Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
2-220074492-C-T c.*168G>A splice_region ABCB6 6 69542 8.62788E-5 34771 0 3.18573E-5
2-220074498-G-T c.*557C>A splice_region ABCB6 1 70608 1.41627E-5 35304 0 NA
2-220074664-C-T p.Arg842Gln missense ABCB6 1 83374 1.19941E-5 41687 0 3.18492E-5
2-220074665-G-A p.Arg842Trp missense ABCB6 3 83380 3.59799E-5 41690 0 3.97687E-6
2-220074673-G-A p.Thr839Ile missense ABCB6 2 83398 2.39814E-5 41699 0 1.19292E-5
2-220074677-G-A p.Gln838* stop_gained ABCB6 11 83390 1.3191E-4 41695 0 2.22902E-4
2-220074678-A-G p.Pro837Pro synonymous ABCB6 2 83390 2.39837E-5 41695 1 NA
2-220074679-G-A p.Pro837Leu missense ABCB6 12 83390 1.43902E-4 41695 0 3.18512E-5
2-220074684-A-AGTGTCTT p.Lys836fs frameshift ABCB6 2 83390 2.39837E-5 41695 0 7.9526E-6
2-220074702-T-C p.Glu829Glu synonymous ABCB6 2 83374 2.39883E-5 41687 0 7.9526E-6
2-220074703-TC-T p.Glu829fs frameshift ABCB6 2 83360 2.39923E-5 41680 0 NA
2-220074737-A-G p.Tyr818His missense ABCB6 2 83372 2.39889E-5 41686 0 7.95267E-6
2-220074740-C-A p.Val817Leu missense ABCB6 1 83372 1.19944E-5 41686 0 8.23669E-6
2-220074742-C-T p.Gly816Glu missense ABCB6 1 83368 1.1995E-5 41684 0 NA
2-220074742-C-G p.Gly816Ala missense ABCB6 1 83368 1.1995E-5 41684 0 NA
2-220074748-C-T p.Arg814Gln missense ABCB6 2 83364 2.39912E-5 41682 0 3.18532E-5
2-220074750-G-C p.Ser813Ser synonymous ABCB6 1 83366 1.19953E-5 41683 0 NA
2-220074753-C-T p.Leu812Leu synonymous ABCB6 1 83352 1.19973E-5 41676 0 5.76568E-5
2-220074764-C-T p.Glu809Lys missense ABCB6 5 83342 5.99938E-5 41671 0 6.3678E-5
2-220074765-G-A p.His808His synonymous ABCB6 1 83342 1.19988E-5 41671 0 8.23845E-6
2-220074769-CTG-C c.2421-3_2421-2delCA splice_acceptor ABCB6 4 83332 4.80008E-5 41666 0 8.23913E-6
2-220074775-TGAG-T c.2421-10_2421-8delCTC splice_region ABCB6 2 83314 2.40056E-5 41657 0 3.18421E-5
2-220074951-C-A c.2420+1G>T splice_donor ABCB6 1 83290 1.20062E-5 41645 0 NA
2-220074953-G-A p.Arg807* stop_gained ABCB6 2 83294 2.40113E-5 41647 0 6.58968E-5
2-220074957-C-G p.Arg805Ser missense ABCB6 1 83316 1.20025E-5 41658 0 NA
2-220074960-C-T p.Glu804Glu synonymous ABCB6 1 83322 1.20016E-5 41661 0 8.2371E-6
2-220074966-G-A p.Ile802Ile synonymous ABCB6 3 83308 3.60109E-5 41654 0 3.18654E-5
2-220074968-T-C p.Ile802Val missense ABCB6 1 83316 1.20025E-5 41658 0 7.95279E-6
2-220074981-G-A p.Ile797Ile synonymous ABCB6 2 83290 2.40125E-5 41645 0 1.64739E-4
2-220074986-C-T p.Val796Ile missense ABCB6 3 83278 3.60239E-5 41639 0 6.37227E-5
2-220074987-G-A p.Leu795Leu synonymous ABCB6 1 83284 1.20071E-5 41642 0 8.23696E-6
2-220074996-G-C p.Asp792Glu missense ABCB6 1 83272 1.20088E-5 41636 0 NA
2-220074999-A-G p.Ala791Ala synonymous ABCB6 4 83274 4.80342E-5 41637 0 1.27413E-4
2-220075000-G-A p.Ala791Val missense ABCB6 1 83272 1.20088E-5 41636 0 NA
2-220075002-A-G p.Asn790Asn synonymous ABCB6 1 83268 1.20094E-5 41634 0 NA
2-220075003-T-C p.Asn790Ser missense ABCB6 6 83262 7.20617E-5 41631 0 5.03525E-4
2-220075004-T-C p.Asn790Asp missense ABCB6 6 83268 7.20565E-5 41634 0 2.38595E-5
2-220075006-A-G p.Val789Ala missense ABCB6 1 83260 1.20106E-5 41630 0 7.95292E-6
2-220075010-C-T p.Val788Met missense ABCB6 1 83260 1.20106E-5 41630 0 NA
2-220075017-G-C p.Leu785Leu synonymous ABCB6 2 83248 2.40246E-5 41624 0 8.23737E-6
2-220075019-GCCTGAGAAGTCAAAGATCAGTCGCCTACTACCCCACCCAAAGCGGGCCACATCACCAGCCGCCCCAGGCCTGTAGTCCTGTA-G p.Arg784fs frameshift ABCB6 8 83228 9.61215E-5 41614 1 NA
2-220075102-C-T c.2351+1G>A splice_donor ABCB6 3 83260 3.60317E-5 41630 0 8.24484E-6
2-220075105-G-A p.His783His splice_region+synonymous ABCB6 3 83278 3.60239E-5 41639 0 NA
2-220075112-A-G p.Val781Ala missense ABCB6 1 83278 1.2008E-5 41639 0 1.64908E-5
2-220075116-C-T p.Val780Ile missense ABCB6 74 83276 8.88611E-4 41638 1 5.03525E-4
2-220075121-G-A p.Thr778Ile missense ABCB6 9 83284 1.08064E-4 41642 0 3.18471E-4
2-220075123-G-GGTGC p.Thr778fs frameshift ABCB6 2 83280 2.40154E-5 41640 0 NA
2-220075127-C-T p.Arg776His missense ABCB6 2 83284 2.40142E-5 41642 0 8.24783E-6
2-220075128-G-A p.Arg776Cys missense ABCB6 1 83282 1.20074E-5 41641 0 1.64959E-5
2-220075140-C-A p.Val772Phe missense ABCB6 22 83300 2.64106E-4 41650 0 6.25E-4
2-220075141-T-G p.Lys771Asn missense ABCB6 7 83304 8.40296E-5 41652 0 NA
2-220075142-T-G p.Lys771Thr missense ABCB6 1 83314 1.20028E-5 41657 0 NA
2-220075156-C-T p.Gln766Gln synonymous ABCB6 1 83292 1.2006E-5 41646 0 3.97772E-6
2-220075171-A-G p.Asn761Asn synonymous ABCB6 3 83280 3.60231E-5 41640 0 1.59297E-4
2-220075177-T-G p.Thr759Thr synonymous ABCB6 1 83272 1.20088E-5 41636 0 1.66146E-5
2-220075177-T-C p.Thr759Thr synonymous ABCB6 1 83272 1.20088E-5 41636 0 1.23361E-4
2-220075187-G-A p.Ala756Val missense ABCB6 2 83188 2.40419E-5 41594 0 3.98384E-6
2-220075192-C-T p.Thr754Thr synonymous ABCB6 3 83140 3.60837E-5 41570 0 2.39219E-5
2-220075193-G-A p.Thr754Met missense ABCB6 4 83150 4.81058E-5 41575 0 3.59072E-5
2-220075194-T-C p.Thr754Ala missense ABCB6 3 83166 3.60724E-5 41583 0 1.18971E-4
2-220075195-T-C p.Ala753Ala splice_region+synonymous ABCB6 2 83160 2.405E-5 41580 0 3.98956E-6
2-220075197-C-T p.Ala753Thr missense+splice_region ABCB6 1 83138 1.20282E-5 41569 0 NA
2-220075199-T-TC c.2257-3_2257-2insG splice_region ABCB6 1 83110 1.20322E-5 41555 0 NA
2-220075427-G-A c.2256+6C>T splice_region ABCB6 2 66028 3.02902E-5 33014 0 1.67687E-5
2-220075428-C-T c.2256+5G>A splice_region ABCB6 4 65838 6.07552E-5 32919 0 1.21426E-5
2-220075429-G-A c.2256+4C>T splice_region ABCB6 2 65674 3.04535E-5 32837 0 1.61873E-5
2-220075435-C-G p.Glu752Gln missense+splice_region ABCB6 1 67072 1.49094E-5 33536 0 NA
2-220075454-C-T p.Pro745Pro synonymous ABCB6 2 67938 2.94386E-5 33969 0 2.51454E-5
2-220075455-G-A p.Pro745Leu missense ABCB6 2 68192 2.9329E-5 34096 0 2.51433E-5
2-220075462-T-C p.Lys743Glu missense ABCB6 2 68728 2.91002E-5 34364 0 8.07298E-6
2-220075469-G-A p.Thr740Thr synonymous ABCB6 2 68824 2.90596E-5 34412 0 NA
2-220075471-T-C p.Thr740Ala missense ABCB6 2 68748 2.90918E-5 34374 0 NA
2-220075473-C-T p.Arg739His missense ABCB6 4 68468 5.84215E-5 34234 0 5.03525E-4
2-220075474-G-A p.Arg739Cys missense ABCB6 41 68862 5.95394E-4 34431 0 0.00453172
2-220075480-TGGC-T p.Ala736del conservative_inframe_deletion ABCB6 1 69542 1.43798E-5 34771 0 NA
2-220075482-G-A p.Ala736Val missense ABCB6 1 69274 1.44354E-5 34637 0 3.18979E-5
2-220075483-C-T p.Ala736Thr missense ABCB6 2 69112 2.89385E-5 34556 0 8.07552E-6
2-220075487-G-C p.Arg734Arg synonymous ABCB6 16 69898 2.28905E-4 34949 1 5.03525E-4
2-220075488-C-T p.Arg734His missense ABCB6 1 70130 1.42592E-5 35065 0 2.52173E-5
2-220075490-CT-C p.Gln733fs frameshift ABCB6 1 70908 1.41028E-5 35454 0 NA
2-220075493-C-T p.Lys732Lys synonymous ABCB6 12 71650 1.67481E-4 35825 0 1.89597E-4
2-220075494-TTC-T p.Lys732fs frameshift ABCB6 1 72048 1.38796E-5 36024 0 NA
2-220075501-C-T p.Gly730Arg missense ABCB6 15 73758 2.03368E-4 36879 0 6.25E-4
2-220075502-G-A p.Gly729Gly synonymous ABCB6 8 73818 1.08375E-4 36909 0 1.93398E-4
2-220075504-C-T p.Gly729Ser missense ABCB6 2 74626 2.68003E-5 37313 0 5.04558E-5
2-220075505-G-A p.Ser728Ser synonymous ABCB6 5 74876 6.67771E-5 37438 0 3.18857E-5
2-220075517-T-A p.Gly724Gly synonymous ABCB6 2 76832 2.60308E-5 38416 0 3.19142E-5
2-220075518-C-G p.Gly724Ala missense ABCB6 1 76994 1.2988E-5 38497 0 4.00966E-6
2-220075521-C-T p.Arg723Gln missense ABCB6 88 77438 0.00113639 38719 1 0.00100705
2-220075522-G-A p.Arg723Trp missense ABCB6 3 77438 3.87407E-5 38719 0 5.03525E-4
2-220075525-C-T p.Glu722Lys missense ABCB6 6 78078 7.68462E-5 39039 0 5.03525E-4
2-220075526-G-A p.Gly721Gly synonymous ABCB6 5 78168 6.39648E-5 39084 0 1.26792E-4
2-220075544-CCCTGTGGATATTACCCACCACACGTTTCTTACGAAACGGAGGGAACAGGGGTCAGGGATTAGCAGGACAACACCAGGAGGGGAGGGGACTCTCTGCAAAGGAATCTCTCA-C p.Tyr716fs frameshift ABCB6 5 80400 6.21891E-5 40200 0 NA
2-220075551-G-T c.2144-6C>A splice_region ABCB6 1 80944 1.23542E-5 40472 0 8.5205E-6
2-220075562-C-T p.Gly38Asp missense ABCB6 14 81418 1.71952E-4 40709 0 4.00808E-5
2-220075567-C-T p.Thr36Thr synonymous ABCB6 2 81480 2.45459E-5 40740 0 3.00677E-4
2-220075568-G-A p.Thr36Met missense ABCB6 1 81504 1.22693E-5 40752 0 8.58841E-6
2-220075576-C-T c.104-5G>A splice_region ABCB6 15 81822 1.83325E-4 40911 0 4.3198E-4
2-220075576-C-A c.104-5G>T splice_region ABCB6 3 81822 3.6665E-5 40911 0 3.18735E-5
2-220075655-C-T c.2143+1G>A splice_donor ABCB6 1 82510 1.21197E-5 41255 0 NA
2-220075676-G-T p.Ala708Asp missense ABCB6 1 82636 1.21013E-5 41318 0 NA
2-220075677-C-A p.Ala708Ser missense ABCB6 1 82636 1.21013E-5 41318 0 8.29518E-6
2-220075684-G-C p.Ile705Met missense ABCB6 2 82688 2.41873E-5 41344 0 1.65582E-5
2-220075689-C-T p.Gly704Ser missense ABCB6 1 82736 1.20866E-5 41368 0 8.2713E-6
2-220075695-C-A p.Ala702Ser missense ABCB6 3 82760 3.62494E-5 41380 0 NA
2-220075703-G-A p.Ala699Val missense ABCB6 2 82854 2.41388E-5 41427 0 3.97779E-6
2-220075711-C-T p.Val696Val synonymous ABCB6 2 82932 2.41161E-5 41466 0 9.55779E-5
2-220075712-ACCT-A p.Glu695del disruptive_inframe_deletion ABCB6 1 82926 1.20589E-5 41463 0 NA
2-220075713-C-T p.Val696Met missense ABCB6 1 82946 1.2056E-5 41473 0 3.18593E-5
2-220075714-C-T p.Glu695Glu synonymous ABCB6 2 82972 2.41045E-5 41486 0 6.37105E-5
2-220075723-C-T p.Gly692Gly synonymous ABCB6 1 83040 1.20424E-5 41520 0 NA
2-220075727-G-A p.Ala691Val missense ABCB6 2 83048 2.40825E-5 41524 0 NA
2-220075730-G-A p.Thr690Ile missense ABCB6 1 83084 1.2036E-5 41542 0 NA
2-220075734-C-T p.Val689Ile missense ABCB6 2 83088 2.40709E-5 41544 0 NA
2-220075736-C-T p.Arg688His missense ABCB6 1 83098 1.2034E-5 41549 0 6.25E-4
2-220075736-C-G p.Arg688Pro missense ABCB6 1 83098 1.2034E-5 41549 0 NA
2-220075737-G-A p.Arg688Cys missense ABCB6 1 83110 1.20322E-5 41555 0 1.19307E-5
2-220075740-C-T p.Gly687Ser missense ABCB6 4 83122 4.8122E-5 41561 0 7.95355E-6
2-220075741-G-A p.Tyr686Tyr synonymous ABCB6 8 83124 9.62418E-5 41562 0 3.22121E-4
2-220075745-C-T p.Arg685His missense ABCB6 2 83162 2.40494E-5 41581 0 5.03525E-4
2-220075746-G-A p.Arg685Cys missense ABCB6 23 83172 2.76535E-4 41586 0 5.73468E-4
2-220075747-G-A p.Ile684Ile synonymous ABCB6 2 83178 2.40448E-5 41589 0 6.25E-4
2-220075755-C-T p.Asp682Asn missense ABCB6 4 83204 4.80746E-5 41602 0 9.56023E-5
2-220075755-C-G p.Asp682His missense ABCB6 2 83204 2.40373E-5 41602 0 1.98837E-5
2-220075757-G-A p.Ala681Val missense ABCB6 1 83206 1.20184E-5 41603 0 1.59063E-5
2-220075758-C-T p.Ala681Thr missense ABCB6 27 83196 3.24535E-4 41598 0 7.65013E-4
2-220075759-G-A p.Ile680Ile synonymous ABCB6 2 83214 2.40344E-5 41607 0 3.18613E-5
2-220075765-G-A p.Asp678Asp synonymous ABCB6 4 83224 4.80631E-5 41612 0 5.76863E-5
2-220075774-G-A p.Leu675Leu synonymous ABCB6 1 83244 1.20129E-5 41622 0 NA
2-220075781-GTGTCTTGGGGCACAACTCCAA-G p.Ile666_Asp672del disruptive_inframe_deletion ABCB6 1 83220 1.20163E-5 41610 0 NA
2-220075788-G-C p.Gln671Glu missense ABCB6 1 83230 1.20149E-5 41615 0 NA
2-220075795-A-G p.Val668Val synonymous ABCB6 2 83212 2.4035E-5 41606 0 NA
2-220075798-T-TC p.Val668fs frameshift ABCB6 2 83212 2.4035E-5 41606 0 8.24294E-6
2-220075810-C-T p.Arg663Arg synonymous ABCB6 3 83184 3.60646E-5 41592 0 3.97706E-6
2-220075811-C-T p.Arg663Gln missense ABCB6 2 83178 2.40448E-5 41589 0 6.25E-4
2-220075812-GGA-G p.Leu662fs frameshift ABCB6 9 83170 1.08212E-4 41585 0 4.12344E-5
2-220075820-G-A p.Ala660Val missense ABCB6 6 83108 7.21952E-5 41554 0 6.37105E-5
2-220075823-T-G p.Gln659Pro missense ABCB6 2 83110 2.40645E-5 41555 0 NA
2-220075832-T-TGTGAAATGTCCTGCCCATCTATTCGGATGCAGCCAGAGCTGATGTCGTAGA c.1969-3_1969-2insTCTACGACATCAGCTCTGGCTGCATCCGAATAGATGGGCAGGACATTTCAC splice_region ABCB6 1 82958 1.20543E-5 41479 0 NA
2-220075832-T-TGTGAAATGTCCTGCCCATCTATTCGGATGCAGCC c.1969-3_1969-2insGGCTGCATCCGAATAGATGGGCAGGACATTTCAC splice_region ABCB6 3 82958 3.61629E-5 41479 1 NA
2-220075832-T-TGTG c.1969-3_1969-2insCAC splice_region ABCB6 2 82960 2.4108E-5 41480 1 NA
2-220077109-C-T p.Gln656Gln splice_region+synonymous ABCB6 1 82968 1.20528E-5 41484 0 NA
2-220077134-C-T p.Arg648Gln missense ABCB6 79 83112 9.50525E-4 41556 0 0.00181552
2-220077134-C-A p.Arg648Leu missense ABCB6 1 83112 1.2032E-5 41556 0 NA
2-220077135-G-A p.Arg648* stop_gained ABCB6 9 83128 1.08267E-4 41564 0 4.11984E-5
2-220077153-TGTC-T p.Asp641del conservative_inframe_deletion ABCB6 4 83218 4.80665E-5 41609 0 5.16915E-5
2-220077156-C-T p.Asp641Asn missense ABCB6 2 83236 2.40281E-5 41618 0 6.25E-4
2-220077157-G-A p.Tyr640Tyr synonymous ABCB6 1 83238 1.20137E-5 41619 0 3.18142E-5
2-220077164-C-T p.Arg638His missense ABCB6 1 83224 1.20158E-5 41612 0 2.38586E-5
2-220077165-G-A p.Arg638Cys missense ABCB6 15 83236 1.8021E-4 41618 0 1.64807E-4
2-220077169-C-G p.Leu636Leu synonymous ABCB6 2 83252 2.40234E-5 41626 0 8.2409E-6
2-220077176-C-T p.Arg634His missense ABCB6 2 83208 2.40361E-5 41604 0 3.18735E-5
2-220077177-G-A p.Arg634Cys missense ABCB6 5 83222 6.00803E-5 41611 0 4.37522E-5
2-220077183-T-C p.Ile632Val missense ABCB6 1 83202 1.20189E-5 41601 0 NA
2-220077189-T-C p.Ser630Gly missense ABCB6 1 83166 1.20241E-5 41583 0 8.24851E-6
2-220077194-C-G p.Gly628Ala missense ABCB6 1 83126 1.20299E-5 41563 0 NA
2-220077198-C-A p.Ala627Ser missense ABCB6 2 83100 2.40674E-5 41550 0 NA
2-220077203-G-T p.Ser625Tyr missense ABCB6 1 83082 1.20363E-5 41541 0 7.95862E-6
2-220077209-C-CT p.Gly623fs frameshift ABCB6 7 83022 8.4315E-5 41511 0 3.98241E-5
2-220077210-C-CACCTGTT p.Gly623fs frameshift ABCB6 7 83034 8.43028E-5 41517 0 3.98556E-5
2-220077215-T-G c.1864-2A>C splice_acceptor ABCB6 1 82954 1.20549E-5 41477 0 NA
2-220077221-A-G c.1864-8T>C splice_region ABCB6 1 82890 1.20642E-5 41445 0 4.0058E-6
2-220077722-C-G c.1863+8G>C splice_region ABCB6 18 83030 2.16789E-4 41515 0 0.00125
2-220077724-T-A c.1863+6A>T splice_region ABCB6 1 83030 1.20438E-5 41515 0 NA
2-220077727-C-T c.1863+3G>A splice_region ABCB6 1 83040 1.20424E-5 41520 0 1.1973E-5
2-220077735-C-A p.Ala620Ser missense ABCB6 3 83056 3.61202E-5 41528 0 NA
2-220077736-A-G p.Leu619Leu synonymous ABCB6 2 83072 2.40755E-5 41536 0 NA
2-220077737-A-G p.Leu619Pro missense ABCB6 1 83062 1.20392E-5 41531 0 1.71993E-5
2-220077739-T-G p.Thr618Thr synonymous ABCB6 33 83054 3.97332E-4 41527 0 0.00453629
2-220077757-A-G p.Thr612Thr synonymous ABCB6 1 83084 1.2036E-5 41542 0 NA
2-220077768-C-T p.Val609Met missense ABCB6 7 83026 8.43109E-5 41513 0 6.25E-4
2-220077780-T-C p.Thr605Ala missense ABCB6 1 82992 1.20494E-5 41496 0 1.72939E-5
2-220077786-G-A p.Arg603Trp missense+splice_region ABCB6 5 83064 6.01946E-5 41532 0 5.99496E-5
2-220077956-G-A c.1805+7C>T splice_region ABCB6 4 83352 4.79893E-5 41676 0 8.25382E-6
2-220077967-C-T p.Asp601Asn missense ABCB6 1 83354 1.1997E-5 41677 0 1.64965E-5
2-220077968-G-A p.Ala600Ala synonymous ABCB6 4 83358 4.79858E-5 41679 0 4.20653E-4
2-220077985-C-T p.Val595Met missense ABCB6 3 83370 3.59842E-5 41685 0 6.59544E-5
2-220077986-G-A p.Asn594Asn synonymous ABCB6 2 83374 2.39883E-5 41687 0 5.77091E-5
2-220077996-T-A p.Glu591Val missense ABCB6 1 83354 1.1997E-5 41677 0 NA
2-220078002-C-T p.Arg589His missense ABCB6 4 83348 4.79916E-5 41674 0 1.59131E-5
2-220078006-C-T p.Gly588Ser missense ABCB6 462 83344 0.00554329 41672 3 0.00484046
2-220078017-C-T p.Arg584His missense ABCB6 5 83340 5.99952E-5 41670 0 3.18276E-5
2-220078022-G-T p.Pro582Pro synonymous ABCB6 1 83344 1.19985E-5 41672 0 NA
2-220078023-G-A p.Pro582Leu missense ABCB6 1 83330 1.20005E-5 41665 0 8.24212E-6
2-220078040-G-A p.Asp576Asp synonymous ABCB6 1 83320 1.20019E-5 41660 0 6.37146E-5
2-220078044-TTCACCTGGAAGGGCACCACCCATGTGTGCTGAGGTTCTCAGCTTTGTGTTTTCCAAGCACGAGAAACACCACACAGCTCCTCCCTCCCCAAACCCTACTCCTCTCCCTTCGC-T p.Val574fs frameshift ABCB6 5 83306 6.00197E-5 41653 0 NA
2-220078052-G-A c.1720-4C>T splice_region ABCB6 2 83290 2.40125E-5 41645 0 3.18552E-5
2-220078056-G-A c.1720-8C>T splice_region ABCB6 9 83282 1.08067E-4 41641 0 6.37308E-5
2-220078155-G-A c.1719+6C>T splice_region ABCB6 1 83328 1.20008E-5 41664 0 7.95317E-6
2-220078155-G-C c.1719+6C>G splice_region ABCB6 1 83328 1.20008E-5 41664 0 8.23655E-6
2-220078156-C-T c.1719+5G>A splice_region ABCB6 1 83326 1.20011E-5 41663 0 NA
2-220078156-C-A c.1719+5G>T splice_region ABCB6 1 83326 1.20011E-5 41663 0 8.23669E-6
2-220078175-T-C p.Lys569Glu missense ABCB6 1 83340 1.1999E-5 41670 0 3.18471E-5
2-220078181-A-C p.Leu567Val missense ABCB6 1 83344 1.19985E-5 41672 0 NA
2-220078182-G-C p.Asp566Glu missense ABCB6 3 83344 3.59954E-5 41672 0 NA
2-220078186-A-G p.Phe565Ser missense ABCB6 10 83346 1.19982E-4 41673 0 0.00100705
2-220078188-CAT-C p.Met564fs frameshift ABCB6 1 83338 1.19993E-5 41669 0 NA
2-220078200-G-A p.Asp560Asp synonymous ABCB6 1 83320 1.20019E-5 41660 0 1.193E-5
2-220078205-T-C p.Ile559Val missense ABCB6 2 83304 2.40085E-5 41652 0 NA
2-220078223-TCCTGCAAAAAGGTGCTGGTTAGGACTTCTCTGAGTAGCCAGGAAATAATAATGTGCCCTGGACAGGTGAGGGCCAGGGCTCAGATTA-T p.Met553fs frameshift ABCB6 7 83252 8.40821E-5 41626 1 NA
2-220078227-G-A c.1656-3C>T splice_region ABCB6 1 83238 1.20137E-5 41619 0 NA
2-220078231-A-G c.1656-7T>C splice_region ABCB6 1 83218 1.20166E-5 41609 0 3.97744E-6
2-220078315-T-C p.Tyr551Cys missense ABCB6 1 83278 1.2008E-5 41639 0 NA
2-220078318-T-C p.Tyr550Cys missense ABCB6 1 83288 1.20065E-5 41644 0 NA
2-220078322-TG-T p.Thr549fs frameshift ABCB6 2 83292 2.40119E-5 41646 0 NA
2-220078333-T-C p.Asn545Ser missense ABCB6 3 83312 3.60092E-5 41656 0 1.64766E-5
2-220078334-T-C p.Asn545Asp missense ABCB6 1 83308 1.20036E-5 41654 0 NA
2-220078335-G-A p.Leu544Leu synonymous ABCB6 1 83300 1.20048E-5 41650 0 NA
2-220078349-G-A p.Leu540Leu synonymous ABCB6 5 83332 6.0001E-5 41666 0 0.00100705
2-220078355-T-A p.Ile538Phe missense ABCB6 3 83338 3.5998E-5 41669 0 NA
2-220078356-A-T p.Ile537Ile synonymous ABCB6 1 83340 1.1999E-5 41670 0 NA
2-220078376-CAT-C p.Tyr530fs frameshift ABCB6 1 83342 1.19988E-5 41671 0 7.95393E-6
2-220078379-A-G p.Tyr530His missense ABCB6 1 83352 1.19973E-5 41676 0 NA
2-220078380-G-A p.Asp529Asp synonymous ABCB6 2 83354 2.3994E-5 41677 0 3.18451E-5
2-220078387-A-G p.Val527Ala missense+splice_region ABCB6 2 83334 2.39998E-5 41667 0 6.25E-4
2-220078392-T-C c.1579-4A>G splice_region ABCB6 5 83328 6.00038E-5 41664 0 2.78403E-5
2-220078392-T-TA c.1579-5_1579-4insT splice_region ABCB6 1 83328 1.20008E-5 41664 0 NA
2-220078395-C-T c.1579-7G>A splice_region ABCB6 7 83306 8.40276E-5 41653 0 6.25E-4
2-220078543-C-G c.1578+5G>C splice_region ABCB6 3 83272 3.60265E-5 41636 0 9.55292E-5
2-220078545-C-T c.1578+3G>A splice_region ABCB6 1 83288 1.20065E-5 41644 0 NA
2-220078547-C-T c.1578+1G>A splice_donor ABCB6 1 83312 1.20031E-5 41656 0 3.99042E-6
2-220078564-G-C p.Thr521Ser missense ABCB6 586 83340 0.00703144 41670 5 0.010574
2-220078565-T-C p.Thr521Ala missense ABCB6 17 83344 2.03974E-4 41672 0 1.43489E-4
2-220078577-C-T p.Ala517Thr missense ABCB6 2 83360 2.39923E-5 41680 0 3.1839E-5
2-220078582-A-AGCAGGGAGCCG p.Leu515fs frameshift ABCB6 1 83380 1.19933E-5 41690 0 3.1841E-5
2-220078586-G-C p.Leu514Val missense ABCB6 2 83386 2.39848E-5 41693 0 NA
2-220078592-C-T p.Gly512Ser missense ABCB6 3 83378 3.59807E-5 41689 0 3.31027E-5
2-220078593-G-A p.Ala511Ala synonymous ABCB6 6 83378 7.19614E-5 41689 0 2.78605E-5
2-220078595-C-T p.Ala511Thr missense ABCB6 22 83372 2.63878E-4 41686 0 3.50341E-4
2-220078596-G-A p.Leu510Leu synonymous ABCB6 1 83378 1.19936E-5 41689 0 1.65464E-5
2-220078604-C-T p.Gly508Arg missense ABCB6 4 83378 4.79743E-5 41689 0 2.78567E-5
2-220078606-A-G p.Leu507Pro missense ABCB6 1 83378 1.19936E-5 41689 0 3.97928E-6
2-220078612-A-G p.Ile505Thr missense ABCB6 1 83372 1.19944E-5 41686 0 2.48036E-5
2-220078614-C-T p.Val504Val synonymous ABCB6 1 83374 1.19941E-5 41687 0 3.97874E-6
2-220078615-A-G p.Val504Ala missense ABCB6 3 83374 3.59824E-5 41687 0 3.18431E-5
2-220078618-A-G p.Leu503Pro missense ABCB6 1 83374 1.19941E-5 41687 0 NA
2-220078630-T-A p.Gln499Leu missense ABCB6 4 83370 4.79789E-5 41685 0 9.55231E-5
2-220078637-G-T p.Leu497Ile missense ABCB6 2 83350 2.39952E-5 41675 0 2.47905E-5
2-220078643-C-G p.Val495Leu missense ABCB6 2 83346 2.39964E-5 41673 0 6.36557E-5
2-220078652-C-T p.Ala492Thr missense ABCB6 584 83290 0.00701165 41645 2 0.00715608
2-220078653-G-A p.Ser491Ser synonymous ABCB6 2 83296 2.40108E-5 41648 0 9.55718E-5
2-220078657-G-A p.Ser490Leu missense ABCB6 5 83270 6.00456E-5 41635 0 8.26282E-6
2-220078665-C-T p.Glu487Glu synonymous ABCB6 1 83256 1.20111E-5 41628 0 6.36862E-5
2-220078677-A-ATATTTGATGATGGCCTCTCGATAGCGTTCCACTTCGTAACTCTC c.1453-5_1453-4insGAGAGTTACGAAGTGGAACGCTATCGAGAGGCCATCATCAAATA splice_region ABCB6 2 83224 2.40315E-5 41612 1 NA
2-220078839-T-C c.1452+4A>G splice_region ABCB6 2 83306 2.40079E-5 41653 0 3.29549E-5
2-220078841-A-T c.1452+2T>A splice_donor ABCB6 2 83312 2.40061E-5 41656 0 1.64769E-5
2-220078846-A-G p.Tyr483Tyr synonymous ABCB6 1 83330 1.20005E-5 41665 0 7.95349E-6
2-220078852-G-C p.Ile481Met missense ABCB6 1 83340 1.1999E-5 41670 0 3.18431E-5
2-220078853-A-T p.Ile481Asn missense ABCB6 1 83336 1.19996E-5 41668 0 NA
2-220078858-G-T p.Ala479Ala synonymous ABCB6 2 83324 2.40027E-5 41662 0 3.1841E-5
2-220078860-C-G p.Ala479Pro missense ABCB6 1 83332 1.20002E-5 41666 0 NA
2-220078865-C-T p.Arg477Gln missense ABCB6 1 83312 1.20031E-5 41656 0 8.23832E-6
2-220078866-G-A p.Arg477* stop_gained ABCB6 2 83318 2.40044E-5 41659 0 NA
2-220078870-G-A p.Arg475Arg synonymous ABCB6 2 83310 2.40067E-5 41655 0 NA
2-220078872-G-A p.Arg475Cys missense ABCB6 3 83286 3.60205E-5 41643 0 1.91034E-4
2-220078876-C-T p.Val473Val synonymous ABCB6 4 83298 4.80204E-5 41649 0 1.64756E-5
2-220078882-G-A p.Tyr471Tyr synonymous ABCB6 10 83286 1.20068E-4 41643 0 5.03525E-4
2-220078882-G-C p.Tyr471* stop_gained ABCB6 3 83286 3.60205E-5 41643 0 2.7837E-5
2-220078890-C-T p.Glu469Lys missense ABCB6 1 83268 1.20094E-5 41634 0 3.1841E-5
2-220078891-G-A c.*349C>T splice_region ABCB6 5 83268 6.00471E-5 41634 0 0.00100705
2-220078893-C-A p.Ala468Ser missense ABCB6 20 83256 2.40223E-4 41628 0 0.00453172
2-220078894-G-A p.Asn467Asn synonymous ABCB6 2 83262 2.40206E-5 41631 0 9.55536E-5
2-220078906-C-T p.Val463Val splice_region+synonymous ABCB6 1 83240 1.20135E-5 41620 0 3.18451E-5
2-220079117-G-A p.Phe460Phe synonymous ABCB6 2 83324 2.40027E-5 41662 0 6.37064E-5
2-220079126-CAG-C p.Leu457fs frameshift ABCB6 1 83330 1.20005E-5 41665 0 6.36862E-5
2-220079130-G-C p.Ser456Cys missense ABCB6 3 83322 3.60049E-5 41661 0 NA
2-220079136-A-G p.Val454Ala missense ABCB6 235 83332 0.00282005 41666 3 0.00613204
2-220079137-C-A p.Val454Leu missense ABCB6 2 83338 2.39987E-5 41669 0 2.38593E-5
2-220079142-C-T p.Arg452Gln missense ABCB6 1 83342 1.19988E-5 41671 0 8.24729E-6
2-220079143-G-A p.Arg452* stop_gained ABCB6 1 83332 1.20002E-5 41666 0 1.19301E-5
2-220079148-C-T p.Arg450Gln missense ABCB6 5 83334 5.99995E-5 41667 0 6.3674E-5
2-220079149-G-C p.Arg450Gly missense ABCB6 2 83340 2.39981E-5 41670 0 8.24606E-6
2-220079149-G-A p.Arg450Trp missense ABCB6 3 83340 3.59971E-5 41670 0 5.03525E-4
2-220079153-A-G p.Ala448Ala synonymous ABCB6 1 83328 1.20008E-5 41664 0 3.97655E-6
2-220079155-C-T p.Ala448Thr missense ABCB6 1 83328 1.20008E-5 41664 0 8.24565E-6
2-220079156-G-A p.Asn447Asn synonymous ABCB6 2 83332 2.40004E-5 41666 0 8.24538E-6
2-220079173-T-C p.Met442Val missense ABCB6 1 83332 1.20002E-5 41666 0 0.00100705
2-220079179-G-A p.Arg440Cys missense ABCB6 7 83324 8.40094E-5 41662 0 1.19307E-5
2-220079181-C-T p.Arg439His missense ABCB6 1 83314 1.20028E-5 41657 0 6.36902E-5
2-220079182-G-A p.Arg439Cys missense ABCB6 2 83314 2.40056E-5 41657 0 3.29902E-5
2-220079204-G-A p.Val431Val synonymous ABCB6 1 83276 1.20083E-5 41638 0 3.18471E-5
2-220079211-A-G p.Ile429Thr missense ABCB6 2 83242 2.40263E-5 41621 0 3.18512E-5
2-220079212-T-C p.Ile429Val missense ABCB6 5 83242 6.00658E-5 41621 0 9.55475E-5
2-220079217-A-G p.Ter119Argext*? stop_lost ABCB6 2 83220 2.40327E-5 41610 0 3.97928E-6
2-220079218-G-A p.Leu427Leu splice_region+synonymous ABCB6 1 83214 1.20172E-5 41607 0 NA
2-220079220-G-GTGAGGTAAAGACTCATGCACAGGAACA c.1277-1_1277insTGTTCCTGTGCATGAGTCTTTACCTCA splice_acceptor ABCB6 1 83186 1.20213E-5 41593 0 NA
2-220079223-GGA-G c.1277-5_1277-4delTC splice_region ABCB6 1 83164 1.20244E-5 41582 0 8.26132E-6
2-220079225-A-G c.1277-5T>C splice_region ABCB6 1 83144 1.20273E-5 41572 0 NA
2-220079681-ACT-A p.Thr426fs frameshift ABCB6 1 83282 1.20074E-5 41641 0 8.25996E-6
2-220079686-G-C p.Leu425Val missense ABCB6 73 83298 8.76372E-4 41649 0 0.00503525
2-220079692-G-A p.Leu423Phe missense ABCB6 1 83312 1.20031E-5 41656 0 3.1839E-5
2-220079711-A-T p.Ile416Ile synonymous ABCB6 8 83340 9.59923E-5 41670 0 6.25E-4
2-220079713-T-C p.Ile416Val missense ABCB6 2 83336 2.39992E-5 41668 0 3.97779E-6
2-220079723-C-T p.Trp412* stop_gained ABCB6 2 83332 2.40004E-5 41666 0 1.65016E-5
2-220079728-C-T p.Ala411Thr missense ABCB6 2 83326 2.40021E-5 41663 0 3.18573E-5
2-220079729-G-A p.Asn410Asn synonymous ABCB6 2 83334 2.39998E-5 41667 0 5.03525E-4
2-220079735-G-A p.Phe408Phe synonymous ABCB6 4 83340 4.79962E-5 41670 0 3.1841E-5
2-220079741-G-C p.Ser406Arg missense ABCB6 1 83340 1.1999E-5 41670 0 3.97766E-6
2-220079750-G-A p.Ile403Ile synonymous ABCB6 1 83354 1.1997E-5 41677 0 1.65006E-5
2-220079752-T-C p.Ile403Val missense ABCB6 1 83348 1.19979E-5 41674 0 3.97753E-6
2-220079770-C-T p.Asp397Asn missense ABCB6 1 83340 1.1999E-5 41670 0 7.95646E-6
2-220079771-G-A p.Ala396Ala synonymous ABCB6 1 83350 1.19976E-5 41675 0 5.03525E-4
2-220079777-C-T p.Thr394Thr synonymous ABCB6 5 83346 5.99909E-5 41673 0 3.18512E-5
2-220079778-G-A p.Thr394Met missense ABCB6 2 83344 2.39969E-5 41672 0 8.25464E-6
2-220079786-G-C p.Val391Val synonymous ABCB6 2 83336 2.39992E-5 41668 0 NA
2-220079787-A-G p.Val391Ala missense ABCB6 2 83340 2.39981E-5 41670 0 8.2575E-6
2-220079800-G-A p.Leu387Leu synonymous ABCB6 3 83330 3.60014E-5 41665 0 NA
2-220079806-T-TG c.1155-3_1155-2insC splice_region ABCB6 1 83328 1.20008E-5 41664 0 NA
2-220080712-G-A c.1154+7C>T splice_region ABCB6 1 56208 1.77911E-5 28104 0 NA
2-220080713-C-T c.1154+6G>A splice_region ABCB6 3 56202 5.33789E-5 28101 0 6.37755E-5
2-220080748-CCGATCCG-C p.Ala373fs frameshift ABCB6 1 66520 1.50331E-5 33260 0 4.63682E-5
2-220080749-C-T p.Arg375Gln missense ABCB6 1 66788 1.49727E-5 33394 0 5.06073E-4
2-220080752-T-A p.Asp374Val missense ABCB6 1 68216 1.46593E-5 34108 0 8.45266E-6
2-220080754-C-T p.Ala373Ala synonymous ABCB6 2 68752 2.90901E-5 34376 0 6.25E-4
2-220080755-G-A p.Ala373Val missense ABCB6 4 69026 5.79492E-5 34513 0 6.38121E-5
2-220080755-GC-TT p.Ala373Lys missense ABCB6 1 69026 1.44873E-5 34513 0 NA
2-220080761-C-T p.Arg371Gln missense ABCB6 2 71182 2.8097E-5 35591 0 2.39731E-4
2-220080768-C-A p.Val369Leu missense ABCB6 1 73180 1.36649E-5 36590 0 NA
2-220080779-C-T p.Arg365His missense ABCB6 1 74362 1.34477E-5 37181 0 0.0015213
2-220080782-C-T p.Arg364His missense ABCB6 1 74366 1.3447E-5 37183 0 NA
2-220080785-C-G p.Gly363Ala missense ABCB6 2 75394 2.65273E-5 37697 0 NA
2-220080785-C-T p.Gly363Glu missense ABCB6 2 75394 2.65273E-5 37697 0 1.01143E-4
2-220080798-G-A p.Arg359Cys missense ABCB6 2 76602 2.6109E-5 38301 0 6.37796E-5
2-220080801-G-C p.Leu358Val missense ABCB6 1 77150 1.29618E-5 38575 0 5.07099E-4
2-220080802-T-C p.Ser357Ser synonymous ABCB6 2 77180 2.59134E-5 38590 0 5.07099E-4
2-220080810-C-T p.Glu355Lys missense ABCB6 8 77658 1.03016E-4 38829 0 6.37755E-5
2-220080811-G-A p.His354His synonymous ABCB6 1 77782 1.28564E-5 38891 0 5.06073E-4
2-220080822-A-G p.Ser351Pro missense ABCB6 1 78532 1.27337E-5 39266 0 NA
2-220080826-G-C p.Ile349Met missense ABCB6 2 78786 2.53852E-5 39393 0 1.92767E-5
2-220080831-G-A p.Leu348Phe missense ABCB6 1 78700 1.27065E-5 39350 0 2.01719E-5
2-220080842-C-T p.Arg344Gln missense ABCB6 3 80730 3.71609E-5 40365 0 3.10366E-5
2-220080845-C-T p.Arg343Gln missense ABCB6 1653 80882 0.0204372 40441 87 0.0440454
2-220080867-G-A p.Arg336Trp missense ABCB6 1 81684 1.22423E-5 40842 0 6.25E-4
2-220080868-G-A p.Ile335Ile synonymous ABCB6 1 81738 1.22342E-5 40869 0 3.18552E-5
2-220080879-A-G p.Phe332Leu missense ABCB6 21 81880 2.56473E-4 40940 0 2.86716E-4
2-220080882-T-C p.Thr331Ala missense ABCB6 2 81810 2.44469E-5 40905 0 NA
2-220080887-AG-A p.Leu329fs frameshift ABCB6 3 81840 3.66569E-5 40920 0 5.05051E-4
2-220080888-G-A p.Leu329Leu synonymous ABCB6 6 81870 7.32869E-5 40935 0 2.89067E-5
2-220080890-T-G p.Asn328Thr missense ABCB6 1 81838 1.22193E-5 40919 0 4.41026E-6
2-220080897-C-G p.Val326Leu missense ABCB6 1 81836 1.22196E-5 40918 0 NA
2-220080898-G-A p.Phe325Phe synonymous ABCB6 1 81816 1.22225E-5 40908 0 0.0010142
2-220080903-C-T c.971-1G>A splice_acceptor ABCB6 2 81854 2.44337E-5 40927 0 8.93639E-6
2-220080905-G-GTACTGCCAGTGC c.971-4_971-3insGCACTGGCAGTA splice_region ABCB6 1 81822 1.22217E-5 40911 0 NA
2-220080905-G-GTACTGCCAGTGCCAC c.971-4_971-3insGTGGCACTGGCAGTA splice_region ABCB6 1 81822 1.22217E-5 40911 0 NA
2-220080905-G-GTACTGCCAGTGCCACCC c.971-4_971-3insGGGTGGCACTGGCAGTA splice_region ABCB6 1 81822 1.22217E-5 40911 0 NA
2-220081087-TG-T p.Thr323fs frameshift ABCB6 1 83218 1.20166E-5 41609 0 NA
2-220081088-G-A p.Thr323Ile missense+splice_region ABCB6 15 83224 1.80236E-4 41612 0 4.96886E-5
2-220081099-GCCAC-G p.Gly318fs frameshift ABCB6 1 83258 1.20109E-5 41629 0 8.27185E-6
2-220081103-C-G p.Gly318Ala missense ABCB6 1 83278 1.2008E-5 41639 0 NA
2-220081103-C-A p.Gly318Val missense ABCB6 1 83278 1.2008E-5 41639 0 NA
2-220081104-C-A p.Gly318Cys missense ABCB6 2 83278 2.40159E-5 41639 0 3.98054E-6
2-220081117-C-T p.Lys313Lys synonymous ABCB6 1 83292 1.2006E-5 41646 0 1.6533E-5
2-220081124-A-G p.Phe311Ser missense ABCB6 1 83316 1.20025E-5 41658 0 NA
2-220081128-C-T p.Val310Ile missense ABCB6 6 83316 7.2015E-5 41658 0 1.27657E-4
2-220081129-G-GT p.Tyr309fs frameshift ABCB6 3 83320 3.60058E-5 41660 0 2.46719E-4
2-220081140-C-T p.Val306Ile missense ABCB6 13 83336 1.55995E-4 41668 1 5.03525E-4
2-220081143-T-C p.Thr305Ala missense ABCB6 1 83332 1.20002E-5 41666 0 8.26966E-6
2-220081152-G-C p.Leu302Val missense ABCB6 13 83330 1.56006E-4 41665 0 3.509E-4
2-220081179-GC-G p.Leu292fs frameshift ABCB6 1 83304 1.20042E-5 41652 0 NA
2-220081184-T-G p.Asn291Thr missense ABCB6 1 83280 1.20077E-5 41640 0 8.34711E-6
2-220081189-T-C c.869-2A>G splice_acceptor ABCB6 1 83258 1.20109E-5 41629 0 NA
2-220081190-G-C c.869-3C>G splice_region ABCB6 1 83254 1.20114E-5 41627 0 2.39128E-5
2-220081195-G-T c.869-8C>A splice_region ABCB6 1 83234 1.20143E-5 41617 0 1.6965E-5
2-220081367-T-A c.868+7A>T splice_region ABCB6 5 82024 6.09578E-5 41012 0 6.37633E-5
2-220081369-C-T c.868+5G>A splice_region ABCB6 1 82064 1.21856E-5 41032 0 NA
2-220081375-A-G p.Ile289Ile splice_region+synonymous ABCB6 9 82172 1.09526E-4 41086 0 8.93575E-5
2-220081376-A-G p.Ile289Thr missense+splice_region ABCB6 1 82208 1.21643E-5 41104 0 1.21794E-5
2-220081382-C-T p.Arg287Lys missense ABCB6 1 82214 1.21634E-5 41107 0 NA
2-220081384-A-G p.Tyr286Tyr synonymous ABCB6 1 82210 1.2164E-5 41105 0 4.30589E-5
2-220081385-T-C p.Tyr286Cys missense ABCB6 1 82228 1.21613E-5 41114 0 1.18533E-5
2-220081397-A-T p.Val282Glu missense ABCB6 1 82292 1.21518E-5 41146 0 NA
2-220081406-T-C p.Asn279Ser missense ABCB6 5 82386 6.06899E-5 41193 0 3.65551E-5
2-220081415-C-T p.Arg276Gln missense ABCB6 28 82414 3.39748E-4 41207 0 6.66836E-4
2-220081416-G-A p.Arg276Trp missense ABCB6 671 82410 0.00814222 41205 2 0.0189505
2-220081429-G-C p.Leu271Leu synonymous ABCB6 1 82472 1.21253E-5 41236 0 5.05561E-4
2-220081441-G-T p.Ile267Ile synonymous ABCB6 4 82502 4.84837E-5 41251 0 NA
2-220081453-C-G p.Leu263Leu synonymous ABCB6 2 82462 2.42536E-5 41231 0 3.30196E-5
2-220081475-C-T p.Arg256Gln missense ABCB6 7 82416 8.4935E-5 41208 0 6.37227E-5
2-220081475-C-G p.Arg256Pro missense ABCB6 1 82416 1.21336E-5 41208 0 3.18613E-5
2-220081496-A-T p.Leu249Gln missense ABCB6 1 82562 1.21121E-5 41281 0 3.20287E-5
2-220081503-G-A p.Arg247Cys missense ABCB6 125 82576 0.00151376 41288 6 0.0066644
2-220081504-G-C p.Leu246Leu synonymous ABCB6 16 82572 1.9377E-4 41286 1 1.21227E-5
2-220081524-G-A p.Arg240* stop_gained ABCB6 1 82618 1.21039E-5 41309 0 2.82047E-5
2-220081525-C-T p.Trp239* stop_gained ABCB6 2 82618 2.42078E-5 41309 0 1.91107E-4
2-220081528-G-T p.Thr238Thr synonymous ABCB6 3 82604 3.63179E-5 41302 0 NA
2-220081530-T-C p.Thr238Ala missense ABCB6 1 82546 1.21145E-5 41273 0 4.02982E-6
2-220081539-G-A p.Gln235* stop_gained ABCB6 2 82462 2.42536E-5 41231 0 NA
2-220081550-C-T p.Arg231Gln missense ABCB6 1 82182 1.21681E-5 41091 0 7.33843E-5
2-220081555-CTAG-C c.688-4_688-2delCTA splice_acceptor ABCB6 1 82086 1.21823E-5 41043 0 3.05835E-5
2-220081557-A-T c.688-3T>A splice_region ABCB6 1 82018 1.21924E-5 41009 0 4.11855E-6
2-220082385-G-A c.687+7C>T splice_region ABCB6 1 82754 1.2084E-5 41377 0 4.12902E-5
2-220082395-G-C p.Ser228Arg missense ABCB6 4 82970 4.82102E-5 41485 0 1.2945E-4
2-220082420-T-A p.Glu220Val missense ABCB6 19 83184 2.28409E-4 41592 0 5.03525E-4
2-220082420-T-C p.Glu220Gly missense ABCB6 1 83186 1.20213E-5 41593 0 1.64894E-5
2-220082430-G-T p.Gln217Lys missense ABCB6 7 83236 8.40982E-5 41618 0 5.57747E-5
2-220082443-C-T p.Gln212Gln synonymous ABCB6 1 83286 1.20068E-5 41643 0 3.97785E-6
2-220082446-G-C p.Pro211Pro synonymous ABCB6 30 83294 3.6017E-4 41647 0 7.95589E-5
2-220082450-C-T p.Arg210His missense ABCB6 2 83282 2.40148E-5 41641 0 1.28403E-4
2-220082457-C-T p.Gly208Arg missense ABCB6 3 83288 3.60196E-5 41644 0 4.12201E-5
2-220082461-G-A p.Ala206Ala synonymous ABCB6 4 83282 4.80296E-5 41641 0 2.47313E-5
2-220082468-A-C p.Leu204Arg missense ABCB6 5 83286 6.00341E-5 41643 0 3.97795E-6
2-220082471-C-G p.Gly203Ala missense ABCB6 1 83292 1.2006E-5 41646 0 NA
2-220082482-C-T p.Leu199Leu synonymous ABCB6 1 83276 1.20083E-5 41638 0 8.24579E-6
2-220082486-C-T p.Gly198Glu missense ABCB6 1 83270 1.20091E-5 41635 0 NA
2-220082504-C-T p.Arg192Gln missense ABCB6 354 83230 0.00425327 41615 1 0.00704935
2-220082505-G-A p.Arg192Trp missense ABCB6 146 83232 0.00175413 41616 0 0.00281708
2-220082511-C-G p.Val190Leu missense ABCB6 2 83228 2.40304E-5 41614 0 NA
2-220082514-A-T p.Trp189Arg missense ABCB6 2 83230 2.40298E-5 41615 0 8.25423E-6
2-220082517-G-A p.Leu188Leu synonymous ABCB6 1 83218 1.20166E-5 41609 0 4.0201E-6
2-220082528-A-G p.Val184Ala missense+splice_region ABCB6 1 83156 1.20256E-5 41578 0 1.22154E-5
2-220082846-CCTG-C p.Gln183del conservative_inframe_deletion ABCB6 1 79934 1.25103E-5 39967 0 NA
2-220082847-CT-GG p.Gln183Pro missense+splice_region ABCB6 3 80010 3.74953E-5 40005 0 NA
2-220082847-C-T p.Gln183Gln splice_region+synonymous ABCB6 1 80010 1.24984E-5 40005 0 8.60097E-6
2-220082861-C-T p.Asp179Asn missense ABCB6 1 80880 1.2364E-5 40440 0 NA
2-220082872-C-T p.Trp175* stop_gained ABCB6 1 81432 1.22802E-5 40716 0 NA
2-220082893-C-T p.Trp168* stop_gained ABCB6 1 82168 1.21702E-5 41084 0 6.37349E-5
2-220082906-C-T p.Ala164Thr missense ABCB6 52 82372 6.31282E-4 41186 0 5.03525E-4
2-220082925-C-T p.Ala157Ala synonymous ABCB6 1 82550 1.21139E-5 41275 0 NA
2-220082926-G-A p.Ala157Val missense ABCB6 2 82526 2.42348E-5 41263 0 8.27226E-6
2-220082936-AG-A p.Trp154fs frameshift ABCB6 1 82560 1.21124E-5 41280 0 8.75692E-5
2-220082943-C-G p.Leu151Leu synonymous ABCB6 1 82522 1.2118E-5 41261 0 1.655E-5
2-220082945-G-C p.Leu151Val missense ABCB6 1 82516 1.21189E-5 41258 0 8.27582E-6
2-220082955-G-A p.Ser147Ser synonymous ABCB6 3 82490 3.6368E-5 41245 0 3.18492E-5
2-220082957-T-C p.Ser147Gly missense ABCB6 2 82500 2.42424E-5 41250 0 4.13928E-5
2-220082983-A-G p.Met138Thr missense ABCB6 2 82348 2.42872E-5 41174 0 3.18431E-5
2-220082984-T-C p.Met138Val missense ABCB6 7 82340 8.50134E-5 41170 0 7.17211E-5
2-220082992-C-T p.Arg135His missense ABCB6 1 82244 1.21589E-5 41122 0 3.18451E-5
2-220082993-G-T p.Arg135Ser missense ABCB6 5 82194 6.08317E-5 41097 0 5.82295E-5
2-220082998-C-T p.Arg133Gln missense ABCB6 2 82184 2.43356E-5 41092 0 3.18471E-5
2-220083000-T-C p.Ala132Ala synonymous ABCB6 1 82166 1.21705E-5 41083 0 8.32834E-6
2-220083009-C-G p.Arg129Arg synonymous ABCB6 2 82188 2.43345E-5 41094 0 4.00074E-5
2-220083010-C-T p.Arg129Gln missense ABCB6 4 82164 4.86831E-5 41082 0 1.6749E-5
2-220083015-CACG-C p.Val127del disruptive_inframe_deletion ABCB6 11 82178 1.33856E-4 41089 0 6.36943E-5
2-220083019-AC-A p.Val126fs frameshift ABCB6 20 82130 2.43516E-4 41065 0 5.03525E-4
2-220083025-AGCCACAG-A p.Leu122fs frameshift ABCB6 1 82312 1.21489E-5 41156 0 NA
2-220083046-G-C p.Ala117Gly missense ABCB6 2 82232 2.43214E-5 41116 0 NA
2-220083050-G-A p.Leu116Leu synonymous ABCB6 1 82276 1.21542E-5 41138 0 4.01004E-6
2-220083056-C-A p.Glu114* stop_gained ABCB6 2 82250 2.43161E-5 41125 0 8.45652E-6
2-220083078-A-G p.Tyr106Tyr synonymous ABCB6 4 81886 4.88484E-5 40943 0 1.27389E-4
2-220083079-T-C p.Tyr106Cys missense ABCB6 1 81886 1.22121E-5 40943 0 4.04708E-6
2-220083094-G-C p.Ala101Gly missense ABCB6 2 81450 2.45549E-5 40725 0 4.10398E-5
2-220083101-G-A p.Arg99Trp missense ABCB6 4 81426 4.91244E-5 40713 0 5.04032E-4
2-220083102-G-C p.Ala98Ala synonymous ABCB6 44 81444 5.40249E-4 40722 1 0.00149748
2-220083113-C-A p.Val95Leu missense ABCB6 1 81466 1.22751E-5 40733 0 8.28576E-6
2-220083116-G-A p.Arg94Trp missense ABCB6 1 81416 1.22826E-5 40708 0 3.18695E-5
2-220083118-C-A p.Gly93Val missense ABCB6 1 81452 1.22772E-5 40726 0 NA
2-220083120-AGCCAGGCCG-A p.Gly90_Ala92del disruptive_inframe_deletion ABCB6 1 81492 1.22711E-5 40746 0 3.18613E-5
2-220083121-G-A p.Ala92Val missense ABCB6 5 81500 6.13497E-5 40750 0 3.18654E-5
2-220083132-C-G p.Leu88Leu synonymous ABCB6 1 81756 1.22315E-5 40878 0 3.18715E-5
2-220083135-G-C p.Pro87Pro synonymous ABCB6 2 81840 2.44379E-5 40920 0 NA
2-220083139-A-C p.Leu86Arg missense ABCB6 1 81856 1.22166E-5 40928 0 NA
2-220083153-TGTGGCCAGAAGC-T p.Leu78_Thr81del disruptive_inframe_deletion ABCB6 1 82046 1.21883E-5 41023 0 NA
2-220083166-A-T p.Leu77Gln missense ABCB6 8 82146 9.73876E-5 41073 0 7.16943E-5
2-220083170-G-A p.Gln76* stop_gained ABCB6 3 82104 3.6539E-5 41052 0 NA
2-220083177-G-T p.Tyr73* stop_gained ABCB6 1 82108 1.21791E-5 41054 0 4.25525E-6
2-220083177-G-C p.Tyr73* stop_gained ABCB6 1 82108 1.21791E-5 41054 0 1.05499E-5
2-220083178-T-C p.Tyr73Cys missense ABCB6 1 82112 1.21785E-5 41056 0 4.2604E-6
2-220083180-G-T p.Pro72Pro synonymous ABCB6 2 82152 2.43451E-5 41076 0 2.11524E-5
2-220083181-G-A p.Pro72Leu missense ABCB6 1 82164 1.21708E-5 41082 0 4.26534E-6
2-220083184-G-A p.Ser71Phe missense ABCB6 2 82196 2.43321E-5 41098 0 3.2E-5
2-220083189-G-A p.Arg69Arg synonymous ABCB6 1 82160 1.21714E-5 41080 0 NA
2-220083194-G-C p.Pro68Ala missense ABCB6 3 82184 3.65035E-5 41092 0 1.07938E-5
2-220083198-G-T p.Ala66Ala synonymous ABCB6 1 82154 1.21723E-5 41077 0 4.32455E-6
2-220083200-C-T p.Ala66Thr missense ABCB6 2 82120 2.43546E-5 41060 0 2.60004E-5
2-220083202-C-G p.Gly65Ala missense ABCB6 1 82216 1.21631E-5 41108 0 NA
2-220083203-C-T p.Gly65Arg missense ABCB6 1 82242 1.21592E-5 41121 0 4.27991E-6
2-220083204-C-G p.Trp64Cys missense ABCB6 1 82258 1.21569E-5 41129 0 3.23618E-5
2-220083210-C-G p.Leu62Leu synonymous ABCB6 2 82240 2.43191E-5 41120 0 NA
2-220083213-C-A p.Ser61Ser synonymous ABCB6 2 82228 2.43226E-5 41114 0 3.18613E-5
2-220083227-C-T p.Ala57Thr missense ABCB6 3 82170 3.65097E-5 41085 0 6.25E-4
2-220083230-G-A p.Pro56Ser missense ABCB6 1 82144 1.21737E-5 41072 0 NA
2-220083234-C-T p.Glu54Glu synonymous ABCB6 15 82112 1.82677E-4 41056 0 8.03036E-5
2-220083234-C-G p.Glu54Asp missense ABCB6 4 82112 4.8714E-5 41056 0 3.18532E-5
2-220083243-T-A p.Arg51Ser missense ABCB6 1 82060 1.21862E-5 41030 0 NA
2-220083249-G-T p.Pro49Pro synonymous ABCB6 3 82134 3.65257E-5 41067 0 NA
2-220083252-A-C p.Leu48Leu synonymous ABCB6 1 82082 1.21829E-5 41041 0 5.04032E-4
2-220083254-G-A p.Leu48Phe missense ABCB6 2 82076 2.43677E-5 41038 0 3.18431E-5
2-220083274-G-C p.Thr41Ser missense ABCB6 1 81816 1.22225E-5 40908 0 NA
2-220083276-C-T p.Gly40Gly synonymous ABCB6 1 81802 1.22246E-5 40901 0 NA
2-220083279-C-T p.Leu39Leu synonymous ABCB6 66568 80800 0.823861 40400 28027 0.854578
2-220083288-C-T p.Arg36Arg synonymous ABCB6 3 81642 3.67458E-5 40821 0 6.08209E-5
2-220083292-G-C p.Thr35Arg missense ABCB6 1 81638 1.22492E-5 40819 0 NA
2-220083295-G-A p.Ser34Leu missense ABCB6 3 81652 3.67413E-5 40826 0 4.3402E-5
2-220083298-G-A p.Pro33Leu missense ABCB6 2 81690 2.44828E-5 40845 0 3.1839E-5
2-220083306-C-A p.Thr30Thr synonymous ABCB6 3 81540 3.67918E-5 40770 0 8.6783E-6
2-220083307-G-A p.Thr30Met missense ABCB6 1 81538 1.22642E-5 40769 0 4.0543E-6
2-220083308-TGAA-T p.Phe29del conservative_inframe_deletion ABCB6 6 81488 7.36305E-5 40744 0 0.00303951
2-220083308-T-C p.Thr30Ala missense ABCB6 1 81488 1.22717E-5 40744 0 6.37186E-5
2-220083313-A-G p.Phe28Ser missense ABCB6 3 81482 3.68179E-5 40741 0 4.05347E-6
2-220083316-A-C p.Phe27Cys missense ABCB6 14 81444 1.71897E-4 40722 0 0.0020141
2-220083328-A-G p.Leu23Pro missense ABCB6 2 81102 2.46603E-5 40551 0 6.93498E-5
2-220083328-A-T p.Leu23Gln missense ABCB6 1 81104 1.23298E-5 40552 0 NA
2-220083329-G-A p.Leu23Leu synonymous ABCB6 3 81064 3.70078E-5 40532 0 3.18451E-5
2-220083332-C-T p.Gly22Ser missense ABCB6 1 80990 1.23472E-5 40495 0 NA
2-220083338-G-A p.Gln20* stop_gained ABCB6 1 80838 1.23704E-5 40419 0 NA
2-220083341-T-A p.Met19Leu missense ABCB6 1 80778 1.23796E-5 40389 0 NA
2-220083342-C-T p.Trp18* stop_gained ABCB6 1 80774 1.23802E-5 40387 0 8.92156E-6
2-220083345-G-C p.Ala17Ala synonymous ABCB6 1 80670 1.23962E-5 40335 0 3.18492E-5
2-220083355-A-G p.Val14Ala missense ABCB6 1 80340 1.24471E-5 40170 0 3.18451E-5
2-220083378-G-C p.Asn6Lys missense ABCB6 1 79964 1.25056E-5 39982 0 NA
2-220083392-C-T p.Val2Met missense ABCB6 1 80080 1.24875E-5 40040 0 6.36943E-5
2-220083417-G-A c.-22C>T 5_prime_UTR_premature_start_codon_gain ABCB6 1 79610 1.25612E-5 39805 0 NA
2-220083478-T-G c.-83A>C 5_prime_UTR_premature_start_codon_gain ABCB6 1 76726 1.30334E-5 38363 0 NA
2-220083502-C-A c.-107G>T 5_prime_UTR_premature_start_codon_gain ABCB6 1 73248 1.36523E-5 36624 0 NA
2-220083531-G-C c.-136C>G 5_prime_UTR_premature_start_codon_gain ABCB6 1 65556 1.52541E-5 32778 0 NA
2-220083551-G-A c.-156C>T 5_prime_UTR_premature_start_codon_gain ABCB6 1 54914 1.82103E-5 27457 0 NA
2-220083558-C-T c.-163G>A 5_prime_UTR_premature_start_codon_gain ABCB6 1 50944 1.96294E-5 25472 0 NA
2-220083662-A-G c.-267T>C 5_prime_UTR_premature_start_codon_gain ABCB6 1 16078 6.21968E-5 8039 0 NA
2-220083674-C-A c.-279G>T 5_prime_UTR_premature_start_codon_gain ABCB6 1 13946 7.17052E-5 6973 0 NA
2-220083700-C-G c.-305G>C 5_prime_UTR_premature_start_codon_gain ABCB6 2 8842 2.26193E-4 4421 0 1.91083E-4