Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
19-1041212-C-T c.-149C>T 5_prime_UTR_premature_start_codon_gain ABCA7 1 72606 1.3773E-5 36303 0 NA
19-1041216-C-G c.-145C>G 5_prime_UTR_premature_start_codon_gain ABCA7 1 73906 1.35307E-5 36953 0 NA
19-1041221-C-G c.-140C>G 5_prime_UTR_premature_start_codon_gain ABCA7 1 75188 1.33E-5 37594 0 NA
19-1041221-C-CA c.-137-2dupA splice_acceptor ABCA7 2 75188 2.66E-5 37594 0 NA
19-1041252-A-G c.-109A>G 5_prime_UTR_premature_start_codon_gain ABCA7 3 80086 3.74597E-5 40043 0 3.19E-5
19-1041314-C-T c.-47C>T 5_prime_UTR_premature_start_codon_gain ABCA7 2 82844 2.41418E-5 41422 0 7.98365E-6
19-1041347-T-C c.-7-7T>C splice_region ABCA7 1182 83060 0.0142307 41530 6 0.02875
19-1041352-A-G c.-7-2A>G splice_acceptor ABCA7 4008 82952 0.0483171 41476 168 0.0699695
19-1041355-C-T c.-6C>T splice_region ABCA7 1 83098 1.2034E-5 41549 0 7.96001E-6
19-1041361-A-T p.Met1? initiator_codon ABCA7 1 83112 1.2032E-5 41556 0 8.25273E-6
19-1041362-T-C p.Met1? start_lost ABCA7 4 83116 4.81255E-5 41558 0 3.97966E-6
19-1041366-C-T p.Ala2Ala synonymous ABCA7 2 83116 2.40628E-5 41558 0 NA
19-1041370-T-TG p.Thr5fs frameshift ABCA7 2 83118 2.40622E-5 41559 0 3.18837E-5
19-1041370-T-C p.Trp4Arg missense ABCA7 1 83118 1.20311E-5 41559 0 NA
19-1041385-C-A p.Leu9Met missense ABCA7 32 83080 3.85171E-4 41540 0 0.00503525
19-1041387-G-A p.Leu9Leu synonymous ABCA7 1 83078 1.20369E-5 41539 0 3.97966E-6
19-1041398-A-G p.Lys13Arg missense ABCA7 2 83072 2.40755E-5 41536 0 6.37267E-5
19-1041399-G-A p.Lys13Lys synonymous ABCA7 1 83074 1.20375E-5 41537 0 NA
19-1041413-G-T p.Arg18Leu missense ABCA7 1 82994 1.20491E-5 41497 0 8.26487E-6
19-1041425-CGGTAACGCCCCAGTGTGAGACCAGGGCCGGGTGGGCAGGCAGCCCCCACTGTCCCCCACCGTCTCCCACCTATTCTCCCCCA-C p.Val23fs frameshift ABCA7 7 82956 8.43821E-5 41478 0 NA
19-1041433-C-T c.66+7C>T splice_region ABCA7 1 82940 1.20569E-5 41470 0 7.96737E-6
19-1041508-G-A c.67-1G>A splice_acceptor ABCA7 18 83048 2.16742E-4 41524 0 1.67364E-4
19-1041530-C-T p.Leu30Leu synonymous ABCA7 1 83044 1.20418E-5 41522 0 1.65349E-5
19-1041535-G-A p.Trp31* stop_gained ABCA7 1 83000 1.20482E-5 41500 0 NA
19-1041540-T-C p.Leu33Pro missense ABCA7 1 82998 1.20485E-5 41499 0 2.56402E-4
19-1041545-CTCT-C p.Phe37del conservative_inframe_deletion ABCA7 1 82978 1.20514E-5 41489 0 3.18776E-5
19-1041560-G-C p.Val40Leu missense ABCA7 5 82712 6.04507E-5 41356 0 8.28267E-6
19-1041569-C-T p.Arg43Cys missense ABCA7 1 82364 1.21412E-5 41182 0 6.37877E-5
19-1041574-C-A p.His44Gln missense ABCA7 1 82198 1.21657E-5 41099 0 NA
19-1041578-C-T p.His46Tyr missense ABCA7 2 82216 2.43262E-5 41108 0 6.37592E-5
19-1041582-C-A p.Pro47Gln missense ABCA7 4 82328 4.85861E-5 41164 0 6.25E-4
19-1041608-C-T c.160+6C>T splice_region ABCA7 1 81206 1.23144E-5 40603 0 3.18918E-5
19-1041826-G-T c.161-4G>T splice_region ABCA7 14 80972 1.72899E-4 40486 0 1.48967E-4
19-1041843-C-T p.Asn58Asn synonymous ABCA7 1 81556 1.22615E-5 40778 0 3.19E-5
19-1041852-G-T p.Leu61Leu synonymous ABCA7 3730 81978 0.0455 40989 116 0.0661376
19-1041860-C-T p.Ala64Val missense ABCA7 3 81896 3.66318E-5 40948 0 1.09414E-5
19-1041861-G-A p.Ala64Ala synonymous ABCA7 1 81814 1.22228E-5 40907 0 2.18751E-5
19-1041865-A-C p.Thr66Pro missense ABCA7 2 80654 2.47973E-5 40327 0 1.36943E-5
19-1041867-C-T p.Thr66Thr synonymous ABCA7 1 80754 1.23833E-5 40377 0 1.11917E-5
19-1041868-G-A p.Val67Met missense ABCA7 1 80506 1.24214E-5 40253 0 1.83749E-5
19-1041871-C-G p.Pro68Ala missense ABCA7 23 80640 2.85218E-4 40320 2 0.0025
19-1041873-C-T p.Pro68Pro synonymous ABCA7 1 80784 1.23787E-5 40392 0 3.18878E-5
19-1041877-C-T p.Leu70Phe missense ABCA7 1 80702 1.23913E-5 40351 0 4.48217E-6
19-1041881-A-C p.Gln71Pro missense ABCA7 1 80738 1.23857E-5 40369 0 NA
19-1041884-G-A p.Gly72Asp missense ABCA7 1 80734 1.23864E-5 40367 0 NA
19-1041897-T-C p.Asn76Asn synonymous ABCA7 1 80936 1.23554E-5 40468 0 NA
19-1041898-G-A p.Val77Met missense ABCA7 3 80894 3.70856E-5 40447 0 NA
19-1041905-A-C p.Asn79Thr missense ABCA7 6 80884 7.41803E-5 40442 0 1.91388E-4
19-1041906-C-T p.Asn79Asn synonymous ABCA7 3 80878 3.70929E-5 40439 0 NA
19-1041909-C-T p.Thr80Thr synonymous ABCA7 12 80860 1.48405E-4 40430 0 1.44241E-4
19-1041922-C-A p.Leu85Met missense ABCA7 42 80502 5.21726E-4 40251 0 8.61189E-4
19-1041927-A-G p.Thr86Thr synonymous ABCA7 1 80284 1.24558E-5 40142 0 NA
19-1041929-C-T p.Pro87Leu missense ABCA7 2 80260 2.4919E-5 40130 0 1.96302E-5
19-1041930-G-A p.Pro87Pro synonymous ABCA7 4 80242 4.98492E-5 40121 0 1.85794E-4
19-1041935-A-C p.Glu89Ala missense ABCA7 10 79930 1.25109E-4 39965 0 5.85949E-5
19-1041942-C-T p.Pro91Pro synonymous ABCA7 3 79674 3.76534E-5 39837 0 3.19061E-5
19-1041947-G-A p.Arg93His missense ABCA7 1 79278 1.26138E-5 39639 0 NA
19-1041950-T-C p.Leu94Pro missense ABCA7 1 79364 1.26002E-5 39682 0 NA
19-1041956-A-G p.Asn96Ser missense ABCA7 1 79052 1.26499E-5 39526 0 3.19E-5
19-1041968-C-G p.Ser100Cys missense ABCA7 1 77934 1.28314E-5 38967 0 2.00409E-5
19-1041971-T-G p.Leu101Arg missense+splice_region ABCA7 73 77648 9.4014E-4 38824 1 8.01895E-4
19-1041971-TGTGAGCCAGAGGCAGTGGGTGCGGCCGGCCTGCAAACTCGGGGCTGCAGTGCCGGCCGGAACCCCGCCTCCTGCCCTCTCTCTGTCCCCAG-T p.Val102fs frameshift ABCA7 6 77650 7.72698E-5 38825 0 NA
19-1042059-C-G c.303-4C>G splice_region ABCA7 11 72700 1.51307E-4 36350 0 1.59378E-4
19-1042064-G-T p.Val102Phe missense+splice_region ABCA7 1 72298 1.38316E-5 36149 0 NA
19-1042071-G-A p.Arg104Gln missense ABCA7 9 71964 1.25063E-4 35982 0 3.18878E-5
19-1042074-T-C p.Leu105Pro missense ABCA7 1 71948 1.38989E-5 35974 0 1.28327E-5
19-1042074-T-A p.Leu105Gln missense ABCA7 1 71948 1.38989E-5 35974 0 1.28327E-5
19-1042089-G-A p.Arg110His missense ABCA7 3 71060 4.22178E-5 35530 0 6.25E-4
19-1042092-C-A p.Thr111Asn missense ABCA7 1 71208 1.40434E-5 35604 0 NA
19-1042098-T-A p.Leu113Gln missense ABCA7 1 70896 1.41052E-5 35448 0 4.45621E-6
19-1042099-G-A p.Leu113Leu synonymous ABCA7 1 70944 1.40956E-5 35472 0 4.45704E-6
19-1042114-C-T p.Ala118Ala synonymous ABCA7 1 70050 1.42755E-5 35025 0 4.43239E-6
19-1042133-C-A p.Leu125Ile missense ABCA7 1 68916 1.45104E-5 34458 0 NA
19-1042147-C-T p.Ile129Ile synonymous ABCA7 2 68252 2.93032E-5 34126 0 9.57243E-5
19-1042148-G-A p.Ala130Thr missense ABCA7 1 68012 1.47033E-5 34006 0 NA
19-1042153-G-C p.Thr131Thr synonymous ABCA7 1 68292 1.4643E-5 34146 0 NA
19-1042155-T-A p.Leu132Gln missense ABCA7 1 68610 1.45751E-5 34305 0 NA
19-1042173-C-T p.Thr138Met missense+splice_region ABCA7 6 68806 8.72017E-5 34403 0 6.0773E-5
19-1042174-GGGTGAGGAGGCCGGGGGGCCTCTGGCAGGGCTGAGCTCTGAGCCTCAACTTGCCGGGCCGTGAAATGGGCACAGGGTGGGGGTGGGTGCCTCAGACCAACGTCCCCCCA-G p.Ala139fs frameshift ABCA7 1 69236 1.44434E-5 34618 0 NA
19-1042181-G-C c.415+6G>C splice_region ABCA7 1 69770 1.43328E-5 34885 0 NA
19-1042310-C-A c.416-4C>A splice_region ABCA7 2 81236 2.46196E-5 40618 0 4.36506E-6
19-1042311-C-G c.416-3C>G splice_region ABCA7 1 81258 1.23065E-5 40629 0 8.94743E-6
19-1042311-C-T c.416-3C>T splice_region ABCA7 3 81258 3.69194E-5 40629 0 3.18837E-5
19-1042314-C-T p.Ala139Val missense+splice_region ABCA7 1 81382 1.22877E-5 40691 0 4.34688E-6
19-1042317-A-G p.Gln140Arg missense ABCA7 1 81574 1.22588E-5 40787 0 NA
19-1042319-C-A p.Pro141Thr missense ABCA7 2 81686 2.4484E-5 40843 0 NA
19-1042325-C-T p.Pro143Ser missense ABCA7 2 81916 2.44153E-5 40958 0 1.11392E-4
19-1042326-CA-C p.Thr144fs frameshift ABCA7 1 81966 1.22002E-5 40983 0 NA
19-1042330-C-A p.Thr144Thr synonymous ABCA7 1 82100 1.21803E-5 41050 0 NA
19-1042331-A-G p.Lys145Glu missense ABCA7 1 82146 1.21734E-5 41073 0 1.77614E-5
19-1042333-G-A p.Lys145Lys synonymous ABCA7 12 82150 1.46074E-4 41075 0 0.00125
19-1042353-C-T p.Pro152Leu missense ABCA7 133 82374 0.00161459 41187 1 0.00375988
19-1042367-G-A p.Ala157Thr missense ABCA7 1 82406 1.2135E-5 41203 0 9.56206E-5
19-1042369-G-A p.Ala157Ala synonymous ABCA7 1 82410 1.21345E-5 41205 0 1.61423E-5
19-1042380-C-T p.Thr161Met missense ABCA7 1 82346 1.21439E-5 41173 0 4.02479E-6
19-1042388-C-A p.Leu164Met missense+splice_region ABCA7 18 82250 2.18845E-4 41125 0 1.10685E-4
19-1042393-C-T p.Arg165Arg synonymous ABCA7 16 82142 1.94785E-4 41071 1 6.25E-4
19-1042396-G-C p.Thr166Thr splice_region+synonymous ABCA7 4 82086 4.87294E-5 41043 0 1.10417E-4
19-1042400-G-C c.498+4G>C splice_region ABCA7 1 82000 1.21951E-5 41000 0 9.55779E-5
19-1042401-G-A c.498+5G>A splice_region ABCA7 2 81960 2.44021E-5 40980 0 NA
19-1042664-G-C p.Val2Leu missense ABCA7 2 82180 2.43368E-5 41090 0 NA
19-1042666-C-G p.Val2Val synonymous ABCA7 9 82182 1.09513E-4 41091 0 1.91339E-4
19-1042668-G-T p.Cys3Phe missense ABCA7 1 82202 1.21652E-5 41101 0 8.81368E-6
19-1042688-G-A p.Ala10Thr missense ABCA7 3 82530 3.63504E-5 41265 0 5.6314E-5
19-1042721-C-A p.Pro21Thr missense ABCA7 6 82838 7.24305E-5 41419 1 6.25E-4
19-1042723-C-T p.Pro21Pro synonymous ABCA7 2 82850 2.414E-5 41425 0 3.18878E-5
19-1042724-C-T p.Pro22Ser missense ABCA7 2 82850 2.414E-5 41425 0 1.66934E-5
19-1042725-C-G p.Pro22Arg missense ABCA7 1 82850 1.207E-5 41425 0 8.34627E-6
19-1042747-A-G p.Glu167Glu splice_region+synonymous ABCA7 15 82834 1.81085E-4 41417 0 0.003125
19-1042760-G-A p.Ala172Thr missense ABCA7 1 82834 1.20723E-5 41417 0 3.99208E-6
19-1042761-C-A p.Ala172Glu missense ABCA7 3 82832 3.62179E-5 41416 0 NA
19-1042763-C-G p.Leu173Val missense ABCA7 1 82838 1.20718E-5 41419 0 8.31891E-6
19-1042768-C-A p.Gly174Gly synonymous ABCA7 2 82838 2.41435E-5 41419 0 7.9848E-5
19-1042780-G-C p.Glu178Asp missense ABCA7 1 82944 1.20563E-5 41472 0 3.18756E-5
19-1042786-G-T p.Leu180Phe missense ABCA7 1 82936 1.20575E-5 41468 0 NA
19-1042789-C-G p.His181Gln missense ABCA7 3 82948 3.61672E-5 41474 0 6.25E-4
19-1042791-G-A p.Ser182Asn missense ABCA7 1 82958 1.20543E-5 41479 0 4.99077E-5
19-1042801-G-A p.Glu185Glu synonymous ABCA7 3 82920 3.61795E-5 41460 0 2.42595E-5
19-1042802-G-A p.Ala186Thr missense ABCA7 2 82906 2.41237E-5 41453 0 NA
19-1042804-C-T p.Ala186Ala synonymous ABCA7 4 82884 4.82602E-5 41442 0 4.8581E-5
19-1042805-G-A p.Ala187Thr missense ABCA7 4 82878 4.82637E-5 41439 0 8.33611E-6
19-1042806-C-T p.Ala187Val missense ABCA7 1 82878 1.20659E-5 41439 0 NA
19-1042809-A-G p.Glu188Gly missense ABCA7 37548 81988 0.457969 40994 8911 0.531289
19-1042813-C-T p.Asp189Asp synonymous ABCA7 1 82806 1.20764E-5 41403 0 3.18695E-5
19-1042814-C-G p.Leu190Val missense ABCA7 1 82808 1.20761E-5 41404 0 2.53396E-5
19-1042815-T-C p.Leu190Pro missense ABCA7 1 82788 1.2079E-5 41394 0 NA
19-1042826-G-A c.579+1G>A splice_donor ABCA7 1 82700 1.20919E-5 41350 0 NA
19-1042829-C-T c.579+4C>T splice_region ABCA7 1 82644 1.21001E-5 41322 0 4.41326E-6
19-1042830-G-A c.579+5G>A splice_region ABCA7 3 82614 3.63135E-5 41307 0 3.25759E-4
19-1042833-G-A c.579+8G>A splice_region ABCA7 2 82570 2.42219E-5 41285 0 4.50252E-6
19-1043047-C-T p.Ala196Val missense ABCA7 2 82364 2.42825E-5 41182 0 5.06586E-4
19-1043048-G-A p.Ala196Ala synonymous ABCA7 2 82376 2.42789E-5 41188 0 2.63255E-5
19-1043052-C-T p.Arg198Cys missense ABCA7 2 82450 2.42571E-5 41225 0 1.37758E-4
19-1043063-G-A p.Val201Val synonymous ABCA7 2 82596 2.42142E-5 41298 0 5.05051E-4
19-1043071-G-A p.Arg204Gln missense ABCA7 2 82646 2.41996E-5 41323 0 5.99901E-5
19-1043071-G-T p.Arg204Leu missense ABCA7 2 82646 2.41996E-5 41323 0 NA
19-1043081-G-A p.Leu207Leu synonymous ABCA7 5 82682 6.04727E-5 41341 0 2.046E-4
19-1043089-C-T p.Pro210Leu missense ABCA7 1 82698 1.20922E-5 41349 0 NA
19-1043092-G-A p.Arg211Gln missense ABCA7 1 82690 1.20934E-5 41345 0 2.40641E-5
19-1043094-G-A p.Gly212Arg missense ABCA7 2 82700 2.41838E-5 41350 0 NA
19-1043095-G-T p.Gly212Val missense ABCA7 2 82698 2.41844E-5 41349 0 NA
19-1043099-C-T p.Thr213Thr synonymous ABCA7 2 82676 2.41908E-5 41338 0 NA
19-1043101-G-C p.Ser214Thr missense ABCA7 2 82676 2.41908E-5 41338 0 6.37471E-5
19-1043102-C-T p.Ser214Ser synonymous ABCA7 5 82670 6.04814E-5 41335 0 3.18735E-5
19-1043103-G-A p.Gly215Ser missense ABCA7 3833 82566 0.0464235 41283 117 0.0475218
19-1043112-G-A p.Glu218Lys missense ABCA7 2 82696 2.4185E-5 41348 0 1.04251E-4
19-1043118-C-T p.Leu220Leu synonymous ABCA7 1 82726 1.20881E-5 41363 0 NA
19-1043127-GC-G p.Leu224fs frameshift ABCA7 1 82692 1.20931E-5 41346 0 NA
19-1043137-G-GT p.Val227fs frameshift ABCA7 1 82732 1.20872E-5 41366 0 6.37267E-5
19-1043138-T-C p.Ser226Ser synonymous ABCA7 4 82742 4.8343E-5 41371 0 7.6145E-5
19-1043139-G-A p.Val227Ile missense ABCA7 2 82740 2.41721E-5 41370 0 2.5337E-5
19-1043150-T-C p.Pro230Pro synonymous ABCA7 5 82750 6.0423E-5 41375 0 1.68756E-5
19-1043152-G-A p.Ser231Asn missense ABCA7 4 82754 4.8336E-5 41377 0 2.53105E-5
19-1043154-A-T p.Ser232Cys missense ABCA7 2 82776 2.41616E-5 41388 0 1.20219E-5
19-1043183-C-T p.Tyr241Tyr synonymous ABCA7 244 82846 0.00294522 41423 2 0.00678733
19-1043183-C-G p.Tyr241* stop_gained ABCA7 1 82846 1.20706E-5 41423 0 8.43085E-6
19-1043184-G-C p.Glu242Gln missense ABCA7 4 82858 4.82754E-5 41429 0 8.43071E-6
19-1043193-G-T p.Asp245Tyr missense ABCA7 4 82880 4.82625E-5 41440 0 6.37105E-5
19-1043196-C-G p.Leu246Val missense ABCA7 1 82880 1.20656E-5 41440 0 NA
19-1043228-C-T p.Ser256Ser synonymous ABCA7 3 82938 3.61716E-5 41469 0 3.18674E-5
19-1043229-G-A p.Ala257Thr missense ABCA7 7 82922 8.44167E-5 41461 0 1.68685E-5
19-1043229-G-C p.Ala257Pro missense ABCA7 1 82922 1.20595E-5 41461 0 1.68685E-5
19-1043238-G-T p.Asp260Tyr missense ABCA7 12 82964 1.44641E-4 41482 0 5.03525E-4
19-1043247-CTGAG-C p.Leu263_Ser264delinsArg splice_donor ABCA7 7 82974 8.43638E-5 41487 0 5.03525E-4
19-1043250-AGTGAGTGACTGACCTCGGTTTCCCCTCTTGGGAAGTGGAACTCTGGGCAGGGGGGCAGGGCCTCATGGCACCCCCATCCCAG-A c.790+1_791-1delGTGAGTGACTGACCTCGGTTTCCCCTCTTGGGAAGTGGAACTCTGGGCAGGGGGGCAGGGCCTCATGGCACCCCCATCCCAG splice_acceptor ABCA7 8 82946 9.64483E-5 41473 1 NA
19-1043257-G-A c.790+7G>A splice_region ABCA7 1 82942 1.20566E-5 41471 0 NA
19-1043325-C-T c.791-8C>T splice_region ABCA7 1 82862 1.20683E-5 41431 0 NA
19-1043327-T-G c.791-6T>G splice_region ABCA7 1 82856 1.20691E-5 41428 0 1.68062E-5
19-1043335-C-T p.Pro265Ser missense+splice_region ABCA7 1 82898 1.2063E-5 41449 0 NA
19-1043338-G-A p.Ala266Thr missense ABCA7 1 82856 1.20691E-5 41428 0 2.51817E-5
19-1043342-G-A p.Cys267Tyr missense ABCA7 1 82848 1.20703E-5 41424 0 1.2022E-5
19-1043345-C-T p.Ser268Leu missense ABCA7 1 82796 1.20779E-5 41398 0 8.39011E-6
19-1043346-G-A p.Ser268Ser synonymous ABCA7 9 82810 1.08683E-4 41405 0 6.37471E-5
19-1043347-G-T p.Glu269* stop_gained ABCA7 3 82816 3.62249E-5 41408 0 3.35548E-5
19-1043349-G-T p.Glu269Asp missense ABCA7 1 82810 1.20758E-5 41405 0 2.51606E-5
19-1043350-C-T p.Leu270Leu synonymous ABCA7 44 82804 5.31375E-4 41402 0 9.05645E-4
19-1043359-G-A p.Ala273Thr missense ABCA7 1 82798 1.20776E-5 41399 0 8.37998E-6
19-1043370-C-G p.Ser276Arg missense ABCA7 2 82752 2.41686E-5 41376 0 NA
19-1043374-C-T p.Pro278Ser missense ABCA7 2 82770 2.41633E-5 41385 0 3.99949E-6
19-1043375-C-T p.Pro278Leu missense ABCA7 1 82736 1.20866E-5 41368 0 6.37349E-5
19-1043377-C-T p.Leu279Leu synonymous ABCA7 3 82746 3.62555E-5 41373 0 NA
19-1043384-G-A p.Arg281His missense ABCA7 1 82796 1.20779E-5 41398 0 8.35003E-6
19-1043384-G-T p.Arg281Leu missense ABCA7 5 82796 6.03894E-5 41398 0 9.58053E-5
19-1043386-C-A p.Leu282Met missense ABCA7 5 82828 6.03661E-5 41414 0 NA
19-1043388-G-A p.Leu282Leu synonymous ABCA7 2 82814 2.41505E-5 41407 0 NA
19-1043394-G-A p.Trp284* stop_gained ABCA7 3 82818 3.6224E-5 41409 0 2.71236E-4
19-1043395-A-T p.Arg285* stop_gained ABCA7 12 82814 1.44903E-4 41407 0 1.27567E-4
19-1043397-AC-A p.Arg286fs frameshift ABCA7 1 82766 1.20823E-5 41383 0 2.79171E-5
19-1043402-T-C p.Leu287Pro missense ABCA7 1 82752 1.20843E-5 41376 0 1.6655E-5
19-1043403-G-A p.Leu287Leu synonymous ABCA7 1 82752 1.20843E-5 41376 0 NA
19-1043406-G-A p.Lys288Lys synonymous ABCA7 24 82736 2.90079E-4 41368 0 0.0014478
19-1043407-C-T p.Pro289Ser missense ABCA7 2 82758 2.41668E-5 41379 0 3.98603E-6
19-1043408-C-A p.Pro289His missense ABCA7 1 82746 1.20852E-5 41373 0 3.98597E-6
19-1043415-C-T p.Ile291Ile synonymous ABCA7 10 82670 1.20963E-4 41335 0 3.40922E-4
19-1043455-C-T p.Arg305Trp missense ABCA7 1 80266 1.24586E-5 40133 0 6.36943E-5
19-1043456-G-A p.Arg305Gln missense ABCA7 2 80180 2.49439E-5 40090 0 0.00100705
19-1043464-A-G p.Met308Val missense ABCA7 3 79308 3.78272E-5 39654 0 1.19808E-5
19-1043469-C-G p.Ala309Ala synonymous ABCA7 1 78782 1.26933E-5 39391 0 NA
19-1043477-G-A c.930+5G>A splice_region ABCA7 1 78280 1.27747E-5 39140 0 NA
19-1043479-G-A c.930+7G>A splice_region ABCA7 1 77820 1.28502E-5 38910 0 NA
19-1043724-G-A p.Val311Met missense+splice_region ABCA7 1 68222 1.4658E-5 34111 0 NA
19-1043738-C-T p.Phe315Phe synonymous ABCA7 1 69782 1.43303E-5 34891 0 NA
19-1043739-G-A p.Glu316Lys missense ABCA7 3 70174 4.27509E-5 35087 0 3.19468E-4
19-1043747-C-T p.Leu318Leu synonymous ABCA7 96 71040 0.00135135 35520 0 0.00177871
19-1043748-A-G p.Thr319Ala missense ABCA7 3908 70722 0.0552586 35361 259 0.0979626
19-1043748-A-T p.Thr319Ser missense ABCA7 1 71040 1.40766E-5 35520 0 NA
19-1043753-G-T p.Leu320Leu synonymous ABCA7 11 71686 1.53447E-4 35843 0 2.9171E-4
19-1043757-A-T p.Arg322Trp missense ABCA7 1 71970 1.38947E-5 35985 0 NA
19-1043767-G-A p.Arg325Gln missense ABCA7 14 72114 1.94137E-4 36057 2 1.41483E-4
19-1043788-G-A p.Gly332Glu missense ABCA7 2 72294 2.76648E-5 36147 0 3.20492E-5
19-1043791-C-T p.Pro333Leu missense ABCA7 2 72150 2.772E-5 36075 0 NA
19-1043793-C-T p.Arg334Trp missense ABCA7 13 71966 1.80641E-4 35983 0 1.60195E-4
19-1043794-G-A p.Arg334Gln missense ABCA7 6 72110 8.32062E-5 36055 0 2.51595E-4
19-1043799-T-C p.Phe336Leu missense ABCA7 3 72178 4.15639E-5 36089 0 8.30758E-6
19-1043801-C-CA p.Thr337fs frameshift ABCA7 2 72204 2.76993E-5 36102 0 2.49178E-5
19-1043811-A-G p.Asn340Asp missense ABCA7 1 71992 1.38904E-5 35996 0 NA
19-1043818-G-T p.Ser342Ile missense ABCA7 1 71716 1.39439E-5 35858 0 NA
19-1043830-C-T p.Ala346Val missense ABCA7 1 70760 1.41323E-5 35380 0 NA
19-1043835-C-A p.Leu348Met missense ABCA7 1 70000 1.42857E-5 35000 0 NA
19-1043838-C-T p.Gln349* stop_gained ABCA7 1 69674 1.43526E-5 34837 0 7.99981E-6
19-1043840-G-GTGCCTGTCCTTGGACAAGCTGGAGGCGGCACCCTCAGA c.1047_1047+1insTGCCTGTCCTTGGACAAGCTGGAGGCGGCACCCTCAGA splice_donor ABCA7 1 69378 1.44138E-5 34689 0 NA
19-1043841-G-A c.1047+1G>A splice_donor ABCA7 1 69166 1.4458E-5 34583 0 3.19061E-5
19-1043842-T-C c.1047+2T>C splice_donor ABCA7 2 68778 2.90791E-5 34389 0 NA
19-1043847-G-A c.1047+7G>A splice_region ABCA7 10 67868 1.47345E-4 33934 0 7.47993E-5
19-1043847-G-T c.1047+7G>T splice_region ABCA7 1 67866 1.47349E-5 33933 0 NA
19-1044567-GC-G c.1048-8delC splice_region ABCA7 1 82510 1.21197E-5 41255 0 8.54642E-6
19-1044567-G-GC c.1048-9_1048-8insC splice_region ABCA7 2 82510 2.42395E-5 41255 0 1.70928E-5
19-1044574-A-C c.1048-2A>C splice_acceptor ABCA7 1 82758 1.20834E-5 41379 0 8.48191E-6
19-1044576-C-T p.Arg350Trp missense+splice_region ABCA7 1 82776 1.20808E-5 41388 0 6.37308E-5
19-1044589-T-C p.Met354Thr missense ABCA7 42 82868 5.0683E-4 41434 0 0.00139991
19-1044614-C-G p.Pro362Pro synonymous ABCA7 2 82968 2.41057E-5 41484 0 2.8E-5
19-1044619-C-G p.Pro364Arg missense ABCA7 48 82954 5.78634E-4 41477 0 0.00251762
19-1044628-G-A p.Arg367Gln missense ABCA7 1 82946 1.2056E-5 41473 0 1.60014E-5
19-1044632-C-G p.Asp368Glu missense ABCA7 1 82944 1.20563E-5 41472 0 NA
19-1044634-A-G p.His369Arg missense ABCA7 1 82944 1.20563E-5 41472 0 3.99859E-6
19-1044646-T-G p.Leu373Arg missense ABCA7 1 82924 1.20592E-5 41462 0 3.99987E-6
19-1044649-G-C p.Arg374Pro missense ABCA7 2 82870 2.41342E-5 41435 0 NA
19-1044650-A-G p.Arg374Arg synonymous ABCA7 4 82874 4.8266E-5 41437 0 6.70601E-5
19-1044654-T-C p.Phe376Leu missense ABCA7 2 82880 2.41313E-5 41440 0 5.03525E-4
19-1044658-T-C p.Leu377Pro missense ABCA7 1 82844 1.20709E-5 41422 0 8.40534E-6
19-1044659-G-C p.Leu377Leu synonymous ABCA7 29 82838 3.50081E-4 41419 0 3.18654E-5
19-1044668-G-T p.Gly380Gly synonymous ABCA7 1 82764 1.20825E-5 41382 0 NA
19-1044672-G-A p.Gly382Ser missense ABCA7 9 82700 1.08827E-4 41350 0 2.231E-4
19-1044672-G-C p.Gly382Arg missense ABCA7 1 82700 1.20919E-5 41350 0 NA
19-1044692-C-T p.Asp388Asp synonymous ABCA7 7 82344 8.50092E-5 41172 0 5.03525E-4
19-1044698-C-G p.His390Gln missense ABCA7 1 82232 1.21607E-5 41116 0 NA
19-1044702-G-T p.Asp392Tyr missense ABCA7 1 82122 1.2177E-5 41061 0 3.18654E-5
19-1044704-T-C p.Asp392Asp synonymous ABCA7 7 82094 8.52681E-5 41047 1 0.0020141
19-1044707-GGGGCACCTGGT-G p.Leu396fs frameshift ABCA7 41 82058 4.99647E-4 41029 0 0.00133835
19-1044708-G-C p.Gly394Arg missense ABCA7 1 82036 1.21898E-5 41018 0 NA
19-1044708-G-A p.Gly394Arg missense ABCA7 3 82036 3.65693E-5 41018 0 1.62473E-5
19-1044709-G-A p.Gly394Glu missense ABCA7 1 82014 1.2193E-5 41007 0 9.24864E-6
19-1044712-A-G p.His395Arg missense ABCA7 4801 81772 0.058712 40886 291 0.0942006
19-1044712-A-AC p.Leu396fs frameshift ABCA7 2 81880 2.4426E-5 40940 0 NA
19-1044726-C-G p.Leu400Val missense ABCA7 22 81684 2.69331E-4 40842 0 2.30549E-4
19-1044732-C-T p.Arg402* stop_gained ABCA7 1 81426 1.22811E-5 40713 0 1.03272E-5
19-1044737-G-A p.Val403Val synonymous ABCA7 5 81358 6.14568E-5 40679 0 1.06293E-5
19-1044997-A-G c.1216-4A>G splice_region ABCA7 1 80472 1.24267E-5 40236 0 4.02963E-6
19-1044998-C-T c.1216-3C>T splice_region ABCA7 1 80442 1.24313E-5 40221 0 NA
19-1045008-C-T p.Ser408Phe missense ABCA7 2 80516 2.48398E-5 40258 0 8.03316E-6
19-1045015-C-G p.Asp410Glu missense ABCA7 1 80596 1.24076E-5 40298 0 8.43668E-6
19-1045026-C-G p.Ala414Gly missense ABCA7 1033 80630 0.0128116 40315 32 0.0245452
19-1045026-C-A p.Ala414Glu missense ABCA7 1 80660 1.23977E-5 40330 0 NA
19-1045027-G-A p.Ala414Ala synonymous ABCA7 1 80696 1.23922E-5 40348 0 8.42304E-6
19-1045046-C-T p.Leu421Leu synonymous ABCA7 1 80856 1.23677E-5 40428 0 8.41199E-6
19-1045054-G-A p.Ser423Ser synonymous ABCA7 2 80756 2.4766E-5 40378 0 4.00516E-6
19-1045055-C-T p.Arg424Trp missense ABCA7 1 80812 1.23744E-5 40406 0 8.40774E-6
19-1045065-A-C p.Gln427Pro missense ABCA7 1 81044 1.2339E-5 40522 0 NA
19-1045070-C-G p.Leu429Val missense ABCA7 2 81120 2.46548E-5 40560 0 NA
19-1045072-C-T p.Leu429Leu synonymous ABCA7 2 81120 2.46548E-5 40560 0 4.00122E-6
19-1045075-G-C p.Ala430Ala synonymous ABCA7 2 81202 2.46299E-5 40601 0 5.03525E-4
19-1045082-C-A p.Arg433Arg synonymous ABCA7 1 81432 1.22802E-5 40716 0 NA
19-1045082-C-T p.Arg433* stop_gained ABCA7 1 81432 1.22802E-5 40716 0 NA
19-1045083-G-A p.Arg433Gln missense ABCA7 8 81460 9.82077E-5 40730 0 2.23271E-4
19-1045086-T-G p.Phe434Cys missense ABCA7 1 81524 1.22663E-5 40762 0 NA
19-1045093-C-T p.Ala436Ala synonymous ABCA7 14 81598 1.71573E-4 40799 0 5.03525E-4
19-1045093-C-G p.Ala436Ala synonymous ABCA7 1 81598 1.22552E-5 40799 0 7.99872E-6
19-1045094-G-A p.Gly437Ser missense ABCA7 1 81596 1.22555E-5 40798 0 8.38617E-6
19-1045096-C-T p.Gly437Gly synonymous ABCA7 2 81632 2.45002E-5 40816 0 NA
19-1045105-C-A p.Phe440Leu missense ABCA7 2 81822 2.44433E-5 40911 0 8.38251E-6
19-1045106-T-C p.Leu441Leu synonymous ABCA7 1 81856 1.22166E-5 40928 0 NA
19-1045108-G-C p.Leu441Phe missense ABCA7 3 81834 3.66596E-5 40917 0 6.37714E-5
19-1045109-G-A p.Gly442Arg missense ABCA7 2 81826 2.44421E-5 40913 0 8.38349E-6
19-1045111-A-G p.Gly442Gly synonymous ABCA7 1 81790 1.22264E-5 40895 0 1.67645E-5
19-1045117-G-A p.Glu444Glu synonymous ABCA7 1 81888 1.22118E-5 40944 0 NA
19-1045124-TC-AA p.Ser447Lys missense ABCA7 2 81882 2.44254E-5 40941 0 NA
19-1045126-A-T p.Ser447Ser synonymous ABCA7 1 81898 1.22103E-5 40949 0 NA
19-1045129-C-T p.Asp448Asp synonymous ABCA7 1 81856 1.22166E-5 40928 0 8.38645E-6
19-1045141-C-T p.His452His synonymous ABCA7 1 81880 1.2213E-5 40940 0 NA
19-1045149-C-T p.Pro455Leu missense ABCA7 3 81936 3.66139E-5 40968 0 5.03525E-4
19-1045151-G-T p.Asp456Tyr missense ABCA7 1 81908 1.22088E-5 40954 0 NA
19-1045155-T-A p.Leu457Gln missense ABCA7 1 81904 1.22094E-5 40952 0 NA
19-1045156-G-A p.Leu457Leu synonymous ABCA7 1 81880 1.2213E-5 40940 0 NA
19-1045160-C-G p.Pro459Ala missense ABCA7 1 81852 1.22172E-5 40926 0 NA
19-1045162-C-A p.Pro459Pro synonymous ABCA7 1 81876 1.22136E-5 40938 0 2.00074E-5
19-1045162-C-T p.Pro459Pro synonymous ABCA7 1 81876 1.22136E-5 40938 0 3.19061E-5
19-1045164-G-C p.Gly460Ala missense ABCA7 2 81812 2.44463E-5 40906 0 4.00131E-6
19-1045164-G-A p.Gly460Asp missense ABCA7 1 81812 1.22231E-5 40906 0 NA
19-1045166-C-G p.His461Asp missense ABCA7 2 81842 2.44373E-5 40921 0 NA
19-1045169-G-A p.Val462Met missense ABCA7 1 81790 1.22264E-5 40895 0 8.42134E-6
19-1045170-T-C p.Val462Ala missense ABCA7 1 81778 1.22282E-5 40889 0 1.68427E-5
19-1045173-G-A p.Arg463His missense ABCA7 2451 81630 0.0300257 40815 64 0.0477543
19-1045173-G-C p.Arg463Pro missense ABCA7 26 81690 3.18276E-4 40845 0 2.00239E-4
19-1045173-GC-TT p.Arg463Leu missense ABCA7 3 81690 3.67242E-5 40845 0 NA
19-1045179-A-G p.Lys465Arg missense ABCA7 2 81590 2.45128E-5 40795 0 4.00641E-6
19-1045185-GC-G p.Met468fs frameshift ABCA7 1 81302 1.22998E-5 40651 0 NA
19-1045186-C-T p.Arg467Arg synonymous ABCA7 5 81322 6.1484E-5 40661 0 5.03525E-4
19-1045199-G-T p.Val472Leu missense ABCA7 1 80712 1.23897E-5 40356 0 NA
19-1045206-C-T p.Thr474Met missense ABCA7 2 80144 2.49551E-5 40072 0 3.41483E-5
19-1045207-G-A p.Thr474Thr synonymous ABCA7 1 80118 1.24816E-5 40059 0 NA
19-1045209-G-A p.Arg475Lys missense ABCA7 6 79990 7.50094E-5 39995 0 3.24652E-5
19-1045211-A-G p.Thr476Ala missense ABCA7 1 79850 1.25235E-5 39925 0 NA
19-1045215-A-G p.Asn477Ser missense ABCA7 2 79646 2.51111E-5 39823 0 4.07196E-5
19-1045220-A-T p.Ile479Phe missense ABCA7 1 79236 1.26205E-5 39618 0 4.30945E-5
19-1045222-C-T p.Ile479Ile synonymous ABCA7 1 79134 1.26368E-5 39567 0 8.6411E-6
19-1045223-A-T p.Arg480Trp missense ABCA7 5 79040 6.32591E-5 39520 0 6.56453E-5
19-1046224-C-T c.1446-5C>T splice_region ABCA7 1 81338 1.22944E-5 40669 0 8.25975E-6
19-1046225-G-A c.1446-4G>A splice_region ABCA7 1 81324 1.22965E-5 40662 0 6.79267E-5
19-1046225-G-T c.1446-4G>T splice_region ABCA7 1 81324 1.22965E-5 40662 0 NA
19-1046228-G-A c.1446-1G>A splice_acceptor ABCA7 2 81442 2.45574E-5 40721 0 2.54181E-5
19-1046229-GTTT-G p.Phe483del disruptive_inframe_deletion ABCA7 1 81470 1.22745E-5 40735 0 NA
19-1046234-GGGACCCT-G p.Asp485fs frameshift ABCA7 1 81536 1.22645E-5 40768 0 NA
19-1046239-C-G p.Pro486Ala missense ABCA7 55 81582 6.74168E-4 40791 0 0.0025
19-1046242-G-T p.Gly487Cys missense ABCA7 2 81590 2.45128E-5 40795 0 8.21207E-6
19-1046243-G-A p.Gly487Asp missense ABCA7 1 81572 1.22591E-5 40786 0 NA
19-1046257-C-A p.Pro492Thr missense ABCA7 18 81630 2.20507E-4 40815 0 4.46258E-4
19-1046258-C-T p.Pro492Leu missense ABCA7 1 81686 1.2242E-5 40843 0 6.25E-4
19-1046260-C-G p.Leu493Val missense ABCA7 4 81678 4.89728E-5 40839 0 4.5099E-5
19-1046261-T-A p.Leu493Gln missense ABCA7 1 81642 1.22486E-5 40821 0 8.41836E-6
19-1046262-G-T p.Leu493Leu synonymous ABCA7 15 81632 1.83751E-4 40816 0 0.00151362
19-1046269-C-A p.Leu496Met missense ABCA7 1 81724 1.22363E-5 40862 0 8.411E-6
19-1046270-TGCGCTACGTGTG-T p.Arg497_Trp500del conservative_inframe_deletion ABCA7 1 81728 1.22357E-5 40864 0 NA
19-1046274-C-G p.Arg497Arg synonymous ABCA7 2 81826 2.44421E-5 40913 0 1.68158E-5
19-1046277-C-T p.Tyr498Tyr synonymous ABCA7 1 81840 1.2219E-5 40920 0 8.20472E-6
19-1046278-G-A p.Val499Met missense ABCA7 1 81904 1.22094E-5 40952 0 1.68144E-5
19-1046293-G-A p.Val504Met missense ABCA7 3 82184 3.65035E-5 41092 0 6.37308E-5
19-1046295-G-T p.Val504Val synonymous ABCA7 1 82284 1.2153E-5 41142 0 1.23286E-5
19-1046307-C-A p.Asp508Glu missense ABCA7 1 82496 1.21218E-5 41248 0 6.37389E-5
19-1046314-G-T p.Glu511* stop_gained ABCA7 7 82538 8.48094E-5 41269 0 2.231E-4
19-1046314-G-C p.Glu511Gln missense ABCA7 1 82538 1.21156E-5 41269 0 NA
19-1046316-G-C p.Glu511Asp missense ABCA7 1 82546 1.21145E-5 41273 0 8.45251E-6
19-1046317-C-G p.Arg512Gly missense ABCA7 7 82524 8.48238E-5 41262 0 5.37532E-5
19-1046317-C-A p.Arg512Ser missense ABCA7 5 82524 6.05884E-5 41262 0 9.56389E-5
19-1046325-C-T p.Ala514Ala synonymous ABCA7 2 82542 2.42301E-5 41271 0 1.65756E-5
19-1046329-C-T p.Arg516Cys missense ABCA7 1 82550 1.21139E-5 41275 0 NA
19-1046330-G-C p.Arg516Pro missense ABCA7 9 82518 1.09067E-4 41259 0 1.36561E-4
19-1046332-G-A p.Val517Met missense ABCA7 1 82512 1.21194E-5 41256 0 1.6624E-5
19-1046340-C-T p.Ser519Ser synonymous ABCA7 8 82480 9.69932E-5 41240 0 1.59357E-4
19-1046344-G-T p.Ala521Ser missense ABCA7 1 82458 1.21274E-5 41229 0 4.18764E-6
19-1046348-A-T p.Asn522Ile missense ABCA7 8 82436 9.7045E-5 41218 0 NA
19-1046353-C-T p.Arg524Trp missense ABCA7 5 82502 6.06046E-5 41251 0 2.31946E-4
19-1046356-G-A p.Ala525Thr missense ABCA7 1 82446 1.21292E-5 41223 0 6.25E-4
19-1046358-C-T p.Ala525Ala synonymous ABCA7 2 82464 2.4253E-5 41232 0 1.69532E-5
19-1046360-G-T p.Gly526Val missense ABCA7 2 82432 2.42624E-5 41216 0 NA
19-1046367-C-T p.Tyr528Tyr synonymous ABCA7 1 82466 1.21262E-5 41233 0 NA
19-1046370-G-C p.Leu529Leu synonymous ABCA7 1 82420 1.2133E-5 41210 0 3.18735E-5
19-1046373-G-A p.Gln530Gln synonymous ABCA7 4 82420 4.85319E-5 41210 0 6.25E-4
19-1046375-A-C p.Gln531Pro missense ABCA7 1 82400 1.21359E-5 41200 0 3.18634E-5
19-1046379-GC-G p.Tyr534fs frameshift ABCA7 1 82340 1.21448E-5 41170 0 NA
19-1046385-T-G p.Tyr534* stop_gained ABCA7 1 82272 1.21548E-5 41136 0 3.57226E-5
19-1046400-C-G p.Asp539Glu missense ABCA7 4 81828 4.8883E-5 40914 0 2.84392E-4
19-1046402-A-G p.Asp540Gly missense ABCA7 1 81700 1.22399E-5 40850 0 1.49808E-5
19-1046403-CGT-C p.Tyr537fs frameshift ABCA7 6 81692 7.34466E-5 40846 0 1.00727E-5
19-1046404-G-A n.263+1G>A splice_donor ABCA7 77 81676 9.42749E-4 40838 1 0.00255885
19-1046796-C-A c.1623-5C>A splice_region ABCA7 4 77964 5.13057E-5 38982 0 6.37511E-5
19-1046800-G-C c.1623-1G>C splice_acceptor ABCA7 1 78176 1.27916E-5 39088 0 NA
19-1046810-T-A p.Arg544Arg synonymous ABCA7 3 78516 3.82088E-5 39258 0 NA
19-1046822-G-C p.Arg548Arg synonymous ABCA7 2 78902 2.53479E-5 39451 0 1.37344E-5
19-1046841-A-C p.Thr555Pro missense ABCA7 1 79566 1.25682E-5 39783 0 NA
19-1046861-C-G p.Ser561Ser synonymous ABCA7 1 79932 1.25106E-5 39966 0 1.30125E-5
19-1046862-G-C p.Val562Leu missense ABCA7 1 79944 1.25088E-5 39972 0 3.18593E-5
19-1046862-G-A p.Val562Met missense ABCA7 2 79944 2.50175E-5 39972 0 3.18593E-5
19-1046872-C-T p.Thr565Ile missense ABCA7 3 80026 3.74878E-5 40013 0 NA
19-1046883-G-A p.Val569Met missense ABCA7 3 80010 3.74953E-5 40005 0 6.29699E-6
19-1046886-G-A p.Val570Met missense ABCA7 1 80008 1.24988E-5 40004 0 NA
19-1046890-GGGAGAAGGAGACGC-G p.Glu572fs frameshift ABCA7 6 79966 7.50319E-5 39983 0 1.24059E-5
19-1046892-GAGA-G p.Lys573del conservative_inframe_deletion ABCA7 3 79938 3.75291E-5 39969 0 3.20431E-5
19-1046892-G-C p.Glu572Gln missense ABCA7 1 79938 1.25097E-5 39969 0 NA
19-1046892-G-T p.Glu572* stop_gained ABCA7 1 79938 1.25097E-5 39969 0 NA
19-1046895-A-G p.Lys573Glu missense ABCA7 1 79906 1.25147E-5 39953 0 NA
19-1046897-G-A p.Lys573Lys synonymous ABCA7 2 79918 2.50257E-5 39959 0 NA
19-1046901-A-T p.Thr575Ser missense ABCA7 3 79776 3.76053E-5 39888 0 8.97989E-5
19-1046902-C-T p.Thr575Met missense ABCA7 1 79760 1.25376E-5 39880 0 NA
19-1046905-G-T p.Arg576Leu missense ABCA7 3 79664 3.76582E-5 39832 0 4.36758E-5
19-1046906-GCTGCGGGACACCATGCGCGCCATGGGGCTCAGCCGCGCGGTGCT-G p.Arg578fs frameshift ABCA7 609 79584 0.00765229 39792 24 0.0173711
19-1046910-C-A p.Arg578Arg synonymous ABCA7 6 79334 7.56296E-5 39667 0 5.82954E-6
19-1046910-C-T p.Arg578Trp missense ABCA7 1 79334 1.26049E-5 39667 0 8.61326E-5
19-1046911-GGGACA-G p.Asp579fs frameshift ABCA7 6 79318 7.56449E-5 39659 0 5.8151E-6
19-1046914-A-G p.Asp579Gly missense ABCA7 1 79194 1.26272E-5 39597 0 5.74165E-6
19-1046915-C-T p.Asp579Asp synonymous ABCA7 1 79202 1.26259E-5 39601 0 NA
19-1046917-C-A p.Thr580Asn missense ABCA7 1 79226 1.26221E-5 39613 0 3.18776E-5
19-1046922-C-T p.Arg582Cys missense ABCA7 1 79044 1.26512E-5 39522 0 5.59434E-6
19-1046923-G-A p.Arg582His missense ABCA7 1 78974 1.26624E-5 39487 0 1.11546E-5
19-1046934-C-T p.Leu586Phe missense ABCA7 12 78696 1.52486E-4 39348 0 1.41363E-4
19-1046940-C-T p.Arg588Cys missense ABCA7 1 78490 1.27405E-5 39245 0 5.29689E-6
19-1046941-G-T p.Arg588Leu missense ABCA7 2 78434 2.54991E-5 39217 0 NA
19-1046944-C-T p.Ala589Val missense ABCA7 56 78404 7.14249E-4 39202 0 0.0012751
19-1046944-C-G p.Ala589Gly missense ABCA7 14 78404 1.78562E-4 39202 0 7.46511E-4
19-1046945-G-A p.Ala589Ala synonymous ABCA7 1 78440 1.27486E-5 39220 0 9.56755E-5
19-1046946-G-A p.Val590Met missense ABCA7 1 78444 1.27479E-5 39222 0 NA
19-1046949-C-A p.Leu591Ile missense ABCA7 5 78342 6.38227E-5 39171 0 8.68126E-5
19-1046970-A-G p.Ser598Gly missense ABCA7 3 78142 3.83916E-5 39071 0 1.99446E-5
19-1046979-G-A p.Gly601Arg missense ABCA7 1 77804 1.28528E-5 38902 0 2.6331E-5
19-1046986-T-C p.Phe603Ser missense ABCA7 1 77900 1.2837E-5 38950 0 9.57671E-5
19-1046994-A-G p.Ser606Gly missense ABCA7 1 77726 1.28657E-5 38863 0 NA
19-1046996-C-A p.Ser606Arg missense ABCA7 1 77576 1.28906E-5 38788 0 NA
19-1046998-C-A p.Ala607Asp missense ABCA7 1 77466 1.29089E-5 38733 0 5.28056E-6
19-1046999-C-T p.Ala607Ala synonymous ABCA7 1 77442 1.29129E-5 38721 0 NA
19-1047002-A-G p.Ala608Ala synonymous ABCA7 41173 73830 0.557673 36915 11575 0.624873
19-1047002-ACT-GGG p.AlaLeu608AlaGly missense ABCA7 1 77370 1.29249E-5 38685 0 NA
19-1047003-CT-GG p.Leu609Gly missense ABCA7 2 77462 2.58191E-5 38731 0 NA
19-1047003-C-G p.Leu609Val missense ABCA7 1 77462 1.29096E-5 38731 0 0.00203046
19-1047004-T-G p.Leu609Arg missense ABCA7 1 77516 1.29006E-5 38758 0 0.00203046
19-1047008-G-C p.Leu610Leu synonymous ABCA7 1 77404 1.29192E-5 38702 0 5.40278E-6
19-1047012-C-T p.Leu612Leu synonymous ABCA7 1 77224 1.29493E-5 38612 0 9.57671E-5
19-1047014-G-C p.Leu612Leu synonymous ABCA7 2 77134 2.59289E-5 38567 0 5.47615E-5
19-1047016-T-C p.Val613Ala missense ABCA7 14 76988 1.81847E-4 38494 0 3.19366E-4
19-1047021-AAGGTGGGCGCGCCTCGGCCTGCCCGGCTGCAGAATGGGTGCGCTGGAGGGTGACAGACAGGGGCGGCCCCACGTGGGTGCGCGCCCCCAGGCCAATCCAGGAGCTGCACCCTAAGCTCCCGTTGCCTCTCAC-A p.Lys615fs frameshift ABCA7 6 76908 7.80153E-5 38454 2 NA
19-1047031-C-T c.1845+8C>T splice_region ABCA7 1 75870 1.31804E-5 37935 0 NA
19-1047161-A-G p.Gly617Gly synonymous ABCA7 47903 74232 0.645315 37116 15693 0.70101
19-1047161-A-C p.Gly617Gly synonymous ABCA7 1 75848 1.31843E-5 37924 0 NA
19-1047166-T-A p.Ile619Asn missense ABCA7 2 75820 2.63783E-5 37910 0 2.1387E-4
19-1047168-C-T p.Leu620Phe missense ABCA7 6 75838 7.9116E-5 37919 0 3.18979E-5
19-1047169-T-C p.Leu620Pro missense ABCA7 19 75684 2.51044E-4 37842 0 6.25E-4
19-1047170-C-T p.Leu620Leu synonymous ABCA7 1 75808 1.31912E-5 37904 0 6.37674E-5
19-1047172-C-T p.Pro621Leu missense ABCA7 1 75712 1.32079E-5 37856 0 9.27093E-6
19-1047176-C-T p.Tyr622Tyr synonymous ABCA7 1 75610 1.32258E-5 37805 0 NA
19-1047176-C-A p.Tyr622* stop_gained ABCA7 1 75610 1.32258E-5 37805 0 NA
19-1047185-G-C p.Pro625Pro synonymous ABCA7 10 74926 1.33465E-4 37463 0 2.552E-4
19-1047185-G-A p.Pro625Pro synonymous ABCA7 1 74926 1.33465E-5 37463 0 9.56999E-5
19-1047187-G-A p.Gly626Asp missense ABCA7 1 74804 1.33683E-5 37402 0 1.835E-5
19-1047190-T-C p.Val627Ala missense ABCA7 1 74748 1.33783E-5 37374 0 4.12296E-6
19-1047192-G-A p.Val628Ile missense ABCA7 1 74710 1.33851E-5 37355 0 NA
19-1047205-T-A p.Leu632* stop_gained ABCA7 5 74322 6.72748E-5 37161 0 NA
19-1047207-G-T p.Ala633Ser missense ABCA7 1 73802 1.35498E-5 36901 0 NA
19-1047212-C-T p.Ala634Ala synonymous ABCA7 4 73668 5.42977E-5 36834 0 2.233E-4
19-1047216-G-A p.Ala636Thr missense ABCA7 1 73120 1.36761E-5 36560 0 9.09703E-6
19-1047218-G-A p.Ala636Ala synonymous ABCA7 1 72942 1.37095E-5 36471 0 5.05051E-4
19-1047230-G-A p.Val640Val synonymous ABCA7 1 72178 1.38546E-5 36089 0 NA
19-1047232-C-T p.Thr641Ile missense ABCA7 1 71940 1.39005E-5 35970 0 5.04541E-4
19-1047245-G-A p.Leu645Leu synonymous ABCA7 2 71362 2.80261E-5 35681 0 1.24767E-5
19-1047251-C-G p.Ser647Arg missense ABCA7 1 71070 1.40706E-5 35535 0 NA
19-1047253-CCTT-C p.Phe650del disruptive_inframe_deletion ABCA7 3 71050 4.22238E-5 35525 0 2.08904E-5
19-1047262-C-G p.Ser651Cys missense ABCA7 4 70356 5.68537E-5 35178 0 9.56694E-5
19-1047264-C-T p.Arg652Cys missense ABCA7 2 70202 2.84892E-5 35101 0 4.19453E-6
19-1047266-C-T p.Arg652Arg synonymous ABCA7 10 69828 1.43209E-4 34914 0 9.56511E-5
19-1047280-C-T p.Ala657Val missense ABCA7 3 68700 4.36681E-5 34350 0 1.71309E-5
19-1047290-C-G p.Gly660Gly synonymous ABCA7 1 67608 1.47911E-5 33804 0 NA
19-1047317-G-A p.Leu669Leu synonymous ABCA7 5 65248 7.66307E-5 32624 0 4.23195E-4
19-1047323-C-T p.Tyr671Tyr synonymous ABCA7 1 64730 1.54488E-5 32365 0 2.61463E-5
19-1047325-T-C p.Val672Ala missense ABCA7 2 64674 3.09243E-5 32337 0 NA
19-1047336-G-A p.Ala676Thr missense ABCA7 986 63574 0.0155095 31787 46 0.032077
19-1047343-G-A p.Arg678Gln missense ABCA7 1 62144 1.60917E-5 31072 0 NA
19-1047345-G-T p.Asp679Tyr missense ABCA7 1 61932 1.61467E-5 30966 0 NA
19-1047346-A-T p.Asp679Val missense ABCA7 2 60924 3.28278E-5 30462 0 NA
19-1047348-C-T p.Arg680Trp missense ABCA7 1 60556 1.65136E-5 30278 0 NA
19-1047349-G-A p.Arg680Gln missense ABCA7 1 60278 1.65898E-5 30139 0 2.7972E-5
19-1047353-G-GC p.Ala683fs frameshift ABCA7 1 59882 1.66995E-5 29941 0 NA
19-1047356-C-T p.Pro682Pro synonymous ABCA7 7 59608 1.17434E-4 29804 0 6.36132E-4
19-1047361-G-T p.Gly684Val missense ABCA7 1 59614 1.67746E-5 29807 0 NA
19-1047364-G-C p.Gly685Ala missense ABCA7 1 59010 1.69463E-5 29505 0 NA
19-1047367-G-T p.Arg686Leu missense ABCA7 1 58534 1.70841E-5 29267 0 NA
19-1047369-G-A p.Val687Met missense ABCA7 2 58486 3.41962E-5 29243 0 NA
19-1047371-G-A p.Val687Val synonymous ABCA7 1 58384 1.7128E-5 29192 0 NA
19-1047376-CGGTGAGAGCCGGGTCGGGCGTGGATGGGGGACGCCCCCCGCTTCGGCCGCTCACTGACCGCCCGCTTTTCCGCA-C p.Ser690fs frameshift ABCA7 8 57578 1.38942E-4 28789 0 NA
19-1047377-G-A p.Ala689Ala splice_region+synonymous ABCA7 19 57608 3.29815E-4 28804 0 0.00111621
19-1047382-G-C c.2067+5G>C splice_region ABCA7 1 57504 1.73901E-5 28752 0 NA
19-1047382-G-A c.2067+5G>A splice_region ABCA7 1 57504 1.73901E-5 28752 0 5.58897E-6
19-1047384-G-A c.2067+7G>A splice_region ABCA7 1 57202 1.74819E-5 28601 0 NA
19-1047448-G-A c.2068-4G>A splice_region ABCA7 746 53046 0.0140633 26523 28 0.031246
19-1047456-T-C p.Leu691Pro missense ABCA7 1 53334 1.87498E-5 26667 0 NA
19-1047460-G-A p.Leu692Leu synonymous ABCA7 1 53364 1.87392E-5 26682 0 NA
19-1047466-C-T p.Pro694Pro synonymous ABCA7 1 53094 1.88345E-5 26547 0 6.37633E-5
19-1047470-G-T p.Ala696Ser missense ABCA7 8 53286 1.50133E-4 26643 0 7.01441E-4
19-1047475-C-T p.Phe697Phe synonymous ABCA7 3 53238 5.63507E-5 26619 0 3.18715E-5
19-1047475-C-A p.Phe697Leu missense ABCA7 1 53238 1.87836E-5 26619 0 3.52622E-5
19-1047478-C-T p.Gly698Gly synonymous ABCA7 2 53452 3.74167E-5 26726 0 3.55821E-5
19-1047489-A-C p.Glu702Ala missense ABCA7 1 54056 1.84993E-5 27028 0 NA
19-1047505-G-A p.Leu707Leu synonymous ABCA7 2 55296 3.6169E-5 27648 0 NA
19-1047507-AGGAGCAG-A p.Glu709fs frameshift ABCA7 88 55248 0.00159282 27624 1 0.00290012
19-1047510-A-G p.Glu709Gly missense ABCA7 2 55246 3.62017E-5 27623 0 NA
19-1047513-A-T p.Gln710Leu missense ABCA7 2 55620 3.59583E-5 27810 0 NA
19-1047524-G-A p.Ala714Thr missense ABCA7 4 55552 7.20046E-5 27776 0 4.14382E-4
19-1047527-C-G p.Gln715Glu missense ABCA7 1 55876 1.78968E-5 27938 0 NA
19-1047537-A-C p.Asn718Thr missense ABCA7 1658 56696 0.0292437 28348 48 0.0702766
19-1047538-C-G p.Asn718Lys missense ABCA7 2 56716 3.52634E-5 28358 0 9.56084E-5
19-1047560-G-T p.Asp726Tyr missense ABCA7 7 57600 1.21528E-4 28800 0 8.67727E-4
19-1047578-C-T p.Gln732* stop_gained ABCA7 1 57284 1.74569E-5 28642 0 1.29002E-5
19-1047582-T-C p.Val733Ala missense ABCA7 1 57112 1.75095E-5 28556 0 NA
19-1047613-C-T p.Leu743Leu synonymous ABCA7 1 53418 1.87203E-5 26709 0 NA
19-1047619-C-T p.Gly745Gly synonymous ABCA7 1 52054 1.92108E-5 26027 0 3.18735E-5
19-1047623-G-C p.Ala747Pro missense ABCA7 2 50924 3.92742E-5 25462 0 NA
19-1047625-C-G p.Ala747Ala synonymous ABCA7 3 50834 5.90156E-5 25417 0 3.3942E-5
19-1047634-C-A p.Tyr750* stop_gained ABCA7 2 49668 4.02674E-5 24834 0 2.34082E-5
19-1047636-T-C p.Leu751Pro missense ABCA7 1 49364 2.02577E-5 24682 0 NA
19-1047647-T-G p.Cys755Gly missense ABCA7 1 47662 2.09811E-5 23831 0 9.10855E-6
19-1047648-G-T p.Cys755Phe missense ABCA7 1 47562 2.10252E-5 23781 0 5.07614E-4
19-1047661-G-T c.2269+8G>T splice_region ABCA7 3 45664 6.56973E-5 22832 0 3.37776E-5
19-1048886-C-A c.2270-8C>A splice_region ABCA7 1 81270 1.23047E-5 40635 0 1.09673E-4
19-1048889-C-T c.2270-5C>T splice_region ABCA7 11 81338 1.35238E-4 40669 0 0.00125156
19-1048890-G-A c.2270-4G>A splice_region ABCA7 3 81220 3.69367E-5 40610 0 1.47206E-5
19-1048898-G-C p.Gln758His missense ABCA7 452 81630 0.00553718 40815 5 0.0129366
19-1048914-CCA-TCT p.Pro764Ser missense ABCA7 1 81998 1.21954E-5 40999 0 NA
19-1048921-A-G p.Asn766Ser missense ABCA7 1 82042 1.21889E-5 41021 0 3.20143E-5
19-1048926-C-G p.Pro768Ala missense ABCA7 1 82048 1.2188E-5 41024 0 NA
19-1048927-C-T p.Pro768Leu missense ABCA7 8 82046 9.75063E-5 41023 0 2.19693E-4
19-1048932-C-T p.Arg770Trp missense ABCA7 8 82012 9.75467E-5 41006 0 6.52486E-5
19-1048933-G-A p.Arg770Gln missense ABCA7 1 82016 1.21927E-5 41008 0 7.5838E-5
19-1048949-C-G p.Cys775Trp missense ABCA7 1 81934 1.22049E-5 40967 0 NA
19-1048949-C-A p.Cys775* stop_gained ABCA7 1 81934 1.22049E-5 40967 0 3.20102E-5
19-1048950-G-A p.Gly776Arg missense ABCA7 19 81936 2.31888E-4 40968 0 1.28397E-4
19-1048950-G-T p.Gly776* stop_gained ABCA7 4 81938 4.88174E-5 40969 0 1.23164E-5
19-1048951-G-C p.Gly776Ala missense ABCA7 1 81930 1.22055E-5 40965 0 1.06959E-5
19-1048951-G-A p.Gly776Glu missense ABCA7 2 81930 2.44111E-5 40965 0 1.06959E-5
19-1048957-G-A p.Arg778Gln missense ABCA7 3 81868 3.66444E-5 40934 0 NA
19-1048959-C-T p.Pro779Ser missense ABCA7 1 81838 1.22193E-5 40919 0 3.20328E-5
19-1048960-C-A p.Pro779His missense ABCA7 3 81912 3.66247E-5 40956 0 3.20061E-5
19-1048961-C-T p.Pro779Pro synonymous ABCA7 1 81912 1.22082E-5 40956 0 3.2002E-5
19-1048961-C-A p.Pro779Pro synonymous ABCA7 2 81910 2.4417E-5 40955 0 0.00100908
19-1048963-C-A p.Pro780His missense ABCA7 1 81922 1.22067E-5 40961 0 0.0025227
19-1048964-CAA-C p.Lys781fs frameshift ABCA7 1 81926 1.22061E-5 40963 0 2.16034E-5
19-1048969-G-T p.Ser782Ile missense ABCA7 3 81838 3.66578E-5 40919 0 5.42594E-5
19-1048969-G-A p.Ser782Asn missense ABCA7 6 81838 7.33156E-5 40919 0 4.16181E-6
19-1048976-C-T p.Ala784Ala synonymous ABCA7 2 81852 2.44343E-5 40926 0 6.39632E-5
19-1048982-C-T p.Cys786Cys synonymous ABCA7 340 81748 0.00415912 40874 4 0.0181635
19-1048983-C-G p.Pro787Ala missense ABCA7 4 81770 4.89177E-5 40885 0 5.52951E-5
19-1048984-C-T p.Pro787Leu missense ABCA7 18 81742 2.20205E-4 40871 0 1.5189E-4
19-1048987-C-T p.Thr788Ile missense ABCA7 2 81722 2.44732E-5 40861 0 5.34326E-5
19-1048988-C-T p.Thr788Thr synonymous ABCA7 9 81736 1.10111E-4 40868 0 1.02389E-4
19-1048990-C-T p.Pro789Leu missense ABCA7 1 81730 1.22354E-5 40865 0 1.12206E-5
19-1048991-G-A p.Pro789Pro synonymous ABCA7 1 81646 1.2248E-5 40823 0 4.49414E-6
19-1049005-G-A c.2380+1G>A splice_donor ABCA7 4 81506 4.90761E-5 40753 0 6.97674E-5
19-1049012-A-C c.2380+8A>C splice_region ABCA7 56670 73420 0.771861 36710 21768 0.856873
19-1049261-G-A c.2381-4G>A splice_region ABCA7 1 80728 1.23873E-5 40364 0 8.91552E-6
19-1049264-G-C c.2381-1G>C splice_acceptor ABCA7 1 80724 1.23879E-5 40362 0 NA
19-1049264-G-A c.2381-1G>A splice_acceptor ABCA7 1 80724 1.23879E-5 40362 0 NA
19-1049267-C-T p.Leu795Leu splice_region+synonymous ABCA7 1 80732 1.23867E-5 40366 0 NA
19-1049269-G-A p.Leu795Leu synonymous ABCA7 12857 80426 0.159861 40213 1124 0.186304
19-1049276-G-A p.Glu798Lys missense ABCA7 1 80712 1.23897E-5 40356 0 4.09102E-6
19-1049280-C-A p.Ala799Glu missense ABCA7 4 80652 4.95958E-5 40326 0 NA
19-1049283-C-G p.Pro800Arg missense ABCA7 1 80638 1.24011E-5 40319 0 NA
19-1049283-C-T p.Pro800Leu missense ABCA7 2 80638 2.48022E-5 40319 0 3.66288E-5
19-1049284-G-A p.Pro800Pro synonymous ABCA7 5 80568 6.20594E-5 40284 0 4.47194E-5
19-1049285-C-A p.Pro801Thr missense ABCA7 2 80590 2.4817E-5 40295 0 4.06081E-6
19-1049287-C-T p.Pro801Pro synonymous ABCA7 1 80592 1.24082E-5 40296 0 3.20431E-5
19-1049288-G-A p.Gly802Ser missense ABCA7 1 80608 1.24057E-5 40304 0 NA
19-1049291-C-T p.Leu803Leu synonymous ABCA7 1 80690 1.23931E-5 40345 0 8.52021E-6
19-1049292-T-G p.Leu803Arg missense ABCA7 21 80708 2.60197E-4 40354 0 2.88314E-4
19-1049298-C-A p.Pro805His missense ABCA7 1 80740 1.23854E-5 40370 0 4.03734E-6
19-1049303-G-A p.Val807Ile missense ABCA7 1 80656 1.23983E-5 40328 0 8.06998E-6
19-1049305-C-A p.Val807Val synonymous ABCA7 12122 80402 0.150767 40201 1069 0.184188
19-1049305-CTC-ATG p.ValSer807ValCys missense ABCA7 1 80688 1.23934E-5 40344 0 NA
19-1049307-C-G p.Ser808Cys missense ABCA7 5 80714 6.19471E-5 40357 2 NA
19-1049312-C-A p.Arg810Ser missense ABCA7 1 80686 1.23937E-5 40343 0 NA
19-1049313-G-C p.Arg810Pro missense ABCA7 5 80736 6.19302E-5 40368 0 3.37519E-5
19-1049313-G-A p.Arg810His missense ABCA7 2 80736 2.47721E-5 40368 0 3.20636E-5
19-1049316-G-T p.Ser811Ile missense ABCA7 4 80816 4.94951E-5 40408 0 1.68651E-5
19-1049318-C-A p.Leu812Met missense ABCA7 2 80882 2.47274E-5 40441 0 3.20307E-5
19-1049318-C-G p.Leu812Val missense ABCA7 2 80882 2.47274E-5 40441 0 NA
19-1049323-G-C p.Glu813Asp missense ABCA7 2 80920 2.47158E-5 40460 0 NA
19-1049326-G-A p.Lys814Lys synonymous ABCA7 1 80874 1.23649E-5 40437 0 8.43128E-6
19-1049327-C-T p.Arg815Cys missense ABCA7 1 80884 1.23634E-5 40442 0 3.20574E-5
19-1049328-G-A p.Arg815His missense ABCA7 1 80832 1.23713E-5 40416 0 8.43185E-6
19-1049332-T-C p.Phe816Phe synonymous ABCA7 1 80896 1.23616E-5 40448 0 8.05322E-6
19-1049340-G-A p.Ser819Asn missense ABCA7 1 80374 1.24418E-5 40187 0 3.21151E-5
19-1049344-G-A p.Pro820Pro synonymous ABCA7 16 80816 1.97981E-4 40408 1 0.00100705
19-1049345-C-T p.Gln821* stop_gained ABCA7 2 80872 2.47304E-5 40436 0 4.03239E-6
19-1049351-G-A p.Ala823Thr missense ABCA7 1 80898 1.23612E-5 40449 0 8.46124E-6
19-1049356-G-A p.Leu824Leu synonymous ABCA7 1 80832 1.23713E-5 40416 0 NA
19-1049357-C-G p.Arg825Gly missense ABCA7 1 80796 1.23769E-5 40398 0 2.87921E-4
19-1049358-G-C p.Arg825Pro missense ABCA7 4 80874 4.94597E-5 40437 0 1.61526E-5
19-1049360-G-A p.Gly826Arg missense ABCA7 35 80930 4.32473E-4 40465 0 6.73941E-4
19-1049362-G-T p.Gly826Gly synonymous ABCA7 1 80888 1.23628E-5 40444 0 NA
19-1049362-G-C p.Gly826Gly synonymous ABCA7 12 80888 1.48353E-4 40444 0 0.00125
19-1049362-G-A p.Gly826Gly synonymous ABCA7 1 80888 1.23628E-5 40444 0 2.54186E-5
19-1049363-C-T p.Leu827Phe missense ABCA7 10 80950 1.23533E-4 40475 1 8.47185E-6
19-1049365-C-T p.Leu827Leu synonymous ABCA7 2 80958 2.47042E-5 40479 0 2.01865E-5
19-1049367-G-C p.Ser828Thr missense ABCA7 1 80910 1.23594E-5 40455 0 4.0391E-6
19-1049369-C-T p.Leu829Leu synonymous ABCA7 1 80906 1.236E-5 40453 0 4.0392E-6
19-1049372-G-C p.Asp830His missense ABCA7 2 80808 2.475E-5 40404 0 3.20718E-5
19-1049372-G-T p.Asp830Tyr missense ABCA7 1 80808 1.2375E-5 40404 0 1.21249E-5
19-1049372-G-A p.Asp830Asn missense ABCA7 2 80808 2.475E-5 40404 0 5.09061E-5
19-1049377-C-T p.Phe831Phe synonymous ABCA7 2 80746 2.4769E-5 40373 0 1.2746E-4
19-1049378-T-C p.Tyr832His missense ABCA7 2 80710 2.47801E-5 40355 0 8.49777E-6
19-1049380-C-T p.Tyr832Tyr synonymous ABCA7 1 80720 1.23885E-5 40360 0 3.20513E-5
19-1049381-C-A p.Gln833Lys missense ABCA7 1 80714 1.23894E-5 40357 0 1.70109E-5
19-1049385-G-A p.Gly834Asp missense ABCA7 2 80592 2.48164E-5 40296 0 6.25E-4
19-1049393-A-G p.Thr837Ala missense ABCA7 1 80194 1.24698E-5 40097 0 NA
19-1049395-C-T p.Thr837Thr synonymous ABCA7 3 80380 3.73227E-5 40190 0 2.74113E-4
19-1049401-C-G p.Phe839Leu missense ABCA7 2 80234 2.49271E-5 40117 0 8.59284E-6
19-1049402-C-A p.Leu840Met missense ABCA7 2 80208 2.49352E-5 40104 0 NA
19-1049407-C-T p.Gly841Gly synonymous ABCA7 1 79972 1.25044E-5 39986 0 7.79221E-5
19-1049414-G-C p.Gly844Arg missense ABCA7 3 79748 3.76185E-5 39874 0 3.2202E-5
19-1049415-G-T p.Gly844Val missense ABCA7 1 79706 1.25461E-5 39853 0 NA
19-1049416-G-T p.Gly844Gly synonymous ABCA7 1 79658 1.25537E-5 39829 0 1.74798E-5
19-1049419-C-G p.Ala845Ala synonymous ABCA7 1 79422 1.2591E-5 39711 0 6.44454E-5
19-1049419-C-T p.Ala845Ala synonymous ABCA7 1 79422 1.2591E-5 39711 0 NA
19-1049420-G-A p.Gly846Ser missense ABCA7 1 79392 1.25957E-5 39696 0 4.19449E-6
19-1049424-A-G p.Lys847Arg missense ABCA7 1 79236 1.26205E-5 39618 0 1.58669E-4
19-1049424-AG-A p.Thr848fs frameshift ABCA7 1 79236 1.26205E-5 39618 0 NA
19-1049426-AC-A p.Thr849fs frameshift ABCA7 1 79070 1.2647E-5 39535 0 6.95725E-5
19-1049428-C-A p.Thr848Thr synonymous ABCA7 1 79082 1.26451E-5 39541 0 0.0037594
19-1049428-C-T p.Thr848Thr synonymous ABCA7 1 79082 1.26451E-5 39541 0 8.86462E-6
19-1049431-C-G p.Thr849Thr synonymous ABCA7 1 78970 1.2663E-5 39485 0 8.91123E-6
19-1049431-C-A p.Thr849Thr synonymous ABCA7 1 78970 1.2663E-5 39485 0 NA
19-1049432-A-C p.Thr850Pro missense ABCA7 1 78760 1.26968E-5 39380 0 0.00807265
19-1049436-TGTGAGCCCCCAACCACTCCCTCCCCGTGAGCCCCCCCACTCCCACCCC-T c.2552+1_2552+48delGTGAGCCCCCAACCACTCCCTCCCCGTGAGCCCCCCCACTCCCACCCC splice_donor ABCA7 34 78754 4.31724E-4 39377 1 3.5144E-4
19-1049436-T-C p.Leu851Pro missense+splice_region ABCA7 1 78756 1.26974E-5 39378 0 1.90413E-5
19-1049439-G-A c.2552+3G>A splice_region ABCA7 3 78506 3.82136E-5 39253 0 2.72356E-5
19-1049441-G-GC c.2552+5_2552+6insC splice_region ABCA7 24 78296 3.06529E-4 39148 0 2.36726E-4
19-1049441-G-A c.2552+5G>A splice_region ABCA7 1 78302 1.27711E-5 39151 0 2.94172E-5
19-1049441-GCCCCCAACCACTCCCTCCCCGTGAGCCCCCCCACTCCCACCCCGTGAGC-G c.2552+6_2552+54delCCCCCAACCACTCCCTCCCCGTGAGCCCCCCCACTCCCACCCCGTGAGC splice_region ABCA7 2 78302 2.55421E-5 39151 0 1.51989E-4
19-1049442-C-T c.2552+6C>T splice_region ABCA7 4 78260 5.11117E-5 39130 0 1.33476E-4
19-1049443-C-T c.2552+7C>T splice_region ABCA7 1 78208 1.27864E-5 39104 0 NA
19-1050920-G-T p.Leu851Leu splice_region+synonymous ABCA7 6 82594 7.26445E-5 41297 0 3.18756E-5
19-1050923-C-T p.Ser852Ser synonymous ABCA7 1 82632 1.21018E-5 41316 0 NA
19-1050926-C-T p.Ile853Ile synonymous ABCA7 3 82672 3.6288E-5 41336 0 NA
19-1050942-C-CT p.Pro859fs frameshift ABCA7 1 82654 1.20986E-5 41327 0 1.7204E-5
19-1050943-C-A p.Pro859Gln missense ABCA7 1 82656 1.20983E-5 41328 0 1.7183E-5
19-1050945-C-T p.Pro860Ser missense ABCA7 2 82644 2.42002E-5 41322 0 8.06536E-5
19-1050953-T-G p.Gly862Gly synonymous ABCA7 2 82494 2.42442E-5 41247 0 3.18878E-5
19-1050956-C-T p.Gly863Gly synonymous ABCA7 11 82436 1.33437E-4 41218 0 2.6318E-4
19-1050968-C-T p.Ile867Ile synonymous ABCA7 3 82516 3.63566E-5 41258 0 3.19224E-5
19-1050971-G-A p.Leu868Leu synonymous ABCA7 1 82512 1.21194E-5 41256 0 3.19203E-5
19-1050975-C-T p.His870Tyr missense ABCA7 1 82500 1.21212E-5 41250 0 3.19122E-5
19-1050977-C-T p.His870His synonymous ABCA7 1 82502 1.21209E-5 41251 0 8.02697E-6
19-1050978-G-C p.Asp871His missense ABCA7 44 82476 5.33489E-4 41238 0 0.00151057
19-1050980-C-T p.Asp871Asp synonymous ABCA7 1 82562 1.21121E-5 41281 0 NA
19-1050981-G-A p.Val872Ile missense ABCA7 2 82574 2.42207E-5 41287 0 3.19326E-5
19-1050982-T-A p.Val872Asp missense ABCA7 1 82562 1.21121E-5 41281 0 NA
19-1050984-C-T p.Arg873Cys missense ABCA7 1 82614 1.21045E-5 41307 0 5.03525E-4
19-1050985-G-A p.Arg873His missense ABCA7 7 82598 8.47478E-5 41299 0 9.57426E-5
19-1050996-G-A p.Ala877Thr missense ABCA7 1038 82656 0.0125581 41328 35 0.0207025
19-1050999-G-A p.Ala878Thr missense ABCA7 1 82696 1.20925E-5 41348 0 3.61011E-5
19-1051001-C-T p.Ala878Ala synonymous ABCA7 1 82718 1.20893E-5 41359 0 4.01007E-6
19-1051005-C-T p.Arg880Trp missense ABCA7 4 82728 4.83512E-5 41364 0 6.38774E-5
19-1051006-G-A p.Arg880Gln missense ABCA7 64 82710 7.73788E-4 41355 0 0.00137442
19-1051009-C-A p.Pro881His missense ABCA7 1 82736 1.20866E-5 41368 0 8.39095E-6
19-1051017-G-A p.Gly884Ser missense ABCA7 2 82804 2.41534E-5 41402 0 8.3894E-6
19-1051020-G-A p.Val885Ile missense ABCA7 1 82810 1.20758E-5 41405 0 9.58038E-5
19-1051022-C-T p.Val885Val synonymous ABCA7 1 82854 1.20694E-5 41427 0 8.38771E-6
19-1051024-G-A p.Cys886Tyr missense ABCA7 1 82854 1.20694E-5 41427 0 4.01178E-6
19-1051027-C-T p.Pro887Leu missense ABCA7 1 82870 1.20671E-5 41435 0 3.21048E-5
19-1051035-A-C p.Asn890His missense ABCA7 1 82884 1.20651E-5 41442 0 NA
19-1051036-A-C p.Asn890Thr missense ABCA7 2 82886 2.41295E-5 41443 0 NA
19-1051037-C-T p.Asn890Asn synonymous ABCA7 2 82886 2.41295E-5 41443 0 8.38926E-6
19-1051040-G-A p.Val891Val synonymous ABCA7 2 82882 2.41307E-5 41441 0 5.03525E-4
19-1051044-T-C p.Phe893Leu missense ABCA7 1 82886 1.20648E-5 41443 0 NA
19-1051049-C-T p.Asp894Asp splice_region+synonymous ABCA7 3 82898 3.61891E-5 41449 0 8.39208E-6
19-1051050-A-T p.Met895Leu missense+splice_region ABCA7 1 82884 1.20651E-5 41442 0 NA
19-1051051-TGTGCGTCTCGGCAGGCCCAGAGTGCAGCGGTGGGAAGGGACTGGACGCCCTCTGGGACTCTGCCTGCCATGTGGGTCACTCTGCTCTGTGCACTGGCCGCAG-T c.2684+1_2685-1del splice_acceptor ABCA7 6 82884 7.23903E-5 41442 1 NA
19-1051054-G-A c.2684+3G>A splice_region ABCA7 3 82862 3.62048E-5 41431 0 8.39659E-6
19-1051055-C-T c.2684+4C>T splice_region ABCA7 1 82852 1.20697E-5 41426 0 1.20817E-5
19-1051056-G-A c.2684+5G>A splice_region ABCA7 15 82844 1.81063E-4 41422 0 1.2751E-4
19-1051057-T-G c.2684+6T>G splice_region ABCA7 2 82834 2.41447E-5 41417 0 NA
19-1051147-GC-G c.2685-6delC splice_region ABCA7 1 82658 1.2098E-5 41329 0 NA
19-1051149-C-T c.2685-5C>T splice_region ABCA7 4 82638 4.84039E-5 41319 0 1.17171E-4
19-1051150-G-T c.2685-4G>T splice_region ABCA7 102 82638 0.0012343 41319 0 0.00302586
19-1051150-G-A c.2685-4G>A splice_region ABCA7 2 82642 2.42008E-5 41321 0 1.20776E-5
19-1051155-C-G p.Leu896Val missense+splice_region ABCA7 2 82660 2.41955E-5 41330 0 8.04719E-6
19-1051158-A-T p.Thr897Ser missense ABCA7 1 82642 1.21004E-5 41321 0 4.02379E-6
19-1051161-G-A p.Val898Met missense ABCA7 1 82614 1.21045E-5 41307 0 1.67356E-5
19-1051166-C-T p.Asp899Asp synonymous ABCA7 2 82568 2.42225E-5 41284 0 1.59256E-4
19-1051167-G-A p.Glu900Lys missense ABCA7 2 82556 2.4226E-5 41278 0 1.67389E-5
19-1051172-C-T p.His901His synonymous ABCA7 4 82526 4.84696E-5 41263 0 3.34767E-5
19-1051178-G-A p.Trp903* stop_gained ABCA7 38 82498 4.60617E-4 41249 0 5.23101E-5
19-1051189-G-A p.Arg907Gln missense ABCA7 1 82322 1.21474E-5 41161 0 8.37395E-6
19-1051208-C-T p.Ala913Ala synonymous ABCA7 1 82126 1.21764E-5 41063 0 8.38799E-6
19-1051209-G-T p.Ala914Ser missense ABCA7 30 82134 3.65257E-4 41067 0 3.50452E-4
19-1051214-A-G p.Val915Val synonymous ABCA7 28884 81428 0.354718 40714 5234 0.37891
19-1051217-G-A p.Val916Val synonymous ABCA7 9 82070 1.09662E-4 41035 0 3.37126E-5
19-1051222-C-G p.Pro918Arg missense ABCA7 1 81904 1.22094E-5 40952 0 4.0391E-6
19-1051223-C-G p.Pro918Pro synonymous ABCA7 5 81834 6.10993E-5 40917 0 3.18593E-5
19-1051224-G-A p.Glu919Lys missense ABCA7 1 81864 1.22154E-5 40932 0 3.18573E-5
19-1051234-G-A p.Arg922His missense ABCA7 7 81618 8.57654E-5 40809 0 1.62065E-5
19-1051267-A-G p.Gln933Arg missense ABCA7 2 81154 2.46445E-5 40577 0 NA
19-1051272-G-A p.Val935Met missense ABCA7 1 81090 1.2332E-5 40545 0 NA
19-1051281-C-T p.Arg938Cys missense ABCA7 3 81008 3.70334E-5 40504 0 4.22073E-6
19-1051282-G-A p.Arg938His missense ABCA7 1 80982 1.23484E-5 40491 0 8.44174E-6
19-1051284-C-T p.His939Tyr missense ABCA7 8 81066 9.8685E-5 40533 0 1.05631E-4
19-1051292-TGGTGAGCCCATCCCCAAGGGAGGTCACCTCACAGGGAGGGGCCTGGGGATTCATCCTGAAGGCAGGGGGAAGCCGGGTACTGAGGTCCACGTGGGTAGGCAACCTTGCCCAAGGCTGGGTGTGACACACTGAGGTCCCTTCCCCATCTCTACCA-T p.Gly942fs frameshift ABCA7 2 81102 2.46603E-5 40551 1 NA
19-1051293-G-A p.Gly942Ser missense+splice_region ABCA7 2 81092 2.46633E-5 40546 0 1.76703E-5
19-1051293-G-C p.Gly942Arg missense+splice_region ABCA7 16 81090 1.97312E-4 40545 0 5.04541E-4
19-1051441-C-T c.2825-7C>T splice_region ABCA7 9 82708 1.08817E-4 41354 0 1.14416E-4
19-1051451-G-A p.Gly943Glu missense ABCA7 1 82878 1.20659E-5 41439 0 NA
19-1051457-A-G p.Gln945Arg missense ABCA7 2 82924 2.41185E-5 41462 0 NA
19-1051458-A-C p.Gln945His missense ABCA7 1 82920 1.20598E-5 41460 0 3.18634E-5
19-1051461-G-A p.Arg946Arg synonymous ABCA7 1 82940 1.20569E-5 41470 0 3.59376E-5
19-1051470-C-T p.Ser949Ser synonymous ABCA7 2 82948 2.41115E-5 41474 0 5.8458E-5
19-1051471-G-A p.Val950Met missense ABCA7 3 82940 3.61707E-5 41470 0 7.0082E-5
19-1051486-G-A p.Val955Met missense ABCA7 1 83006 1.20473E-5 41503 0 3.25373E-5
19-1051491-C-T p.Gly956Gly synonymous ABCA7 1 82982 1.20508E-5 41491 0 0.004375
19-1051492-G-A p.Gly957Ser missense ABCA7 3 82994 3.61472E-5 41497 0 2.80168E-5
19-1051493-G-A p.Gly957Asp missense ABCA7 1 82988 1.20499E-5 41494 0 1.66978E-5
19-1051502-T-C p.Val960Ala missense ABCA7 4 83008 4.81881E-5 41504 0 1.59317E-4
19-1051504-G-T p.Val961Phe missense ABCA7 2 82998 2.4097E-5 41499 0 5.04541E-4
19-1051515-C-G p.Asp964Glu missense ABCA7 31 82958 3.73683E-4 41479 0 0.00172596
19-1051515-C-A p.Asp964Glu missense ABCA7 2 82958 2.41086E-5 41479 0 NA
19-1051515-C-T p.Asp964Asp synonymous ABCA7 1 82958 1.20543E-5 41479 0 NA
19-1051522-A-G p.Thr967Ala missense ABCA7 1 82996 1.20488E-5 41498 0 3.1841E-5
19-1051523-C-T p.Thr967Met missense ABCA7 2 82996 2.40975E-5 41498 0 1.50979E-4
19-1051524-G-A p.Thr967Thr synonymous ABCA7 18 82996 2.16878E-4 41498 0 2.96294E-4
19-1051530-C-T p.Gly969Gly synonymous ABCA7 2 82918 2.41202E-5 41459 0 1.68569E-5
19-1051531-G-A p.Val970Met missense ABCA7 10 82930 1.20584E-4 41465 0 0.00101215
19-1051546-C-T p.Arg975Cys missense ABCA7 6 82920 7.23589E-5 41460 0 1.78684E-4
19-1051547-G-A p.Arg975His missense ABCA7 2 82900 2.41255E-5 41450 0 2.54777E-4
19-1051549-C-T p.Arg976Cys missense ABCA7 2 82906 2.41237E-5 41453 0 4.40829E-5
19-1051549-C-A p.Arg976Ser missense ABCA7 1 82906 1.20619E-5 41453 0 NA
19-1051550-G-A p.Arg976His missense ABCA7 2 82892 2.41278E-5 41446 0 2.0043E-5
19-1051551-C-T p.Arg976Arg synonymous ABCA7 18 82896 2.1714E-4 41448 0 4.45803E-4
19-1051552-G-A p.Gly977Ser missense ABCA7 1 82884 1.20651E-5 41442 0 8.55974E-6
19-1051554-T-A p.Gly977Gly synonymous ABCA7 1 82854 1.20694E-5 41427 0 NA
19-1051555-A-G p.Ile978Val missense ABCA7 7 82888 8.44513E-5 41444 0 NA
19-1051568-T-C p.Leu982Pro missense ABCA7 1 82854 1.20694E-5 41427 0 8.77024E-6
19-1051579-C-T p.Arg986* stop_gained ABCA7 1 82776 1.20808E-5 41388 0 3.18593E-5
19-1051580-G-T p.Arg986Leu missense ABCA7 1 82774 1.20811E-5 41387 0 9.14127E-6
19-1051584-AG-A p.Lys984fs frameshift ABCA7 1 82756 1.20837E-5 41378 0 1.20836E-5
19-1051584-A-G p.Glu987Glu splice_region+synonymous ABCA7 1 82756 1.20837E-5 41378 0 NA
19-1051933-G-A c.2963-8G>A splice_region ABCA7 1985 81968 0.0242168 40984 126 0.0524587
19-1051935-GCCTAGGTCGCACGCTGATCCTCT-G p.Gly988_Ser994delinsAla splice_acceptor ABCA7 1 82066 1.21853E-5 41033 0 2.52644E-5
19-1051940-G-A c.2963-1G>A splice_acceptor ABCA7 1 82212 1.21637E-5 41106 0 1.21152E-5
19-1051943-C-T p.Arg989Cys missense+splice_region ABCA7 5 82214 6.08169E-5 41107 0 6.25E-4
19-1051944-G-A p.Arg989His missense ABCA7 106 82208 0.00128941 41104 0 8.11393E-4
19-1051947-C-T p.Thr990Met missense ABCA7 4 82272 4.86192E-5 41136 0 4.8368E-5
19-1051948-G-A p.Thr990Thr synonymous ABCA7 1 82284 1.2153E-5 41142 0 6.25E-4
19-1051950-T-A p.Leu991Gln missense ABCA7 2 82352 2.4286E-5 41176 0 8.05036E-6
19-1051964-C-T p.His996Tyr missense ABCA7 6 82480 7.27449E-5 41240 0 5.02664E-5
19-1051997-C-T p.Arg1007Cys missense ABCA7 1 82452 1.21283E-5 41226 0 3.18573E-5
19-1051998-G-A p.Arg1007His missense ABCA7 1 82460 1.21271E-5 41230 0 5.06073E-4
19-1052005-C-T p.Ala1009Ala synonymous ABCA7 34634 81856 0.423109 40928 7452 0.46125
19-1052006-G-A p.Val1010Met missense ABCA7 1 82402 1.21356E-5 41201 0 3.18695E-5
19-1052009-G-A p.Val1011Met missense ABCA7 1 82364 1.21412E-5 41182 0 4.01381E-6
19-1052017-T-A p.Gly1013Gly synonymous ABCA7 31 82116 3.77515E-4 41058 0 0.001875
19-1052021-C-T p.Arg1015Cys missense ABCA7 4 82160 4.86855E-5 41080 0 1.27518E-4
19-1052022-G-A p.Arg1015His missense ABCA7 5 82096 6.09043E-5 41048 0 0.00201816
19-1052025-T-A p.Leu1016* stop_gained ABCA7 1 82162 1.21711E-5 41081 0 NA
19-1052030-T-G p.Cys1018Gly missense ABCA7 1 82096 1.21809E-5 41048 0 8.41368E-6
19-1052054-C-T p.Arg1026Cys missense ABCA7 11 81482 1.34999E-4 40741 0 2.55346E-4
19-1052055-G-A p.Arg1026His missense ABCA7 4 81388 4.91473E-5 40694 0 6.25E-4
19-1052058-G-A p.Arg1027His missense ABCA7 12 81416 1.47391E-4 40708 0 1.10153E-4
19-1052065-G-C p.Leu1029Leu synonymous ABCA7 6 81502 7.36178E-5 40751 0 1.91485E-4
19-1052071-C-T p.Ser1031Ser synonymous ABCA7 10 81388 1.22868E-4 40694 0 0.00100806
19-1052072-G-A p.Gly1032Ser missense ABCA7 4 81364 4.91618E-5 40682 0 6.03806E-5
19-1052085-C-T p.Thr1036Met missense ABCA7 3 81238 3.69285E-5 40619 0 3.19122E-5
19-1052086-G-A p.Thr1036Thr synonymous ABCA7 1989 81098 0.0245259 40549 135 0.0538122
19-1052090-G-A p.Val1038Met missense ABCA7 1 81296 1.23007E-5 40648 0 NA
19-1052091-T-C p.Val1038Ala missense ABCA7 2 81240 2.46184E-5 40620 0 1.72322E-5
19-1052095-G-C p.Lys1039Asn missense ABCA7 1 81314 1.2298E-5 40657 0 3.19326E-5
19-1052100-G-A p.Arg1041His missense ABCA7 1 81498 1.22702E-5 40749 0 5.04541E-4
19-1052118-A-G p.Asn1047Ser missense ABCA7 1 81650 1.22474E-5 40825 0 NA
19-1052123-AAGGTGGGGACCGGCCTTCTCCTGACCCCTGACCCCCGGGACTCTGTTCAGCCCTGAAGGCCAAGCCACTTGGTGCCTCTCTGCCCGC-A p.Lys1049fs frameshift ABCA7 13 81588 1.59337E-4 40794 5 NA
19-1052124-A-C p.Lys1049Thr missense+splice_region ABCA7 1 81554 1.22618E-5 40777 0 NA
19-1052205-G-A c.3148-8G>A splice_region ABCA7 4 81664 4.89812E-5 40832 0 1.93686E-5
19-1052206-C-A c.3148-7C>A splice_region ABCA7 2 81644 2.44966E-5 40822 0 5.93754E-5
19-1052208-C-T c.3148-5C>T splice_region ABCA7 33 81618 4.04323E-4 40809 0 6.25E-4
19-1052209-G-A c.3148-4G>A splice_region ABCA7 15 81620 1.83778E-4 40810 0 8.47745E-5
19-1052209-G-T c.3148-4G>T splice_region ABCA7 2 81620 2.45038E-5 40810 0 2.11936E-5
19-1052221-T-TGACATGGAGGGCAGTGTGGACACC p.Asp1053_Thr1060dup conservative_inframe_insertion ABCA7 12 81534 1.47178E-4 40767 0 0.0010482
19-1052238-T-C p.Val1058Ala missense ABCA7 2 81324 2.4593E-5 40662 0 NA
19-1052243-A-G p.Thr1060Ala missense ABCA7 3 81202 3.69449E-5 40601 0 NA
19-1052244-C-T p.Thr1060Ile missense ABCA7 1 81180 1.23183E-5 40590 0 1.44103E-4
19-1052247-G-A p.Arg1061Lys missense ABCA7 1 81152 1.23226E-5 40576 0 7.66342E-5
19-1052251-G-A p.Gln1062Gln synonymous ABCA7 1 81028 1.23414E-5 40514 0 NA
19-1052252-G-A p.Glu1063Lys missense ABCA7 12 80994 1.48159E-4 40497 0 0.00356779
19-1052268-G-A p.Ser1068Asn missense ABCA7 1 80572 1.24113E-5 40286 0 NA
19-1052272-G-A p.Gln1069Gln synonymous ABCA7 1 80498 1.24227E-5 40249 0 NA
19-1052273-G-T p.Gly1070Cys missense ABCA7 2 80456 2.48583E-5 40228 0 5.04185E-5
19-1052275-C-T p.Gly1070Gly synonymous ABCA7 223 80314 0.0027766 40157 1 0.0172594
19-1052278-C-T p.Ser1071Ser synonymous ABCA7 1 80258 1.24598E-5 40129 0 5.25762E-4
19-1052284-C-T p.Val1073Val splice_region+synonymous ABCA7 3 79764 3.7611E-5 39882 0 1.07446E-4
19-1052285-G-A p.Gly1074Ser missense+splice_region ABCA7 8 79862 1.00173E-4 39931 0 0.00250627
19-1052287-T-G c.3220+2T>G splice_donor ABCA7 1 79684 1.25496E-5 39842 0 NA
19-1052288-G-A c.3220+3G>A splice_region ABCA7 1 79680 1.25502E-5 39840 0 NA
19-1052290-G-A c.3220+5G>A splice_region ABCA7 2 79586 2.513E-5 39793 0 NA