Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
17-67074843-T-G c.*271A>C splice_region ABCA6 2 13614 1.46908E-4 6807 0 9.55414E-5
17-67075119-G-T p.Pro1617Thr missense ABCA6 1 81364 1.22904E-5 40682 0 6.41849E-4
17-67075129-A-G p.His1613His synonymous ABCA6 1 81776 1.22285E-5 40888 0 NA
17-67075131-G-A p.His1613Tyr missense ABCA6 3 81840 3.66569E-5 40920 0 NA
17-67075150-CATT-C p.Met1606del disruptive_inframe_deletion ABCA6 2 82314 2.42972E-5 41157 0 3.18613E-5
17-67075172-T-C p.Asp1599Gly missense ABCA6 1 82508 1.212E-5 41254 0 NA
17-67075178-T-C p.Asn1597Ser missense ABCA6 1 82514 1.21192E-5 41257 0 3.18512E-5
17-67075179-T-G p.Asn1597His missense ABCA6 2 82528 2.42342E-5 41264 0 NA
17-67075191-G-A p.Gln1593* stop_gained ABCA6 2 82520 2.42365E-5 41260 0 3.18695E-5
17-67075200-A-G p.Ser1590Pro missense ABCA6 1 82456 1.21277E-5 41228 0 1.20311E-5
17-67075201-A-G p.Leu1589Leu synonymous ABCA6 1 82460 1.21271E-5 41230 0 NA
17-67075208-A-G p.Leu1587Ser missense ABCA6 1 82474 1.2125E-5 41237 0 NA
17-67075218-A-G c.4753-3T>C splice_region ABCA6 1 82400 1.21359E-5 41200 0 NA
17-67075343-T-C c.4752+8A>G splice_region ABCA6 56 82528 6.78558E-4 41264 0 0.0019749
17-67075344-G-A c.4752+7C>T splice_region ABCA6 1 82532 1.21165E-5 41266 0 NA
17-67075346-C-G c.4752+5G>C splice_region ABCA6 1 82542 1.2115E-5 41271 0 4.03054E-6
17-67075357-C-T p.Leu1582Leu synonymous ABCA6 7 82550 8.47971E-5 41275 0 6.36983E-5
17-67075358-A-C p.Leu1582Arg missense ABCA6 1 82558 1.21127E-5 41279 0 NA
17-67075360-T-G p.Thr1581Thr synonymous ABCA6 1 82566 1.21115E-5 41283 0 NA
17-67075360-T-C p.Thr1581Thr synonymous ABCA6 1 82566 1.21115E-5 41283 0 NA
17-67075361-G-A p.Thr1581Ile missense ABCA6 7 82572 8.47745E-5 41286 0 1.91131E-4
17-67075374-G-A p.Leu1577Phe missense ABCA6 46 82480 5.57711E-4 41240 0 0.001115
17-67075413-G-GA c.4697-8_4697-7insT splice_region ABCA6 3 81946 3.66095E-5 40973 0 6.51025E-5
17-67077225-A-G p.Phe1560Leu missense ABCA6 2 82498 2.4243E-5 41249 0 8.2687E-6
17-67077237-G-T p.Leu1556Ile missense ABCA6 244 82618 0.00295335 41309 5 0.00463279
17-67077244-AACGTCTGCC-A p.Ala1551_Val1553del disruptive_inframe_deletion ABCA6 12 82634 1.45219E-4 41317 0 9.55292E-5
17-67077246-C-T p.Val1553Ile missense ABCA6 11 82600 1.33172E-4 41300 0 5.05051E-4
17-67077246-C-G p.Val1553Leu missense ABCA6 1 82600 1.21065E-5 41300 0 2.03441E-5
17-67077255-C-T p.Val1550Met missense ABCA6 11 82506 1.33324E-4 41253 0 0.00100908
17-67077256-G-A p.Pro1549Pro synonymous ABCA6 3 82510 3.63592E-5 41255 0 9.55597E-5
17-67077259-C-A p.Leu1548Leu synonymous ABCA6 1 82474 1.2125E-5 41237 0 NA
17-67077262-C-T p.Lys1547Lys synonymous ABCA6 1 82416 1.21336E-5 41208 0 3.1839E-5
17-67077268-G-A p.Thr1545Thr synonymous ABCA6 1 82378 1.21392E-5 41189 0 NA
17-67077276-AAG-A p.Ser1542fs frameshift ABCA6 1 82056 1.21868E-5 41028 0 3.30912E-5
17-67079006-C-T c.4616+8G>A splice_region ABCA6 2 83140 2.40558E-5 41570 0 4.94397E-5
17-67079007-G-A c.4616+7C>T splice_region ABCA6 13 83148 1.56348E-4 41574 0 4.37968E-5
17-67079014-C-G p.Arg1539Thr missense+splice_region ABCA6 1 83186 1.20213E-5 41593 0 4.37776E-5
17-67079023-C-T p.Gly1536Glu missense ABCA6 3 83220 3.6049E-5 41610 0 NA
17-67079042-G-A p.Leu1530Phe missense ABCA6 1 83242 1.20132E-5 41621 0 NA
17-67079057-T-C p.Thr1525Ala missense ABCA6 2 83282 2.40148E-5 41641 0 7.95393E-6
17-67079079-C-T p.Thr1517Thr synonymous ABCA6 88 83290 0.00105655 41645 1 0.0025
17-67079080-G-A p.Thr1517Met missense ABCA6 1 83296 1.20054E-5 41648 0 3.57938E-5
17-67079114-T-C p.Lys1506Glu missense ABCA6 1 83314 1.20028E-5 41657 0 NA
17-67079116-C-T p.Gly1505Asp missense ABCA6 1 83310 1.20034E-5 41655 0 NA
17-67079136-T-C p.Gln1498Gln synonymous ABCA6 1 83312 1.20031E-5 41656 0 3.97776E-6
17-67079149-A-G p.Ile1494Thr missense ABCA6 6 83300 7.20288E-5 41650 0 6.3678E-5
17-67079156-T-C c.4476-2A>G splice_acceptor ABCA6 1 83292 1.2006E-5 41646 0 NA
17-67079160-G-T c.4476-6C>A splice_region ABCA6 5 83290 6.00312E-5 41645 0 8.25655E-6
17-67079160-G-A c.4476-6C>T splice_region ABCA6 1 83290 1.20062E-5 41645 0 4.00766E-6
17-67079161-G-A c.4476-7C>T splice_region ABCA6 1 83288 1.20065E-5 41644 0 8.25777E-6
17-67079352-C-T c.4475+1G>A splice_donor ABCA6 3 82398 3.64087E-5 41199 0 9.18523E-5
17-67079359-CT-C p.Arg1490fs frameshift ABCA6 6 82372 7.28403E-5 41186 0 1.03641E-4
17-67079370-C-T p.Met1486Ile missense ABCA6 1 82232 1.21607E-5 41116 0 NA
17-67079378-C-T p.Ala1484Thr missense ABCA6 1 82094 1.21812E-5 41047 0 8.5008E-6
17-67079382-A-G p.Arg1482Arg synonymous ABCA6 2 82038 2.43789E-5 41019 0 8.4717E-6
17-67079383-C-T p.Arg1482His missense ABCA6 10 82014 1.2193E-4 41007 0 1.35256E-4
17-67079384-G-A p.Arg1482Cys missense ABCA6 3 81976 3.65961E-5 40988 0 1.22873E-5
17-67079388-A-G p.Cys1480Cys synonymous ABCA6 1 81952 1.22023E-5 40976 0 NA
17-67079400-C-T p.Ala1476Ala synonymous ABCA6 18 81662 2.20421E-4 40831 0 2.06674E-4
17-67079401-G-A p.Ala1476Val missense ABCA6 2 81548 2.45254E-5 40774 0 3.36123E-5
17-67079410-AG-A p.Leu1473fs frameshift ABCA6 2 81368 2.45797E-5 40684 0 NA
17-67079410-A-G p.Leu1473Pro missense ABCA6 1 81368 1.22898E-5 40684 0 0.00100806
17-67079412-G-A p.Asn1472Asn synonymous ABCA6 1 81320 1.22971E-5 40660 0 8.39856E-6
17-67079420-TG-T p.Thr1470fs frameshift ABCA6 1 80992 1.23469E-5 40496 0 4.15586E-6
17-67079427-G-C p.Leu1467Leu synonymous ABCA6 1 80560 1.24131E-5 40280 0 8.42233E-6
17-67079434-CCT-C p.Gly1465fs frameshift ABCA6 1 80014 1.24978E-5 40007 0 1.66782E-5
17-67079440-T-A p.Glu1463Val missense ABCA6 2 79586 2.513E-5 39793 0 3.18512E-5
17-67079441-C-G p.Glu1463Gln missense ABCA6 21 79498 2.64158E-4 39749 0 0.001875
17-67079453-C-T p.Val1459Ile missense ABCA6 3 78296 3.83161E-5 39148 0 6.37308E-5
17-67079454-G-A p.Val1458Val synonymous ABCA6 583 78118 0.00746307 39059 5 0.0144951
17-67079456-C-T p.Val1458Ile missense ABCA6 1 77890 1.28386E-5 38945 0 NA
17-67079463-G-T p.Ile1455Ile synonymous ABCA6 1 77200 1.29534E-5 38600 0 NA
17-67079476-C-T c.4356-4G>A splice_region ABCA6 2 75476 2.64985E-5 37738 0 1.28485E-4
17-67080395-T-G c.4355+7A>C splice_region ABCA6 1 83088 1.20354E-5 41544 0 NA
17-67080396-G-A c.4355+6C>T splice_region ABCA6 2 83090 2.40703E-5 41545 0 3.18492E-5
17-67080396-G-GCTCAT c.4355+5_4355+6insATGAG splice_region ABCA6 2 83090 2.40703E-5 41545 0 NA
17-67080418-C-T p.Gly1447Arg missense ABCA6 5 83218 6.00832E-5 41609 0 1.64775E-5
17-67080429-A-G p.Ile1443Thr missense ABCA6 2 83258 2.40217E-5 41629 0 2.78445E-5
17-67080430-T-C p.Ile1443Val missense ABCA6 2 83258 2.40217E-5 41629 0 3.1837E-5
17-67080435-G-A p.Thr1441Met missense ABCA6 15 83256 1.80167E-4 41628 0 5.03525E-4
17-67080435-G-C p.Thr1441Arg missense ABCA6 1 83256 1.20111E-5 41628 0 NA
17-67080441-G-C p.Pro1439Arg missense ABCA6 1 83282 1.20074E-5 41641 0 NA
17-67080442-G-A p.Pro1439Ser missense ABCA6 59 83282 7.08436E-4 41641 0 0.00181575
17-67080445-C-A p.Glu1438* stop_gained ABCA6 1 83280 1.20077E-5 41640 0 8.2371E-6
17-67080455-C-A p.Leu1434Phe missense ABCA6 2 83290 2.40125E-5 41645 0 NA
17-67080463-G-C p.Pro1432Ala missense ABCA6 1 83306 1.20039E-5 41653 0 NA
17-67080464-T-C p.Ser1431Ser synonymous ABCA6 2 83304 2.40085E-5 41652 0 9.55597E-5
17-67080496-A-G p.Leu1421Leu splice_region+synonymous ABCA6 8 83316 9.602E-5 41658 0 1.91205E-4
17-67080565-G-A c.4260+8C>T splice_region ABCA6 689 83222 0.00827906 41611 21 0.0163078
17-67080569-G-C c.4260+4C>G splice_region ABCA6 2 83228 2.40304E-5 41614 0 NA
17-67080569-G-A c.4260+4C>T splice_region ABCA6 1 83228 1.20152E-5 41614 0 1.98989E-5
17-67080571-A-G c.4260+2T>C splice_donor ABCA6 1 83222 1.20161E-5 41611 0 3.1834E-5
17-67080579-C-T p.Thr1418Thr synonymous ABCA6 36 83182 4.32786E-4 41591 0 0.0025
17-67080627-C-T p.Leu1402Leu synonymous ABCA6 2 82692 2.41861E-5 41346 0 NA
17-67081161-G-A c.4184+8C>T splice_region ABCA6 7112 81204 0.0875819 40602 339 0.0810861
17-67081166-T-C c.4184+3A>G splice_region ABCA6 2 81942 2.44075E-5 40971 0 NA
17-67081169-C-T p.Arg1395Lys missense+splice_region ABCA6 1 82026 1.21913E-5 41013 0 4.08647E-6
17-67081179-C-T p.Ala1392Thr missense ABCA6 2 82164 2.43416E-5 41082 0 0.0020141
17-67081180-G-A p.Leu1391Leu synonymous ABCA6 2 82228 2.43226E-5 41114 0 1.68648E-5
17-67081181-A-G p.Leu1391Pro missense ABCA6 1 82246 1.21586E-5 41123 0 NA
17-67081192-C-T p.Ala1387Ala synonymous ABCA6 18 82436 2.18351E-4 41218 0 0.00100705
17-67081193-G-C p.Ala1387Gly missense ABCA6 2 82448 2.42577E-5 41224 0 1.6208E-5
17-67081193-G-A p.Ala1387Val missense ABCA6 3 82448 3.63866E-5 41224 0 1.52138E-4
17-67081195-T-C p.Lys1386Lys synonymous ABCA6 1 82496 1.21218E-5 41248 0 NA
17-67081206-C-T p.Gly1383Arg missense ABCA6 1 82616 1.21042E-5 41308 0 NA
17-67081207-C-G p.Lys1382Asn missense ABCA6 2 82638 2.42019E-5 41319 0 3.18695E-5
17-67081212-C-T p.Val1381Ile missense ABCA6 1 82624 1.2103E-5 41312 0 8.54584E-6
17-67081213-G-A p.Ala1380Ala synonymous ABCA6 1 82624 1.2103E-5 41312 0 7.99399E-6
17-67081218-C-T p.Ala1379Thr missense ABCA6 183 82708 0.0022126 41354 0 0.00286624
17-67081242-A-G p.Leu1371Leu synonymous ABCA6 1 82928 1.20587E-5 41464 0 NA
17-67081274-GG-TC p.Pro1360Asp missense ABCA6 2 83016 2.40917E-5 41508 0 NA
17-67081278-A-G p.Cys1359Arg missense ABCA6 878 82988 0.0105798 41494 4 0.0108187
17-67081282-C-T p.Gly1357Gly synonymous ABCA6 1 83006 1.20473E-5 41503 0 9.56993E-6
17-67081285-C-T p.Leu1356Leu synonymous ABCA6 3 82998 3.61454E-5 41499 0 8.06757E-6
17-67081292-C-A p.Gly1354Val missense ABCA6 1 82960 1.2054E-5 41480 0 8.1078E-6
17-67081293-C-A p.Gly1354Cys missense ABCA6 2 82960 2.4108E-5 41480 0 NA
17-67081304-C-T p.Ser1350Asn missense ABCA6 1 82940 1.20569E-5 41470 0 NA
17-67081310-C-A p.Gly1348Val missense ABCA6 10 82898 1.2063E-4 41449 0 3.18959E-4
17-67081319-T-G p.Glu1345Ala missense ABCA6 1 82784 1.20796E-5 41392 0 4.20907E-6
17-67081325-TA-T c.4030-3delT splice_region ABCA6 1 82682 1.20945E-5 41341 0 6.39754E-5
17-67081693-TAGTCTTACAAAGATATAATCTATACGTATCATGAAATTCCTGTTTTGGAAATGGAAACCATTTCC-T c.4029+8_4029+72delGGAAATGGTTTCCATTTCCAAAACAGGAATTTCATGATACGTATAGATTATATCTTTGTAAGACT splice_region ABCA6 1 72664 1.3762E-5 36332 0 NA
17-67081773-G-A p.Ala1341Val missense ABCA6 1 82402 1.21356E-5 41201 0 1.59678E-5
17-67081787-G-T p.Ile1336Ile synonymous ABCA6 1 82490 1.21227E-5 41245 0 3.30213E-5
17-67081810-A-G p.Ser1329Pro missense ABCA6 3 82466 3.63786E-5 41233 0 4.39736E-5
17-67081811-T-C p.Ser1328Ser synonymous ABCA6 5 82472 6.06266E-5 41236 0 8.25191E-6
17-67081829-A-T p.Asn1322Lys missense ABCA6 3 82390 3.64122E-5 41195 0 NA
17-67081830-T-C p.Asn1322Ser missense ABCA6 47083 81156 0.580154 40578 14343 0.594375
17-67081835-T-C p.Gly1320Gly synonymous ABCA6 1 82320 1.21477E-5 41160 0 NA
17-67081841-C-A p.Leu1318Phe missense ABCA6 9 82236 1.09441E-4 41118 0 1.59561E-4
17-67081859-TGAAA-T c.3938-6_3938-3delTTTC splice_region ABCA6 12 81878 1.4656E-4 40939 0 1.50525E-4
17-67081862-A-C c.3938-5T>G splice_region ABCA6 2 81836 2.44391E-5 40918 0 1.22054E-5
17-67082756-G-A c.3937+3C>T splice_region ABCA6 1 81790 1.22264E-5 40895 0 8.26966E-6
17-67082758-C-A c.3937+1G>T splice_donor ABCA6 1 81784 1.22273E-5 40892 0 NA
17-67082763-T-C p.Gln1311Gln synonymous ABCA6 2 81868 2.44296E-5 40934 0 4.12861E-5
17-67082770-C-A p.Cys1309Phe missense ABCA6 1 81978 1.21984E-5 40989 0 NA
17-67082774-A-G p.Phe1308Leu missense ABCA6 1 82092 1.21815E-5 41046 0 6.3861E-5
17-67082787-T-C p.Ala1303Ala synonymous ABCA6 354 82248 0.00430406 41124 1 0.015625
17-67082789-C-T p.Ala1303Thr missense ABCA6 1 82280 1.21536E-5 41140 0 7.96654E-6
17-67082799-C-A p.Lys1299Asn missense ABCA6 1 82320 1.21477E-5 41160 0 2.39038E-5
17-67082803-T-C p.Lys1298Arg missense ABCA6 1 82312 1.21489E-5 41156 0 7.96514E-6
17-67082807-T-A p.Arg1297Trp missense ABCA6 4 82286 4.86109E-5 41143 0 6.38081E-5
17-67082816-A-G p.Phe1294Leu missense ABCA6 1 82184 1.21678E-5 41092 0 NA
17-67082817-G-A p.Cys1293Cys synonymous ABCA6 1 82172 1.21696E-5 41086 0 8.24729E-6
17-67082837-C-A p.Ala1287Ser missense ABCA6 1 82034 1.21901E-5 41017 0 NA
17-67082846-T-C p.Lys1284Glu missense ABCA6 1 81778 1.22282E-5 40889 0 NA
17-67082847-G-A p.His1283His synonymous ABCA6 1 81752 1.22321E-5 40876 0 8.25518E-6
17-67082858-T-C p.Ser1280Gly missense ABCA6 1 81408 1.22838E-5 40704 0 NA
17-67082859-G-A p.Ala1279Ala synonymous ABCA6 361 81348 0.00443772 40674 13 0.00906827
17-67082866-AT-A p.Ile1277fs frameshift ABCA6 17 81150 2.09489E-4 40575 0 9.60738E-5
17-67082870-C-T p.Val1276Ile missense ABCA6 55 81084 6.78309E-4 40542 0 0.0015949
17-67083485-C-CT c.3819+8_3819+9insA splice_region ABCA6 1 83078 1.20369E-5 41539 0 NA
17-67083486-T-A c.3819+8A>T splice_region ABCA6 2 83086 2.40714E-5 41543 0 8.25341E-6
17-67083491-T-C c.3819+3A>G splice_region ABCA6 1 83108 1.20325E-5 41554 0 NA
17-67083496-C-T p.Glu1273Lys missense+splice_region ABCA6 122 83120 0.00146776 41560 0 0.00366452
17-67083496-C-CTA p.Glu1273fs frameshift ABCA6 1 83124 1.20302E-5 41562 0 NA
17-67083498-T-TTGTGGGCAGAACATAATTCAA p.Asp1272delinsValGluLeuCysSerAlaHisAsn conservative_inframe_insertion ABCA6 1 83116 1.20314E-5 41558 0 NA
17-67083499-C-A p.Asp1272Tyr missense ABCA6 1 83124 1.20302E-5 41562 0 3.99377E-6
17-67083502-A-C p.Leu1271Val missense ABCA6 1 83122 1.20305E-5 41561 0 NA
17-67083506-T-C p.Ser1269Ser synonymous ABCA6 1 83136 1.20285E-5 41568 0 NA
17-67083511-T-C p.Thr1268Ala missense ABCA6 1 83140 1.20279E-5 41570 0 NA
17-67083521-A-C p.Thr1264Thr synonymous ABCA6 2 83156 2.40512E-5 41578 0 8.24035E-6
17-67083526-C-T p.Ala1263Thr missense ABCA6 1 83174 1.2023E-5 41587 0 NA
17-67083565-C-T p.Asp1250Asn missense ABCA6 4 83212 4.807E-5 41606 0 1.19382E-5
17-67083567-A-G p.Ile1249Thr missense ABCA6 1 83200 1.20192E-5 41600 0 3.18715E-5
17-67083570-G-A p.Pro1248Leu missense ABCA6 1 83208 1.20181E-5 41604 0 NA
17-67083591-G-A p.Ala1241Val missense ABCA6 2 83208 2.40361E-5 41604 0 7.96128E-6
17-67083592-C-G p.Ala1241Pro missense ABCA6 1 83210 1.20178E-5 41605 0 NA
17-67083598-T-A p.Arg1239* stop_gained ABCA6 2 83206 2.40367E-5 41603 0 NA
17-67083603-T-TG p.Gln1237fs frameshift ABCA6 1 83192 1.20204E-5 41596 0 NA
17-67083603-T-TGG p.Gln1237fs frameshift ABCA6 2 83202 2.40379E-5 41601 0 NA
17-67083603-T-C p.Gln1237Arg missense ABCA6 2 83202 2.40379E-5 41601 0 6.25E-4
17-67083620-G-A c.3699-6C>T splice_region ABCA6 1 83172 1.20233E-5 41586 0 3.99278E-6
17-67084310-G-GA p.Arg1233fs frameshift ABCA6 1 82800 1.20773E-5 41400 0 NA
17-67084320-T-C p.Asp1229Gly missense ABCA6 1 82862 1.20683E-5 41431 0 NA
17-67084326-C-T p.Arg1227Gln missense ABCA6 2 82900 2.41255E-5 41450 0 0.00100806
17-67084327-G-A p.Arg1227* stop_gained ABCA6 6 82888 7.23868E-5 41444 0 1.91192E-4
17-67084341-C-A p.Gly1222Val missense ABCA6 2 82948 2.41115E-5 41474 0 3.18593E-5
17-67084357-T-C p.Met1217Val missense ABCA6 1 82968 1.20528E-5 41484 0 1.71886E-5
17-67084359-C-T p.Cys1216Tyr missense ABCA6 1 82966 1.20531E-5 41483 0 8.62114E-6
17-67084360-A-C p.Cys1216Gly missense ABCA6 58 82964 6.99098E-4 41482 1 0.008125
17-67084361-T-C p.Arg1215Arg synonymous ABCA6 1 82960 1.2054E-5 41480 0 NA
17-67084376-G-A p.Phe1210Phe synonymous ABCA6 2 82890 2.41284E-5 41445 0 2.81208E-5
17-67084379-T-C p.Leu1209Leu synonymous ABCA6 2 82874 2.4133E-5 41437 0 1.20422E-5
17-67084381-G-C p.Leu1209Val missense ABCA6 1 82882 1.20653E-5 41441 0 NA
17-67084404-G-A c.3607-5C>T splice_region ABCA6 1 82612 1.21048E-5 41306 0 9.36698E-6
17-67084407-C-A c.3607-8G>T splice_region ABCA6 1 82518 1.21186E-5 41259 0 NA
17-67085605-C-G c.3606+1G>C splice_donor ABCA6 1 82924 1.20592E-5 41462 0 NA
17-67085614-A-T p.Cys1200Ser missense ABCA6 1 82980 1.20511E-5 41490 0 NA
17-67085629-T-C p.Thr1195Ala missense ABCA6 1 83032 1.20435E-5 41516 0 6.37186E-5
17-67085639-T-C p.Glu1191Glu synonymous ABCA6 1 83064 1.20389E-5 41532 0 3.18431E-5
17-67085652-T-C p.Glu1187Gly missense ABCA6 1 83034 1.20433E-5 41517 0 NA
17-67087286-C-G p.Val1176Leu missense+splice_region ABCA6 4 82960 4.8216E-5 41480 0 2.5244E-5
17-67087290-C-T p.Leu1174Leu synonymous ABCA6 1 82976 1.20517E-5 41488 0 8.39955E-6
17-67087313-A-C p.Leu1167Val missense ABCA6 5 83040 6.02119E-5 41520 0 3.82117E-4
17-67087317-A-G p.Tyr1165Tyr synonymous ABCA6 1 83058 1.20398E-5 41529 0 4.01452E-6
17-67087320-T-A p.Ser1164Ser synonymous ABCA6 1 83070 1.2038E-5 41535 0 NA
17-67087329-C-A p.Leu1161Phe missense ABCA6 1 83060 1.20395E-5 41530 0 NA
17-67087335-C-T p.Met1159Ile missense ABCA6 2 83054 2.40807E-5 41527 0 1.74433E-4
17-67087338-G-C p.Thr1158Thr synonymous ABCA6 1 83044 1.20418E-5 41522 0 8.30413E-6
17-67087356-T-C p.Leu1152Leu synonymous ABCA6 391 83028 0.00470925 41514 6 0.00812205
17-67087366-T-C p.His1149Arg missense ABCA6 1 83046 1.20415E-5 41523 0 NA
17-67087392-G-C p.Ile1140Met missense ABCA6 1 82952 1.20552E-5 41476 0 6.25E-4
17-67087394-T-C p.Ile1140Val missense ABCA6 6 82942 7.23397E-5 41471 0 7.47086E-5
17-67087396-G-A p.Thr1139Ile missense ABCA6 2 82916 2.41208E-5 41458 0 NA
17-67087399-G-A p.Ser1138Phe missense ABCA6 1 82896 1.20633E-5 41448 0 NA
17-67087403-C-T p.Ala1137Thr missense+splice_region ABCA6 1 82852 1.20697E-5 41426 0 NA
17-67092373-A-G c.3408+8T>C splice_region ABCA6 1 77778 1.28571E-5 38889 0 1.35117E-5
17-67092391-TA-T p.Tyr1133fs frameshift ABCA6 1 78622 1.27191E-5 39311 0 NA
17-67092406-C-T p.Gly1128Asp missense ABCA6 4 79274 5.04579E-5 39637 1 3.18613E-5
17-67092422-T-A p.Arg1123Trp missense ABCA6 1 79698 1.25474E-5 39849 0 2.32286E-5
17-67092427-C-T p.Arg1121His missense ABCA6 45 79208 5.68124E-4 39604 0 0.00252525
17-67092428-G-A p.Arg1121Cys missense ABCA6 6 79450 7.55192E-5 39725 0 9.59447E-5
17-67092432-A-C p.Ile1119Met missense ABCA6 1 79826 1.25272E-5 39913 0 NA
17-67092452-TGAA-T p.Phe1112del conservative_inframe_deletion ABCA6 1 79796 1.2532E-5 39898 0 NA
17-67092469-G-C p.Ala1107Gly missense ABCA6 2 79234 2.52417E-5 39617 0 0.00188206
17-67092472-G-C p.Ala1106Gly missense ABCA6 3 79198 3.78797E-5 39599 0 1.59439E-4
17-67092477-A-G p.Gly1104Gly synonymous ABCA6 3 79236 3.78616E-5 39618 0 9.34824E-6
17-67092478-C-T p.Gly1104Asp missense ABCA6 1 79092 1.26435E-5 39546 0 NA
17-67092484-G-A p.Thr1102Ile missense ABCA6 2 78968 2.53267E-5 39484 0 5.12421E-6
17-67092484-G-C p.Thr1102Ser missense ABCA6 1 78968 1.26634E-5 39484 0 NA
17-67092489-T-A p.Ile1100Ile synonymous ABCA6 3 79052 3.79497E-5 39526 1 2.96004E-5
17-67092808-C-T p.Met1085Ile missense ABCA6 1 81460 1.2276E-5 40730 0 8.5282E-6
17-67092815-T-C p.Glu1083Gly missense ABCA6 1 81540 1.22639E-5 40770 0 NA
17-67092818-A-T p.Ile1082Lys missense ABCA6 2 81616 2.4505E-5 40808 0 NA
17-67092819-T-C p.Ile1082Val missense ABCA6 1 81616 1.22525E-5 40808 0 6.39018E-5
17-67092833-T-C p.Tyr1077Cys missense ABCA6 1 81958 1.22014E-5 40979 0 5.03525E-4
17-67092835-C-T p.Met1076Ile missense ABCA6 1 82142 1.2174E-5 41071 0 5.08397E-5
17-67092840-A-G p.Leu1075Leu synonymous ABCA6 1 82220 1.21625E-5 41110 0 3.19305E-5
17-67092844-G-T p.Leu1073Leu synonymous ABCA6 5 82268 6.0777E-5 41134 0 NA
17-67092846-G-T p.Leu1073Ile missense ABCA6 1 82302 1.21504E-5 41151 0 NA
17-67092861-A-C p.Phe1068Val missense ABCA6 1 82414 1.21339E-5 41207 0 NA
17-67092867-C-T p.Val1066Ile missense ABCA6 4 82394 4.85472E-5 41197 0 3.22123E-5
17-67092868-G-T p.Asp1065Glu missense ABCA6 1 82334 1.21457E-5 41167 0 NA
17-67092882-G-T p.Gln1061Lys missense ABCA6 2 82534 2.42324E-5 41267 0 NA
17-67092883-C-T p.Gly1060Gly synonymous ABCA6 1 82510 1.21197E-5 41255 0 NA
17-67092887-C-T p.Cys1059Tyr missense ABCA6 59 82474 7.15377E-4 41237 0 6.79216E-4
17-67092889-C-T p.Trp1058* stop_gained ABCA6 1 82456 1.21277E-5 41228 0 NA
17-67092892-G-C p.Tyr1057* stop_gained ABCA6 1 82406 1.2135E-5 41203 0 8.35603E-6
17-67092903-T-A p.Thr1054Ser missense ABCA6 1 82288 1.21524E-5 41144 0 NA
17-67092905-T-C p.Tyr1053Cys missense ABCA6 4 82224 4.86476E-5 41112 0 1.61488E-4
17-67092925-C-T p.Gln1046Gln synonymous ABCA6 368 81416 0.00452 40708 13 0.00920744
17-67092929-G-A p.Ser1045Phe missense ABCA6 36 81298 4.42815E-4 40649 0 4.00041E-4
17-67092935-G-C p.Ala1043Gly missense ABCA6 1 81064 1.23359E-5 40532 0 8.6881E-6
17-67092936-C-T p.Ala1043Thr missense ABCA6 9 81084 1.10996E-4 40542 0 0.00188679
17-67092939-T-C p.Asn1042Asp missense ABCA6 2 81100 2.46609E-5 40550 0 9.70748E-5
17-67092944-T-A c.3121-2A>T splice_acceptor ABCA6 1 80738 1.23857E-5 40369 0 NA
17-67092948-TA-T c.3121-7delT splice_region ABCA6 52 73418 7.08273E-4 36709 1 0.0751889
17-67092948-T-TA c.3121-7_3121-6insT splice_region ABCA6 32 78124 4.09605E-4 39062 0 0.0157741
17-67092948-T-TAA c.3121-7_3121-6insTT splice_region ABCA6 1 80550 1.24146E-5 40275 0 5.58173E-5
17-67092949-A-T c.3121-7T>A splice_region ABCA6 2 80414 2.48713E-5 40207 0 1.90201E-5
17-67094069-C-G p.Asp1038His missense ABCA6 1 82608 1.21054E-5 41304 0 8.87138E-6
17-67094074-A-G p.Ile1036Thr missense ABCA6 1 82664 1.20972E-5 41332 0 NA
17-67094074-A-T p.Ile1036Asn missense ABCA6 1 82664 1.20972E-5 41332 0 4.26694E-6
17-67094075-T-C p.Ile1036Val missense ABCA6 10 82678 1.20951E-4 41339 0 6.37024E-5
17-67094076-G-A p.Ser1035Ser synonymous ABCA6 1 82670 1.20963E-5 41335 0 NA
17-67094095-G-A p.Pro1029Leu missense ABCA6 1 82846 1.20706E-5 41423 0 NA
17-67094096-G-C p.Pro1029Ala missense ABCA6 1 82834 1.20723E-5 41417 0 NA
17-67094105-T-C p.Ser1026Gly missense ABCA6 1 82866 1.20677E-5 41433 0 NA
17-67094106-A-T p.Cys1025* stop_gained ABCA6 1 82852 1.20697E-5 41426 0 NA
17-67094107-C-T p.Cys1025Tyr missense ABCA6 3 82884 3.61952E-5 41442 0 6.37633E-5
17-67094120-A-G p.Phe1021Leu missense ABCA6 1 82940 1.20569E-5 41470 0 1.60538E-5
17-67094124-GA-G p.Phe1019fs frameshift ABCA6 1 82946 1.2056E-5 41473 0 8.44252E-6
17-67094124-G-GAA p.Leu1020fs frameshift ABCA6 1 82946 1.2056E-5 41473 0 NA
17-67094139-C-T p.Pro1014Pro synonymous ABCA6 1 82948 1.20557E-5 41474 0 3.43731E-5
17-67094140-GGCAACCCAGTCCA-G p.Trp1010fs frameshift ABCA6 1 82928 1.20587E-5 41464 0 3.18573E-5
17-67094140-G-A p.Pro1014Leu missense ABCA6 1 82928 1.20587E-5 41464 0 3.18573E-5
17-67094146-C-A p.Gly1012Val missense ABCA6 4 82912 4.82439E-5 41456 0 3.18552E-5
17-67094147-C-A p.Gly1012Trp missense ABCA6 11 82914 1.32668E-4 41457 0 3.8219E-4
17-67094163-G-A p.His1006His synonymous ABCA6 2 82812 2.41511E-5 41406 0 NA
17-67094169-C-T c.3013-1G>A splice_acceptor ABCA6 1 82538 1.21156E-5 41269 0 NA
17-67094449-T-C n.278+7A>G splice_region ABCA6 2 17484 1.1439E-4 8742 0 NA
17-67096937-C-A c.3012+1G>T splice_donor ABCA6 1 82872 1.20668E-5 41436 0 NA
17-67096947-T-C p.Pro1001Pro synonymous ABCA6 1 82888 1.20645E-5 41444 0 8.42531E-6
17-67096950-G-A p.Ser1000Ser synonymous ABCA6 1 82888 1.20645E-5 41444 0 8.40492E-6
17-67096953-T-C p.Ser999Ser synonymous ABCA6 1 82896 1.20633E-5 41448 0 NA
17-67096954-GA-TT p.Ser999Lys missense ABCA6 1 82896 1.20633E-5 41448 0 NA
17-67096959-A-T p.Ile997Ile synonymous ABCA6 1 82894 1.20636E-5 41447 0 NA
17-67096963-C-A p.Arg996Leu missense ABCA6 1 82906 1.20619E-5 41453 0 1.66736E-5
17-67096964-G-A p.Arg996* stop_gained ABCA6 2 82906 2.41237E-5 41453 0 3.18552E-5
17-67096966-A-G p.Ile995Thr missense ABCA6 1 82930 1.20584E-5 41465 0 3.1835E-5
17-67096976-T-G p.Thr992Pro missense ABCA6 8 82948 9.6446E-5 41474 0 2.54664E-4
17-67096996-A-G p.Leu985Pro missense ABCA6 3 82942 3.61699E-5 41471 0 2.79606E-5
17-67096999-C-T p.Gly984Glu missense ABCA6 2 82932 2.41161E-5 41466 0 NA
17-67097009-T-A p.Ile981Phe missense ABCA6 1 82944 1.20563E-5 41472 0 1.65492E-5
17-67097011-A-G p.Ile980Thr missense ABCA6 1 82946 1.2056E-5 41473 0 3.1837E-5
17-67097018-T-C p.Met978Val missense ABCA6 31 82924 3.73836E-4 41462 0 5.41194E-4
17-67097025-T-C p.Pro975Pro synonymous ABCA6 1 82898 1.2063E-5 41449 0 7.99162E-6
17-67097038-A-T p.Leu971* stop_gained ABCA6 1 82820 1.20744E-5 41410 0 NA
17-67097051-T-C p.Asn967Asp missense ABCA6 1 82734 1.20869E-5 41367 0 1.66182E-5
17-67097073-A-G p.Asp959Asp splice_region+synonymous ABCA6 1 82350 1.21433E-5 41175 0 NA
17-67098969-A-G c.2874+7T>C splice_region ABCA6 1 81790 1.22264E-5 40895 0 NA
17-67098975-C-T c.2874+1G>A splice_donor ABCA6 1 81826 1.22211E-5 40913 0 NA
17-67099005-C-T p.Gly949Arg missense ABCA6 2 82158 2.43433E-5 41079 0 2.5397E-5
17-67099016-A-G p.Leu945Pro missense ABCA6 2 82244 2.43179E-5 41122 0 1.26496E-5
17-67099024-A-C p.Thr942Thr synonymous ABCA6 2 82252 2.43155E-5 41126 0 1.71239E-5
17-67099028-C-A p.Gly941Val missense ABCA6 1 82252 1.21578E-5 41126 0 NA
17-67099034-C-A p.Arg939Ile missense ABCA6 51 82258 6.2E-4 41129 0 0.00178606
17-67099035-T-C p.Arg939Gly missense ABCA6 2 82270 2.43102E-5 41135 0 9.5584E-5
17-67099049-T-C p.Asp934Gly missense ABCA6 1 82162 1.21711E-5 41081 0 3.18634E-5
17-67099050-C-G p.Asp934His missense ABCA6 3 82138 3.65239E-5 41069 0 1.59388E-4
17-67099057-C-A p.Leu931Phe missense ABCA6 1 82028 1.2191E-5 41014 0 1.27616E-4
17-67099061-A-G p.Leu930Pro missense ABCA6 1 81996 1.21957E-5 40998 0 3.18613E-5
17-67099063-T-C p.Ile929Met missense ABCA6 1 81924 1.22064E-5 40962 0 2.72114E-5
17-67099067-T-G p.Asn928Thr missense ABCA6 4 81884 4.88496E-5 40942 0 3.18593E-5
17-67099069-T-C p.Gln927Gln synonymous ABCA6 1 81856 1.22166E-5 40928 0 9.13175E-6
17-67099082-G-T p.Ser923* stop_gained ABCA6 2 81442 2.45574E-5 40721 0 NA
17-67101600-C-T c.2740+3G>A splice_region ABCA6 1 82890 1.20642E-5 41445 0 NA
17-67101611-T-C p.Asn911Ser missense ABCA6 5 83064 6.01946E-5 41532 0 8.68417E-6
17-67101619-C-A p.Leu908Phe missense ABCA6 2 83064 2.40778E-5 41532 0 1.70692E-5
17-67101628-G-C p.Thr905Thr synonymous ABCA6 2 83108 2.40651E-5 41554 0 3.18674E-5
17-67101632-C-T p.Arg904His missense ABCA6 2 83084 2.4072E-5 41542 0 6.37552E-5
17-67101633-G-A p.Arg904Cys missense ABCA6 6 83096 7.22056E-5 41548 0 3.18593E-5
17-67101644-G-T p.Pro900His missense ABCA6 1 83120 1.20308E-5 41560 0 NA
17-67101655-A-G p.Pro896Pro synonymous ABCA6 1 83092 1.20349E-5 41546 0 NA
17-67101659-G-A p.Ser895Phe missense ABCA6 2 83076 2.40743E-5 41538 0 2.51231E-5
17-67101661-G-A p.Leu894Leu synonymous ABCA6 163 83072 0.00196215 41536 1 0.00388708
17-67101675-C-T p.Glu890Lys missense ABCA6 4 83042 4.81684E-5 41521 0 1.99787E-5
17-67101676-G-A p.Asn889Asn synonymous ABCA6 4 83034 4.8173E-5 41517 0 NA
17-67101677-T-C p.Asn889Ser missense ABCA6 1 83046 1.20415E-5 41523 0 8.37381E-6
17-67101693-C-A p.Asp884Tyr missense ABCA6 1 82906 1.20619E-5 41453 0 1.60068E-5
17-67101694-G-T p.Ile883Ile synonymous ABCA6 113 82884 0.00136335 41442 1 8.5696E-4
17-67101694-G-A p.Ile883Ile synonymous ABCA6 1 82890 1.20642E-5 41445 0 5.20583E-5
17-67101712-A-G p.Ala877Ala synonymous ABCA6 1 82598 1.21068E-5 41299 0 8.35687E-6
17-67101718-C-T p.Met875Ile missense ABCA6 66195 77570 0.853358 38785 29151 0.880829
17-67101721-T-A p.Ile874Ile synonymous ABCA6 2 82324 2.42943E-5 41162 0 1.91119E-4
17-67101738-A-C p.Leu869Val missense ABCA6 1 81880 1.2213E-5 40940 0 NA
17-67101739-A-G p.Pro868Pro synonymous ABCA6 2 81872 2.44284E-5 40936 0 8.56267E-6
17-67101739-AG-A p.Pro868fs frameshift ABCA6 1 81872 1.22142E-5 40936 0 NA
17-67101750-C-T p.Ala865Thr missense ABCA6 1 81454 1.22769E-5 40727 0 9.55243E-5
17-67101750-C-A p.Ala865Ser missense ABCA6 1 81454 1.22769E-5 40727 0 NA
17-67101751-G-A p.Ile864Ile synonymous ABCA6 1 81400 1.2285E-5 40700 0 3.18857E-5
17-67101751-G-T p.Ile864Ile synonymous ABCA6 2 81400 2.457E-5 40700 0 8.69474E-6
17-67101765-A-G p.Leu860Leu synonymous ABCA6 1 80952 1.2353E-5 40476 0 8.95881E-6
17-67101766-T-C p.Leu859Leu synonymous ABCA6 2 80910 2.47188E-5 40455 0 1.37043E-5
17-67101771-T-C c.2574-2A>G splice_acceptor ABCA6 1 80666 1.23968E-5 40333 0 9.56023E-5
17-67101772-A-C c.2574-3T>G splice_region ABCA6 1 80630 1.24023E-5 40315 0 4.70557E-6
17-67101777-A-G c.2574-8T>C splice_region ABCA6 13 80406 1.61679E-4 40203 0 1.59256E-4
17-67102166-C-T c.2573+3G>A splice_region ABCA6 8 82454 9.70238E-5 41227 0 9.55779E-5
17-67102171-G-C p.Thr857Thr splice_region+synonymous ABCA6 3 82458 3.63822E-5 41229 0 3.18593E-5
17-67102178-A-G p.Leu855Ser missense ABCA6 1 82564 1.21118E-5 41282 0 NA
17-67102180-C-G p.Val854Val synonymous ABCA6 4 82596 4.84285E-5 41298 0 6.36862E-5
17-67102185-T-C p.Lys853Glu missense ABCA6 2 82630 2.42043E-5 41315 0 5.04541E-4
17-67102189-T-G p.Gln851His missense ABCA6 1 82648 1.20995E-5 41324 0 NA
17-67102193-C-T p.Arg850His missense ABCA6 2 82626 2.42055E-5 41313 0 9.55353E-5
17-67102194-G-A p.Arg850Cys missense ABCA6 2 82634 2.42031E-5 41317 0 5.03525E-4
17-67102196-T-C p.Lys849Arg missense ABCA6 1 82670 1.20963E-5 41335 0 3.1839E-5
17-67102211-C-T p.Arg844His missense ABCA6 9 82692 1.08838E-4 41346 0 9.09361E-5
17-67102218-G-A p.Arg842Trp missense ABCA6 3 82686 3.62818E-5 41343 0 6.36902E-5
17-67102219-T-A p.Ala841Ala synonymous ABCA6 5 82698 6.0461E-5 41349 0 7.43372E-5
17-67102227-C-A p.Ala839Ser missense ABCA6 2 82722 2.41774E-5 41361 0 2.39414E-5
17-67102244-C-G p.Trp833Ser missense ABCA6 3 82742 3.62573E-5 41371 0 1.19615E-5
17-67102249-G-T p.Gly831Gly synonymous ABCA6 2 82756 2.41674E-5 41378 0 1.99364E-5
17-67102255-GTCAC-G p.Ser828fs frameshift ABCA6 2 82774 2.41622E-5 41387 0 NA
17-67102258-A-G p.Ser828Ser synonymous ABCA6 1 82766 1.20823E-5 41383 0 3.98661E-6
17-67102295-G-A p.Ala816Val missense ABCA6 2 82810 2.41517E-5 41405 0 3.18451E-5
17-67102305-T-C p.Met813Val missense ABCA6 4 82818 4.82987E-5 41409 0 9.55292E-5
17-67102310-T-C p.Asn811Ser missense ABCA6 1 82778 1.20805E-5 41389 0 0.00100705
17-67102319-T-C p.Glu808Gly missense ABCA6 1 82714 1.20899E-5 41357 0 NA
17-67102320-C-T p.Glu808Lys missense ABCA6 5 82716 6.04478E-5 41358 0 5.03525E-4
17-67102330-T-C p.Ile804Met missense ABCA6 1 82594 1.21074E-5 41297 0 NA
17-67102333-C-G p.Met803Ile missense ABCA6 78 82550 9.44882E-4 41275 0 0.00238869
17-67102341-C-T p.Val801Met missense ABCA6 1 82448 1.21289E-5 41224 0 3.22721E-5
17-67102347-C-T p.Glu799Lys missense ABCA6 3 82332 3.64378E-5 41166 0 2.83739E-5
17-67102348-G-A p.Phe798Phe synonymous ABCA6 3 82294 3.64547E-5 41147 0 1.91241E-4
17-67102356-T-C c.2390-4A>G splice_region ABCA6 1 82168 1.21702E-5 41084 0 4.05393E-6
17-67103831-C-T c.2389+6G>A splice_region ABCA6 1 81276 1.23038E-5 40638 0 NA
17-67103837-C-T p.Asp797Asn missense+splice_region ABCA6 1 81412 1.22832E-5 40706 0 NA
17-67103844-G-A p.Ile794Ile synonymous ABCA6 2 81520 2.45339E-5 40760 0 2.47987E-5
17-67103846-T-C p.Ile794Val missense ABCA6 1 81620 1.22519E-5 40810 0 8.26583E-6
17-67103848-G-A p.Thr793Ile missense ABCA6 45 81622 5.51322E-4 40811 0 0.001115
17-67103854-T-C p.Gln791Arg missense ABCA6 2 81742 2.44672E-5 40871 0 3.30557E-5
17-67103869-A-T p.Met786Lys missense ABCA6 1 81840 1.2219E-5 40920 0 3.996E-6
17-67103877-T-C p.Glu783Glu synonymous ABCA6 5 81902 6.10486E-5 40951 0 1.32297E-4
17-67103894-T-C p.Met778Val missense ABCA6 3 81826 3.66632E-5 40913 0 NA
17-67103911-G-A p.Thr772Ile missense ABCA6 3 81748 3.66981E-5 40874 0 8.30868E-6
17-67103924-C-T p.Asp768Asn missense ABCA6 1 81634 1.22498E-5 40817 0 NA
17-67103953-T-C p.Asp758Gly missense+splice_region ABCA6 2 81016 2.46865E-5 40508 0 NA
17-67103953-T-A p.Asp758Val missense+splice_region ABCA6 2 81016 2.46865E-5 40508 0 3.19509E-5
17-67103960-C-CA c.2273-8dupT splice_region ABCA6 5 80722 6.1941E-5 40361 0 8.78642E-5
17-67106943-T-C p.Pro757Pro splice_region+synonymous ABCA6 2 82850 2.414E-5 41425 0 3.38432E-5
17-67106979-T-C p.Val745Val synonymous ABCA6 1 83000 1.20482E-5 41500 0 NA
17-67106998-T-TGG p.Glu739fs frameshift ABCA6 1 82970 1.20525E-5 41485 0 NA
17-67107006-T-G p.Leu736Phe missense ABCA6 5 82924 6.02962E-5 41462 0 3.18329E-5
17-67107017-C-T p.Asp733Asn missense ABCA6 2 82838 2.41435E-5 41419 0 3.47596E-5
17-67107018-G-T p.Pro732Pro synonymous ABCA6 5 82806 6.03821E-5 41403 0 6.37064E-5
17-67107021-G-A p.Ile731Ile synonymous ABCA6 1 82808 1.20761E-5 41404 0 NA
17-67107023-T-C p.Ile731Val missense ABCA6 1 82794 1.20782E-5 41397 0 1.20002E-5
17-67107028-T-C p.His729Arg missense ABCA6 1 82762 1.20828E-5 41381 0 8.58811E-6
17-67107028-T-A p.His729Leu missense ABCA6 1 82762 1.20828E-5 41381 0 NA
17-67107057-G-T p.Asn719Lys missense ABCA6 31 82484 3.7583E-4 41242 0 6.25E-4
17-67107069-AT-A p.Asn715fs frameshift ABCA6 1 82252 1.21578E-5 41126 0 1.68107E-5
17-67107074-T-C p.Arg714Gly missense ABCA6 111 82142 0.00135132 41071 0 0.00277123
17-67107079-A-C p.Leu712* stop_gained ABCA6 5 81996 6.09786E-5 40998 0 1.7696E-5
17-67107083-T-C c.2133-2A>G splice_acceptor ABCA6 2 81914 2.44159E-5 40957 0 2.22448E-5
17-67108347-C-A p.Arg703Ser missense ABCA6 9 82498 1.09094E-4 41249 0 4.38474E-5
17-67108349-T-C p.Arg703Gly missense ABCA6 1 82526 1.21174E-5 41263 0 8.2496E-6
17-67108355-T-C p.Lys701Glu missense ABCA6 4 82456 4.85107E-5 41228 0 1.19592E-5
17-67108361-A-T p.Phe699Ile missense ABCA6 2 82440 2.42601E-5 41220 0 NA
17-67108362-C-G p.Met698Ile missense ABCA6 9614 82176 0.116993 41088 1115 0.167933
17-67108362-C-T p.Met698Ile missense ABCA6 8 82436 9.7045E-5 41218 0 6.9979E-4
17-67108364-T-C p.Met698Val missense ABCA6 3 82406 3.64051E-5 41203 0 1.91229E-4
17-67108365-A-G p.Ser697Ser synonymous ABCA6 2 82408 2.42695E-5 41204 0 0.00151057
17-67108383-C-T p.Leu691Leu synonymous ABCA6 1 82276 1.21542E-5 41138 0 NA
17-67108385-G-A p.Leu691Leu synonymous ABCA6 1 82246 1.21586E-5 41123 0 NA
17-67108390-C-A p.Gly689Val missense ABCA6 1 82198 1.21657E-5 41099 0 NA
17-67108393-T-C p.Asn688Ser missense ABCA6 22 82082 2.68025E-4 41041 0 6.69131E-4
17-67108395-G-T p.Ser687Ser synonymous ABCA6 3 82134 3.65257E-5 41067 0 3.99246E-6
17-67108398-C-T p.Met686Ile missense ABCA6 78 82096 9.50107E-4 41048 0 5.73577E-4
17-67108403-T-C p.Ile685Val missense ABCA6 2 82040 2.43784E-5 41020 0 3.99358E-5
17-67108406-C-G p.Val684Leu missense ABCA6 1 81996 1.21957E-5 40998 0 1.19918E-5
17-67108406-C-T p.Val684Met missense ABCA6 2 81996 2.43914E-5 40998 0 NA
17-67108409-TTC-T p.Arg682fs frameshift ABCA6 1 81928 1.22058E-5 40964 0 3.18634E-5
17-67108412-T-C p.Arg682Gly missense+splice_region ABCA6 1 81848 1.22178E-5 40924 0 1.20091E-5
17-67108413-A-T p.Asp681Glu missense+splice_region ABCA6 1 81778 1.22282E-5 40889 0 4.00247E-6
17-67108414-T-A p.Asp681Val missense+splice_region ABCA6 2 81772 2.44582E-5 40886 0 8.28226E-6
17-67109380-T-C p.Glu675Gly missense ABCA6 9 82162 1.0954E-4 41081 0 3.18593E-5
17-67109383-T-C p.Asp674Gly missense ABCA6 3 82170 3.65097E-5 41085 0 6.37349E-5
17-67109387-T-C p.Met673Val missense ABCA6 2 82186 2.4335E-5 41093 0 NA
17-67109411-C-T p.Val665Met missense ABCA6 3 82176 3.6507E-5 41088 0 NA
17-67109413-T-C p.His664Arg missense ABCA6 16 82170 1.94718E-4 41085 0 6.05096E-4
17-67109413-T-A p.His664Leu missense ABCA6 1 82170 1.21699E-5 41085 0 4.14945E-6
17-67109413-T-G p.His664Pro missense ABCA6 1 82170 1.21699E-5 41085 0 NA
17-67109416-T-C p.Asp663Gly missense ABCA6 4 82156 4.86879E-5 41078 0 1.66069E-5
17-67109422-C-G p.Arg661Thr missense ABCA6 2 82156 2.43439E-5 41078 0 NA
17-67109424-A-G p.Arg660Arg synonymous ABCA6 1 82132 1.21755E-5 41066 0 NA
17-67109425-C-T p.Arg660His missense ABCA6 24 82128 2.92227E-4 41064 0 0.001875
17-67109426-G-A p.Arg660Cys missense ABCA6 1 82102 1.218E-5 41051 0 6.37227E-5
17-67109427-C-G p.Glu659Asp missense ABCA6 1 82112 1.21785E-5 41056 0 3.18492E-5
17-67109429-C-T p.Glu659Lys missense ABCA6 1 82092 1.21815E-5 41046 0 NA
17-67109435-G-T p.Leu657Met missense ABCA6 1 82070 1.21847E-5 41035 0 1.27776E-4
17-67109437-A-G p.Leu656Pro missense ABCA6 2 82058 2.4373E-5 41029 0 8.30151E-6
17-67109450-G-T p.Gln652Lys missense ABCA6 1 81950 1.22026E-5 40975 0 1.27462E-4
17-67109468-C-G p.Asp646His missense ABCA6 4 81836 4.88782E-5 40918 0 8.75335E-6
17-67109484-T-C p.Glu640Glu synonymous ABCA6 25 81748 3.05818E-4 40874 0 1.54015E-4
17-67109490-T-C p.Leu638Leu synonymous ABCA6 4 81716 4.895E-5 40858 0 4.38543E-6
17-67109493-A-G p.Leu637Leu synonymous ABCA6 4388 81614 0.0537653 40807 655 0.110173
17-67109756-T-C c.1902+3A>G splice_region ABCA6 1 83148 1.20267E-5 41574 0 NA
17-67109796-T-C p.Lys622Arg missense ABCA6 6 83196 7.21189E-5 41598 0 4.12991E-5
17-67109809-C-T p.Gly618Arg missense ABCA6 1 83156 1.20256E-5 41578 0 1.99268E-5
17-67109815-T-C p.Ser616Gly missense ABCA6 1 83128 1.20296E-5 41564 0 NA
17-67109821-G-A p.His614Tyr missense ABCA6 1 83114 1.20317E-5 41557 0 NA
17-67109827-C-G p.Ala612Pro missense ABCA6 2 83072 2.40755E-5 41536 0 NA
17-67109831-G-T p.Asn610Lys missense ABCA6 2 83028 2.40883E-5 41514 0 3.18552E-5
17-67109833-T-A p.Asn610Tyr missense ABCA6 5815 82916 0.0701312 41458 286 0.096875
17-67109842-T-A p.Ile607Phe missense ABCA6 1 82990 1.20496E-5 41495 0 NA
17-67109864-T-C p.Leu599Leu synonymous ABCA6 5 82784 6.03981E-5 41392 0 1.59266E-4
17-67109872-G-A p.Arg597* stop_gained ABCA6 1 82648 1.20995E-5 41324 0 6.37024E-5
17-67109878-C-T p.Val595Ile missense+splice_region ABCA6 1 82530 1.21168E-5 41265 0 3.18492E-5
17-67110903-C-T p.Glu594Glu splice_region+synonymous ABCA6 3 82776 3.62424E-5 41388 0 1.21759E-5
17-67110908-G-A p.Gln593* stop_gained ABCA6 1 82824 1.20738E-5 41412 0 3.18613E-5
17-67110917-C-T p.Glu590Lys missense ABCA6 1 82918 1.20601E-5 41459 0 NA
17-67110922-A-T p.Leu588Gln missense ABCA6 1 82944 1.20563E-5 41472 0 4.0149E-6
17-67110941-T-C p.Lys582Glu missense ABCA6 8 83008 9.63763E-5 41504 0 1.59347E-4
17-67110950-G-A p.Leu579Leu synonymous ABCA6 1 83008 1.2047E-5 41504 0 1.65104E-5
17-67110960-T-C p.Glu575Glu synonymous ABCA6 1 82964 1.20534E-5 41482 0 9.081E-5
17-67110968-C-T p.Val573Met missense ABCA6 1 82936 1.20575E-5 41468 0 3.18654E-5
17-67110969-GGTGA-G p.Leu571fs frameshift ABCA6 21 82940 2.53195E-4 41470 0 1.477E-4
17-67110984-T-C p.Gln567Gln synonymous ABCA6 2 82934 2.41156E-5 41467 0 8.25846E-6
17-67110991-T-C p.Asn565Ser missense ABCA6 36 82934 4.3408E-4 41467 0 2.83216E-4
17-67110996-T-G p.Gln563His missense ABCA6 1 82908 1.20616E-5 41454 0 NA
17-67111007-C-T p.Val560Ile missense ABCA6 15 82850 1.8105E-4 41425 0 6.7886E-5
17-67111008-G-A p.Gly559Gly synonymous ABCA6 7 82844 8.44962E-5 41422 0 1.27567E-4
17-67111012-G-A p.Thr558Ile missense ABCA6 1 82854 1.20694E-5 41427 0 NA
17-67111035-G-A p.Asp550Asp synonymous ABCA6 1 82826 1.20735E-5 41413 0 NA
17-67111040-G-T p.Gln549Lys missense ABCA6 3 82812 3.62266E-5 41406 0 4.00699E-6
17-67111041-C-T p.Met548Ile missense ABCA6 21 82798 2.53629E-4 41399 0 1.32979E-4
17-67111047-A-G p.Ser546Ser synonymous ABCA6 1 82760 1.20831E-5 41380 0 4.00959E-6
17-67111054-T-C p.Asn544Ser missense ABCA6 1 82704 1.20913E-5 41352 0 NA
17-67111063-T-C p.Tyr541Cys missense ABCA6 2 82664 2.41943E-5 41332 0 6.25E-4
17-67111065-G-A p.Ile540Ile synonymous ABCA6 393 82608 0.00475741 41304 1 0.0039177
17-67111066-A-T p.Ile540Asn missense ABCA6 5 82610 6.05254E-5 41305 0 2.02064E-5
17-67111067-T-G p.Ile540Leu missense ABCA6 1 82622 1.21033E-5 41311 0 NA
17-67111070-T-C p.Thr539Ala missense ABCA6 2 82582 2.42184E-5 41291 0 4.07631E-6
17-67111074-T-G p.Ser537Ser synonymous ABCA6 5 82474 6.06252E-5 41237 0 3.18451E-5
17-67111077-T-C p.Gly536Gly splice_region+synonymous ABCA6 2 82406 2.42701E-5 41203 0 NA
17-67111081-AAGAAT-A c.1607-8_1607-4delATTCT splice_region ABCA6 9 82332 1.09314E-4 41166 0 8.11981E-5
17-67111538-C-G p.Gly529Arg missense ABCA6 2 82384 2.42766E-5 41192 0 NA
17-67111541-T-C p.Asn528Asp missense ABCA6 2 82428 2.42636E-5 41214 0 8.26761E-6
17-67111550-T-A p.Asn525Tyr missense ABCA6 2 82564 2.42236E-5 41282 0 5.04032E-4
17-67111553-G-T p.Leu524Ile missense ABCA6 3 82570 3.63328E-5 41285 0 3.9953E-6
17-67111564-T-C p.Lys520Arg missense ABCA6 1 82628 1.21024E-5 41314 0 6.60884E-5
17-67111575-A-T p.Ser516Arg missense ABCA6 7 82636 8.47088E-5 41318 0 5.41505E-4
17-67111579-T-C p.His515Arg missense ABCA6 30 82614 3.63135E-4 41307 0 0.00100806
17-67111587-G-A p.Ile512Ile synonymous ABCA6 1 82582 1.21092E-5 41291 0 NA
17-67111593-C-T p.Thr510Thr synonymous ABCA6 5 82544 6.05738E-5 41272 0 9.56328E-5
17-67111594-G-A p.Thr510Met missense ABCA6 2 82526 2.42348E-5 41263 0 5.19514E-5
17-67111603-C-G p.Gly507Ala missense ABCA6 158 82472 0.0019158 41236 1 0.00462225
17-67111610-A-G p.Tyr505His missense ABCA6 1 82356 1.21424E-5 41178 0 8.28555E-6
17-67111611-T-G p.Ile504Ile synonymous ABCA6 1 82328 1.21465E-5 41164 0 6.00942E-5
17-67111611-T-C p.Ile504Met missense ABCA6 1 82328 1.21465E-5 41164 0 8.28583E-6
17-67111627-C-G p.Gly499Ala missense+splice_region ABCA6 4 81842 4.88747E-5 40921 0 NA
17-67111921-T-A n.135A>T splice_region ABCA6 1 6924 1.44425E-4 3462 0 NA
17-67114029-TTTTC-T c.1495+6_1495+9delGAAA splice_region ABCA6 2 81330 2.45912E-5 40665 0 8.43569E-6
17-67114033-C-T c.1495+6G>A splice_region ABCA6 1 81464 1.22754E-5 40732 0 NA
17-67114048-C-T p.Ala496Thr missense ABCA6 1 81852 1.22172E-5 40926 0 NA
17-67114065-T-C p.Lys490Arg missense ABCA6 10 81912 1.22082E-4 40956 0 5.04032E-4
17-67114067-T-C p.Gly489Gly synonymous ABCA6 2 81876 2.44272E-5 40938 0 NA
17-67114068-C-T p.Gly489Glu missense ABCA6 1 81862 1.22157E-5 40931 0 NA
17-67114079-C-T p.Lys485Lys synonymous ABCA6 1 81698 1.22402E-5 40849 0 6.40697E-5
17-67119372-G-A c.1436+8C>T splice_region ABCA6 12 76854 1.5614E-4 38427 0 NA
17-67119390-C-G p.Glu476Gln missense ABCA6 1 77954 1.28281E-5 38977 0 3.18654E-5
17-67119406-A-G p.Pro470Pro synonymous ABCA6 1 78472 1.27434E-5 39236 0 1.66981E-5
17-67119415-T-C p.Pro467Pro synonymous ABCA6 2 78922 2.53415E-5 39461 0 8.66844E-6
17-67119417-G-A p.Pro467Ser missense ABCA6 1 79058 1.26489E-5 39529 0 3.18613E-5
17-67119427-A-T p.Asp463Glu missense ABCA6 1 79188 1.26282E-5 39594 0 NA
17-67119427-A-G p.Asp463Asp synonymous ABCA6 2 79188 2.52564E-5 39594 0 8.31186E-6
17-67119448-A-G p.Asp456Asp synonymous ABCA6 2 80640 2.48016E-5 40320 0 3.18634E-5
17-67119448-A-T p.Asp456Glu missense ABCA6 1 80640 1.24008E-5 40320 0 8.30772E-6
17-67119452-A-T p.Ile455Asn missense ABCA6 3 80618 3.72125E-5 40309 0 8.30841E-6
17-67119455-T-C p.Glu454Gly missense ABCA6 8 80642 9.92039E-5 40321 0 1.27445E-4
17-67119467-A-G p.Val450Ala missense ABCA6 1 80778 1.23796E-5 40389 0 NA
17-67119478-A-T p.Thr446Thr synonymous ABCA6 1 80818 1.23735E-5 40409 0 3.32878E-5
17-67119479-G-C p.Thr446Ser missense ABCA6 1 80792 1.23775E-5 40396 0 NA
17-67119482-C-G p.Arg445Thr missense ABCA6 1 80734 1.23864E-5 40367 0 NA
17-67119484-T-C p.Gln444Gln synonymous ABCA6 1 80572 1.24113E-5 40286 0 3.19E-5
17-67119493-G-A p.Phe441Phe synonymous ABCA6 10 80100 1.24844E-4 40050 0 3.19264E-4
17-67119496-A-T p.Cys440* stop_gained ABCA6 1 80058 1.24909E-5 40029 0 3.19E-5
17-67119502-T-C p.Ser438Ser synonymous ABCA6 1 79994 1.25009E-5 39997 0 NA
17-67119505-T-G p.Ser437Ser synonymous ABCA6 84 79876 0.00105163 39938 1 0.003125
17-67119518-A-G p.Phe433Ser missense ABCA6 2 79088 2.52883E-5 39544 0 6.38855E-5
17-67119536-C-T p.Arg427His missense ABCA6 2 77768 2.57175E-5 38884 0 1.47266E-4
17-67119537-G-A p.Arg427Cys missense ABCA6 3 77676 3.8622E-5 38838 0 5.10499E-5
17-67119548-T-A p.Tyr423Phe missense+splice_region ABCA6 13 77308 1.68159E-4 38654 0 9.56755E-5
17-67119548-T-C p.Tyr423Cys missense+splice_region ABCA6 4 77308 5.17411E-5 38654 0 9.46163E-6
17-67121026-T-C c.1267+3A>G splice_region ABCA6 10 79650 1.25549E-4 39825 0 3.21089E-4
17-67121031-G-A p.Pro422Leu missense+splice_region ABCA6 1 79722 1.25436E-5 39861 0 3.21626E-5
17-67121039-T-C p.Lys419Lys synonymous ABCA6 3 79962 3.75178E-5 39981 0 NA
17-67121040-T-C p.Lys419Arg missense ABCA6 2 79962 2.50119E-5 39981 0 4.58278E-6
17-67121043-T-C p.Asp418Gly missense ABCA6 1 79968 1.2505E-5 39984 0 NA
17-67121045-A-G p.Phe417Phe synonymous ABCA6 2 80010 2.49969E-5 40005 0 NA
17-67121048-G-A p.Tyr416Tyr synonymous ABCA6 1 80138 1.24785E-5 40069 0 NA
17-67121049-T-A p.Tyr416Phe missense ABCA6 1 80172 1.24732E-5 40086 0 NA
17-67121054-T-A p.Ala414Ala synonymous ABCA6 2 80282 2.49122E-5 40141 0 NA
17-67121059-A-G p.Leu413Leu synonymous ABCA6 1 80236 1.24632E-5 40118 0 NA
17-67121060-T-C p.Leu412Leu synonymous ABCA6 21 80206 2.61826E-4 40103 0 3.84788E-4
17-67121062-G-T p.Leu412Ile missense ABCA6 1 80254 1.24604E-5 40127 0 5.69441E-5
17-67121065-A-ATATATTATAATT p.Tyr410_Leu411insAsnTyrAsnIle conservative_inframe_insertion ABCA6 1 80358 1.24443E-5 40179 0 NA
17-67121066-G-A p.Tyr410Tyr synonymous ABCA6 1 80328 1.2449E-5 40164 0 NA
17-67121070-A-G p.Ile409Thr missense ABCA6 2 80444 2.4862E-5 40222 0 NA
17-67121079-T-C p.Asp406Gly missense ABCA6 1 80316 1.24508E-5 40158 0 8.65314E-6
17-67121081-CA-C p.Leu405fs frameshift ABCA6 35 80326 4.35724E-4 40163 0 2.08332E-4
17-67121093-A-G p.Ser401Ser synonymous ABCA6 6 80354 7.46696E-5 40177 0 5.05051E-4
17-67121106-A-G p.Ile397Thr missense ABCA6 1 80224 1.24651E-5 40112 0 NA
17-67121109-A-G p.Met396Thr missense ABCA6 16 80186 1.99536E-4 40093 0 4.69444E-4
17-67121115-T-C p.Tyr394Cys missense ABCA6 1 80146 1.24772E-5 40073 0 3.20595E-5
17-67121121-T-C p.Asp392Gly missense ABCA6 1 79294 1.26113E-5 39647 0 3.20821E-5
17-67121128-A-G p.Ser390Pro missense ABCA6 1 78966 1.26637E-5 39483 0 1.40832E-5
17-67121131-G-A p.Pro389Ser missense ABCA6 1 78378 1.27587E-5 39189 0 2.53165E-5
17-67121148-C-G p.Gly383Ala missense ABCA6 2 77028 2.59646E-5 38514 0 3.2256E-5
17-67121166-A-C p.Leu377Arg missense ABCA6 1 75346 1.32721E-5 37673 0 NA
17-67121183-T-C c.1120-7A>G splice_region ABCA6 1 73982 1.35168E-5 36991 0 4.36758E-5
17-67124753-C-A c.1119+7G>T splice_region ABCA6 994 82586 0.0120359 41293 9 0.015
17-67124755-C-T c.1119+5G>A splice_region ABCA6 1 82700 1.20919E-5 41350 0 8.52311E-6
17-67124759-C-T c.1119+1G>A splice_donor ABCA6 1 82762 1.20828E-5 41381 0 NA
17-67124778-A-G p.Phe367Phe synonymous ABCA6 12 82890 1.4477E-4 41445 0 9.15797E-5
17-67124784-A-T p.Phe365Leu missense ABCA6 2 82904 2.41243E-5 41452 0 NA
17-67124801-T-A p.Asn360Tyr missense ABCA6 1 82938 1.20572E-5 41469 0 NA
17-67124835-A-T p.Tyr348* stop_gained ABCA6 1 82958 1.20543E-5 41479 0 NA
17-67124842-A-G p.Val346Ala missense ABCA6 5 82948 6.02787E-5 41474 0 5.77415E-5
17-67124857-C-T p.Cys341Tyr missense ABCA6 1 82926 1.20589E-5 41463 0 NA
17-67124863-C-G p.Trp339Ser missense ABCA6 1 82928 1.20587E-5 41464 0 8.24742E-6
17-67124888-C-T p.Val331Ile missense ABCA6 3 82926 3.61768E-5 41463 0 8.25369E-6
17-67124912-T-C p.Lys323Glu missense ABCA6 2 82760 2.41663E-5 41380 0 3.18674E-5
17-67124918-G-A p.Leu321Leu synonymous ABCA6 5 82702 6.0458E-5 41351 0 1.22627E-5
17-67124923-C-CAT p.Ser319fs frameshift ABCA6 4 82606 4.84226E-5 41303 0 2.86679E-4
17-67124929-A-T p.Leu317Gln missense ABCA6 1 82416 1.21336E-5 41208 0 NA
17-67124934-C-G p.Val315Val synonymous ABCA6 1 82156 1.2172E-5 41078 0 3.18552E-5
17-67124939-A-C p.Leu314Val missense ABCA6 1 82246 1.21586E-5 41123 0 3.18492E-5
17-67124945-C-T p.Val312Ile missense+splice_region ABCA6 3 81942 3.66113E-5 40971 0 4.35335E-6
17-67125743-C-G c.933+8G>C splice_region ABCA6 1 81832 1.22202E-5 40916 0 NA
17-67125766-T-TA p.Leu306fs frameshift ABCA6 13 82074 1.58394E-4 41037 0 3.40292E-5
17-67125767-A-T p.Leu306* stop_gained ABCA6 6 82098 7.30834E-5 41049 0 3.1955E-5
17-67125773-AAG-A p.Leu306fs frameshift ABCA6 2 82166 2.4341E-5 41083 0 2.4839E-5
17-67125790-C-A p.Met298Ile missense ABCA6 1 82184 1.21678E-5 41092 0 8.12064E-6
17-67125797-C-A p.Gly296Val missense ABCA6 27 82230 3.28347E-4 41115 0 2.89491E-4
17-67125803-A-G p.Met294Thr missense ABCA6 5 82258 6.07844E-5 41129 0 1.59256E-4
17-67125813-T-C p.Ile291Val missense ABCA6 1 82244 1.21589E-5 41122 0 NA
17-67125818-G-A p.Thr289Ile missense ABCA6 1 82202 1.21652E-5 41101 0 3.99779E-6
17-67125836-G-A p.Thr283Ile missense ABCA6 3 82182 3.65043E-5 41091 0 2.15004E-4
17-67125840-C-T p.Val282Ile missense ABCA6 53211 81258 0.65484 40629 17813 0.701128
17-67125853-A-G p.Ile277Ile synonymous ABCA6 3 82096 3.65426E-5 41048 0 3.61713E-5
17-67125881-C-A p.Gly268Val missense ABCA6 1 81604 1.22543E-5 40802 0 5.04032E-4
17-67125889-G-A p.Leu265Leu synonymous ABCA6 2 81350 2.45851E-5 40675 0 4.21813E-5
17-67125892-C-T p.Trp264* stop_gained ABCA6 4 81116 4.93121E-5 40558 0 1.69771E-5
17-67125893-CTAAA-C c.792-5_792-2delTTTA splice_acceptor ABCA6 104 81124 0.00128199 40562 0 0.00283946
17-67125900-A-G c.792-8T>C splice_region ABCA6 433 80750 0.00536223 40375 4 0.00847836
17-67129774-T-C c.791+8A>G splice_region ABCA6 1 82410 1.21345E-5 41205 0 NA
17-67129803-C-A p.Gly257Val missense ABCA6 1 82840 1.20715E-5 41420 0 NA
17-67129804-C-A p.Gly257Cys missense ABCA6 2 82836 2.41441E-5 41418 0 1.67107E-5
17-67129851-T-C p.Asn241Ser missense ABCA6 62 82928 7.47636E-4 41464 0 0.00191107
17-67129854-A-T p.Leu240His missense ABCA6 1 82928 1.20587E-5 41464 0 NA
17-67129858-A-T p.Ser239Thr missense ABCA6 3 82940 3.61707E-5 41470 0 6.36983E-5
17-67129869-A-G p.Val235Ala missense ABCA6 1 82950 1.20555E-5 41475 0 3.18431E-5
17-67129873-G-A p.Leu234Phe missense ABCA6 2 82976 2.41034E-5 41488 0 4.14573E-5
17-67129875-G-A p.Pro233Leu missense ABCA6 1 82988 1.20499E-5 41494 0 NA
17-67129888-G-A p.Leu229Phe missense ABCA6 2 83018 2.40912E-5 41509 0 3.18715E-4
17-67129893-A-T p.Phe227Tyr missense ABCA6 4 83028 4.81765E-5 41514 0 NA
17-67129905-A-C p.Phe223Cys missense ABCA6 1 83038 1.20427E-5 41519 0 8.28665E-6
17-67129908-A-G p.Met222Thr missense ABCA6 5 83032 6.02177E-5 41516 0 3.18471E-5
17-67129909-T-C p.Met222Val missense ABCA6 2 83026 2.40888E-5 41513 0 9.94695E-5
17-67129913-A-G p.Asn220Asn synonymous ABCA6 2 83024 2.40894E-5 41512 0 NA
17-67129916-G-T p.His219Gln missense ABCA6 3 83032 3.61306E-5 41516 0 8.28912E-6
17-67129917-TGAA-T p.Leu218del disruptive_inframe_deletion ABCA6 1 83022 1.2045E-5 41511 0 NA
17-67129926-T-G p.Asn216Thr missense ABCA6 6 83030 7.2263E-5 41515 0 6.38443E-4
17-67129934-T-C p.Ile213Met missense ABCA6 2 83026 2.40888E-5 41513 0 3.99087E-6
17-67129940-A-C p.Pro211Pro synonymous ABCA6 1 83022 1.2045E-5 41511 0 NA
17-67129947-G-C p.Thr209Arg missense ABCA6 2 83002 2.40958E-5 41501 0 3.18492E-5
17-67129961-A-G p.Ala204Ala synonymous ABCA6 1 82980 1.20511E-5 41490 0 NA
17-67129973-C-T p.Met200Ile missense ABCA6 1 82868 1.20674E-5 41434 0 3.18451E-5
17-67129981-C-T p.Glu198Lys missense ABCA6 2 82828 2.41464E-5 41414 0 NA
17-67129981-C-G p.Glu198Gln missense ABCA6 5 82826 6.03675E-5 41413 0 3.68762E-4
17-67129987-T-C p.Met196Val missense ABCA6 2 82760 2.41663E-5 41380 0 8.42787E-6
17-67129988-C-T p.Val195Val synonymous ABCA6 3 82754 3.6252E-5 41377 0 1.27389E-4
17-67130009-C-T c.565-1G>A splice_acceptor ABCA6 1 82266 1.21557E-5 41133 0 NA
17-67130015-TAG-T c.565-9_565-8delCT splice_region ABCA6 1 81964 1.22005E-5 40982 0 NA
17-67130772-G-A c.564+8C>T splice_region ABCA6 1 81962 1.22008E-5 40981 0 4.11482E-6
17-67130774-A-T c.564+6T>A splice_region ABCA6 1 82032 1.21904E-5 41016 0 4.09527E-6
17-67130780-T-G p.Glu188Asp missense+splice_region ABCA6 1 82152 1.21726E-5 41076 0 NA
17-67130783-T-C p.Ile187Met missense ABCA6 3 82202 3.64955E-5 41101 0 9.55718E-5
17-67130793-G-T p.Thr184Asn missense ABCA6 2 82350 2.42866E-5 41175 0 NA
17-67130800-TA-T p.Ile182fs frameshift ABCA6 1 82426 1.21321E-5 41213 0 2.23556E-4
17-67130808-T-C p.Gln179Arg missense ABCA6 1 82544 1.21148E-5 41272 0 1.9952E-5
17-67130857-AC-A p.Glu162fs frameshift ABCA6 1 82558 1.21127E-5 41279 0 7.97601E-6
17-67130873-C-G p.Trp157Cys missense ABCA6 1 82416 1.21336E-5 41208 0 NA
17-67130883-G-A p.Ala154Val missense+splice_region ABCA6 1 82242 1.21592E-5 41121 0 NA
17-67130886-G-A c.461-3C>T splice_region ABCA6 9 82188 1.09505E-4 41094 0 6.25E-4
17-67132137-A-C p.Ter186Glyext*? stop_lost ABCA6 2 77772 2.57162E-5 38886 0 1.70644E-4
17-67132157-C-G p.Arg179Thr missense ABCA6 2 79904 2.503E-5 39952 0 6.36983E-5
17-67132167-A-G p.Leu176Leu synonymous ABCA6 4 80504 4.9687E-5 40252 0 2.46948E-4
17-67132171-C-T p.Arg174Arg synonymous ABCA6 4 80842 4.94792E-5 40421 0 2.23072E-4
17-67132172-C-T p.Arg174Lys missense ABCA6 1 80908 1.23597E-5 40454 0 NA
17-67132182-T-G p.Lys171Gln missense ABCA6 1 81330 1.22956E-5 40665 0 NA
17-67132186-T-A p.Gln169His missense ABCA6 3 81474 3.68216E-5 40737 0 3.18431E-5
17-67132193-C-A p.Cys167Phe missense ABCA6 2 81614 2.45056E-5 40807 0 NA
17-67132194-A-C p.Cys167Gly missense ABCA6 1 81662 1.22456E-5 40831 0 8.632E-6
17-67132195-T-C p.Ser166Ser synonymous ABCA6 1 81652 1.22471E-5 40826 0 NA
17-67132204-C-T p.Trp163* stop_gained ABCA6 5 81780 6.11396E-5 40890 0 4.21713E-5
17-67132211-G-A p.Ser161Leu missense ABCA6 1 81916 1.22076E-5 40958 0 NA
17-67132222-T-C p.Pro157Pro synonymous ABCA6 1 81948 1.22029E-5 40974 0 NA
17-67132230-C-T p.Asp155Asn missense ABCA6 9 81950 1.09823E-4 40975 0 3.18573E-4
17-67132235-G-A p.Ser153Leu missense+splice_region ABCA6 2 81962 2.44016E-5 40981 0 NA
17-67132240-ATCT-A p.Glu150del disruptive_inframe_deletion ABCA6 1 81926 1.22061E-5 40963 0 NA
17-67132257-G-A p.Pro146Ser missense ABCA6 10 81954 1.2202E-4 40977 0 3.50385E-4
17-67132260-T-TCCA p.Asn144_Ser145insTrp conservative_inframe_insertion ABCA6 1 81966 1.22002E-5 40983 0 NA
17-67132261-G-T p.Asn144Lys missense ABCA6 1 81948 1.22029E-5 40974 0 NA
17-67132262-T-A p.Asn144Ile missense ABCA6 2 81940 2.44081E-5 40970 0 5.29313E-5
17-67132264-A-G p.Tyr143Tyr synonymous ABCA6 1 81938 1.22043E-5 40969 0 NA
17-67132267-T-G p.Gly142Gly synonymous ABCA6 1 81918 1.22073E-5 40959 0 1.07289E-5
17-67132271-T-G p.Gln141Pro missense ABCA6 1 81902 1.22097E-5 40951 0 NA
17-67132274-A-G p.Phe140Ser missense ABCA6 1 81902 1.22097E-5 40951 0 4.10931E-6
17-67132277-A-T p.Phe139Tyr missense ABCA6 1 81890 1.22115E-5 40945 0 NA
17-67132279-T-G p.Ile138Ile synonymous ABCA6 1 81878 1.22133E-5 40939 0 NA
17-67132282-T-TGCC p.Leu137_Ile138insAla disruptive_inframe_insertion ABCA6 1 81890 1.22115E-5 40945 0 NA
17-67132284-A-AGAGG p.Leu137fs frameshift ABCA6 1 81872 1.22142E-5 40936 0 NA
17-67132288-A-G p.Tyr135Tyr synonymous ABCA6 2 81900 2.442E-5 40950 0 5.80275E-5
17-67132291-A-C p.Ser134Ser synonymous ABCA6 1 81894 1.22109E-5 40947 0 1.17619E-5
17-67132298-G-C p.Thr132Ser missense ABCA6 1 81926 1.22061E-5 40963 0 NA
17-67132299-T-G p.Thr132Pro missense ABCA6 5 81922 6.10337E-5 40961 0 1.46879E-4
17-67132301-T-C p.Glu131Gly missense ABCA6 1 81916 1.22076E-5 40958 0 3.18471E-5
17-67132348-T-G p.Glu115Asp missense ABCA6 1 82124 1.21767E-5 41062 0 4.44066E-6
17-67132350-C-T p.Glu115Lys missense ABCA6 1 82090 1.21818E-5 41045 0 4.50548E-5
17-67132351-G-A p.Asp114Asp synonymous ABCA6 276 82082 0.00336249 41041 3 0.0075521
17-67132354-C-T p.Met113Ile missense ABCA6 2 82108 2.43582E-5 41054 0 3.18532E-5
17-67132360-T-C p.Thr111Thr synonymous ABCA6 1 82006 1.21942E-5 41003 0 NA
17-67132370-GGT-G p.Pro108fs frameshift ABCA6 2 81836 2.44391E-5 40918 0 5.62556E-5
17-67132371-G-A p.Pro108Ser missense ABCA6 1 81812 1.22231E-5 40906 0 NA
17-67132374-C-T p.Ala107Thr missense ABCA6 3 81762 3.66919E-5 40881 0 1.95419E-5
17-67132379-A-G p.Ile105Thr missense ABCA6 1 81780 1.22279E-5 40890 0 NA
17-67132381-G-A p.Val104Val synonymous ABCA6 1 81728 1.22357E-5 40864 0 NA
17-67133374-ACAACTTATCAACAGTATATAGACATCTATCAGTAACTCTTTTTTTGCCATGAGTACACCTACCTTTCAAAAGAGGAGCAAGTGCTGTTTTATTCATTAT-A p.Ile89fs frameshift ABCA6 1 78836 1.26846E-5 39418 0 NA
17-67133438-T-C p.Lys100Lys splice_region+synonymous ABCA6 8 81958 9.7611E-5 40979 0 3.19864E-5
17-67133452-C-G p.Ala96Pro missense ABCA6 2 82310 2.42984E-5 41155 0 NA
17-67133476-G-T p.Gln88Lys missense ABCA6 4 82622 4.84133E-5 41311 0 0.00101112
17-67133480-G-T p.Thr86Thr synonymous ABCA6 1 82640 1.21007E-5 41320 0 NA
17-67133494-T-C p.Ile82Val missense ABCA6 1 82660 1.20978E-5 41330 0 3.98746E-6
17-67133508-A-G p.Val77Ala missense ABCA6 2 82622 2.42066E-5 41311 0 3.19142E-5
17-67133509-C-T p.Val77Ile missense ABCA6 1 82614 1.21045E-5 41307 0 NA
17-67133516-A-T p.Ser74Ser synonymous ABCA6 1 82624 1.2103E-5 41312 0 NA
17-67133534-A-G p.Asp68Asp synonymous ABCA6 1 82560 1.21124E-5 41280 0 NA
17-67133539-C-A p.Val67Leu missense ABCA6 1 82558 1.21127E-5 41279 0 3.99096E-6
17-67133544-C-T p.Gly65Glu missense ABCA6 1 82524 1.21177E-5 41262 0 NA
17-67133554-G-A p.Gln62* stop_gained ABCA6 2 82522 2.4236E-5 41261 0 8.28144E-6
17-67133560-C-G p.Ala60Pro missense ABCA6 2 82548 2.42283E-5 41274 0 NA
17-67133563-T-C p.Met59Val missense ABCA6 1 82570 1.21109E-5 41285 0 NA
17-67133570-A-C p.Phe56Leu missense ABCA6 2 82554 2.42266E-5 41277 0 NA
17-67133575-G-A p.Gln55* stop_gained ABCA6 3 82578 3.63293E-5 41289 0 6.37064E-5
17-67133578-C-A p.Val54Phe missense ABCA6 1 82582 1.21092E-5 41291 0 8.29242E-6
17-67133603-A-G p.Ala45Ala synonymous ABCA6 2 82570 2.42219E-5 41285 0 NA
17-67133605-C-G p.Ala45Pro missense ABCA6 2 82568 2.42225E-5 41284 0 3.99517E-6
17-67133612-C-T p.Leu42Leu synonymous ABCA6 1 82558 1.21127E-5 41279 0 8.33889E-6
17-67133615-T-C p.Gly41Gly synonymous ABCA6 1 82538 1.21156E-5 41269 0 4.00375E-6
17-67133619-A-G p.Leu40Pro missense ABCA6 1 82538 1.21156E-5 41269 0 2.51286E-5
17-67133623-G-T p.Leu39Ile missense ABCA6 3 82542 3.63451E-5 41271 0 6.37024E-5
17-67133626-T-C p.Ile38Val missense ABCA6 3 82530 3.63504E-5 41265 0 3.1841E-5
17-67133627-T-C p.Ser37Ser synonymous ABCA6 1 82530 1.21168E-5 41265 0 NA
17-67136741-A-T c.96+8T>A splice_region ABCA6 1 81562 1.22606E-5 40781 0 8.71224E-6
17-67136751-A-G p.Leu32Leu splice_region+synonymous ABCA6 1 81892 1.22112E-5 40946 0 4.22526E-6
17-67136762-C-A p.Arg28Ile missense ABCA6 2 82004 2.43891E-5 41002 0 9.55901E-5
17-67136784-G-A p.Leu21Phe missense ABCA6 1 82116 1.21779E-5 41058 0 NA
17-67136794-G-A p.Cys17Cys synonymous ABCA6 1 82150 1.21729E-5 41075 0 NA
17-67136815-C-G p.Gln10His missense ABCA6 1 82012 1.21933E-5 41006 0 NA
17-67136823-C-T p.Val8Met missense ABCA6 4 81860 4.88639E-5 40930 0 1.07975E-4
17-67136837-A-G p.Met3Thr missense ABCA6 2 81488 2.45435E-5 40744 0 2.55595E-5
17-67136838-T-TTACCTACTG p.Asn2_Met3insGlnTerVal stop_gained ABCA6 1 81446 1.22781E-5 40723 0 NA
17-67136839-A-G p.Asn2Asn synonymous ABCA6 1 81370 1.22895E-5 40685 0 NA
17-67136842-C-A p.Met1? start_lost ABCA6 1 81266 1.23053E-5 40633 0 6.37064E-5
17-67136865-G-C c.-21C>G 5_prime_UTR_premature_start_codon_gain ABCA6 3 78634 3.81514E-5 39317 0 NA
17-67136876-T-A c.-32A>T 5_prime_UTR_premature_start_codon_gain ABCA6 1 77854 1.28446E-5 38927 0 NA