Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
7-87133472-A-C n.539T>G splice_region ABCB1 1 78832 1.26852E-5 39416 0 NA
7-87133562-C-A p.Gln1280His missense ABCB1 2 83108 2.40651E-5 41554 0 3.97836E-6
7-87133563-T-G p.Gln1280Pro missense ABCB1 2 83114 2.40633E-5 41557 0 1.64758E-5
7-87133566-C-T p.Arg1279His missense ABCB1 8 83106 9.62626E-5 41553 0 3.1839E-4
7-87133566-C-A p.Arg1279Leu missense ABCB1 1 83106 1.20328E-5 41553 0 3.1839E-5
7-87133567-G-A p.Arg1279Cys missense ABCB1 5 83110 6.01612E-5 41555 0 4.11882E-5
7-87133567-G-T p.Arg1279Ser missense ABCB1 1 83110 1.20322E-5 41555 0 5.03525E-4
7-87133573-T-C p.Thr1277Ala missense ABCB1 1 83162 1.20247E-5 41581 0 1.59109E-5
7-87133574-T-C p.Gly1276Gly synonymous ABCB1 8 83174 9.61839E-5 41587 0 1.27348E-4
7-87133576-C-T p.Gly1276Arg missense ABCB1 1 83166 1.20241E-5 41583 0 NA
7-87133576-C-A p.Gly1276* stop_gained ABCB1 1 83166 1.20241E-5 41583 0 NA
7-87133579-C-A p.Ala1275Ser missense ABCB1 2 83176 2.40454E-5 41588 0 NA
7-87133596-G-GA p.Ser1269fs frameshift ABCB1 1 83188 1.2021E-5 41594 0 NA
7-87133617-G-A p.Ala1262Val missense ABCB1 1 83112 1.2032E-5 41556 0 NA
7-87133623-A-G p.Leu1260Pro missense ABCB1 1 83066 1.20386E-5 41533 0 NA
7-87133625-C-T p.Gln1259Gln synonymous ABCB1 1 83058 1.20398E-5 41529 0 3.97753E-6
7-87133632-T-C p.His1257Arg missense ABCB1 1 83042 1.20421E-5 41521 0 3.97763E-6
7-87133633-G-A p.His1257Tyr missense ABCB1 2 83024 2.40894E-5 41512 0 2.47097E-5
7-87133634-C-T p.Thr1256Thr synonymous ABCB1 18 83012 2.16836E-4 41506 0 0.00100705
7-87133635-G-A p.Thr1256Met missense ABCB1 1 82988 1.20499E-5 41494 0 NA
7-87133651-C-T p.Val1251Ile missense ABCB1 247 82800 0.00298309 41400 1 0.00468227
7-87133652-T-C p.Arg1250Arg synonymous ABCB1 1 82792 1.20785E-5 41396 0 8.23642E-6
7-87133655-G-C p.Gly1249Gly synonymous ABCB1 26 82708 3.14359E-4 41354 0 0.00130582
7-87133656-C-T p.Gly1249Asp missense ABCB1 1 82726 1.20881E-5 41363 0 NA
7-87133658-A-G p.Asn1248Asn synonymous ABCB1 1 82730 1.20875E-5 41365 0 3.1841E-5
7-87133671-A-G p.Val1244Ala missense ABCB1 1 82576 1.21101E-5 41288 0 1.98954E-5
7-87133674-A-G p.Ile1243Thr missense ABCB1 1 82564 1.21118E-5 41282 0 NA
7-87133685-A-G p.Asn1239Asn synonymous ABCB1 23 82490 2.78822E-4 41245 0 0.00125
7-87133688-C-T p.Gln1238Gln synonymous ABCB1 1 82448 1.21289E-5 41224 0 3.1841E-5
7-87133690-G-A p.Gln1238* stop_gained ABCB1 1 82446 1.21292E-5 41223 0 NA
7-87133704-C-T p.Arg1233His missense ABCB1 3 82362 3.64246E-5 41181 0 1.6478E-5
7-87133705-G-A p.Arg1233Cys missense ABCB1 9 82348 1.09292E-4 41174 0 4.1197E-5
7-87133709-A-G p.Ala1231Ala synonymous ABCB1 3 82336 3.64361E-5 41168 0 3.18253E-5
7-87133715-C-T p.Val1229Val synonymous ABCB1 2 82328 2.42931E-5 41164 0 NA
7-87133718-A-T p.Ile1228Ile synonymous ABCB1 2 82306 2.42996E-5 41153 0 7.95659E-6
7-87133720-T-G p.Ile1228Leu missense ABCB1 1 82310 1.21492E-5 41155 0 NA
7-87133720-T-C p.Ile1228Val missense ABCB1 1 82310 1.21492E-5 41155 0 NA
7-87133724-G-A p.Thr1226Thr synonymous ABCB1 1 82292 1.21518E-5 41146 0 NA
7-87133729-G-A p.Arg1225Cys missense ABCB1 1 82208 1.21643E-5 41104 0 3.18573E-5
7-87133769-T-A c.3637-4A>T splice_region ABCB1 4 81886 4.88484E-5 40943 0 3.98321E-5
7-87135209-T-C c.3636+4A>G splice_region ABCB1 2 83154 2.40518E-5 41577 0 3.97871E-6
7-87135233-G-C p.Leu1206Val missense ABCB1 1 83262 1.20103E-5 41631 0 NA
7-87135237-T-G p.Ser1204Ser synonymous ABCB1 1 83272 1.20088E-5 41636 0 NA
7-87135240-C-T p.Thr1203Thr synonymous ABCB1 2 83280 2.40154E-5 41640 0 3.29544E-5
7-87135240-C-A p.Thr1203Thr synonymous ABCB1 11 83280 1.32085E-4 41640 0 5.03525E-4
7-87135241-G-A p.Thr1203Met missense ABCB1 6 83282 7.20444E-5 41641 0 6.25E-4
7-87135286-C-T p.Arg1188His missense ABCB1 5 83300 6.0024E-5 41650 0 1.64756E-5
7-87135287-G-A p.Arg1188Cys missense ABCB1 1 83298 1.20051E-5 41649 0 NA
7-87135302-G-T p.Arg1183Ser missense ABCB1 3 83280 3.60231E-5 41640 0 4.77373E-5
7-87135302-G-A p.Arg1183Cys missense ABCB1 2 83280 2.40154E-5 41640 0 1.19343E-5
7-87135316-C-G p.Gly1178Ala missense ABCB1 1 83254 1.20114E-5 41627 0 NA
7-87135347-T-C p.Lys1168Glu missense ABCB1 21 83152 2.5255E-4 41576 1 4.17837E-4
7-87135352-C-T p.Ser1166Asn missense ABCB1 1 83128 1.20296E-5 41564 0 NA
7-87135359-T-TATTAGGCAGTGACTCGATGAAGGCATGTATGTTGGCCTCCTTTG c.3490-1_3490insCAAAGGAGGCCAACATACATGCCTTCATCGAGTCACTGCCTAAT splice_acceptor ABCB1 9 83086 1.08321E-4 41543 4 NA
7-87135359-T-TATTAGGCAGTGACTCGATGAAGGCATGTATGTTGGCCTC c.3490-1_3490insGAGGCCAACATACATGCCTTCATCGAGTCACTGCCTAAT splice_acceptor ABCB1 2 83086 2.40714E-5 41543 1 NA
7-87135359-T-TATTAGGCAGTGACTCGATGAAGGCATGTATGTTGGCCTCCTTTGCTGC c.3490-1_3490insGCAGCAAAGGAGGCCAACATACATGCCTTCATCGAGTCACTGCCTAAT splice_acceptor ABCB1 2 83086 2.40714E-5 41543 1 NA
7-87138597-C-T p.Leu1161Leu synonymous ABCB1 2 83186 2.40425E-5 41593 0 8.23954E-6
7-87138606-G-A p.Ile1158Ile synonymous ABCB1 2 83230 2.40298E-5 41615 0 6.37064E-5
7-87138611-A-C p.Phe1157Val missense ABCB1 1 83248 1.20123E-5 41624 0 NA
7-87138645-A-G p.Ile1145Ile synonymous ABCB1 45051 82774 0.544265 41387 12751 0.584089
7-87138657-T-C p.Ser1141Ser synonymous ABCB1 3 83182 3.60655E-5 41591 0 NA
7-87138659-A-T p.Ser1141Thr missense ABCB1 769 83146 0.00924879 41573 19 0.0178458
7-87138665-C-T p.Val1139Met missense ABCB1 1 83150 1.20265E-5 41575 0 NA
7-87138668-G-A p.Arg1138Trp missense ABCB1 1 83146 1.2027E-5 41573 0 1.64739E-5
7-87138672-G-A p.Asn1136Asn synonymous ABCB1 4 83134 4.81151E-5 41567 0 6.58968E-5
7-87138678-T-A p.Gly1134Gly synonymous ABCB1 1 83118 1.20311E-5 41559 0 NA
7-87138680-C-T p.Gly1134Arg missense ABCB1 1 83118 1.20311E-5 41559 0 3.97956E-6
7-87138682-T-C p.Tyr1133Cys missense ABCB1 2 83112 2.40639E-5 41556 0 3.18532E-5
7-87138684-G-A p.Ala1132Ala synonymous ABCB1 117 83110 0.00140777 41555 1 0.00805639
7-87138690-G-A p.Asn1130Asn synonymous ABCB1 2 83088 2.40709E-5 41544 0 8.23683E-6
7-87138691-T-A p.Asn1130Ile missense ABCB1 2 83084 2.4072E-5 41542 0 8.23683E-6
7-87138695-C-T p.Glu1129Lys missense ABCB1 3 83062 3.61176E-5 41531 0 0.00125
7-87138695-C-G p.Glu1129Gln missense ABCB1 2 83062 2.40784E-5 41531 0 NA
7-87138697-G-A p.Ala1128Val missense ABCB1 1 83052 1.20406E-5 41526 0 NA
7-87138708-G-A p.Asp1124Asp synonymous ABCB1 2 83008 2.40941E-5 41504 0 7.96026E-6
7-87138710-C-A p.Asp1124Tyr missense ABCB1 1 83000 1.20482E-5 41500 0 NA
7-87138711-A-G p.Phe1123Phe synonymous ABCB1 4 83002 4.81916E-5 41501 0 7.96064E-6
7-87138727-T-C p.Gln1118Arg missense ABCB1 1 82932 1.20581E-5 41466 0 NA
7-87138731-A-T p.Ser1117Thr missense ABCB1 1 82912 1.2061E-5 41456 0 NA
7-87138734-C-T p.Val1116Met missense ABCB1 2 82900 2.41255E-5 41450 0 3.18451E-5
7-87138735-G-A p.Ile1115Ile synonymous ABCB1 4 82892 4.82556E-5 41446 0 6.25E-4
7-87138736-A-G p.Ile1115Thr missense ABCB1 1 82880 1.20656E-5 41440 0 7.96261E-6
7-87138747-T-C p.Ala1111Ala synonymous ABCB1 1 82826 1.20735E-5 41413 0 NA
7-87138749-C-T p.Ala1111Thr missense ABCB1 1 82836 1.2072E-5 41418 0 3.98168E-6
7-87138751-C-T p.Arg1110Gln missense ABCB1 2 82828 2.41464E-5 41414 0 8.23981E-6
7-87138758-A-G p.Trp1108Arg missense ABCB1 30 82814 3.62258E-4 41407 0 8.27815E-4
7-87138760-T-G p.Gln1107Pro missense ABCB1 221 82786 0.00266953 41393 1 0.00968153
7-87138764-C-T p.Val1106Ile missense ABCB1 13 82756 1.57088E-4 41378 0 3.82117E-4
7-87138770-G-T p.Leu1104Met missense ABCB1 1 82710 1.20904E-5 41355 0 NA
7-87138772-C-A p.Arg1103Leu missense ABCB1 1 82678 1.20951E-5 41339 0 NA
7-87138773-G-A p.Arg1103* stop_gained ABCB1 1 82634 1.21016E-5 41317 0 3.98362E-6
7-87138774-C-T p.Lys1102Lys synonymous ABCB1 6 82636 7.26076E-5 41318 0 2.47406E-5
7-87138797-G-A p.Leu1095Leu splice_region+synonymous ABCB1 1 82212 1.21637E-5 41106 0 NA
7-87138804-A-C c.3283-7T>G splice_region ABCB1 1 82074 1.21841E-5 41037 0 NA
7-87144567-C-T p.Asp1088Asn missense ABCB1 35 82686 4.23288E-4 41343 0 4.13155E-4
7-87144568-G-A p.Tyr1087Tyr synonymous ABCB1 18 82728 2.1758E-4 41364 0 0.00100806
7-87144577-C-T p.Glu1084Glu synonymous ABCB1 3 82790 3.62363E-5 41395 0 8.25532E-6
7-87144582-G-C p.Leu1083Val missense ABCB1 11 82832 1.32799E-4 41416 0 3.98213E-5
7-87144615-T-G p.Ser1072Arg missense ABCB1 1 83012 1.20465E-5 41506 0 NA
7-87144630-C-T p.Ala1067Thr missense ABCB1 1 83048 1.20412E-5 41524 0 1.64948E-5
7-87144632-A-T p.Leu1066Gln missense ABCB1 3 83074 3.61124E-5 41537 0 NA
7-87144643-C-A p.Lys1062Asn missense ABCB1 1 83162 1.20247E-5 41581 0 3.97981E-6
7-87144652-C-T p.Glu1059Glu synonymous ABCB1 2 83194 2.40402E-5 41597 0 NA
7-87144663-G-C p.Leu1056Val missense ABCB1 1 83232 1.20146E-5 41616 0 NA
7-87144665-C-T p.Gly1055Glu missense ABCB1 2 83244 2.40258E-5 41622 0 5.77253E-5
7-87144678-G-C p.Pro1051Ala missense ABCB1 12 83280 1.44092E-4 41640 0 3.82263E-4
7-87144681-T-G p.Ile1050Leu missense ABCB1 1 83286 1.20068E-5 41643 0 6.37024E-5
7-87144685-C-T p.Pro1048Pro synonymous ABCB1 1 83296 1.20054E-5 41648 0 3.18573E-5
7-87144686-G-A p.Pro1048Leu missense ABCB1 2 83302 2.4009E-5 41651 0 0.00100705
7-87144687-G-A p.Pro1048Ser missense ABCB1 1 83310 1.20034E-5 41655 0 3.18593E-5
7-87144689-C-T p.Arg1047Gln missense ABCB1 1 83312 1.20031E-5 41656 0 NA
7-87144693-T-C p.Thr1046Ala missense ABCB1 1 83310 1.20034E-5 41655 0 NA
7-87144694-G-A p.Pro1045Pro synonymous ABCB1 1 83306 1.20039E-5 41653 0 NA
7-87144708-C-T p.Val1041Ile missense ABCB1 3 83332 3.60006E-5 41666 0 3.97788E-5
7-87144719-A-T p.Phe1037Tyr missense ABCB1 1 83320 1.20019E-5 41660 0 NA
7-87144743-T-C p.Asn1029Ser missense+splice_region ABCB1 3 83264 3.603E-5 41632 0 6.37024E-5
7-87144745-C-CGGCATTAGGCCTTCCG c.3085-2_3085-1insCGGAAGGCCTAATGCC splice_acceptor ABCB1 2 83258 2.40217E-5 41629 1 NA
7-87145824-C-T c.3084+1G>A splice_donor ABCB1 1 83110 1.20322E-5 41555 0 NA
7-87145826-G-A p.Pro1028Leu missense+splice_region ABCB1 4 83130 4.81174E-5 41565 0 4.94234E-5
7-87145830-T-A p.Met1027Leu missense ABCB1 1 83150 1.20265E-5 41575 0 8.2371E-6
7-87145840-C-T p.Thr1023Thr synonymous ABCB1 2 83178 2.40448E-5 41589 0 5.03525E-4
7-87145841-G-A p.Thr1023Met missense ABCB1 2 83184 2.40431E-5 41592 0 1.9897E-5
7-87145846-G-A p.Tyr1021Tyr synonymous ABCB1 4 83196 4.80792E-5 41598 0 8.2371E-6
7-87145865-G-T p.Thr1015Asn missense ABCB1 5 83246 6.00629E-5 41623 0 2.54874E-4
7-87145870-T-C p.Glu1013Glu synonymous ABCB1 1 83234 1.20143E-5 41617 0 NA
7-87145881-T-C p.Met1010Val missense ABCB1 3 83218 3.60499E-5 41609 0 4.94307E-5
7-87145885-G-T p.Ile1008Ile synonymous ABCB1 1 83208 1.20181E-5 41604 0 8.23873E-6
7-87145887-T-C p.Ile1008Val missense ABCB1 1 83198 1.20195E-5 41599 0 NA
7-87145888-G-A p.His1007His synonymous ABCB1 1 83194 1.20201E-5 41597 0 8.23913E-6
7-87145892-G-A p.Ala1006Val missense ABCB1 2 83186 2.40425E-5 41593 0 NA
7-87145941-G-GC p.Gln990fs frameshift ABCB1 1 83024 1.20447E-5 41512 0 NA
7-87145947-C-T p.Val988Met missense ABCB1 14 83004 1.68667E-4 41502 0 1.91302E-4
7-87145948-G-A p.Ala987Ala synonymous ABCB1 2 83000 2.40964E-5 41500 0 3.58429E-5
7-87145969-A-C p.Ala980Ala synonymous ABCB1 1 82948 1.20557E-5 41474 0 3.98318E-6
7-87145981-T-TAACAGAACATC c.2928-1_2928insGATGTTCTGTT splice_acceptor ABCB1 1 82842 1.20712E-5 41421 0 NA
7-87145988-A-T c.2928-7T>A splice_region ABCB1 1 82750 1.20846E-5 41375 0 4.16334E-5
7-87148644-C-T p.Leu975Leu splice_region+synonymous ABCB1 4 83048 4.81649E-5 41524 0 7.42844E-5
7-87148649-C-T p.Val974Ile missense ABCB1 1 83082 1.20363E-5 41541 0 3.18451E-5
7-87148651-T-G p.Asp973Ala missense ABCB1 2 83092 2.40697E-5 41546 0 1.19458E-5
7-87148655-C-T p.Glu972Lys missense ABCB1 1 83100 1.20337E-5 41550 0 6.36821E-5
7-87148681-A-G p.Leu963Ser missense ABCB1 1 83146 1.2027E-5 41573 0 7.96014E-6
7-87148683-G-A p.Tyr962Tyr synonymous ABCB1 2 83150 2.40529E-5 41575 0 3.98038E-6
7-87148696-C-T p.Arg958Gln missense ABCB1 7 83160 8.41751E-5 41580 1 5.03525E-4
7-87148697-G-A p.Arg958Trp missense ABCB1 1 83164 1.20244E-5 41582 0 6.25E-4
7-87148702-C-T p.Cys956Tyr missense ABCB1 2 83170 2.40471E-5 41585 0 3.97994E-6
7-87148711-T-G p.Tyr953Ser missense ABCB1 1 83164 1.20244E-5 41582 0 NA
7-87148712-A-G p.Tyr953His missense ABCB1 1 83164 1.20244E-5 41582 0 1.64897E-5
7-87148713-G-C p.Ser952Ser synonymous ABCB1 2 83166 2.40483E-5 41583 0 8.24498E-6
7-87148719-A-G p.Tyr950Tyr synonymous ABCB1 1 83146 1.2027E-5 41573 0 NA
7-87148726-A-G p.Met948Thr missense ABCB1 2 83136 2.4057E-5 41568 0 8.24484E-6
7-87148730-C-A p.Ala947Ser missense ABCB1 1 83126 1.20299E-5 41563 0 4.12276E-5
7-87148741-G-T p.Ser943Tyr missense ABCB1 1 83094 1.20346E-5 41547 0 NA
7-87148760-T-G p.Ile937Leu missense ABCB1 2 83018 2.40912E-5 41509 0 8.24715E-6
7-87148773-C-T p.Leu932Leu synonymous ABCB1 1 82966 1.20531E-5 41483 0 8.25341E-6
7-87148781-T-G p.Asn930His missense+splice_region ABCB1 2 82894 2.41272E-5 41447 0 3.18512E-5
7-87150095-T-G p.Tyr928Ser missense ABCB1 3 83250 3.6036E-5 41625 0 6.59903E-5
7-87150097-T-C p.Pro927Pro synonymous ABCB1 1 83246 1.20126E-5 41623 0 3.1841E-5
7-87150102-C-T p.Val926Ile missense ABCB1 2 83250 2.4024E-5 41625 0 3.71183E-4
7-87150105-G-T p.Gln925Lys missense ABCB1 1 83254 1.20114E-5 41627 0 8.2481E-6
7-87150123-T-C p.Met919Val missense ABCB1 1 83232 1.20146E-5 41616 0 NA
7-87150134-T-G p.Lys915Thr missense ABCB1 1 83202 1.20189E-5 41601 0 3.1837E-5
7-87150146-G-A p.Thr911Ile missense ABCB1 1 83170 1.20236E-5 41585 0 NA
7-87150150-A-G p.Leu910Leu synonymous ABCB1 2 83154 2.40518E-5 41577 0 3.1837E-5
7-87150159-C-T p.Val907Ile missense ABCB1 2 83074 2.40749E-5 41537 0 6.25E-4
7-87150164-C-T p.Arg905Gln missense ABCB1 2 83040 2.40848E-5 41520 0 6.37227E-5
7-87150177-T-C p.Ile901Val missense ABCB1 2 82992 2.40987E-5 41496 0 NA
7-87150182-T-C p.Glu899Gly missense ABCB1 1 82954 1.20549E-5 41477 0 NA
7-87150189-C-T p.Ala897Thr missense ABCB1 5 82878 6.03296E-5 41439 0 4.96582E-5
7-87150190-G-A p.Ile896Ile splice_region+synonymous ABCB1 4 82854 4.82777E-5 41427 0 2.4832E-5
7-87160604-A-G c.2685+6T>C splice_region ABCB1 1 82574 1.21103E-5 41287 0 NA
7-87160616-AGA-GGC p.Ser893Ala missense ABCB1 1 82684 1.20942E-5 41342 0 NA
7-87160616-A-G p.Ser893Ser synonymous ABCB1 1 82684 1.20942E-5 41342 0 NA
7-87160618-A-C p.Ser893Ala missense ABCB1 44979 77822 0.577973 38911 13368 0.63661
7-87160618-A-T p.Ser893Thr missense ABCB1 1821 82368 0.0221081 41184 40 0.0625
7-87160622-T-C p.Glu891Glu synonymous ABCB1 1 82718 1.20893E-5 41359 0 3.18431E-5
7-87160644-A-G p.Leu884Pro missense ABCB1 2 82832 2.41453E-5 41416 0 3.18532E-5
7-87160645-G-A p.Leu884Leu synonymous ABCB1 311 82838 0.00375432 41419 0 0.0035687
7-87160675-C-T p.Val874Ile missense ABCB1 2 82954 2.41097E-5 41477 0 NA
7-87160694-G-C p.Ile867Met missense ABCB1 1 82952 1.20552E-5 41476 0 NA
7-87160705-T-C p.Ile864Val missense ABCB1 2 82978 2.41028E-5 41489 0 3.18552E-5
7-87160706-T-C p.Ala863Ala synonymous ABCB1 1 82980 1.20511E-5 41490 0 3.98318E-6
7-87160707-G-T p.Ala863Glu missense ABCB1 1 82972 1.20523E-5 41486 0 NA
7-87160720-G-C p.Leu859Val missense ABCB1 1 83026 1.20444E-5 41513 0 NA
7-87160727-T-C p.Gln856Gln synonymous ABCB1 3 83042 3.61263E-5 41521 0 2.38973E-5
7-87160739-G-A p.Ile852Ile synonymous ABCB1 1 83060 1.20395E-5 41530 0 8.2545E-6
7-87160747-A-G p.Ser850Pro missense ABCB1 1 83054 1.20404E-5 41527 0 NA
7-87160761-G-A p.Thr845Ile missense ABCB1 1 83050 1.20409E-5 41525 0 NA
7-87160766-A-G p.Leu843Leu synonymous ABCB1 1 83024 1.20447E-5 41512 0 NA
7-87160774-C-T p.Ala841Thr missense ABCB1 1 83000 1.20482E-5 41500 0 NA
7-87160789-T-C p.Ile836Val missense ABCB1 35 82932 4.22033E-4 41466 0 0.00133732
7-87160803-G-C p.Ser831Cys missense ABCB1 1 82856 1.20691E-5 41428 0 NA
7-87160815-T-C c.2482-2A>G splice_acceptor ABCB1 1 82720 1.2089E-5 41360 0 NA
7-87160821-A-G c.2482-8T>C splice_region ABCB1 1 82560 1.21124E-5 41280 0 NA
7-87165766-G-C c.2481+8C>G splice_region ABCB1 12 83256 1.44134E-4 41628 0 7.00592E-4
7-87165769-C-T c.2481+5G>A splice_region ABCB1 1 83262 1.20103E-5 41631 0 8.25164E-6
7-87165777-T-C p.Lys826Lys synonymous ABCB1 1 83286 1.20068E-5 41643 0 NA
7-87165787-G-T p.Ala823Asp missense ABCB1 2 83304 2.40085E-5 41652 0 NA
7-87165789-A-C p.Ala822Ala synonymous ABCB1 3 83314 3.60084E-5 41657 0 3.1839E-5
7-87165791-C-T p.Ala822Thr missense ABCB1 1 83314 1.20028E-5 41657 0 NA
7-87165796-T-C p.Asn820Ser missense ABCB1 2 83312 2.40061E-5 41656 0 NA
7-87165800-C-T p.Ala819Thr missense ABCB1 10 83286 1.20068E-4 41643 0 1.27494E-4
7-87165817-G-C p.Ala813Gly missense ABCB1 20 83272 2.40177E-4 41636 1 6.25E-4
7-87165847-C-G p.Trp803Ser missense ABCB1 1 83190 1.20207E-5 41595 0 NA
7-87165854-C-T p.Val801Met missense ABCB1 1 83164 1.20244E-5 41582 0 NA
7-87165855-A-T p.Asp800Glu missense+splice_region ABCB1 1 83164 1.20244E-5 41582 0 5.41643E-4
7-87165860-G-GTC c.2398-4_2398-3insGA splice_region ABCB1 2 83106 2.40657E-5 41553 1 NA
7-87166347-G-A n.25+7C>T splice_region ABCB1 5 458 0.010917 229 0 0.00828342
7-87168579-C-G c.2397+5G>C splice_region ABCB1 1 82262 1.21563E-5 41131 0 NA
7-87168581-T-C c.2397+3A>G splice_region ABCB1 5 82260 6.07829E-5 41130 0 7.44663E-5
7-87168590-G-A p.Leu797Leu synonymous ABCB1 1 82378 1.21392E-5 41189 0 NA
7-87168597-G-C p.Ser795Cys missense ABCB1 2 82460 2.42542E-5 41230 0 6.25E-4
7-87168600-C-A p.Arg794Leu missense ABCB1 8 82466 9.70097E-5 41233 0 3.58629E-5
7-87168602-G-A p.Phe793Phe synonymous ABCB1 1 82484 1.21236E-5 41242 0 8.36793E-5
7-87168608-C-T p.Met791Ile missense ABCB1 1 82570 1.21109E-5 41285 0 NA
7-87168609-A-G p.Met791Thr missense ABCB1 3 82582 3.63275E-5 41291 0 2.54696E-4
7-87168610-T-C p.Met791Val missense ABCB1 1 82584 1.21089E-5 41292 0 8.25437E-6
7-87168615-C-T p.Arg789Gln missense ABCB1 1 82578 1.21098E-5 41289 0 NA
7-87168622-G-T p.Arg787Arg synonymous ABCB1 1 82616 1.21042E-5 41308 0 1.99186E-5
7-87168626-G-A p.Thr785Thr synonymous ABCB1 23 82630 2.78349E-4 41315 0 7.00592E-4
7-87168631-G-A p.Leu784Phe missense ABCB1 1 82634 1.21016E-5 41317 0 NA
7-87168635-C-T p.Glu782Glu synonymous ABCB1 1 82634 1.21016E-5 41317 0 NA
7-87168639-C-G p.Gly781Ala missense ABCB1 1 82642 1.21004E-5 41321 0 NA
7-87168649-CA-C p.Phe777fs frameshift ABCB1 1 82612 1.21048E-5 41306 0 NA
7-87168661-C-G p.Gly774Arg missense+splice_region ABCB1 3 82522 3.63539E-5 41261 0 3.18532E-5
7-87168668-G-C c.2320-7C>G splice_region ABCB1 1 82442 1.21297E-5 41221 0 9.93789E-5
7-87170678-G-A p.Leu772Phe missense ABCB1 1 82786 1.20793E-5 41393 0 NA
7-87170685-T-C p.Thr769Thr synonymous ABCB1 13 82944 1.56732E-4 41472 0 0.00125156
7-87170690-T-C p.Ile768Val missense ABCB1 2 83010 2.40935E-5 41505 0 7.97594E-6
7-87170691-A-G p.Phe767Phe synonymous ABCB1 1 83034 1.20433E-5 41517 0 NA
7-87170699-T-C p.Ile765Val missense ABCB1 1 83086 1.20357E-5 41543 0 1.19537E-5
7-87170714-G-A p.Leu760Leu synonymous ABCB1 1 83174 1.2023E-5 41587 0 NA
7-87170719-A-T p.Leu758* stop_gained ABCB1 1 83182 1.20218E-5 41591 0 NA
7-87170722-A-G p.Leu757Pro missense ABCB1 1 83180 1.20221E-5 41590 0 1.99007E-5
7-87170730-C-A p.Leu754Phe missense ABCB1 2 83170 2.40471E-5 41585 0 3.18979E-5
7-87170730-C-T p.Leu754Leu synonymous ABCB1 1 83170 1.20236E-5 41585 0 NA
7-87170735-T-C p.Asn753Asp missense ABCB1 3 83174 3.6069E-5 41587 0 5.96958E-5
7-87170745-TC-T p.Arg749fs frameshift ABCB1 1 83176 1.20227E-5 41588 0 3.97956E-6
7-87170746-C-A p.Arg749Leu missense ABCB1 3 83158 3.60759E-5 41579 0 6.37024E-5
7-87170760-A-T p.Asp744Glu missense ABCB1 2 83088 2.40709E-5 41544 0 8.26433E-6
7-87170770-C-A p.Arg741Ile missense ABCB1 1 83016 1.20459E-5 41508 0 3.98073E-6
7-87173443-A-G c.2211+2T>C splice_donor ABCB1 2 82990 2.40993E-5 41495 0 NA
7-87173445-C-T p.Gly737Gly splice_region+synonymous ABCB1 1 82984 1.20505E-5 41492 0 8.25191E-6
7-87173445-C-G p.Gly737Gly splice_region+synonymous ABCB1 1 82984 1.20505E-5 41492 0 8.25191E-6
7-87173454-C-A p.Lys734Asn missense ABCB1 1 82990 1.20496E-5 41495 0 NA
7-87173486-G-A p.Leu724Leu synonymous ABCB1 5 83100 6.01685E-5 41550 0 1.19433E-5
7-87173492-CA-C p.Asn721fs frameshift ABCB1 1 83098 1.2034E-5 41549 0 NA
7-87173498-T-C p.Ile720Val missense ABCB1 2 83106 2.40657E-5 41553 0 3.18451E-5
7-87173507-A-G p.Cys717Arg missense ABCB1 1 83126 1.20299E-5 41563 0 NA
7-87173514-A-C p.Gly714Gly synonymous ABCB1 1 83136 1.20285E-5 41568 0 3.97988E-6
7-87173519-C-T p.Val713Ile missense ABCB1 5 83158 6.01265E-5 41579 0 3.18573E-5
7-87173539-G-T p.Thr706Asn missense ABCB1 2 83156 2.40512E-5 41578 0 2.47419E-5
7-87173541-T-C p.Leu705Leu synonymous ABCB1 1 83154 1.20259E-5 41577 0 NA
7-87173550-C-T p.Lys702Lys synonymous ABCB1 4 83126 4.81197E-5 41563 0 6.25E-4
7-87173559-C-T p.Arg699Arg synonymous ABCB1 2 83064 2.40778E-5 41532 0 9.55475E-5
7-87173590-T-C p.Asp689Gly missense+splice_region ABCB1 1 82700 1.20919E-5 41350 0 3.98632E-6
7-87174159-G-C p.Leu682Val missense ABCB1 2 83280 2.40154E-5 41640 0 3.18532E-5
7-87174165-T-C p.Arg680Gly missense ABCB1 1 83264 1.201E-5 41632 0 NA
7-87174166-G-A p.Asp679Asp synonymous ABCB1 1 83266 1.20097E-5 41633 0 3.97725E-6
7-87174168-C-G p.Asp679His missense ABCB1 1 83268 1.20094E-5 41634 0 3.97719E-6
7-87174186-G-A p.Arg673Cys missense ABCB1 2 83286 2.40136E-5 41643 0 5.03525E-4
7-87174188-A-G p.Val672Ala missense ABCB1 1 83290 1.20062E-5 41645 0 NA
7-87174192-T-G p.Ser671Arg missense ABCB1 7 83288 8.40457E-5 41644 0 3.97766E-6
7-87174197-C-T p.Arg669His missense ABCB1 3 83278 3.60239E-5 41639 0 2.22944E-4
7-87174197-C-A p.Arg669Leu missense ABCB1 5 83278 6.00399E-5 41639 0 2.78452E-5
7-87174198-G-A p.Arg669Cys missense ABCB1 74 83266 8.88718E-4 41633 1 0.00238884
7-87174201-T-C p.Thr668Ala missense ABCB1 1 83266 1.20097E-5 41633 0 8.23737E-6
7-87174210-T-G p.Lys665Gln missense ABCB1 3 83248 3.60369E-5 41624 0 3.50274E-4
7-87174218-A-C p.Leu662Arg missense ABCB1 65 83230 7.80968E-4 41615 0 4.41661E-4
7-87174219-G-A p.Leu662Leu synonymous ABCB1 7 83238 8.40962E-5 41619 0 2.23001E-4
7-87174240-A-G p.Ser655Pro missense ABCB1 1 83182 1.20218E-5 41591 0 3.97931E-6
7-87174254-G-C p.Ala650Gly missense ABCB1 5 83134 6.01439E-5 41567 0 6.25E-4
7-87174259-A-G p.Ile648Ile synonymous ABCB1 1 83124 1.20302E-5 41562 0 NA
7-87174260-A-G p.Ile648Thr missense ABCB1 2 83118 2.40622E-5 41559 0 1.55221E-4
7-87174266-C-A p.Ser646Ile missense ABCB1 1 83106 1.20328E-5 41553 0 1.8976E-4
7-87174278-T-A p.Asp642Val missense ABCB1 3 83046 3.61246E-5 41523 0 1.99081E-5
7-87174286-A-G p.Asn639Asn synonymous ABCB1 1 82998 1.20485E-5 41499 0 NA
7-87174288-T-C p.Asn639Asp missense ABCB1 1 82990 1.20496E-5 41495 0 NA
7-87174290-T-G p.Glu638Ala missense ABCB1 1 82978 1.20514E-5 41489 0 NA
7-87174292-T-C p.Leu637Leu synonymous ABCB1 1 82960 1.2054E-5 41480 0 3.1839E-5
7-87175175-A-C c.1887+4T>G splice_region ABCB1 19 83114 2.28602E-4 41557 0 1.79129E-4
7-87175175-A-G c.1887+4T>C splice_region ABCB1 1 83114 1.20317E-5 41557 0 3.18471E-5
7-87175176-T-C c.1887+3A>G splice_region ABCB1 1 83122 1.20305E-5 41561 0 NA
7-87175195-T-C p.Lys624Arg missense ABCB1 13 83164 1.56318E-4 41582 0 6.59424E-5
7-87175212-C-T p.Glu618Glu synonymous ABCB1 19 83176 2.28431E-4 41588 0 0.00251762
7-87175221-G-A p.Leu615Leu synonymous ABCB1 1 83202 1.20189E-5 41601 0 NA
7-87175229-C-A p.Asp613Tyr missense ABCB1 1 83204 1.20187E-5 41602 0 8.24158E-6
7-87175247-C-T p.Val607Met missense ABCB1 3 83188 3.60629E-5 41594 0 2.47268E-5
7-87175257-A-G p.Asp603Asp synonymous ABCB1 3 83188 3.60629E-5 41594 0 9.55292E-5
7-87175259-C-A p.Asp603Tyr missense ABCB1 2 83190 2.40414E-5 41595 0 3.97852E-6
7-87175260-A-G p.Asp602Asp synonymous ABCB1 6 83180 7.21327E-5 41590 0 NA
7-87175262-C-T p.Asp602Asn missense ABCB1 1 83176 1.20227E-5 41588 0 1.64856E-5
7-87175263-G-A p.Phe601Phe synonymous ABCB1 2 83176 2.40454E-5 41588 0 6.59424E-5
7-87175267-C-T p.Gly600Asp missense ABCB1 1 83166 1.20241E-5 41583 0 1.1936E-5
7-87175271-C-T p.Ala599Thr missense ABCB1 3 83166 3.60724E-5 41583 0 9.55475E-5
7-87175271-C-A p.Ala599Ser missense ABCB1 1 83166 1.20241E-5 41583 0 NA
7-87175272-G-A p.Ile598Ile synonymous ABCB1 22 83164 2.64538E-4 41582 0 0.00125
7-87175274-T-A p.Ile598Phe missense ABCB1 1 83164 1.20244E-5 41582 0 NA
7-87175278-G-A p.Asp596Asp synonymous ABCB1 15 83158 1.8038E-4 41579 0 3.82141E-4
7-87175284-A-G p.Asn594Asn synonymous ABCB1 1 83174 1.2023E-5 41587 0 NA
7-87175288-C-T p.Arg593His missense ABCB1 13 83174 1.56299E-4 41587 0 2.88569E-4
7-87175289-G-A p.Arg593Cys missense ABCB1 5 83178 6.0112E-5 41589 0 1.15422E-4
7-87175295-T-C p.Thr591Ala missense ABCB1 1 83158 1.20253E-5 41579 0 5.96777E-5
7-87175304-G-A p.Arg588Cys missense ABCB1 5 83158 6.01265E-5 41579 0 2.47402E-5
7-87175308-A-C p.Ala586Ala synonymous ABCB1 1 83144 1.20273E-5 41572 0 NA
7-87175320-G-T p.Thr582Thr synonymous ABCB1 1 83098 1.2034E-5 41549 0 3.97972E-6
7-87175327-C-T p.Arg580Gln missense ABCB1 2 83066 2.40772E-5 41533 0 5.03525E-4
7-87175328-G-A p.Arg580Trp missense ABCB1 1 83064 1.20389E-5 41532 0 3.98035E-6
7-87175340-C-T p.Ala576Thr missense+splice_region ABCB1 1 83024 1.20447E-5 41512 0 NA
7-87175342-T-TTATCCAGAGCCACCTGAACCACTGCTTCGCTTTCTGTGTCC c.1726-3_1726-2insGGACACAGAAAGCGAAGCAGTGGTTCAGGTGGCTCTGGATA splice_region ABCB1 1 83006 1.20473E-5 41503 0 NA
7-87178660-T-C c.1725+4A>G splice_region ABCB1 5 83326 6.00053E-5 41663 1 1.59079E-5
7-87178661-G-A c.1725+3C>T splice_region ABCB1 1 83332 1.20002E-5 41666 0 NA
7-87178668-T-A p.Asp574Val missense ABCB1 1 83360 1.19962E-5 41680 0 NA
7-87178678-C-T p.Val571Met missense ABCB1 4 83374 4.79766E-5 41687 0 1.64796E-5
7-87178679-C-T p.Gln570Gln synonymous ABCB1 1 83378 1.19936E-5 41689 0 6.25E-4
7-87178685-C-A p.Val568Val synonymous ABCB1 1 83382 1.1993E-5 41691 0 NA
7-87178693-C-T p.Glu566Lys missense ABCB1 1 83388 1.19921E-5 41694 0 6.37024E-5
7-87178701-G-A p.Thr563Ile missense ABCB1 1 83388 1.19921E-5 41694 0 NA
7-87178701-G-C p.Thr563Arg missense ABCB1 1 83388 1.19921E-5 41694 0 NA
7-87178715-C-T p.Thr558Thr synonymous ABCB1 16 83394 1.9186E-4 41697 0 2.14732E-4
7-87178715-C-A p.Thr558Thr synonymous ABCB1 2 83394 2.39825E-5 41697 0 8.2375E-6
7-87178719-G-C p.Ala557Gly missense ABCB1 1 83394 1.19913E-5 41697 0 3.18532E-5
7-87178726-C-A p.Asp555Tyr missense ABCB1 1 83394 1.19913E-5 41697 0 NA
7-87178727-C-G p.Leu554Leu synonymous ABCB1 140 83394 0.00167878 41697 0 0.0040282
7-87178733-G-C p.Leu552Leu synonymous ABCB1 1 83398 1.19907E-5 41699 0 2.47117E-5
7-87178745-G-A p.Asn548Asn synonymous ABCB1 1 83394 1.19913E-5 41697 0 1.59074E-5
7-87178749-C-T p.Arg547His missense ABCB1 1 83398 1.19907E-5 41699 0 1.98839E-5
7-87178750-G-A p.Arg547Cys missense ABCB1 3 83398 3.59721E-5 41699 0 3.18451E-5
7-87178757-G-A p.Ala544Ala synonymous ABCB1 2 83398 2.39814E-5 41699 0 1.19302E-5
7-87178759-C-T p.Ala544Thr missense ABCB1 2 83402 2.39802E-5 41701 0 8.23683E-6
7-87178761-C-T p.Arg543His missense ABCB1 2 83404 2.39797E-5 41702 0 7.95323E-6
7-87178762-G-A p.Arg543Cys missense ABCB1 1 83400 1.19904E-5 41700 0 3.1841E-5
7-87178766-A-C p.Ile541Met missense ABCB1 1 83402 1.19901E-5 41701 0 3.18532E-5
7-87178766-A-G p.Ile541Ile synonymous ABCB1 1 83402 1.19901E-5 41701 0 6.37064E-5
7-87178769-G-A p.Ala540Ala synonymous ABCB1 10 83402 1.19901E-4 41701 0 4.11834E-5
7-87178771-C-T p.Ala540Thr missense ABCB1 2 83398 2.39814E-5 41699 0 3.18532E-5
7-87178772-G-A p.Ile539Ile synonymous ABCB1 1 83404 1.19898E-5 41702 0 NA
7-87178783-T-G p.Lys536Gln missense ABCB1 4 83404 4.79593E-5 41702 0 2.38601E-5
7-87178800-T-C p.Gln530Arg missense ABCB1 1 83398 1.19907E-5 41699 0 NA
7-87178808-T-C p.Arg527Arg synonymous ABCB1 1 83396 1.1991E-5 41698 0 NA
7-87178834-T-TATGAGGCAGTTTCATGATAAAGTCATAGGCATTGG c.1555-1_1555insCCAATGCCTATGACTTTATCATGAAACTGCCTCAT splice_acceptor ABCB1 2 83346 2.39964E-5 41673 1 NA
7-87178840-A-G c.1555-6T>C splice_region ABCB1 5 83322 6.00082E-5 41661 0 6.36943E-5
7-87179166-C-G c.1554+1G>C splice_donor ABCB1 1 83278 1.2008E-5 41639 0 NA
7-87179181-T-C p.Met514Val missense ABCB1 3 83300 3.60144E-5 41650 0 1.64728E-5
7-87179186-A-T p.Phe512Tyr missense ABCB1 1 83298 1.20051E-5 41649 0 NA
7-87179198-T-C p.Asn508Ser missense ABCB1 1 83286 1.20068E-5 41643 0 1.98834E-5
7-87179201-G-A p.Ala507Val missense ABCB1 3 83288 3.60196E-5 41644 0 3.18532E-5
7-87179222-A-G p.Ile500Thr missense ABCB1 2 83266 2.40194E-5 41633 0 8.23655E-6
7-87179228-T-C p.Asp498Gly missense ABCB1 1 83266 1.20097E-5 41633 0 8.23642E-6
7-87179229-C-A p.Asp498Tyr missense ABCB1 1 83272 1.20088E-5 41636 0 3.18451E-5
7-87179236-G-T p.Val495Val synonymous ABCB1 1 83250 1.2012E-5 41625 0 NA
7-87179238-C-T p.Val495Ile missense ABCB1 1 83244 1.20129E-5 41622 0 1.98866E-5
7-87179245-A-G p.Arg492Arg synonymous ABCB1 1 83228 1.20152E-5 41614 0 NA
7-87179246-C-T p.Arg492His missense ABCB1 2 83228 2.40304E-5 41614 0 1.19323E-5
7-87179247-G-A p.Arg492Cys missense ABCB1 3 83222 3.60482E-5 41611 0 4.11821E-5
7-87179254-G-A p.Arg489Arg synonymous ABCB1 1 83210 1.20178E-5 41605 0 3.1839E-5
7-87179255-C-A p.Arg489Leu missense ABCB1 1 83202 1.20189E-5 41601 0 2.47097E-5
7-87179256-G-A p.Arg489Cys missense ABCB1 28 83212 3.3649E-4 41606 0 5.60076E-4
7-87179272-C-T p.Thr483Thr synonymous ABCB1 3 83240 3.60404E-5 41620 0 2.47093E-5
7-87179272-C-G p.Thr483Thr synonymous ABCB1 1 83240 1.20135E-5 41620 0 1.64728E-5
7-87179276-G-A p.Thr482Ile missense ABCB1 1 83250 1.2012E-5 41625 0 8.23642E-6
7-87179278-G-A p.Ala481Ala synonymous ABCB1 2 83262 2.40206E-5 41631 0 NA
7-87179292-G-T p.Pro477Thr missense ABCB1 1 83254 1.20114E-5 41627 0 8.23655E-6
7-87179293-T-G p.Glu476Asp missense ABCB1 1 83260 1.20106E-5 41630 0 6.36983E-5
7-87179293-T-A p.Glu476Asp missense ABCB1 1 83260 1.20106E-5 41630 0 NA
7-87179312-A-G p.Ile470Thr missense ABCB1 2 83302 2.4009E-5 41651 0 NA
7-87179315-A-G p.Ile469Thr missense ABCB1 1 83300 1.20048E-5 41650 0 NA
7-87179334-C-A p.Val463Leu missense ABCB1 2 83306 2.40079E-5 41653 0 8.23683E-6
7-87179350-A-G p.Asp457Asp synonymous ABCB1 4 83324 4.80054E-5 41662 0 2.22859E-4
7-87179359-A-G p.Asp454Asp synonymous ABCB1 7 83322 8.40114E-5 41661 0 9.5511E-5
7-87179368-GACCTGGAATAAAAAGTAAGTGTGACTTTCATACATTTGTAATTGAAAGGGCAACATCAGAAAGATGTGCAATGTGACTGCTGATCACCGCAGGGTCTAGCTCGCATGGGTCATCTC-G p.Val451fs frameshift ABCB1 6 83302 7.20271E-5 41651 0 NA
7-87179498-T-C p.Thr447Ala missense ABCB1 1 83290 1.20062E-5 41645 0 NA
7-87179529-T-C p.Thr436Thr synonymous ABCB1 41 83330 4.9202E-4 41665 0 0.00453172
7-87179571-C-T p.Thr422Thr synonymous ABCB1 4 83332 4.80008E-5 41666 0 6.25E-4
7-87179572-G-A p.Thr422Met missense ABCB1 2 83332 2.40004E-5 41666 0 3.18431E-5
7-87179590-T-C p.Lys416Arg missense ABCB1 1 83326 1.20011E-5 41663 0 7.95494E-6
7-87179601-A-G p.Gly412Gly synonymous ABCB1 49156 82886 0.593056 41443 14954 0.614002
7-87179614-T-TTAACTTCTTTTCGAGATGGGTA c.1225-3_1225-2insTACCCATCTCGAAAAGAAGTTA splice_region ABCB1 2 83286 2.40136E-5 41643 0 NA
7-87179616-C-T c.1225-4G>A splice_region ABCB1 140 83268 0.00168132 41634 0 0.00363127
7-87179779-T-A c.1224+5A>T splice_region ABCB1 2 83220 2.40327E-5 41610 0 8.26446E-6
7-87179789-C-A p.Val407Phe missense ABCB1 14 83232 1.68205E-4 41616 0 2.54761E-4
7-87179797-C-T p.Arg404Gln missense ABCB1 5 83244 6.00644E-5 41622 0 1.15492E-4
7-87179809-C-T p.Ser400Asn missense ABCB1 2985 83196 0.0358791 41598 64 0.029708
7-87179815-T-A p.His398Leu missense ABCB1 7 83262 8.4072E-5 41631 0 1.07611E-4
7-87179820-A-G p.Asn396Asn synonymous ABCB1 1 83260 1.20106E-5 41630 0 1.64845E-5
7-87179825-T-C p.Arg395Gly missense ABCB1 3 83262 3.60308E-5 41631 0 3.98406E-6
7-87179845-A-C p.Ile388Ser missense ABCB1 1 83266 1.20097E-5 41633 0 3.18471E-5
7-87179859-G-A p.His383His synonymous ABCB1 3 83232 3.60438E-5 41616 0 9.55414E-5
7-87179863-C-T p.Gly382Glu missense ABCB1 2 83220 2.40327E-5 41610 0 7.96876E-6
7-87179877-G-A p.Ser377Ser synonymous ABCB1 4 83184 4.80862E-5 41592 0 3.29848E-5
7-87179879-T-C p.Ser377Gly missense ABCB1 1 83182 1.20218E-5 41591 0 8.24674E-6
7-87179901-A-G c.1114-7T>C splice_region ABCB1 1 83110 1.20322E-5 41555 0 8.25191E-6
7-87180048-A-G p.Ile369Thr missense ABCB1 1 82988 1.20499E-5 41494 0 NA
7-87180049-T-C p.Ile369Val missense ABCB1 23 82978 2.77182E-4 41489 0 4.45718E-4
7-87180075-C-T p.Gly360Glu missense ABCB1 1 83080 1.20366E-5 41540 0 NA
7-87180088-C-T p.Ala356Thr missense ABCB1 2 83084 2.4072E-5 41542 0 8.26528E-6
7-87180094-C-T p.Ala354Thr missense ABCB1 1 83116 1.20314E-5 41558 0 7.16441E-5
7-87180103-T-C p.Ser351Gly missense ABCB1 2 83118 2.40622E-5 41559 0 NA
7-87180112-C-T p.Ala348Thr missense ABCB1 2 83122 2.4061E-5 41561 0 8.26966E-6
7-87180132-C-T p.Gly341Glu missense ABCB1 2 83108 2.40651E-5 41554 0 NA
7-87180144-G-T p.Ser337Tyr missense ABCB1 1 82980 1.20511E-5 41490 0 3.98441E-6
7-87180161-A-T c.1000-7T>A splice_region ABCB1 1 82622 1.21033E-5 41311 0 NA
7-87180162-A-T c.1000-8T>A splice_region ABCB1 12 82574 1.45324E-4 41287 0 1.91071E-4
7-87183088-G-T p.Gln330Lys missense ABCB1 2 83104 2.40662E-5 41552 0 NA
7-87183095-A-G p.Ser327Ser synonymous ABCB1 16 83120 1.92493E-4 41560 0 9.55231E-5
7-87183095-A-C p.Ser327Ser synonymous ABCB1 1 83120 1.20308E-5 41560 0 3.1841E-5
7-87183112-G-A p.Leu322Phe missense ABCB1 1 83124 1.20302E-5 41562 0 8.2447E-6
7-87183119-G-A p.Thr319Thr synonymous ABCB1 1 83132 1.20291E-5 41566 0 NA
7-87183121-T-G p.Thr319Pro missense ABCB1 1 83126 1.20299E-5 41563 0 NA
7-87183128-A-G p.Tyr316Tyr synonymous ABCB1 17 83132 2.04494E-4 41566 0 0.001875
7-87183138-G-C p.Ala313Gly missense ABCB1 1 83136 1.20285E-5 41568 0 NA
7-87183146-A-G p.Tyr310Tyr synonymous ABCB1 1 83134 1.20288E-5 41567 0 1.19364E-5
7-87183167-G-A p.Phe303Phe synonymous ABCB1 2 83108 2.40651E-5 41554 0 NA
7-87183179-T-C p.Ile299Met missense ABCB1 1 83060 1.20395E-5 41530 0 NA
7-87183186-A-C p.Ile297Ser missense ABCB1 1 83044 1.20418E-5 41522 0 NA
7-87183201-GCT-G p.Lys291fs frameshift ABCB1 1 83020 1.20453E-5 41510 0 NA
7-87183211-T-C p.Ile289Val missense ABCB1 1 83006 1.20473E-5 41503 0 3.98076E-6
7-87183223-T-C p.Lys285Glu missense ABCB1 3 82978 3.61542E-5 41489 0 1.65057E-5
7-87190573-T-G c.827+6A>C splice_region ABCB1 1 83076 1.20372E-5 41538 0 8.31974E-6
7-87190574-CA-C c.827+4delT splice_region ABCB1 1 83104 1.20331E-5 41552 0 NA
7-87190584-A-C p.Leu274Leu synonymous ABCB1 1 83174 1.2023E-5 41587 0 NA
7-87190588-T-C p.Glu273Gly missense ABCB1 2 83194 2.40402E-5 41597 0 NA
7-87190621-C-T p.Arg262Lys missense ABCB1 3 83248 3.60369E-5 41624 0 0.00100705
7-87190625-T-C p.Ile261Val missense ABCB1 393 83246 0.00472095 41623 3 0.0110775
7-87190639-T-G p.Glu256Ala missense ABCB1 1 83242 1.20132E-5 41621 0 3.97966E-6
7-87190643-C-A p.Glu255* stop_gained ABCB1 2 83240 2.40269E-5 41620 0 NA
7-87190648-A-G p.Val253Ala missense ABCB1 1 83224 1.20158E-5 41612 0 NA
7-87190650-T-C p.Ala252Ala synonymous ABCB1 4 83232 4.80584E-5 41616 0 1.99008E-5
7-87190663-G-C p.Ala248Gly missense ABCB1 1 83220 1.20163E-5 41610 0 NA
7-87190668-C-T p.Ala246Ala synonymous ABCB1 18 83210 2.1632E-4 41605 0 0.0015121
7-87190669-G-T p.Ala246Glu missense ABCB1 1 83214 1.20172E-5 41607 0 NA
7-87190669-G-A p.Ala246Val missense ABCB1 1 83214 1.20172E-5 41607 0 2.15055E-4
7-87190671-TAA-T p.Leu245fs frameshift ABCB1 1 83206 1.20184E-5 41603 0 NA
7-87190677-T-C p.Glu243Glu synonymous ABCB1 308 83184 0.00370264 41592 1 0.00474811
7-87190683-A-G p.Asp241Asp synonymous ABCB1 1 83184 1.20215E-5 41592 0 NA
7-87190684-T-C p.Asp241Gly missense ABCB1 5 83176 6.01135E-5 41588 0 4.3529E-5
7-87195391-C-T p.Ala233Thr missense ABCB1 1 83326 1.20011E-5 41663 0 6.25E-4
7-87195397-C-G p.Val231Leu missense ABCB1 4 83340 4.79962E-5 41670 0 4.11902E-5
7-87195441-A-T p.Leu216His missense ABCB1 2 83316 2.4005E-5 41658 0 NA
7-87195449-C-T p.Lys213Lys synonymous ABCB1 1 83308 1.20036E-5 41654 0 NA
7-87195455-A-G p.Gly211Gly synonymous ABCB1 1 83314 1.20028E-5 41657 0 NA
7-87195491-T-C p.Thr199Thr synonymous ABCB1 1 83272 1.20088E-5 41636 0 NA
7-87195509-G-T p.Phe193Leu missense ABCB1 2 83198 2.4039E-5 41599 0 3.18634E-5
7-87195524-G-C p.Asp188Glu missense ABCB1 2 83128 2.40593E-5 41564 0 6.37267E-5
7-87195540-T-C p.Asn183Ser missense ABCB1 154 82950 0.00185654 41475 0 0.01875
7-87195543-A-G p.Ile182Thr missense ABCB1 2 82932 2.41161E-5 41466 0 NA
7-87195551-G-C p.Val179Val synonymous ABCB1 3 82806 3.62293E-5 41403 0 NA
7-87196093-A-C c.530+8T>G splice_region ABCB1 2 83220 2.40327E-5 41610 0 NA
7-87196102-C-T p.Asp177Asn missense+splice_region ABCB1 2 83254 2.40229E-5 41627 0 NA
7-87196110-C-T p.Arg174Gln missense ABCB1 4 83256 4.80446E-5 41628 0 8.75531E-5
7-87196111-G-T p.Arg174Arg synonymous ABCB1 1 83262 1.20103E-5 41631 0 1.6488E-5
7-87196113-G-A p.Thr173Ile missense ABCB1 1 83268 1.20094E-5 41634 0 NA
7-87196114-T-G p.Thr173Pro missense ABCB1 6 83266 7.20582E-5 41633 0 3.18552E-5
7-87196121-C-T p.Glu170Glu synonymous ABCB1 1 83294 1.20057E-5 41647 0 NA
7-87196127-A-G p.Val168Val synonymous ABCB1 1 83310 1.20034E-5 41655 0 NA
7-87196129-C-T p.Val168Ile missense ABCB1 68 83308 8.16248E-4 41654 0 8.59818E-4
7-87196132-C-T p.Asp167Asn missense ABCB1 1 83302 1.20045E-5 41651 0 8.239E-6
7-87196133-G-A p.His166His synonymous ABCB1 1 83304 1.20042E-5 41652 0 2.78445E-5
7-87196136-C-G p.Val165Val synonymous ABCB1 1 83310 1.20034E-5 41655 0 NA
7-87196150-C-A p.Gly161Cys missense ABCB1 1 83342 1.19988E-5 41671 0 NA
7-87196154-C-A p.Glu159Asp missense ABCB1 1 83358 1.19964E-5 41679 0 NA
7-87196158-T-C p.Gln158Arg missense ABCB1 1 83366 1.19953E-5 41683 0 NA
7-87196161-C-T p.Arg157Gln missense ABCB1 7 83370 8.39631E-5 41685 0 3.18573E-5
7-87196161-C-A p.Arg157Leu missense ABCB1 2 83370 2.39894E-5 41685 0 8.23818E-6
7-87196165-T-A p.Met156Leu missense ABCB1 1 83384 1.19927E-5 41692 0 8.23805E-6
7-87196180-A-T p.Phe151Ile missense ABCB1 1 83396 1.1991E-5 41698 0 5.04032E-4
7-87196200-A-G p.Ile144Thr missense ABCB1 36 83392 4.31696E-4 41696 0 6.69301E-4
7-87196207-T-G p.Arg142Arg synonymous ABCB1 1 83386 1.19924E-5 41693 0 NA
7-87196216-C-T p.Ala139Thr missense ABCB1 1 83372 1.19944E-5 41686 0 NA
7-87196234-C-T p.Val133Ile missense ABCB1 1 83366 1.19953E-5 41683 0 NA
7-87196240-T-C p.Ile131Val missense ABCB1 1 83364 1.19956E-5 41682 0 3.97728E-6
7-87196245-G-A p.Ala129Val missense ABCB1 1 83360 1.19962E-5 41680 0 NA
7-87196260-C-A p.Gly124Val missense ABCB1 1 83318 1.20022E-5 41659 0 NA
7-87196264-C-G p.Ala123Pro missense ABCB1 1 83300 1.20048E-5 41650 0 NA
7-87196272-C-T p.Gly120Glu missense ABCB1 5 83256 6.00557E-5 41628 0 2.78625E-5
7-87196280-A-G p.Tyr117Tyr synonymous ABCB1 2 83208 2.40361E-5 41604 0 NA
7-87196284-T-C p.Tyr116Cys missense ABCB1 1 83156 1.20256E-5 41578 0 3.98279E-6
7-87196290-T-A p.Tyr114Phe missense+splice_region ABCB1 1 83066 1.20386E-5 41533 0 3.18451E-5
7-87196293-C-T c.339-1G>A splice_acceptor ABCB1 1 83028 1.20441E-5 41514 0 NA
7-87199483-A-G c.338+5T>C splice_region ABCB1 1 83004 1.20476E-5 41502 0 3.18431E-5
7-87199495-T-C p.Met111Val missense ABCB1 2 83042 2.40842E-5 41521 0 1.64984E-5
7-87199501-C-T p.Glu109Lys missense ABCB1 2 83070 2.40761E-5 41535 0 1.23722E-4
7-87199508-A-G p.Asn106Asn synonymous ABCB1 3 83096 3.61028E-5 41548 0 1.99162E-5
7-87199520-C-T p.Gly102Gly synonymous ABCB1 2 83104 2.40662E-5 41552 0 NA
7-87199521-C-G p.Gly102Ala missense ABCB1 1 83100 1.20337E-5 41550 0 NA
7-87199522-C-G p.Gly102Arg missense ABCB1 1 83104 1.20331E-5 41552 0 9.55353E-5
7-87199533-A-G p.Ile98Thr missense ABCB1 2 83092 2.40697E-5 41546 0 NA
7-87214832-A-T p.Asn94Lys missense ABCB1 2 83162 2.40494E-5 41581 0 1.19528E-5
7-87214836-G-A p.Thr93Ile missense ABCB1 1 83186 1.20213E-5 41593 0 1.99195E-5
7-87214848-A-G p.Met89Thr missense ABCB1 56 83232 6.72818E-4 41616 0 4.54568E-4
7-87214851-A-G p.Leu88Pro missense ABCB1 1 83238 1.20137E-5 41619 0 NA
7-87214881-A-G p.Ile78Thr missense ABCB1 3 83278 3.60239E-5 41639 0 4.37717E-5
7-87214884-T-C p.Asp77Gly missense ABCB1 1 83284 1.20071E-5 41642 0 5.03525E-4
7-87214919-A-G p.Leu65Leu synonymous ABCB1 1 83312 1.20031E-5 41656 0 4.94617E-5
7-87214925-A-C p.Ala63Ala synonymous ABCB1 1 83316 1.20025E-5 41658 0 NA
7-87214927-C-T p.Ala63Thr missense ABCB1 2 83310 2.40067E-5 41655 0 8.24457E-6
7-87214928-C-T p.Gly62Gly synonymous ABCB1 1 83306 1.20039E-5 41653 0 NA
7-87214931-A-G p.His61His synonymous ABCB1 2 83304 2.40085E-5 41652 0 3.18512E-5
7-87214932-T-A p.His61Leu missense ABCB1 1 83302 1.20045E-5 41651 0 NA
7-87214936-T-C p.Ile60Val missense ABCB1 1 83300 1.20048E-5 41650 0 NA
7-87214939-T-C p.Ile59Val missense ABCB1 3 83296 3.60161E-5 41648 0 NA
7-87214943-A-G p.Ala57Ala synonymous ABCB1 3 83302 3.60135E-5 41651 1 3.97886E-6
7-87214950-G-A p.Thr55Ile missense ABCB1 1 83286 1.20068E-5 41643 0 NA
7-87214967-C-A p.Leu49Phe missense ABCB1 1 83248 1.20123E-5 41624 0 1.6539E-5
7-87214978-G-T p.Leu46Ile missense ABCB1 1 83216 1.20169E-5 41608 0 NA
7-87214984-T-C p.Asn44Asp missense ABCB1 1 83184 1.20215E-5 41592 0 8.32847E-6
7-87214987-A-C p.Ser43Ala missense ABCB1 1 83158 1.20253E-5 41579 0 1.6692E-5
7-87214989-T-C p.Tyr42Cys missense ABCB1 1 83148 1.20267E-5 41574 0 NA
7-87214992-C-T p.Arg41His missense ABCB1 2 83092 2.40697E-5 41546 0 5.04244E-5
7-87214993-G-A p.Arg41Cys missense ABCB1 3 83086 3.61072E-5 41543 0 1.68413E-5
7-87214997-CTAAAAAGAG-C c.118-10_118-2delCTCTTTTTA splice_acceptor ABCB1 2 83030 2.40877E-5 41515 1 NA
7-87215004-G-C c.118-8C>G splice_region ABCB1 1 49530 2.01898E-5 24765 0 4.00991E-6
7-87225074-A-G c.117+8T>C splice_region ABCB1 3 82436 3.63919E-5 41218 0 1.59794E-5
7-87225082-CA-C p.Met39fs frameshift ABCB1 2 82528 2.42342E-5 41264 0 NA
7-87225099-CAGTT-C p.Thr33fs frameshift ABCB1 1 82578 1.21098E-5 41289 0 NA
7-87225105-G-T p.Pro32Thr missense ABCB1 1 82514 1.21192E-5 41257 0 8.32265E-6
7-87225109-CT-C p.Lys30fs frameshift ABCB1 1 82508 1.212E-5 41254 0 NA
7-87225121-A-T p.Asp26Glu missense ABCB1 1 82434 1.21309E-5 41217 0 NA
7-87229440-T-C p.Asn21Asp missense ABCB1 5578 83166 0.0670707 41583 248 0.0894643
7-87229445-A-T p.Leu19Gln missense ABCB1 4 83322 4.80065E-5 41661 0 2.59023E-5
7-87229446-G-C p.Leu19Val missense ABCB1 4 83322 4.80065E-5 41661 0 1.19447E-5
7-87229451-A-G p.Phe17Ser missense ABCB1 1 83318 1.20022E-5 41659 0 1.70698E-5
7-87229456-GTTC-G p.Lys14del disruptive_inframe_deletion ABCB1 6 83326 7.20063E-5 41663 0 2.26813E-4
7-87229467-T-G p.Lys12Gln missense ABCB1 1 83332 1.20002E-5 41666 0 2.78478E-5
7-87229477-A-C p.Asn8Lys missense ABCB1 3 83330 3.60014E-5 41665 0 3.18573E-5
7-87229478-T-C p.Asn8Ser missense ABCB1 2 83332 2.40004E-5 41666 0 NA
7-87229486-C-G p.Gly5Gly synonymous ABCB1 1 83310 1.20034E-5 41655 0 NA
7-87229488-C-T p.Gly5Arg missense ABCB1 2 83316 2.4005E-5 41658 0 NA
7-87229495-A-G p.Asp2Asp synonymous ABCB1 1 83306 1.20039E-5 41653 0 1.67034E-5
7-87229496-T-C p.Asp2Gly missense ABCB1 1 83310 1.20034E-5 41655 0 NA
7-87229497-C-T p.Asp2Asn missense ABCB1 2 83292 2.40119E-5 41646 0 NA
7-87229504-G-A c.-4C>T 5_prime_UTR_premature_start_codon_gain ABCB1 50 83250 6.00601E-4 41625 0 8.28553E-4
7-87229510-A-T c.-6-4T>A splice_region ABCB1 2 83232 2.40292E-5 41616 0 1.19471E-5
7-87230100-G-A c.-36C>T 5_prime_UTR_premature_start_codon_gain ABCB1 1 2910 3.43643E-4 1455 0 NA