Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
X-74273118-G-A c.*87C>T splice_region ABCB7 1 79508 1.25774E-5 39754 0 NA
X-74273121-T-C c.*84A>G splice_region ABCB7 2 79714 2.50897E-5 39857 0 NA
X-74273211-C-A p.Ser752Ser synonymous ABCB7 2 82848 2.41406E-5 41424 1 NA
X-74273211-C-T p.Ser752Ser synonymous ABCB7 2 82848 2.41406E-5 41424 0 2.72774E-5
X-74273212-G-A p.Ser752Leu missense ABCB7 3 82870 3.62013E-5 41435 1 6.8419E-5
X-74273237-T-C p.Ser744Gly missense ABCB7 2 83074 2.40749E-5 41537 1 NA
X-74273239-T-C p.Asn743Ser missense ABCB7 1 83088 1.20354E-5 41544 0 9.10084E-5
X-74273259-T-C p.Lys736Lys synonymous ABCB7 1 83100 1.20337E-5 41550 0 NA
X-74273277-T-C p.Lys730Lys synonymous ABCB7 4 83084 4.8144E-5 41542 1 NA
X-74273313-G-A p.Asn718Asn synonymous ABCB7 1 82964 1.20534E-5 41482 0 1.24174E-5
X-74273320-T-C p.His716Arg missense ABCB7 2 82986 2.41005E-5 41493 1 1.26409E-5
X-74273327-G-A p.Gln714* stop_gained ABCB7 2 82968 2.41057E-5 41484 1 NA
X-74273332-C-T p.Arg712His missense ABCB7 3 82936 3.61725E-5 41468 1 4.56475E-5
X-74273378-T-C p.Asn697Asp missense ABCB7 3 82766 3.62468E-5 41383 1 NA
X-74273379-A-G p.Ala696Ala synonymous ABCB7 3 82766 3.62468E-5 41383 1 NA
X-74273398-G-A p.Thr690Ile missense ABCB7 1 82442 1.21297E-5 41221 0 2.5035E-5
X-74273404-C-T p.Arg688His missense ABCB7 1 82262 1.21563E-5 41131 0 NA
X-74273409-G-A p.Ala686Ala synonymous ABCB7 3 82066 3.65559E-5 41033 1 NA
X-74273422-T-TGATCCAAGACAATGATTTCATCTGCATCAACCACTGTTGAC c.2047-3_2047-2insGTCAACAGTGGTTGATGCAGATGAAATCATTGTCTTGGATC splice_region ABCB7 2 81634 2.44996E-5 40817 1 NA
X-74273428-G-A c.2047-8C>T splice_region ABCB7 1 81434 1.22799E-5 40717 0 7.89322E-6
X-74280103-T-C p.Arg667Arg synonymous ABCB7 4 82120 4.87092E-5 41060 1 NA
X-74280106-G-A p.His666His synonymous ABCB7 2 82102 2.43599E-5 41051 1 5.8881E-5
X-74280139-C-T p.Val655Val synonymous ABCB7 1 82022 1.21919E-5 41011 0 NA
X-74280151-G-C p.Ala651Ala synonymous ABCB7 27 81874 3.29775E-4 40937 7 1.20461E-4
X-74280163-A-G p.Thr647Thr splice_region+synonymous ABCB7 2 81586 2.4514E-5 40793 1 NA
X-74280170-A-C c.1939-5T>G splice_region ABCB7 1 81274 1.23041E-5 40637 0 NA
X-74282155-T-C c.1938+8A>G splice_region ABCB7 5 80466 6.2138E-5 40233 2 1.93437E-4
X-74282157-A-G c.1938+6T>C splice_region ABCB7 1 80654 1.23986E-5 40327 0 5.52575E-6
X-74282158-C-G c.1938+5G>C splice_region ABCB7 1 80710 1.239E-5 40355 0 1.34876E-5
X-74282175-C-A p.Ser642Ser synonymous ABCB7 3 81678 3.67296E-5 40839 1 1.09657E-5
X-74282175-C-T p.Ser642Ser synonymous ABCB7 1 81678 1.22432E-5 40839 0 2.45441E-5
X-74282184-C-T p.Ser639Ser synonymous ABCB7 12 81906 1.46509E-4 40953 3 0.00137646
X-74282187-T-C p.Ser638Ser synonymous ABCB7 1 81986 1.21972E-5 40993 0 NA
X-74282269-G-GAAAGCTTGAGTCCTCGTTCCCCTACTTGGGT c.1835-4_1835-3insACCCAAGTAGGGGAACGAGGACTCAAGCTTT splice_region ABCB7 4 81612 4.90124E-5 40806 2 NA
X-74282269-G-GAAAGCTTGAGTCCTCGTTCCCCTACTTGGGTGTCATATCCAT c.1835-4_1835-3insATGGATATGACACCCAAGTAGGGGAACGAGGACTCAAGCTTT splice_region ABCB7 2 81612 2.45062E-5 40806 1 NA
X-74284897-C-CTT c.1834+7_1834+8insAA splice_region ABCB7 1 81702 1.22396E-5 40851 0 NA
X-74284901-T-TTTTCTC c.1834+3_1834+4insGAGAAA splice_region ABCB7 1 81752 1.22321E-5 40876 0 NA
X-74284903-A-T c.1834+2T>A splice_donor ABCB7 1 81752 1.22321E-5 40876 0 NA
X-74284934-T-C p.Gln602Arg missense ABCB7 9 82148 1.09558E-4 41074 3 4.92592E-5
X-74284940-T-A p.Asp600Val missense ABCB7 3 82180 3.65052E-5 41090 1 5.94106E-5
X-74284945-T-C p.Gly598Gly synonymous ABCB7 1 82202 1.21652E-5 41101 0 NA
X-74284949-T-A p.His597Leu missense ABCB7 2 82194 2.43327E-5 41097 1 NA
X-74284958-C-T p.Arg594Gln missense ABCB7 2 82222 2.43244E-5 41111 1 NA
X-74284972-A-G p.His589His synonymous ABCB7 34 82248 4.13384E-4 41124 6 8.21243E-4
X-74284972-A-C p.His589Gln missense ABCB7 11 82250 1.33739E-4 41125 1 1.64066E-5
X-74284977-G-C p.Leu588Val missense ABCB7 2 82200 2.43309E-5 41100 1 NA
X-74284996-T-C p.Ala581Ala synonymous ABCB7 2029 82292 0.0246561 41146 706 0.104039
X-74284996-TG-CA p.Ala581Val missense ABCB7 2354 82288 0.0286068 41144 601 NA
X-74284997-G-A p.Ala581Val missense ABCB7 807 82292 0.00980654 41146 257 0.0774923
X-74284998-C-T p.Ala581Thr missense ABCB7 1 82314 1.21486E-5 41157 0 1.36918E-4
X-74285013-G-A p.Pro576Ser missense ABCB7 1 82318 1.2148E-5 41159 0 2.28969E-4
X-74285047-A-G p.Tyr564Tyr synonymous ABCB7 1 82034 1.21901E-5 41017 0 NA
X-74285078-T-TGAGGTACCACTCCCACTGCCCTCC c.1663-3_1663-2insGGAGGGCAGTGGGAGTGGTACCTC splice_region ABCB7 1 81332 1.22953E-5 40666 0 NA
X-74285080-A-AGGT c.1663-5_1663-4insACC splice_region ABCB7 1 81204 1.23147E-5 40602 0 NA
X-74288858-A-T p.Val549Glu missense ABCB7 1 82982 1.20508E-5 41491 0 NA
X-74288864-C-T p.Arg547Lys missense ABCB7 6 83000 7.22892E-5 41500 1 1.37773E-4
X-74288887-A-G p.Asp539Asp synonymous ABCB7 1 83044 1.20418E-5 41522 0 2.7268E-5
X-74288912-T-C p.Tyr531Cys missense ABCB7 21 83028 2.52927E-4 41514 6 0.00206327
X-74288966-C-T p.Ser513Asn missense ABCB7 1 82864 1.2068E-5 41432 0 NA
X-74289122-C-A c.1532+4G>T splice_region ABCB7 2 82564 2.42236E-5 41282 0 NA
X-74289163-C-T p.Gly499Arg missense ABCB7 72 82640 8.71249E-4 41320 14 0.00482426
X-74289166-C-G p.Ala498Pro missense ABCB7 1 82662 1.20975E-5 41331 0 NA
X-74289197-T-C p.Lys487Lys synonymous ABCB7 1 82744 1.20855E-5 41372 0 6.88705E-4
X-74289239-C-A p.Val473Val synonymous ABCB7 2 82590 2.4216E-5 41295 1 NA
X-74289241-C-T p.Val473Met missense ABCB7 1 82534 1.21162E-5 41267 0 5.45995E-6
X-74289251-C-T p.Gln469Gln synonymous ABCB7 1 82544 1.21148E-5 41272 0 NA
X-74289275-T-G p.Ala461Ala synonymous ABCB7 1 82378 1.21392E-5 41189 0 NA
X-74289275-T-C p.Ala461Ala synonymous ABCB7 1 82378 1.21392E-5 41189 0 NA
X-74290187-ATAGAT-A c.1368+8_1368+12delATCTA splice_region ABCB7 1 82320 1.21477E-5 41160 0 1.14486E-5
X-74290209-G-A p.Thr453Thr synonymous ABCB7 1 82572 1.21106E-5 41286 0 NA
X-74290219-T-G p.Lys450Thr missense ABCB7 5 82646 6.0499E-5 41323 2 1.14115E-5
X-74290226-G-C p.Leu448Val missense ABCB7 1 82676 1.20954E-5 41338 0 5.45878E-6
X-74290237-G-T p.Thr444Asn missense ABCB7 1 82734 1.20869E-5 41367 0 NA
X-74290244-T-C p.Met442Val missense ABCB7 1 82756 1.20837E-5 41378 0 5.45694E-6
X-74290245-A-G p.Asp441Asp synonymous ABCB7 934 82740 0.0112884 41370 242 0.0124192
X-74290254-T-A p.Ala438Ala synonymous ABCB7 1 82798 1.20776E-5 41399 0 3.42106E-5
X-74290286-G-A p.Leu428Leu synonymous ABCB7 1 82892 1.20639E-5 41446 0 1.14034E-5
X-74290290-G-A p.Asn426Asn synonymous ABCB7 1 82912 1.2061E-5 41456 0 NA
X-74290295-G-A p.Leu425Leu synonymous ABCB7 1 82890 1.20642E-5 41445 0 NA
X-74290351-A-C p.Leu406Arg missense ABCB7 1 82840 1.20715E-5 41420 0 NA
X-74290360-T-G c.1211-3A>C splice_region ABCB7 1 82752 1.20843E-5 41376 0 4.62642E-5
X-74291348-C-T p.Val402Val synonymous ABCB7 1 82044 1.21886E-5 41022 0 2.18597E-5
X-74291350-C-G p.Val402Leu missense ABCB7 1 82040 1.21892E-5 41020 0 4.61063E-5
X-74291351-A-T p.Ile401Ile synonymous ABCB7 1 82058 1.21865E-5 41029 0 1.38166E-4
X-74291363-G-T p.Ala397Ala synonymous ABCB7 2 82058 2.4373E-5 41029 1 NA
X-74291377-T-C p.Ile393Val missense ABCB7 58 82214 7.05476E-4 41107 15 0.00164956
X-74291380-C-T p.Ala392Thr missense ABCB7 1 82194 1.21663E-5 41097 0 NA
X-74291393-A-G p.Ser387Ser synonymous ABCB7 1 82218 1.21628E-5 41109 0 1.0925E-5
X-74291414-A-G p.Phe380Phe synonymous ABCB7 1 82290 1.21521E-5 41145 0 1.09242E-5
X-74291427-G-A p.Ala376Val missense ABCB7 2 82358 2.42842E-5 41179 1 NA
X-74291465-C-T p.Thr363Thr synonymous ABCB7 5 82194 6.08317E-5 41097 1 2.31128E-4
X-74291466-G-A p.Thr363Met missense ABCB7 2 82174 2.43386E-5 41087 1 1.6482E-5
X-74291467-T-C p.Thr363Ala missense ABCB7 1 82156 1.2172E-5 41078 0 NA
X-74291502-C-A p.Arg351Ile missense ABCB7 1 81252 1.23074E-5 40626 0 4.58001E-5
X-74291517-T-C p.Tyr346Cys missense+splice_region ABCB7 1 80186 1.2471E-5 40093 0 NA
X-74291522-C-T c.1036-4G>A splice_region ABCB7 1 79458 1.25853E-5 39729 0 4.58589E-5
X-74291537-T-C n.126A>G splice_region ABCB7 3 77348 3.87857E-5 38674 1 5.84332E-5
X-74293598-T-C p.Ile321Val missense ABCB7 10 81848 1.22178E-4 40924 1 2.26562E-4
X-74293611-TCTGTAAGACAAAGATTTGCATAGGCATGAAATACATGTTATAAAAGCAAAACAATTTCTAAATTTTATGTGGCTTCTAGGGAATAAATTAC-T c.947+1_948-1delGTAATTTATTCCCTAGAAGCCACATAAAATTTAGAAATTGTTTTGCTTTTATAACATGTATTTCATGCCTATGCAAATCTTTGTCTTACAG splice_acceptor ABCB7 10 81796 1.22255E-4 40898 4 NA
X-74293618-G-A c.948-7C>T splice_region ABCB7 828 81754 0.0101279 40877 195 0.00965128
X-74293695-T-G c.947+8A>C splice_region ABCB7 1 82204 1.21649E-5 41102 0 NA
X-74293709-C-T p.Arg314Gln missense ABCB7 210 82308 0.00255139 41154 55 0.00309217
X-74293714-G-A p.Val312Val synonymous ABCB7 5 82362 6.07076E-5 41181 2 4.63892E-5
X-74293738-T-G p.Thr304Thr synonymous ABCB7 1 82360 1.21418E-5 41180 0 4.5253E-5
X-74293744-A-ATTTAATTT p.Gly303fs frameshift ABCB7 1 82318 1.2148E-5 41159 0 NA
X-74293746-G-A p.Leu302Phe missense ABCB7 1 82280 1.21536E-5 41140 0 NA
X-74293780-G-A p.Cys290Cys synonymous ABCB7 1 81718 1.22372E-5 40859 0 4.55498E-5
X-74293782-A-G p.Cys290Arg missense ABCB7 1 81706 1.2239E-5 40853 0 NA
X-74293792-C-CAAAACACCACTGACAAGCATCACTTCAAACA c.859-2_859-1insTGTTTGAAGTGATGCTTGTCAGTGGTGTTTT splice_acceptor ABCB7 2 81254 2.46142E-5 40627 1 NA
X-74295202-C-T p.Val285Ile missense ABCB7 1 82442 1.21297E-5 41221 0 4.55976E-5
X-74295230-G-C p.Ile275Met missense ABCB7 1 82754 1.2084E-5 41377 0 9.10001E-5
X-74295243-T-C p.Asn271Ser missense ABCB7 1 82854 1.20694E-5 41427 0 2.39984E-5
X-74295248-T-C p.Val269Val synonymous ABCB7 2 82862 2.41365E-5 41431 0 2.98031E-4
X-74295251-C-T p.Leu268Leu synonymous ABCB7 1 82874 1.20665E-5 41437 0 NA
X-74295314-C-T p.Thr247Thr synonymous ABCB7 2 82970 2.41051E-5 41485 1 2.29069E-5
X-74295335-A-G p.Gly240Gly synonymous ABCB7 1 82938 1.20572E-5 41469 0 NA
X-74295388-T-C p.Ile223Val missense ABCB7 1 82570 1.21109E-5 41285 0 8.74599E-5
X-74295435-A-C p.Phe207Cys missense ABCB7 3 81960 3.66032E-5 40980 0 NA
X-74295451-C-T p.Ala202Thr missense ABCB7 2 81598 2.45104E-5 40799 0 NA
X-74295459-A-G p.Val199Ala missense ABCB7 2 81442 2.45574E-5 40721 1 NA
X-74296364-C-G p.Leu194Leu synonymous ABCB7 2 82406 2.42701E-5 41203 1 1.14179E-5
X-74296364-C-T p.Leu194Leu synonymous ABCB7 1 82406 1.2135E-5 41203 0 NA
X-74296386-G-A p.Ala187Val missense ABCB7 1 82488 1.2123E-5 41244 0 NA
X-74296387-C-T p.Ala187Thr missense ABCB7 1 82502 1.21209E-5 41251 0 NA
X-74296390-C-T p.Val186Ile missense ABCB7 1 82528 1.21171E-5 41264 0 NA
X-74296400-T-A p.Ala182Ala synonymous ABCB7 2 82568 2.42225E-5 41284 0 NA
X-74296415-C-T p.Leu177Leu synonymous ABCB7 1 82598 1.21068E-5 41299 0 4.54442E-5
X-74296481-A-G p.Asn155Asn synonymous ABCB7 4 82630 4.84086E-5 41315 1 4.53227E-5
X-74318801-C-T p.Ser144Ser synonymous ABCB7 9 82468 1.09133E-4 41234 2 2.73061E-5
X-74318801-C-G p.Ser144Ser synonymous ABCB7 3 82468 3.63777E-5 41234 1 2.2842E-5
X-74318830-G-T p.Pro135Thr missense ABCB7 2 82546 2.42289E-5 41273 0 5.4629E-6
X-74318869-T-C p.Ile122Val missense ABCB7 36 82328 4.37275E-4 41164 6 9.10747E-4
X-74318902-GA-G c.337-7delT splice_region ABCB7 3 81880 3.6639E-5 40940 1 8.77633E-5
X-74332742-G-A p.Leu105Leu synonymous ABCB7 612 82000 0.00746341 41000 152 0.021875
X-74332751-T-C p.Gly102Gly synonymous ABCB7 2 82068 2.437E-5 41034 1 1.14021E-5
X-74332779-T-C p.Lys93Arg missense ABCB7 1 81856 1.22166E-5 40928 0 NA
X-74332784-T-C p.Ile91Met missense ABCB7 1 81722 1.22366E-5 40861 0 1.14086E-5
X-74332798-C-T p.Val87Ile missense ABCB7 1 81480 1.2273E-5 40740 0 NA
X-74332805-A-G p.Ala84Ala splice_region+synonymous ABCB7 1 81276 1.23038E-5 40638 0 1.86055E-4
X-74332809-T-TTTGCAGCATCTAAGAACTGTCCTGAATTGCCTTTTCCC c.250-3_250-2insGGGAAAAGGCAATTCAGGACAGTTCTTAGATGCTGCAA splice_region ABCB7 4 81120 4.93097E-5 40560 2 NA
X-74332813-T-C c.250-6A>G splice_region ABCB7 1 80964 1.23512E-5 40482 0 5.47315E-6
X-74332814-G-A c.250-7C>T splice_region ABCB7 1 80930 1.23564E-5 40465 0 NA
X-74334588-C-T c.249+1G>A splice_donor ABCB7 1206 82162 0.0146783 41081 298 0.014375
X-74334594-C-T p.Ala82Thr missense ABCB7 12 82254 1.4589E-4 41127 4 0.00206612
X-74334620-C-T p.Gly73Asp missense ABCB7 1 82392 1.21371E-5 41196 0 NA
X-74334624-T-C p.Lys72Glu missense ABCB7 1 82380 1.21389E-5 41190 0 2.16578E-4
X-74334634-C-G p.Gln68His missense ABCB7 204 82350 0.00247723 41175 40 0.00383352
X-74334655-T-C p.Ser61Ser synonymous ABCB7 1 82112 1.21785E-5 41056 0 1.23394E-5
X-74334660-C-G p.Glu60Gln missense ABCB7 1 82010 1.21936E-5 41005 0 NA
X-74334668-T-A c.169-2A>T splice_acceptor ABCB7 2 81802 2.44493E-5 40901 1 NA
X-74334669-G-GGTAGGCTCGAGCGGTTCCCAAGGCGCCGAGTTGATGTGGC c.169-1_169insGCCACATCAACTCGGCGCCTTGGGAACCGCTCGAGCCTAC splice_acceptor ABCB7 1 81772 1.22291E-5 40886 0 NA
X-74375932-C-T c.168+8G>A splice_region ABCB7 5 81524 6.13316E-5 40762 0 1.56126E-5
X-74375950-C-A p.Arg53Leu missense ABCB7 2 81750 2.44648E-5 40875 1 5.64669E-6
X-74375965-G-A p.Ala48Val missense ABCB7 4 81868 4.88591E-5 40934 0 1.56514E-5
X-74375969-C-G p.Gly47Arg missense ABCB7 1 81890 1.22115E-5 40945 0 NA
X-74375977-T-G p.His44Pro missense ABCB7 3 81912 3.66247E-5 40956 1 NA
X-74375987-A-G p.Trp41Arg missense ABCB7 39 81858 4.76435E-4 40929 10 0.00621977
X-74375991-C-T p.Pro39Pro synonymous ABCB7 1 81822 1.22217E-5 40911 0 NA
X-74376001-C-T p.Gly36Asp missense ABCB7 1 81832 1.22202E-5 40916 0 NA
X-74376003-G-A p.Ser35Ser synonymous ABCB7 3 81814 3.66685E-5 40907 1 5.85923E-6
X-74376006-A-G p.Val34Val synonymous ABCB7 17 81768 2.07905E-4 40884 3 3.18486E-4
X-74376034-G-C p.Ala25Gly missense ABCB7 2 81294 2.46021E-5 40647 1 1.93244E-5
X-74376035-C-G p.Ala25Pro missense ABCB7 8 81266 9.84421E-5 40633 3 6.90131E-4
X-74376042-C-A p.Arg22Arg synonymous ABCB7 3 81174 3.69576E-5 40587 0 1.98622E-5
X-74376058-G-A p.Ala17Val missense ABCB7 4 80864 4.94658E-5 40432 2 0.00138122
X-74376084-A-G p.Ser8Ser synonymous ABCB7 1 80764 1.23818E-5 40382 0 NA
X-74376085-G-A p.Ser8Phe missense ABCB7 2 80794 2.47543E-5 40397 1 6.09953E-6
X-74376093-C-G p.Ala5Ala synonymous ABCB7 1 80470 1.2427E-5 40235 0 2.25825E-5
X-74376094-G-A p.Ala5Val missense ABCB7 4 80406 4.97475E-5 40203 1 2.25779E-5
X-74376095-C-T p.Ala5Thr missense ABCB7 2 80322 2.48998E-5 40161 0 NA
X-74376098-G-C p.Leu4Val missense ABCB7 1 80316 1.24508E-5 40158 0 1.235E-5
X-74376098-G-A p.Leu4Phe missense ABCB7 1 80316 1.24508E-5 40158 0 NA
X-74376103-G-A p.Ala2Val missense ABCB7 2 80124 2.49613E-5 40062 1 4.02186E-4
X-74376111-G-A c.37-4C>T splice_region ABCB7 2 79744 2.50803E-5 39872 1 4.54442E-5
X-74376539-T-A c.-7A>T 5_prime_UTR_premature_start_codon_gain ABCB7 5 10956 4.56371E-4 5478 2 NA