splice_region ABCB8 15 80480 1.86382E-4 40240 0 2.73848E-5
7-150730689-C-T c.147-3C>T splice_region ABCB8 2 80510 2.48416E-5 40255 0 NA
7-150730689-C-G c.147-3C>G splice_region ABCB8 1 80510 1.24208E-5 40255 0 NA
7-150730708-C-T p.Arg55Cys missense ABCB8 2 81064 2.46719E-5 40532 0 2.7049E-5
7-150730712-G-A p.Ser56Asn missense ABCB8 1129 81084 0.0139238 40542 33 0.0246969
7-150730725-C-G p.Leu60Leu synonymous ABCB8 1 81294 1.2301E-5 40647 0 NA
7-150730726-C-T p.Arg61Trp missense ABCB8 6 81290 7.38098E-5 40645 0 6.65729E-5
7-150730732-G-A p.Val63Met missense ABCB8 4 81304 4.91981E-5 40652 0 6.59734E-5
7-150730743-G-A p.Leu66Leu synonymous ABCB8 30 81348 3.68786E-4 40674 0 8.61684E-4
7-150730744-C-T p.Arg67Trp missense ABCB8 4 81318 4.91896E-5 40659 0 2.99294E-4
7-150730745-G-A p.Arg67Gln missense ABCB8 2 81356 2.45833E-5 40678 0 6.38203E-5
7-150730752-G-C p.Gln69His missense ABCB8 1 81432 1.22802E-5 40716 0 8.47041E-6
7-150730753-C-T p.Leu70Phe missense ABCB8 4 81458 4.91051E-5 40729 0 NA
7-150730772-G-A p.Arg76Gln missense ABCB8 17 81568 2.08415E-4 40784 0 1.17013E-4
7-150730774-G-T p.Ala77Ser missense ABCB8 1 81652 1.22471E-5 40826 0 NA
7-150730779-C-A p.Pro78Pro synonymous ABCB8 3 81870 3.66435E-5 40935 0 1.66453E-5
7-150730779-C-G p.Pro78Pro synonymous ABCB8 2 81870 2.4429E-5 40935 0 8.32265E-6
7-150730779-C-T p.Pro78Pro synonymous ABCB8 3 81870 3.66435E-5 40935 0 1.66453E-5
7-150730799-C-G p.Pro85Arg missense ABCB8 1 82362 1.21415E-5 41181 0 NA
7-150730806-C-T p.Ala87Ala synonymous ABCB8 1 82532 1.21165E-5 41266 0 NA
7-150730806-C-G p.Ala87Ala synonymous ABCB8 2 82532 2.4233E-5 41266 0 6.37633E-5
7-150730809-G-T p.Trp88Cys missense ABCB8 1 82538 1.21156E-5 41269 0 6.37877E-5
7-150730822-G-A p.Gly93Arg missense ABCB8 2 82734 2.41739E-5 41367 0 NA
7-150730825-G-T p.Ala94Ser missense ABCB8 1 82758 1.20834E-5 41379 0 NA
7-150730840-A-G p.Met99Val missense ABCB8 1 82946 1.2056E-5 41473 0 3.9853E-6
7-150730860-C-T p.Pro105Pro synonymous ABCB8 1 82996 1.20488E-5 41498 0 NA
7-150730863-C-T p.His106His synonymous ABCB8 2 83004 2.40952E-5 41502 0 5.03525E-4
7-150730869-C-T p.Cys108Cys synonymous ABCB8 5 82998 6.02424E-5 41499 0 6.37471E-5
7-150730871-T-C p.Leu109Pro missense ABCB8 2 82998 2.4097E-5 41499 0 8.25409E-6
7-150730886-AG-A p.Ala115fs frameshift ABCB8 2 82890 2.41284E-5 41445 0 NA
7-150730897-G-A p.Ala118Thr missense ABCB8 1 82728 1.20878E-5 41364 0 3.18837E-5
7-150730899-C-T p.Ala118Ala synonymous ABCB8 101 82748 0.00122057 41374 0 0.00159469
7-150730900-C-T p.Pro119Ser missense ABCB8 151 82738 0.00182504 41369 0 0.002232
7-150730912-T-C p.Ser123Pro missense ABCB8 3 82578 3.63293E-5 41289 0 1.19793E-5
7-150730915-A-T p.Thr124Ser missense ABCB8 1 82494 1.21221E-5 41247 0 8.25887E-6
7-150730926-C-T p.Val127Val synonymous ABCB8 37 82254 4.49826E-4 41127 0 0.0010523
7-150730927-G-T p.Val148Leu missense+splice_region ABCB8 20 82212 2.43273E-4 41106 0 7.32492E-4
7-150730927-G-A p.Val148Met missense+splice_region ABCB8 2 82212 2.43273E-5 41106 0 3.18959E-5
7-150730936-C-T p.Arg131Cys missense ABCB8 2 81848 2.44355E-5 40924 0 6.37552E-5
7-150730937-G-A p.Arg131His missense ABCB8 15 81764 1.83455E-4 40882 0 1.27543E-4
7-150730966-C-G p.Leu141Val missense ABCB8 537 79928 0.00671855 39964 3 0.00749028
7-150730966-C-T p.Leu141Leu synonymous ABCB8 2 79950 2.50156E-5 39975 0 1.62372E-5
7-150730973-C-A p.Pro143His missense ABCB8 5 79300 6.30517E-5 39650 0 4.0812E-6
7-150730975-C-T p.His144Tyr missense ABCB8 1 79204 1.26256E-5 39602 0 3.18735E-5
7-150730980-G-C p.Leu145Leu synonymous ABCB8 1 78660 1.27129E-5 39330 0 NA
7-150730984-G-A p.Val147Ile missense ABCB8 1 78192 1.2789E-5 39096 0 NA
7-150730998-C-T p.Ala151Ala synonymous ABCB8 3 75658 3.96521E-5 37829 0 9.73159E-5
7-150730999-G-A p.Val152Ile missense ABCB8 3287 74832 0.0439251 37416 64 0.065
7-150731002-G-A p.Val153Met missense+splice_region ABCB8 1 74384 1.34438E-5 37192 0 3.58372E-5
7-150731352-C-G c.460-8C>G splice_region ABCB8 1 82870 1.20671E-5 41435 0 8.39743E-6
7-150731362-G-C p.Trp33Ser missense+splice_region ABCB8 1 82970 1.20525E-5 41485 0 NA
7-150731369-G-A p.Trp35* stop_gained ABCB8 3 83020 3.61359E-5 41510 0 4.00372E-6
7-150731370-G-A p.Gly157Asp missense ABCB8 2 83016 2.40917E-5 41508 0 8.33028E-6
7-150731373-C-T p.Ala158Val missense ABCB8 2 83004 2.40952E-5 41502 0 3.18878E-5
7-150731374-G-A p.Arg37Gln missense ABCB8 3 83018 3.61367E-5 41509 0 9.56328E-5
7-150731380-C-CGTGA p.Asn162fs frameshift ABCB8 1 83076 1.20372E-5 41538 0 1.65656E-5
7-150731380-C-T p.Ser39Leu missense ABCB8 2 83076 2.40743E-5 41538 0 5.19107E-5
7-150731381-G-A p.Val161Met missense ABCB8 15 83076 1.80558E-4 41538 0 6.25E-4
7-150731381-G-T p.Val161Leu missense ABCB8 1 83076 1.20372E-5 41538 0 3.99246E-6
7-150731385-A-G p.Asn162Ser missense ABCB8 1 83128 1.20296E-5 41564 0 NA
7-150731387-G-A p.Val163Ile missense ABCB8 4 83130 4.81174E-5 41565 0 8.26228E-6
7-150731394-T-TCC p.Leu167fs frameshift ABCB8 2 83152 2.40523E-5 41576 0 NA
7-150731398-C-A p.Pro166Pro synonymous ABCB8 5 83206 6.00918E-5 41603 0 2.79029E-5
7-150731400-T-C p.Leu167Pro missense ABCB8 1 83214 1.20172E-5 41607 0 NA
7-150731404-C-A p.Leu168Leu synonymous ABCB8 2 83222 2.40321E-5 41611 0 1.59406E-5
7-150731408-G-A p.Gly170Ser missense ABCB8 1 83222 1.20161E-5 41611 0 8.24416E-6
7-150731419-A-G p.Val173Val synonymous ABCB8 7 83254 8.408E-5 41627 0 1.6484E-5
7-150731425-C-T p.Val175Val synonymous ABCB8 269 83256 0.003231 41628 1 0.00373319
7-150731426-G-A p.Val176Met missense ABCB8 2 83264 2.402E-5 41632 0 2.47223E-5
7-150731449-C-T p.His183His synonymous ABCB8 5 83288 6.00327E-5 41644 0 3.18436E-5
7-150731450-G-A p.Val184Ile missense ABCB8 1 83280 1.20077E-5 41640 0 6.25E-4
7-150731452-A-T p.Val184Val synonymous ABCB8 12 83278 1.44096E-4 41639 0 NA
7-150731452-AG-A p.Ser186fs frameshift ABCB8 2 83278 2.40159E-5 41639 0 NA
7-150731472-C-T p.Ser191Phe missense ABCB8 4 83284 4.80284E-5 41642 0 3.18817E-5
7-150731476-G-C p.Gln192His missense ABCB8 13 83284 1.56092E-4 41642 0 NA
7-150731483-A-C p.Ser195Arg missense ABCB8 29 83270 3.48265E-4 41635 0 8.60914E-4
7-150731488-C-T p.Thr196Thr synonymous ABCB8 2 83272 2.40177E-5 41636 0 1.19404E-5
7-150731505-A-G p.Tyr202Cys missense ABCB8 8 83234 9.61146E-5 41617 0 NA
7-150731511-T-G p.Val204Gly missense ABCB8 2 83222 2.40321E-5 41611 0 NA
7-150731512-CCAGGTACAGCCGGGAGTGGGGCTGGGGACCGCCGAGGAGCCACCCGAGGCATCCCTGAGTGCACTGGGCTCTTTCG-C p.Gly206fs frameshift ABCB8 7 83216 8.41184E-5 41608 0 NA
7-150731519-C-T c.615+4C>T splice_region ABCB8 657 83186 0.00789796 41593 11 0.0165837
7-150731588-G-T c.616-4G>T splice_region ABCB8 41 82916 4.94476E-4 41458 0 7.33372E-4
7-150731603-C-T p.Thr209Thr synonymous ABCB8 1 82850 1.207E-5 41425 0 NA
7-150731604-T-G p.Phe210Val missense ABCB8 1 82836 1.2072E-5 41418 0 8.24375E-6
7-150731607-G-A p.Gly211Arg missense ABCB8 1 82792 1.20785E-5 41396 0 3.98816E-6
7-150731609-G-A p.Gly211Gly synonymous ABCB8 2 82786 2.41587E-5 41393 0 6.37471E-5
7-150731630-C-T p.His218His synonymous ABCB8 353 82690 0.00426896 41345 5 0.00863773
7-150731631-G-A p.Val219Ile missense ABCB8 1 82714 1.20899E-5 41357 0 1.9944E-5
7-150731640-C-G p.Arg222Gly missense ABCB8 5 82622 6.05166E-5 41311 0 3.98759E-5
7-150731640-C-T p.Arg222Cys missense ABCB8 3 82622 3.63099E-5 41311 0 3.18878E-5
7-150731641-G-A p.Arg222His missense ABCB8 1 82636 1.21013E-5 41318 0 1.64919E-5
7-150731648-T-C p.Ala224Ala synonymous ABCB8 1 82668 1.20966E-5 41334 0 7.97022E-6
7-150731655-A-G p.Met227Val missense ABCB8 1 82610 1.21051E-5 41305 0 NA
7-150731658-C-T p.Arg228Trp missense ABCB8 3 82538 3.63469E-5 41269 0 2.47447E-5
7-150731659-G-A p.Arg228Gln missense ABCB8 2 82576 2.42201E-5 41288 0 2.3917E-5
7-150731667-C-T p.Leu231Phe missense ABCB8 1 82622 1.21033E-5 41311 0 NA
7-150731681-G-A p.Leu235Leu synonymous ABCB8 105 82676 0.00127002 41338 0 0.00100705
7-150731685-C-T p.Arg237* stop_gained ABCB8 2 82676 2.41908E-5 41338 0 3.18837E-5
7-150731686-G-A p.Arg237Gln missense+splice_region ABCB8 5 82672 6.048E-5 41336 0 1.99249E-5
7-150731689-A-T c.710+3A>T splice_region ABCB8 3 82696 3.62775E-5 41348 0 7.96737E-6
7-150731808-C-CAG c.711-3_711-2insAG splice_acceptor ABCB8 1 83234 1.20143E-5 41617 0 3.98165E-6
7-150731808-C-G c.711-3C>G splice_region ABCB8 1 83234 1.20143E-5 41617 0 NA
7-150731815-G-C p.Asp239His missense ABCB8 1 83260 1.20106E-5 41630 0 8.26064E-6
7-150731820-C-T p.Ile240Ile synonymous ABCB8 3 83262 3.60308E-5 41631 0 6.37267E-5
7-150731821-A-G p.Thr241Ala missense ABCB8 1 83264 1.201E-5 41632 0 NA
7-150731837-A-G p.Asn246Ser missense ABCB8 1 83284 1.20071E-5 41642 0 3.97763E-6
7-150731855-T-TGGGCCACGGCCCG p.Ser253fs frameshift ABCB8 1 83290 1.20062E-5 41645 0 NA
7-150731856-G-A p.Val252Val synonymous ABCB8 1 83292 1.2006E-5 41646 0 1.23781E-4
7-150731874-C-T p.Asp258Asp synonymous ABCB8 5 83286 6.00341E-5 41643 0 3.30431E-5
7-150731875-G-A p.Val259Met missense ABCB8 5 83268 6.00471E-5 41634 0 6.25E-4
7-150731880-G-A p.Gln260Gln synonymous ABCB8 1 83270 1.20091E-5 41635 0 3.97814E-6
7-150731912-C-T p.Ser271Phe missense ABCB8 1 83042 1.20421E-5 41521 0 NA
7-150731913-C-T p.Ser271Ser synonymous ABCB8 1 83026 1.20444E-5 41513 0 1.19695E-5
7-150731917-G-C c.816+1G>C splice_donor ABCB8 1 82966 1.20531E-5 41483 0 NA
7-150731924-G-T c.816+8G>T splice_region ABCB8 3 82854 3.62083E-5 41427 0 2.00665E-5
7-150732660-C-A c.817-8C>A splice_region ABCB8 1 82130 1.21758E-5 41065 0 NA
7-150732674-C-T p.Arg275* stop_gained ABCB8 2 82312 2.42978E-5 41156 0 5.69166E-5
7-150732675-G-A p.Arg275Gln missense ABCB8 93 82328 0.00112963 41164 2 0.0021856
7-150732681-G-C p.Cys277Ser missense ABCB8 1 82438 1.21303E-5 41219 0 3.18898E-5
7-150732705-T-C p.Val285Ala missense ABCB8 2 82516 2.42377E-5 41258 0 8.00064E-6
7-150732721-G-A p.Leu290Leu synonymous ABCB8 3 82596 3.63214E-5 41298 0 3.99081E-6
7-150732724-G-A p.Ser291Ser synonymous ABCB8 1 82626 1.21027E-5 41313 0 1.66091E-5
7-150732728-C-T p.Arg293Cys missense ABCB8 1 82640 1.21007E-5 41320 0 1.65926E-5
7-150732729-G-A p.Arg293His missense ABCB8 3 82642 3.63012E-5 41321 0 5.98473E-5
7-150732736-G-A p.Thr295Thr synonymous ABCB8 3 82720 3.62669E-5 41360 0 9.56984E-5
7-150732752-G-A p.Ala301Thr missense ABCB8 2 82858 2.41377E-5 41429 0 1.59407E-5
7-150732757-A-C p.Thr302Thr synonymous ABCB8 1 82890 1.20642E-5 41445 0 1.19509E-5
7-150732766-G-T p.Leu305Leu synonymous ABCB8 1 82962 1.20537E-5 41481 0 NA
7-150732781-C-A p.Thr310Thr synonymous ABCB8 3 83018 3.61367E-5 41509 0 5.03525E-4
7-150732784-G-A p.Leu311Leu synonymous ABCB8 1 83022 1.2045E-5 41511 0 6.37552E-5
7-150732789-G-T p.Gly313Val missense ABCB8 1 83026 1.20444E-5 41513 0 9.56511E-5
7-150732800-C-T p.Arg317* stop_gained ABCB8 1 83036 1.2043E-5 41518 0 NA
7-150732801-G-A p.Arg317Gln missense ABCB8 2 83042 2.40842E-5 41521 0 2.47893E-5
7-150732809-T-G p.Ser320Ala missense ABCB8 7 83072 8.42643E-5 41536 0 1.32207E-4
7-150732812-C-T p.Arg321Cys missense ABCB8 3733 82972 0.0449911 41486 107 0.0442659
7-150732813-G-T p.Arg321Leu missense ABCB8 2 83046 2.4083E-5 41523 0 7.98027E-6
7-150732816-A-T p.Gln322Leu missense ABCB8 1 83064 1.20389E-5 41532 0 3.18817E-5
7-150732818-T-C p.Cys323Arg missense ABCB8 1 83062 1.20392E-5 41531 0 NA
7-150732825-AGCAGGTACCGGCATTCCTGGCCATCCTCTTCACCCTCCCCACACCGTTTCTCTTTCCACTCCCCGGAACTCCTCCCTGTCCCCATCCTGGACTCCTTGTCCTGTTTTCTGGACTCCTTGTCCTGTTTCCTGGACTCCTT-A c.978+1_979-1del splice_acceptor ABCB8 1 83022 1.2045E-5 41511 0 NA
7-150732825-A-G p.Glu325Gly missense ABCB8 1 83022 1.2045E-5 41511 0 NA
7-150732828-A-C p.Gln326Pro missense+splice_region ABCB8 1 83030 1.20438E-5 41515 0 3.18715E-5
7-150732833-C-T c.978+4C>T splice_region ABCB8 2 82980 2.41022E-5 41490 0 NA
7-150732834-C-T c.978+5C>T splice_region ABCB8 24 82990 2.89191E-4 41495 0 3.50676E-4
7-150732835-G-A c.978+6G>A splice_region ABCB8 4 82970 4.82102E-5 41485 0 4.80731E-5
7-150732932-TCTGGACTCCTTGTCCTGTTTC-T c.979-24_979-4delTCCTGTTTCCTGGACTCCTTG splice_region ABCB8 2 83002 2.40958E-5 41501 0 3.21357E-5
7-150732963-T-C c.979-6T>C splice_region ABCB8 1 83056 1.20401E-5 41528 0 8.26105E-6
7-150732964-T-C c.979-5T>C splice_region ABCB8 2 83050 2.40819E-5 41525 0 3.99658E-6
7-150732969-A-G p.Ile327Val missense+splice_region ABCB8 2 83046 2.4083E-5 41523 0 8.2605E-6
7-150732972-G-A p.Ala328Thr missense ABCB8 4 83048 4.81649E-5 41524 0 6.79071E-5
7-150732985-G-A p.Gly332Asp missense ABCB8 3 83036 3.61289E-5 41518 0 8.25859E-6
7-150732987-G-A p.Val333Ile missense ABCB8 9 83040 1.08382E-4 41520 0 6.04941E-4
7-150732995-CGAG-C p.Glu336del disruptive_inframe_deletion ABCB8 1 83032 1.20435E-5 41516 0 5.78082E-5
7-150732995-C-T p.Asp335Asp synonymous ABCB8 1 83032 1.20435E-5 41516 0 2.22958E-4
7-150733014-C-T p.Arg342Trp missense ABCB8 1 82972 1.20523E-5 41486 0 3.98632E-6
7-150733015-G-A p.Arg342Gln missense ABCB8 1 82980 1.20511E-5 41490 0 4.13073E-5
7-150733022-G-A p.Val344Val synonymous ABCB8 4 82948 4.8223E-5 41474 0 9.55597E-5
7-150733023-C-T p.Arg345Cys missense ABCB8 1 82922 1.20595E-5 41461 0 1.19618E-5
7-150733023-CGT-TGA p.Arg345* stop_gained ABCB8 1 82922 1.20595E-5 41461 0 NA
7-150733024-GT-AA p.Arg345Gln missense ABCB8 1 82934 1.20578E-5 41467 0 NA
7-150733025-T-A p.Arg345Arg synonymous ABCB8 26124 82482 0.316724 41241 4177 0.355
7-150733032-G-A p.Ala348Thr missense ABCB8 3 82910 3.61838E-5 41455 0 5.18441E-5
7-150733034-C-T p.Ala348Ala synonymous ABCB8 224 82910 0.00270172 41455 1 0.00806452
7-150733043-A-G p.Gln351Gln synonymous ABCB8 1 82866 1.20677E-5 41433 0 1.19622E-5
7-150733044-C-T p.Arg352Trp missense ABCB8 1 82840 1.20715E-5 41420 0 4.15731E-5
7-150733045-G-A p.Arg352Gln missense ABCB8 1 82838 1.20718E-5 41419 0 3.18573E-5
7-150733046-G-A p.Arg352Arg synonymous ABCB8 2 82846 2.41412E-5 41423 0 3.18613E-5
7-150733053-G-C p.Glu355Gln missense+splice_region ABCB8 1 82818 1.20747E-5 41409 0 NA
7-150733054-AGTGAGTCCTGGGAGGGCGGAGCACAAAGCAGAGATGCCCCCCACACCCTGCCAACCCTTCGTGCCAGCCCAGCTGCCTCCTGAATGCACTGGTCTCTCTCACCAG-A p.Glu355fs frameshift ABCB8 7 82812 8.45288E-5 41406 3 NA
7-150733054-A-C p.Glu355Ala missense+splice_region ABCB8 1 82814 1.20753E-5 41407 0 6.37511E-5
7-150733165-A-G p.Tyr357Cys missense ABCB8 1 81368 1.22898E-5 40684 0 6.10596E-5
7-150733168-G-A p.Gly358Glu missense ABCB8 2 81484 2.45447E-5 40742 0 NA
7-150733171-C-T p.Ala359Val missense ABCB8 1 81452 1.22772E-5 40726 0 NA
7-150733188-C-T p.Arg365Cys missense ABCB8 3 81914 3.66238E-5 40957 0 3.47675E-5
7-150733190-C-T p.Arg365Arg synonymous ABCB8 1 81944 1.22035E-5 40972 0 1.73575E-5
7-150733194-C-T p.Arg367Trp missense ABCB8 3 81996 3.65871E-5 40998 0 3.18634E-5
7-150733195-G-A p.Arg367Gln missense ABCB8 2 82010 2.43873E-5 41005 0 6.25782E-4
7-150733208-G-A p.Leu371Leu synonymous ABCB8 1 82082 1.21829E-5 41041 0 8.69868E-6
7-150733212-C-T p.Arg373Cys missense ABCB8 1 82060 1.21862E-5 41030 0 1.27462E-4
7-150733213-G-A p.Arg373His missense ABCB8 14 82040 1.70648E-4 41020 0 0.00100908
7-150733214-C-T p.Arg373Arg synonymous ABCB8 2 82018 2.43849E-5 41009 0 2.61739E-5
7-150733215-G-A p.Gly374Ser missense ABCB8 2 82046 2.43766E-5 41023 0 0.00125156
7-150733220-C-T p.Ile375Ile synonymous ABCB8 1 81976 1.21987E-5 40988 0 3.18613E-5
7-150733221-G-A p.Ala376Thr missense ABCB8 2 81908 2.44176E-5 40954 0 8.76163E-6
7-150733223-C-G p.Ala376Ala synonymous ABCB8 1 81926 1.22061E-5 40963 0 NA
7-150733229-C-T p.Phe378Phe synonymous ABCB8 2 81856 2.44332E-5 40928 0 8.44248E-5
7-150733242-A-G p.Asn383Asp missense ABCB8 1 81656 1.22465E-5 40828 0 NA
7-150733247-C-T p.Ile384Ile synonymous ABCB8 6 81484 7.36341E-5 40742 0 0.00100908
7-150733248-G-A p.Ala385Thr missense ABCB8 1 81392 1.22862E-5 40696 0 9.55414E-5
7-150733249-C-T p.Ala385Val missense ABCB8 1 81376 1.22886E-5 40688 0 9.36996E-6
7-150733250-C-G p.Ala385Ala synonymous ABCB8 1 81404 1.22844E-5 40702 0 NA
7-150733650-A-T p.Leu394Leu synonymous ABCB8 1 80186 1.2471E-5 40093 0 5.03525E-4
7-150733669-G-T p.Val401Leu missense ABCB8 4 80488 4.96968E-5 40244 0 3.18573E-5
7-150733674-C-T p.Ala402Ala synonymous ABCB8 4 80526 4.96734E-5 40263 0 3.32088E-5
7-150733675-G-A p.Gly403Arg missense ABCB8 1 80528 1.2418E-5 40264 0 5.03525E-4
7-150733678-C-T p.Gln404* stop_gained ABCB8 1 80536 1.24168E-5 40268 0 9.15218E-5
7-150733683-G-T p.Gln405His missense ABCB8 1 80550 1.24146E-5 40275 0 NA
7-150733688-CAG-C p.Gly409fs frameshift ABCB8 6 80556 7.44823E-5 40278 0 7.51202E-5
7-150733689-A-G p.Thr407Thr synonymous ABCB8 6 80550 7.44879E-5 40275 0 3.6259E-5
7-150733691-G-C p.Gly408Ala missense ABCB8 8 80536 9.93345E-5 40268 0 8.35296E-5
7-150733736-G-A p.Arg423Lys missense+splice_region ABCB8 1 80076 1.24881E-5 40038 0 8.59683E-6
7-150733941-G-T c.1329-7G>T splice_region ABCB8 2 61578 3.24791E-5 30789 0 3.18552E-5
7-150733948-G-A p.Arg443Arg splice_region+synonymous ABCB8 1 61008 1.63913E-5 30504 0 NA
7-150733952-G-A c.1332+1G>A splice_donor ABCB8 1 60572 1.65093E-5 30286 0 3.18492E-5
7-150733955-C-T c.1332+4C>T splice_region ABCB8 1 60270 1.6592E-5 30135 0 2.84657E-5
7-150734252-CT-C c.1218-3delT splice_region ABCB8 1 52272 1.91307E-5 26136 0 3.18512E-5
7-150734254-A-C c.1218-2A>C splice_acceptor ABCB8 1 52280 1.91278E-5 26140 0 3.18634E-5
7-150734259-C-T p.Asp407Asp synonymous ABCB8 2 52270 3.82629E-5 26135 0 7.42776E-5
7-150734260-G-A p.Val408Ile missense ABCB8 3 52268 5.73965E-5 26134 0 6.37146E-5
7-150734262-C-T p.Val408Val synonymous ABCB8 2 52280 3.82555E-5 26140 0 1.48546E-5
7-150734332-C-T p.Leu408Phe missense ABCB8 1 52310 1.91168E-5 26155 0 3.18552E-5
7-150734336-G-A p.Arg409His missense ABCB8 1 52310 1.91168E-5 26155 0 2.22572E-5
7-150734337-T-C p.Arg409Arg synonymous ABCB8 2 52310 3.82336E-5 26155 0 7.4195E-6
7-150734351-C-T p.Pro414Leu missense ABCB8 2 52300 3.82409E-5 26150 0 9.55597E-5
7-150734352-G-A p.Pro414Pro synonymous ABCB8 5 52298 9.5606E-5 26149 0 0.001875
7-150734353-A-G p.Asn415Asp missense ABCB8 1 52296 1.91219E-5 26148 0 7.41895E-6
7-150734363-C-T p.Pro418Leu missense ABCB8 3 52284 5.73789E-5 26142 0 7.41972E-6
7-150734364-G-T c.414-7G>T splice_region ABCB8 2455 52240 0.0469946 26120 81 0.0442433
7-150734364-G-A c.414-7G>A splice_region ABCB8 1 52282 1.9127E-5 26141 0 8.06972E-5
7-150734367-G-C c.414-4G>C splice_region ABCB8 1 52282 1.9127E-5 26141 0 NA
7-150734368-C-T p.Gln420* stop_gained ABCB8 1 52284 1.91263E-5 26142 0 6.37105E-5
7-150734380-T-C p.Phe424Leu missense ABCB8 16545 51810 0.31934 25905 2622 0.363058
7-150734388-A-C p.Ala426Ala synonymous ABCB8 1 52210 1.91534E-5 26105 0 NA
7-150734392-A-G p.Lys428Glu missense ABCB8 2 52200 3.83142E-5 26100 0 3.18715E-5
7-150734393-A-T p.Lys428Met missense ABCB8 1 52196 1.91586E-5 26098 0 NA
7-150734673-T-A c.*296T>A splice_region ABCB8 1 7716 1.29601E-4 3858 0 NA
7-150737354-G-C c.1269-1G>C splice_acceptor ABCB8 1 83108 1.20325E-5 41554 0 NA
7-150737355-G-A p.Val445Ile missense+splice_region ABCB8 10 83108 1.20325E-4 41554 0 1.82089E-4
7-150737387-A-G p.Gln434Arg missense+splice_region ABCB8 1 83094 1.20346E-5 41547 0 8.27664E-6
7-150737582-C-T c.1303-3C>T splice_region ABCB8 2 82954 2.41097E-5 41477 0 NA
7-150737584-G-C c.1303-1G>C splice_acceptor ABCB8 2 82956 2.41092E-5 41478 0 4.01616E-6
7-150737590-C-G p.Pro458Ala missense ABCB8 1 82936 1.20575E-5 41468 0 NA
7-150737592-G-A p.Arg437Gln missense ABCB8 2 82936 2.4115E-5 41468 0 3.19E-5
7-150737613-G-A p.Arg444Gln missense ABCB8 2 82896 2.41266E-5 41448 0 2.79212E-5
7-150737622-A-C p.Ter468Cysext*? stop_lost ABCB8 1 82888 1.20645E-5 41444 0 NA
7-150737623-G-C p.Glu447Asp missense ABCB8 1 82880 1.20656E-5 41440 0 NA
7-150737631-C-T p.Ala450Val missense ABCB8 1 82810 1.20758E-5 41405 0 NA
7-150737638-C-T p.Asn452Asn synonymous ABCB8 13 82754 1.57092E-4 41377 0 2.23243E-4
7-150737646-T-A p.Ile455Asn missense ABCB8 6 82738 7.25181E-5 41369 0 6.37755E-5
7-150737651-C-T p.Leu457Leu synonymous ABCB8 1 82742 1.20858E-5 41371 0 NA
7-150737655-C-G p.Ser458Cys missense ABCB8 1 82710 1.20904E-5 41355 0 NA
7-150737655-C-T p.Ser458Phe missense ABCB8 1 82710 1.20904E-5 41355 0 NA
7-150737657-G-T p.Gly459Trp missense ABCB8 1 82700 1.20919E-5 41350 0 1.99259E-5
7-150737668-C-T p.Cys462Cys synonymous ABCB8 1 82658 1.2098E-5 41329 0 3.18939E-5
7-150737669-G-A p.Val463Ile missense ABCB8 7 82660 8.46843E-5 41330 0 4.14326E-5
7-150737673-C-G p.Pro464Arg missense ABCB8 18 82696 2.17665E-4 41348 0 0.003125
7-150737680-G-A p.Glu466Glu synonymous ABCB8 1 82704 1.20913E-5 41352 0 8.29229E-6
7-150737688-G-T p.Arg469Leu missense ABCB8 608 82662 0.00735525 41331 10 0.0145399
7-150737688-G-C p.Arg469Pro missense ABCB8 1 82690 1.20934E-5 41345 0 NA
7-150737695-C-T p.Ser471Ser synonymous ABCB8 25 82676 3.02385E-4 41338 0 2.82453E-4
7-150737696-G-A p.Val472Ile missense ABCB8 4 82662 4.83898E-5 41331 0 3.18857E-5
7-150737700-C-A p.Thr473Lys missense ABCB8 1 82674 1.20957E-5 41337 0 2.49476E-5
7-150737702-T-C p.Phe474Leu missense ABCB8 1 82686 1.20939E-5 41343 0 8.31712E-6
7-150737707-G-C p.Gln475His missense ABCB8 2 82670 2.41926E-5 41335 0 NA
7-150737710-C-T p.Asn476Asn synonymous ABCB8 1 82664 1.20972E-5 41332 0 1.66606E-5
7-150737711-G-A p.Val477Ile missense ABCB8 19 82642 2.29907E-4 41321 0 1.31822E-4
7-150737723-T-G c.1439+2T>G splice_donor ABCB8 1 82586 1.21086E-5 41293 0 4.00048E-6
7-150737723-T-A c.1439+2T>A splice_donor ABCB8 1 82586 1.21086E-5 41293 0 8.35436E-6
7-150737729-C-T c.1439+8C>T splice_region ABCB8 15 82476 1.81871E-4 41238 0 6.37755E-5
7-150737732-G-A c.*1210+1G>A splice_donor ABCB8 1 82484 1.21236E-5 41242 0 1.6756E-5
7-150737733-T-A c.*1210+2T>A splice_donor ABCB8 2 82478 2.42489E-5 41239 0 NA
7-150737735-A-AG c.*1210+4_*1210+5insG splice_region ABCB8 9 82468 1.09133E-4 41234 0 1.00298E-4
7-150737925-C-T p.Arg484Cys missense ABCB8 3 82120 3.65319E-5 41060 0 2.23357E-4
7-150737926-G-A p.Arg484His missense ABCB8 1 82130 1.21758E-5 41065 0 3.19183E-5
7-150737930-CGGCTTCGA-C p.Phe487fs frameshift ABCB8 1 82138 1.21746E-5 41069 0 1.86074E-5
7-150737930-C-T p.Pro485Pro synonymous ABCB8 9 82138 1.09572E-4 41069 0 7.44297E-5
7-150737931-G-A p.Gly486Ser missense ABCB8 5 82058 6.09325E-5 41029 0 1.10791E-4
7-150737936-C-T p.Phe487Phe synonymous ABCB8 1 82262 1.21563E-5 41131 0 NA
7-150737937-G-A p.Glu488Lys missense ABCB8 2 82274 2.4309E-5 41137 0 1.78044E-5
7-150737938-A-G p.Glu488Gly missense ABCB8 1 82320 1.21477E-5 41160 0 NA
7-150737940-G-A p.Val489Met missense ABCB8 1 82356 1.21424E-5 41178 0 1.91339E-4
7-150737948-A-G p.Lys491Lys synonymous ABCB8 3 82438 3.6391E-5 41219 0 4.31634E-6
7-150737955-AC-A p.Leu495fs frameshift ABCB8 1 82396 1.21365E-5 41198 0 NA
7-150737963-G-A p.Thr496Thr synonymous ABCB8 1 82406 1.2135E-5 41203 0 1.53008E-5
7-150737966-G-A p.Leu497Leu synonymous ABCB8 1 82418 1.21333E-5 41209 0 8.51013E-6
7-150737970-C-G p.Pro499Ala missense ABCB8 3 82436 3.63919E-5 41218 0 1.48161E-5
7-150737973-G-A p.Gly500Ser missense ABCB8 1 82422 1.21327E-5 41211 0 4.23837E-6
7-150737974-G-A p.Gly500Asp missense ABCB8 1 82416 1.21336E-5 41208 0 NA
7-150737979-A-C p.Ile502Leu missense ABCB8 2 82428 2.42636E-5 41214 0 4.23388E-6
7-150737981-C-T p.Ile502Ile synonymous ABCB8 2 82420 2.4266E-5 41210 0 1.47593E-5
7-150737981-C-G p.Ile502Met missense ABCB8 2 82420 2.4266E-5 41210 0 1.47593E-5
7-150737991-G-A p.Val506Met missense ABCB8 4 82320 4.85909E-5 41160 0 6.38284E-5
7-150738005-C-T p.Gly510Gly synonymous ABCB8 215 82260 0.00261366 41130 1 0.00201816
7-150738006-G-A p.Gly511Arg missense ABCB8 2 82278 2.43078E-5 41139 0 9.56999E-5
7-150738180-C-T c.1535-6C>T splice_region ABCB8 375 83062 0.0045147 41531 0 0.00353005
7-150738187-A-G p.Gly512Gly splice_region+synonymous ABCB8 1 83102 1.20334E-5 41551 0 NA
7-150738193-C-G p.Thr514Thr synonymous ABCB8 2 83094 2.40691E-5 41547 0 NA
7-150738196-C-T p.Thr515Thr synonymous ABCB8 1 83100 1.20337E-5 41550 0 1.65552E-5
7-150738197-G-A p.Val516Met missense ABCB8 1 83094 1.20346E-5 41547 0 3.31104E-5
7-150738198-T-G p.Val516Gly missense ABCB8 1 83094 1.20346E-5 41547 0 3.98451E-6
7-150738205-C-G p.Ser518Ser synonymous ABCB8 1 83096 1.20343E-5 41548 0 3.18613E-5
7-150738221-T-C p.Tyr524His missense ABCB8 7 83092 8.4244E-5 41546 0 7.46516E-5
7-150738232-G-A p.Thr527Thr synonymous ABCB8 3 83026 3.61333E-5 41513 0 6.25E-4
7-150738238-C-T p.Gly529Gly synonymous ABCB8 1 82996 1.20488E-5 41498 0 9.98868E-5
7-150738239-G-A p.Val530Met missense ABCB8 12 82994 1.44589E-4 41497 0 3.41297E-4
7-150738240-T-A p.Val530Glu missense ABCB8 1 82980 1.20511E-5 41490 0 4.01365E-6
7-150738258-G-A p.Arg536Gln missense ABCB8 1 82894 1.20636E-5 41447 0 5.85686E-5
7-150738259-G-A p.Arg536Arg synonymous ABCB8 1 82898 1.2063E-5 41449 0 NA
7-150738261-AC-A p.Leu538fs frameshift ABCB8 1 82828 1.20732E-5 41414 0 NA
7-150738266-C-T p.Arg539Cys missense ABCB8 1 82818 1.20747E-5 41409 0 1.6783E-5
7-150738267-G-A p.Arg539His missense ABCB8 1 82816 1.2075E-5 41408 0 3.18735E-5
7-150738290-C-T p.Arg547Trp missense ABCB8 2 82654 2.41973E-5 41327 0 3.4195E-5
7-150738292-G-A p.Arg547Arg synonymous ABCB8 3 82622 3.63099E-5 41311 0 NA
7-150738293-G-A p.Gly548Ser missense ABCB8 2 82614 2.4209E-5 41307 0 6.25E-4
7-150738297-A-G p.Gln549Arg missense ABCB8 1 82552 1.21136E-5 41276 0 8.62977E-6
7-150738304-C-A p.Val551Val synonymous ABCB8 1 82418 1.21333E-5 41209 0 8.36365E-6
7-150738305-G-A p.Gly552Ser missense ABCB8 1 82386 1.2138E-5 41193 0 2.62206E-5
7-150738307-C-T p.Gly552Gly synonymous ABCB8 13 82368 1.57828E-4 41184 0 5.04032E-4
7-150738310-C-T p.Phe553Phe synonymous ABCB8 1 82334 1.21457E-5 41167 0 NA
7-150738313-C-G p.Ile554Met missense ABCB8 3 82308 3.64485E-5 41154 0 1.77506E-5
7-150738323-C-T c.1668+4C>T splice_region ABCB8 1 81986 1.21972E-5 40993 0 9.03163E-6
7-150738324-G-A c.1668+5G>A splice_region ABCB8 4 81960 4.88043E-5 40980 0 4.54422E-5
7-150738326-G-A c.1668+7G>A splice_region ABCB8 2 81930 2.44111E-5 40965 0 9.10664E-6
7-150739040-A-G c.1669-8A>G splice_region ABCB8 2 82882 2.41307E-5 41441 0 NA
7-150739045-C-T c.1669-3C>T splice_region ABCB8 1 82948 1.20557E-5 41474 0 NA
7-150739053-C-T p.Pro558Pro synonymous ABCB8 3 83014 3.61385E-5 41507 0 5.04032E-4
7-150739054-G-A p.Val559Ile missense ABCB8 2771 82930 0.0334137 41465 59 0.055
7-150739059-G-C p.Leu560Leu synonymous ABCB8 2 83044 2.40836E-5 41522 0 NA
7-150739067-C-T p.Thr563Met missense ABCB8 6 83056 7.22404E-5 41528 0 1.66803E-5
7-150739080-A-T p.Glu567Asp missense ABCB8 1 83072 1.20378E-5 41536 0 NA
7-150739083-C-T p.Asn568Asn synonymous ABCB8 4 83084 4.8144E-5 41542 0 NA
7-150739086-C-T p.Ile569Ile synonymous ABCB8 1 83092 1.20349E-5 41546 0 NA
7-150739087-C-T p.Arg570Cys missense ABCB8 2 83090 2.40703E-5 41545 0 5.04541E-4
7-150739096-A-C p.Lys573Gln missense ABCB8 1 83082 1.20363E-5 41541 0 NA
7-150739098-G-A p.Lys573Lys synonymous ABCB8 1 83078 1.20369E-5 41539 0 3.1837E-5
7-150739109-C-G p.Ser577Cys missense ABCB8 17 83088 2.04602E-4 41544 0 0.0025
7-150739110-C-T p.Ser577Ser synonymous ABCB8 1 83084 1.2036E-5 41542 0 4.15787E-5
7-150739111-G-A p.Asp578Asn missense ABCB8 14 83098 1.68476E-4 41549 0 1.3301E-4
7-150739121-T-C p.Val581Ala missense ABCB8 1 83108 1.20325E-5 41554 0 NA
7-150739131-C-T p.Ala584Ala synonymous ABCB8 12 83102 1.44401E-4 41551 0 3.18512E-5
7-150739132-G-T p.Ala585Ser missense ABCB8 2 83102 2.40668E-5 41551 0 NA
7-150739134-C-T p.Ala585Ala synonymous ABCB8 3 83092 3.61046E-5 41546 0 NA
7-150739135-C-T p.Arg586Trp missense ABCB8 31 83100 3.73045E-4 41550 0 6.25391E-4
7-150739142-C-T p.Ala588Val missense ABCB8 1 83094 1.20346E-5 41547 0 3.18451E-5
7-150739144-A-T p.Asn589Tyr missense ABCB8 1 83102 1.20334E-5 41551 0 NA
7-150739153-G-A p.Glu592Lys missense ABCB8 8 83056 9.63206E-5 41528 0 1.2752E-4
7-150739161-C-G p.Ile594Met missense ABCB8 1 83036 1.2043E-5 41518 0 8.29793E-6
7-150739161-C-T p.Ile594Ile synonymous ABCB8 1 83036 1.2043E-5 41518 0 NA
7-150739163-C-G p.Thr595Ser missense ABCB8 1 83026 1.20444E-5 41513 0 NA
7-150739170-C-T p.Phe597Phe synonymous ABCB8 1 83000 1.20482E-5 41500 0 3.18451E-5
7-150739174-G-A p.Glu599Lys missense ABCB8 9 82918 1.08541E-4 41459 0 1.27397E-4
7-150739178-G-A p.Gly600Asp missense ABCB8 2 82876 2.41324E-5 41438 0 NA
7-150739187-C-T p.Thr603Met missense ABCB8 7 82730 8.46126E-5 41365 0 3.18431E-5
7-150739192-G-A p.Val605Ile missense ABCB8 4 82556 4.8452E-5 41278 0 6.25782E-4
7-150739194-C-T p.Val605Val splice_region+synonymous ABCB8 2 82494 2.42442E-5 41247 0 8.31117E-6
7-150739195-G-A p.Gly606Ser missense+splice_region ABCB8 1 82482 1.21239E-5 41241 0 3.18451E-5
7-150741058-G-A p.Gly606Asp missense+splice_region ABCB8 2 80348 2.48917E-5 40174 0 NA
7-150741064-G-A p.Arg608Gln missense ABCB8 1 80524 1.24187E-5 40262 0 1.62825E-5
7-150741068-C-T p.Gly609Gly synonymous ABCB8 2 80598 2.48145E-5 40299 0 7.0594E-5
7-150741080-T-G p.Ser613Ser synonymous ABCB8 2 80996 2.46926E-5 40498 0 NA
7-150741096-C-T p.Arg619Cys missense ABCB8 1 81304 1.22995E-5 40652 0 9.57426E-5
7-150741097-G-A p.Arg619His missense ABCB8 3 81334 3.68849E-5 40667 0 2.42618E-5
7-150741107-C-T p.Ile622Ile synonymous ABCB8 4 81610 4.90136E-5 40805 0 6.25E-4
7-150741108-G-A p.Ala623Thr missense ABCB8 2 81606 2.4508E-5 40803 0 3.62979E-5
7-150741112-G-A p.Arg624Gln missense ABCB8 1 81856 1.22166E-5 40928 0 2.41478E-5
7-150741117-C-T p.Leu626Phe missense ABCB8 1 82048 1.2188E-5 41024 0 NA
7-150741122-C-A p.Ile627Ile synonymous ABCB8 2 82138 2.43493E-5 41069 0 NA
7-150741125-G-A p.Lys628Lys synonymous ABCB8 1 82166 1.21705E-5 41083 0 1.60533E-5
7-150741134-G-A p.Thr631Thr synonymous ABCB8 3 82320 3.64431E-5 41160 0 4.30893E-5
7-150741140-G-A p.Leu633Leu synonymous ABCB8 1 82424 1.21324E-5 41212 0 NA
7-150741142-T-C p.Ile634Thr missense ABCB8 1 82464 1.21265E-5 41232 0 8.57295E-6
7-150741144-C-T p.Leu635Leu synonymous ABCB8 4 82490 4.84907E-5 41245 0 4.00061E-6
7-150741153-G-A p.Ala638Thr missense ABCB8 1 82542 1.2115E-5 41271 0 3.99776E-6
7-150741162-G-A p.Ala641Thr missense ABCB8 1 82614 1.21045E-5 41307 0 5.03525E-4
7-150741163-C-T p.Ala641Val missense ABCB8 1 82630 1.21021E-5 41315 0 3.18979E-5
7-150741164-G-A p.Ala641Ala synonymous ABCB8 3 82656 3.6295E-5 41328 0 2.54578E-5
7-150741171-G-A p.Ala644Thr missense ABCB8 2 82696 2.4185E-5 41348 0 NA
7-150741179-C-T p.Ser646Ser synonymous ABCB8 1 82714 1.20899E-5 41357 0 3.19101E-5
7-150741180-G-A p.Glu647Lys missense ABCB8 2 82684 2.41885E-5 41342 0 3.9887E-6
7-150741183-C-T p.Arg648Trp missense ABCB8 69 82704 8.34301E-4 41352 0 0.00178697
7-150741184-G-A p.Arg648Gln missense ABCB8 6 82734 7.25216E-5 41367 0 5.03525E-4
7-150741191-A-G p.Val650Val synonymous ABCB8 285 82710 0.00344577 41355 4 0.00823492
7-150741193-A-G p.Gln651Arg missense ABCB8 15 82686 1.81409E-4 41343 0 3.509E-4
7-150741199-C-T p.Ala653Val missense ABCB8 1 82624 1.2103E-5 41312 0 3.9861E-6
7-150741202-T-C p.Leu654Pro missense ABCB8 1 82596 1.21071E-5 41298 0 3.98572E-6
7-150741206-C-T p.Asp655Asp synonymous ABCB8 2 82510 2.42395E-5 41255 0 NA
7-150741207-C-T p.Arg656Trp missense ABCB8 3 82480 3.63725E-5 41240 0 6.38203E-5
7-150741207-C-A p.Arg656Arg synonymous ABCB8 1 82480 1.21242E-5 41240 0 3.19101E-5
7-150741207-C-G p.Arg656Gly missense ABCB8 1 82480 1.21242E-5 41240 0 NA
7-150741208-G-A p.Arg656Gln missense ABCB8 1 82478 1.21244E-5 41239 0 7.51064E-5
7-150741222-C-T p.Arg661Cys missense ABCB8 1 82324 1.21471E-5 41162 0 3.18979E-5
7-150741226-C-T p.Thr662Met missense ABCB8 1 82356 1.21424E-5 41178 0 3.18898E-5
7-150741227-G-A p.Thr662Thr synonymous ABCB8 3 82324 3.64414E-5 41162 0 5.18333E-5
7-150741247-G-A p.Arg669Gln missense ABCB8 6 82072 7.31065E-5 41036 0 3.31274E-5
7-150741262-G-A p.Arg674His missense ABCB8 2 81960 2.44021E-5 40980 0 6.62186E-5
7-150741264-G-A p.Gly675Arg missense ABCB8 1 81932 1.22052E-5 40966 0 4.00378E-6
7-150741265-G-T p.Gly675Val missense ABCB8 1 81954 1.2202E-5 40977 0 NA
7-150741275-C-T p.Cys678Cys synonymous ABCB8 1 81902 1.22097E-5 40951 0 NA
7-150741276-A-G p.Ile679Val missense ABCB8 3 81924 3.66193E-5 40962 0 NA
7-150741285-A-G p.Met682Val missense ABCB8 2 81920 2.44141E-5 40960 0 3.31653E-5
7-150741290-C-T p.Ala683Ala synonymous ABCB8 8 81902 9.76777E-5 40951 0 3.21761E-5
7-150741291-G-A p.Asp684Asn missense ABCB8 2 81912 2.44164E-5 40956 0 3.18796E-5
7-150741293-T-C p.Asp684Asp synonymous ABCB8 2 81934 2.44099E-5 40967 0 3.18837E-5
7-150741297-C-T p.Arg686Cys missense ABCB8 6 81864 7.32923E-5 40932 0 5.04032E-4
7-150741298-G-A p.Arg686His missense ABCB8 6 81878 7.32798E-5 40939 0 5.04032E-4
7-150741304-G-C p.Trp688Ser missense ABCB8 2 81908 2.44176E-5 40954 0 1.21105E-5
7-150741311-T-C c.2067+3T>C splice_region ABCB8 1 81848 1.22178E-5 40924 0 8.33056E-6
7-150741314-T-A c.2067+6T>A splice_region ABCB8 2 81814 2.44457E-5 40907 0 NA
7-150741316-G-T c.2067+8G>T splice_region ABCB8 1 81790 1.22264E-5 40895 0 5.84307E-5
7-150742311-G-A p.Glu695Lys missense ABCB8 1 82596 1.21071E-5 41298 0 8.56663E-6
7-150742313-G-A p.Glu695Glu synonymous ABCB8 2 82622 2.42066E-5 41311 0 3.18695E-5
7-150742313-G-T p.Glu695Asp missense ABCB8 7 82622 8.47232E-5 41311 0 1.2821E-5
7-150742322-G-C p.Lys698Asn missense ABCB8 1 82582 1.21092E-5 41291 0 NA
7-150742325-A-AGGCG p.Leu702fs frameshift ABCB8 1 82586 1.21086E-5 41293 0 8.51861E-6
7-150742325-A-G p.Lys699Lys synonymous ABCB8 2 82586 2.42172E-5 41293 0 0.00100705
7-150742328-C-T p.Gly700Gly synonymous ABCB8 15 82578 1.81646E-4 41289 0 1.99983E-4
7-150742332-C-CTATA p.Ala704fs frameshift ABCB8 1 82630 1.21021E-5 41315 0 8.3654E-6
7-150742335-TAC-T p.Tyr703fs frameshift ABCB8 1 82712 1.20901E-5 41356 0 NA
7-150742340-C-T p.Ala704Ala synonymous ABCB8 2 82756 2.41674E-5 41378 0 3.18674E-5
7-150742342-A-G p.Glu705Gly missense ABCB8 1 82746 1.20852E-5 41373 0 8.33973E-6
7-150742350-C-T p.Arg708Trp missense ABCB8 1 82732 1.20872E-5 41366 0 8.33431E-6
7-150742368-G-T p.Ala714Ser missense ABCB8 1 82688 1.20937E-5 41344 0 NA
7-150742372-C-T p.Pro715Leu missense ABCB8 2 82670 2.41926E-5 41335 0 4.12971E-6
7-150742372-C-G p.Pro715Arg missense ABCB8 1 82670 1.20963E-5 41335 0 4.12971E-6
7-150742373-G-A p.Pro715Pro synonymous ABCB8 3 82644 3.63003E-5 41322 0 2.51227E-5
7-150742382-G-A p.Ala718Ala synonymous ABCB8 2 82488 2.4246E-5 41244 0 1.25555E-5
7-150742384-C-T p.Ala719Val missense ABCB8 6 82456 7.27661E-5 41228 0 3.18735E-4
7-150742386-C-G p.Pro720Ala missense ABCB8 1 82468 1.21259E-5 41234 0 NA
7-150742387-CA-C p.Pro721fs frameshift ABCB8 6 82450 7.27714E-5 41225 0 3.18735E-4
7-150742388-A-C p.Pro720Pro synonymous ABCB8 3778 82172 0.0459767 41086 109 0.06125
7-150742390-C-T p.Pro721Leu missense ABCB8 2 82348 2.42872E-5 41174 0 2.10704E-5
7-150742391-G-A p.Pro721Pro synonymous ABCB8 1 82280 1.21536E-5 41140 0 0.00125
7-150742393-C-T p.Pro722Leu missense ABCB8 2 82320 2.42954E-5 41160 0 1.69584E-5
7-150742408-G-T p.Gly727Val missense ABCB8 3640 81940 0.0444227 40970 106 0.0442602
7-150742408-G-A p.Gly727Asp missense ABCB8 3 82116 3.65337E-5 41058 0 NA
7-150742409-C-G p.Gly727Gly synonymous ABCB8 18 82114 2.19207E-4 41057 0 5.03525E-4
7-150742417-G-A p.Ser730Asn missense ABCB8 2 82056 2.43736E-5 41028 0 6.13309E-5
7-150742418-C-T p.Ser730Ser synonymous ABCB8 1 81898 1.22103E-5 40949 0 NA
7-150742423-A-T p.Gln732Leu missense ABCB8 1 81832 1.22202E-5 40916 0 NA
7-150742432-C-T p.Ser735Phe missense ABCB8 1 81568 1.22597E-5 40784 0 NA
7-150742435-G-A p.Ter736Ter stop_retained ABCB8 2 81468 2.45495E-5 40734 0 3.18674E-5