Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
17-67243706-C-T p.Arg1634Gln missense ABCA5 4 81820 4.88878E-5 40910 0 4.95295E-5
17-67243712-C-T p.Trp1632* stop_gained ABCA5 1 81908 1.22088E-5 40954 0 NA
17-67243730-A-G p.Leu1626Ser missense ABCA5 3 82010 3.65809E-5 41005 0 NA
17-67243737-C-G p.Gly1624Arg missense ABCA5 2 81980 2.43962E-5 40990 0 4.02781E-6
17-67243740-AACT-A p.Ser1622del conservative_inframe_deletion ABCA5 1 81962 1.22008E-5 40981 0 NA
17-67243758-C-T p.Glu1617Lys missense ABCA5 1 81754 1.22318E-5 40877 0 8.26132E-6
17-67243770-T-C p.Thr1613Ala missense ABCA5 1 81486 1.2272E-5 40743 0 NA
17-67243788-A-T c.4822-3T>A splice_region ABCA5 1 80866 1.23661E-5 40433 0 6.38081E-5
17-67244397-T-C c.4821+6A>G splice_region ABCA5 2 78786 2.53852E-5 39393 0 8.9815E-5
17-67244399-G-T c.4821+4C>A splice_region ABCA5 1 78890 1.26759E-5 39445 0 NA
17-67244409-C-T p.Leu1605Leu synonymous ABCA5 1 79466 1.2584E-5 39733 0 NA
17-67244412-T-A p.Thr1604Thr synonymous ABCA5 2 79616 2.51206E-5 39808 0 NA
17-67244415-T-C p.Ala1603Ala synonymous ABCA5 1 79622 1.25593E-5 39811 0 1.32123E-5
17-67244428-C-A p.Ser1599Ile missense ABCA5 2 79688 2.50979E-5 39844 0 0.00137741
17-67244437-T-C p.Glu1596Gly missense ABCA5 1 79622 1.25593E-5 39811 0 1.57337E-5
17-67244441-T-C p.Ile1595Val missense ABCA5 1 79582 1.25657E-5 39791 0 1.58504E-5
17-67244442-G-A p.Ala1594Ala synonymous ABCA5 2 79600 2.51256E-5 39800 0 3.18959E-5
17-67244447-A-T p.Phe1593Ile missense ABCA5 6 79626 7.53523E-5 39813 0 9.69337E-5
17-67244450-C-T p.Ala1592Thr missense ABCA5 1 79636 1.25571E-5 39818 0 NA
17-67244461-A-G c.4766-3T>C splice_region ABCA5 5 79080 6.32271E-5 39540 0 6.37389E-5
17-67246043-T-C c.4765+3A>G splice_region ABCA5 28 80960 3.4585E-4 40480 0 8.31202E-4
17-67246046-C-A p.Ala1589Ser missense+splice_region ABCA5 2 80864 2.47329E-5 40432 0 3.21027E-5
17-67246059-A-G p.Phe1584Phe synonymous ABCA5 1 81086 1.23326E-5 40543 0 4.46429E-6
17-67246074-A-T p.Leu1579Leu synonymous ABCA5 1 80934 1.23557E-5 40467 0 NA
17-67246076-G-C p.Leu1579Val missense ABCA5 1 80782 1.2379E-5 40391 0 NA
17-67246129-G-GA c.4686-5_4686-4insT splice_region ABCA5 2 77946 2.56588E-5 38973 0 4.00208E-5
17-67246608-T-C c.4685+5A>G splice_region ABCA5 1 82674 1.20957E-5 41337 0 NA
17-67246618-C-T p.Gln1560Gln synonymous ABCA5 1 82792 1.20785E-5 41396 0 2.43855E-5
17-67246621-A-G p.Arg1559Arg synonymous ABCA5 8 82804 9.66137E-5 41402 0 9.57732E-5
17-67246621-A-T p.Arg1559Arg synonymous ABCA5 1 82804 1.20767E-5 41402 0 NA
17-67246622-C-T p.Arg1559His missense ABCA5 4 82788 4.83162E-5 41394 0 9.98303E-5
17-67246623-G-A p.Arg1559Cys missense ABCA5 5 82770 6.04084E-5 41385 0 7.71962E-5
17-67246645-C-A p.Gln1551His missense ABCA5 2 82824 2.41476E-5 41412 0 NA
17-67246664-C-T p.Arg1545His missense ABCA5 2 82792 2.41569E-5 41396 0 3.34697E-5
17-67246665-G-A p.Arg1545Cys missense ABCA5 2 82784 2.41593E-5 41392 0 1.27714E-4
17-67246665-G-C p.Arg1545Gly missense ABCA5 1 82784 1.20796E-5 41392 0 8.39201E-6
17-67246670-A-T p.Val1543Glu missense ABCA5 1 82794 1.20782E-5 41397 0 1.24405E-5
17-67246674-C-G p.Glu1542Gln missense ABCA5 1 82816 1.2075E-5 41408 0 3.19061E-5
17-67246689-A-G p.Trp1537Arg missense ABCA5 1 82814 1.20753E-5 41407 0 NA
17-67246695-T-G p.Lys1535Gln missense ABCA5 1 82794 1.20782E-5 41397 0 3.18857E-5
17-67246702-A-G p.Ile1532Ile synonymous ABCA5 2 82756 2.41674E-5 41378 0 4.13066E-6
17-67246714-G-A p.Tyr1528Tyr synonymous ABCA5 2 82738 2.41727E-5 41369 0 0.00151057
17-67246718-C-T p.Gly1527Asp missense ABCA5 1 82700 1.20919E-5 41350 0 NA
17-67246730-T-G p.Lys1523Thr missense ABCA5 5 82536 6.05796E-5 41268 0 1.71854E-5
17-67246732-A-G p.Ser1522Ser synonymous ABCA5 1 82516 1.21189E-5 41258 0 NA
17-67246740-G-C p.Leu1520Val missense ABCA5 1 82424 1.21324E-5 41212 0 NA
17-67246747-T-C p.Val1517Val synonymous ABCA5 5 82280 6.07681E-5 41140 0 5.03525E-4
17-67246749-C-T p.Val1517Ile missense ABCA5 2 82244 2.43179E-5 41122 0 8.89957E-6
17-67246755-C-T p.Gly1515Arg missense ABCA5 1 81706 1.2239E-5 40853 0 2.89637E-5
17-67246755-C-G p.Gly1515Arg missense ABCA5 1 81706 1.2239E-5 40853 0 NA
17-67246756-G-A p.Ile1514Ile synonymous ABCA5 1 81744 1.22333E-5 40872 0 8.9941E-6
17-67246765-GAAGT-G c.4536-7_4536-4delACTT splice_region ABCA5 1 81312 1.22983E-5 40656 0 NA
17-67246768-G-A c.4536-6C>T splice_region ABCA5 1 81164 1.23207E-5 40582 0 NA
17-67247894-T-C p.Gln1510Arg missense ABCA5 2 83274 2.40171E-5 41637 0 3.99866E-6
17-67247900-G-C p.Ser1508Cys missense ABCA5 69 83286 8.28471E-4 41643 1 0.00101995
17-67247902-C-T p.Val1507Val synonymous ABCA5 3 83290 3.60187E-5 41645 0 1.35407E-4
17-67247919-G-A p.Arg1502* stop_gained ABCA5 3 83284 3.60213E-5 41642 0 3.18878E-5
17-67247925-A-T p.Cys1500Ser missense ABCA5 2 83286 2.40136E-5 41643 0 NA
17-67247930-G-A p.Ala1498Val missense ABCA5 1 83282 1.20074E-5 41641 0 NA
17-67247958-T-C p.Thr1489Ala missense ABCA5 2 83192 2.40408E-5 41596 0 3.18654E-5
17-67247964-T-C p.Ile1487Val missense ABCA5 1 83172 1.20233E-5 41586 0 5.03525E-4
17-67247970-C-T p.Ala1485Thr missense ABCA5 2 83138 2.40564E-5 41569 0 NA
17-67247973-G-A p.Arg1484Trp missense ABCA5 1 83118 1.20311E-5 41559 0 5.03525E-4
17-67247988-A-C p.Phe1479Val missense ABCA5 1 83004 1.20476E-5 41502 0 NA
17-67247990-G-A p.Ala1478Val missense ABCA5 5 82970 6.02627E-5 41485 0 8.27924E-6
17-67247997-G-A p.Arg1476* stop_gained ABCA5 1 82822 1.20741E-5 41411 0 1.65989E-5
17-67248004-T-C p.Arg1473Arg synonymous ABCA5 3 82748 3.62547E-5 41374 0 4.1641E-5
17-67249707-T-C c.4415+7A>G splice_region ABCA5 2 82678 2.41902E-5 41339 0 8.24919E-6
17-67249711-C-T c.4415+3G>A splice_region ABCA5 1001 82664 0.0121093 41332 5 0.0110512
17-67249716-C-T p.Met1471Ile missense+splice_region ABCA5 1 82744 1.20855E-5 41372 0 3.18532E-5
17-67249738-T-C p.Asp1464Gly missense ABCA5 1 82904 1.20621E-5 41452 0 3.29712E-5
17-67249744-C-G p.Gly1462Ala missense ABCA5 1 82930 1.20584E-5 41465 0 3.18735E-5
17-67249748-T-G p.Thr1461Pro missense ABCA5 1 82942 1.20566E-5 41471 0 NA
17-67249755-T-G p.Glu1458Asp missense ABCA5 1 82942 1.20566E-5 41471 0 NA
17-67249773-C-A p.Gln1452His missense ABCA5 1 82954 1.20549E-5 41477 0 2.47329E-5
17-67249778-G-C p.Pro1451Ala missense ABCA5 2 82954 2.41097E-5 41477 0 NA
17-67249789-A-G p.Met1447Thr missense ABCA5 11 82954 1.32604E-4 41477 0 3.50318E-4
17-67249790-T-C p.Met1447Val missense ABCA5 1 82950 1.20555E-5 41475 0 3.29859E-5
17-67249797-A-C p.Ala1444Ala synonymous ABCA5 6 82946 7.23362E-5 41473 0 1.07229E-4
17-67249798-G-A p.Ala1444Val missense ABCA5 11 82936 1.32632E-4 41468 0 5.27948E-4
17-67249808-ACTACATGGAAAGAAAAAGATGGGTGGGAAATTAACAAAGGTTCACTATAAGGAATCTATCAAGACAATATCAGGTACTAAACTATCAATAAAAATACAGGCATTATTTGGTGTTTAATGAAAGTAC-A c.4320+1_4321-1del splice_acceptor ABCA5 4 82916 4.82416E-5 41458 2 NA
17-67249816-G-T c.4321-8C>A splice_region ABCA5 1 82846 1.20706E-5 41423 0 NA
17-67249934-C-A c.4320+1G>T splice_donor ABCA5 4 82892 4.82556E-5 41446 0 2.47627E-5
17-67249934-C-T c.4320+1G>A splice_donor ABCA5 4 82892 4.82556E-5 41446 0 2.39498E-5
17-67249939-C-T p.Arg1439Gln missense ABCA5 3 82892 3.61917E-5 41446 0 2.39446E-5
17-67249944-G-C p.Ile1437Met missense ABCA5 2 82892 2.41278E-5 41446 0 8.25164E-6
17-67249951-G-C p.Ala1435Gly missense ABCA5 1 82888 1.20645E-5 41444 0 NA
17-67249963-T-C p.Lys1431Arg missense ABCA5 1 82840 1.20715E-5 41420 0 NA
17-67249985-C-A p.Glu1424* stop_gained ABCA5 20 82632 2.42037E-4 41316 0 6.60415E-5
17-67249985-C-T p.Glu1424Lys missense ABCA5 2 82634 2.42031E-5 41317 0 NA
17-67249990-A-ATTATAATAGTTT p.Leu1422delinsTerThrIleIleIle stop_gained ABCA5 1 82552 1.21136E-5 41276 0 NA
17-67249997-G-A p.Leu1420Phe missense ABCA5 9 82396 1.09229E-4 41198 0 1.27453E-4
17-67249998-T-C p.Ala1419Ala synonymous ABCA5 1 82384 1.21383E-5 41192 0 NA
17-67250002-T-C p.His1418Arg missense ABCA5 2 82310 2.42984E-5 41155 0 NA
17-67250004-T-A p.Thr1417Thr synonymous ABCA5 11 82254 1.33732E-4 41127 0 5.04541E-4
17-67250457-G-A p.Arg1415* stop_gained ABCA5 2 82148 2.43463E-5 41074 0 NA
17-67250466-C-G p.Val1412Leu missense ABCA5 1 82432 1.21312E-5 41216 0 1.65653E-5
17-67250466-C-T p.Val1412Ile missense ABCA5 6 82432 7.27873E-5 41216 0 3.23024E-4
17-67250495-T-G p.Lys1402Thr missense ABCA5 1 82886 1.20648E-5 41443 0 NA
17-67250497-G-C p.Val1401Val synonymous ABCA5 1 82902 1.20624E-5 41451 0 NA
17-67250500-A-G p.Ala1400Ala synonymous ABCA5 2 82912 2.4122E-5 41456 0 NA
17-67250507-T-C p.Tyr1398Cys missense ABCA5 1 82958 1.20543E-5 41479 0 NA
17-67250510-A-T p.Ile1397Asn missense ABCA5 1 82960 1.2054E-5 41480 0 8.24307E-6
17-67250518-A-G p.His1394His synonymous ABCA5 1 82998 1.20485E-5 41499 0 1.64845E-5
17-67250530-T-C p.Thr1390Thr synonymous ABCA5 1 83030 1.20438E-5 41515 0 4.94633E-5
17-67250534-G-A p.Thr1389Ile missense ABCA5 1 83040 1.20424E-5 41520 0 2.47333E-5
17-67250541-G-A p.Pro1387Ser missense ABCA5 2 83062 2.40784E-5 41531 0 NA
17-67250588-T-G p.Asp1371Ala missense ABCA5 2 83058 2.40796E-5 41529 0 3.20018E-5
17-67250618-T-A p.Asp1361Val missense ABCA5 3 82910 3.61838E-5 41455 0 3.18613E-5
17-67250637-G-T c.4069-6C>A splice_region ABCA5 27 82610 3.26837E-4 41305 0 2.21996E-4
17-67251680-A-C c.4068+4T>G splice_region ABCA5 2 82258 2.43137E-5 41129 0 NA
17-67251690-T-C p.Ser1354Ser synonymous ABCA5 1 82538 1.21156E-5 41269 0 3.18634E-5
17-67251694-G-A p.Thr1353Ile missense ABCA5 3 82574 3.63311E-5 41287 0 NA
17-67251703-A-G p.Ile1350Thr missense ABCA5 1 82706 1.2091E-5 41353 0 NA
17-67251720-A-G p.Asn1344Asn synonymous ABCA5 7 82874 8.44656E-5 41437 0 4.4446E-6
17-67251723-A-G p.Ile1343Ile synonymous ABCA5 3 82882 3.6196E-5 41441 0 3.18451E-5
17-67251724-A-C p.Ile1343Ser missense ABCA5 4 82892 4.82556E-5 41446 0 5.03525E-4
17-67251745-C-T p.Gly1336Asp missense ABCA5 1 82946 1.2056E-5 41473 0 3.19142E-5
17-67251774-T-C p.Gly1326Gly splice_region+synonymous ABCA5 4 82964 4.82137E-5 41482 0 1.69733E-5
17-67251774-TCCTAAAGGAATTGAAAGAAAAAAAAATCATAATCAAATCATACTAAAAGTAGAAATTACTCTTCTAGAAAAGTTATGTAAGGAAAAATTAAATACCAG-T p.Gly1326fs frameshift ABCA5 8 82964 9.64274E-5 41482 2 NA
17-67251776-C-G c.3977-1G>C splice_acceptor ABCA5 1 82954 1.20549E-5 41477 0 NA
17-67251880-T-TC p.Lys1324fs frameshift ABCA5 1 80806 1.23753E-5 40403 0 NA
17-67251884-A-G p.Cys1322Cys synonymous ABCA5 32 80700 3.9653E-4 40350 0 0.00563204
17-67251893-G-T p.Ile1319Ile synonymous ABCA5 1 80656 1.23983E-5 40328 0 2.58162E-5
17-67251897-T-C p.Tyr1318Cys missense ABCA5 1 80664 1.23971E-5 40332 0 NA
17-67251902-A-C p.Thr1316Thr synonymous ABCA5 2 80688 2.47868E-5 40344 0 NA
17-67251907-C-T p.Ala1315Thr missense ABCA5 29 80740 3.59178E-4 40370 0 8.6053E-4
17-67251908-C-G p.Val1314Val synonymous ABCA5 2 80812 2.47488E-5 40406 0 NA
17-67251909-A-G p.Val1314Ala missense ABCA5 2 80848 2.47378E-5 40424 0 NA
17-67251917-T-A p.Val1311Val synonymous ABCA5 1 81262 1.23059E-5 40631 0 NA
17-67251919-C-T p.Val1311Ile missense ABCA5 1 81306 1.22992E-5 40653 0 8.70868E-6
17-67251941-TTTC-T p.Lys1303del disruptive_inframe_deletion ABCA5 2 81800 2.44499E-5 40900 0 4.23722E-6
17-67251958-C-G p.Glu1298Gln missense ABCA5 1 82040 1.21892E-5 41020 0 NA
17-67251969-T-C p.Asn1294Ser missense ABCA5 2 82158 2.43433E-5 41079 0 4.55382E-5
17-67251974-G-A p.Val1292Val synonymous ABCA5 1 82216 1.21631E-5 41108 0 3.18735E-5
17-67251990-T-C p.Lys1287Arg missense+splice_region ABCA5 6 82200 7.29927E-5 41100 0 0.0010101
17-67251995-A-G c.3859-4T>C splice_region ABCA5 3695 81944 0.0450918 40972 108 0.0483352
17-67252308-C-A p.Cys1283Phe missense ABCA5 1 82338 1.21451E-5 41169 0 NA
17-67252314-C-G p.Cys1281Ser missense ABCA5 1 82408 1.21347E-5 41204 0 NA
17-67252329-T-C p.Lys1276Arg missense ABCA5 1 82578 1.21098E-5 41289 0 1.60466E-5
17-67252340-T-C p.Arg1272Arg synonymous ABCA5 1 82660 1.20978E-5 41330 0 NA
17-67252340-T-A p.Arg1272Ser missense ABCA5 1 82660 1.20978E-5 41330 0 NA
17-67252342-T-C p.Arg1272Gly missense ABCA5 2 82650 2.41984E-5 41325 0 8.00532E-6
17-67252367-A-C p.Asp1263Glu missense ABCA5 2 82452 2.42565E-5 41226 0 NA
17-67252368-T-A p.Asp1263Val missense ABCA5 2 82446 2.42583E-5 41223 0 3.99358E-6
17-67252376-G-T p.Asp1260Glu missense ABCA5 1 82314 1.21486E-5 41157 0 NA
17-67252378-C-T p.Asp1260Asn missense ABCA5 27 82302 3.2806E-4 41151 0 8.64277E-4
17-67252383-G-A p.Pro1258Leu missense ABCA5 1 82210 1.2164E-5 41105 0 NA
17-67252386-T-C p.Glu1257Gly missense ABCA5 1 82130 1.21758E-5 41065 0 NA
17-67252412-C-T p.Thr1248Thr synonymous ABCA5 12 81164 1.47849E-4 40582 2 0.0015121
17-67252413-G-A p.Thr1248Met missense ABCA5 94 81112 0.00115889 40556 0 9.3464E-4
17-67252413-G-GTTTACTTACTT p.Thr1248fs frameshift ABCA5 1 81114 1.23283E-5 40557 0 NA
17-67252429-A-G c.3732-5T>C splice_region ABCA5 3 80048 3.74775E-5 40024 0 9.52191E-6
17-67252430-T-C c.3732-6A>G splice_region ABCA5 1 79926 1.25116E-5 39963 0 1.79154E-5
17-67255842-C-G c.3731+5G>C splice_region ABCA5 1 80442 1.24313E-5 40221 0 NA
17-67255843-T-A c.3731+4A>T splice_region ABCA5 5 80540 6.2081E-5 40270 0 3.19387E-5
17-67255864-T-C p.Arg1238Arg synonymous ABCA5 1 81334 1.2295E-5 40667 0 4.03786E-6
17-67255871-G-A p.Ser1236Leu missense ABCA5 3 81510 3.68053E-5 40755 0 6.38855E-5
17-67255880-C-A p.Gly1233Val missense ABCA5 1 81616 1.22525E-5 40808 0 NA
17-67255881-C-T p.Gly1233Arg missense ABCA5 1 81626 1.2251E-5 40813 0 NA
17-67255895-T-C p.Tyr1228Cys missense ABCA5 2 81682 2.44852E-5 40841 0 4.00985E-6
17-67255902-G-T p.Gln1226Lys missense ABCA5 1 81736 1.22345E-5 40868 0 NA
17-67255905-A-T p.Leu1225Ile missense ABCA5 2 81734 2.44696E-5 40867 0 2.00518E-5
17-67255920-G-T p.Leu1220Met missense ABCA5 2 81660 2.44918E-5 40830 0 1.61054E-5
17-67255929-G-A p.Gln1217* stop_gained ABCA5 1 81554 1.22618E-5 40777 0 NA
17-67256471-T-A c.3639+8A>T splice_region ABCA5 1 81072 1.23347E-5 40536 0 1.76308E-5
17-67256482-T-TA p.Ser1213fs frameshift ABCA5 1 81498 1.22702E-5 40749 0 3.1902E-5
17-67256483-A-G p.Ile1212Thr missense ABCA5 2 81506 2.45381E-5 40753 0 1.63002E-5
17-67256487-C-A p.Val1211Phe missense ABCA5 2 81600 2.45098E-5 40800 0 NA
17-67256505-C-A p.Asp1205Tyr missense ABCA5 1 81746 1.2233E-5 40873 0 NA
17-67256520-T-C p.Thr1200Ala missense ABCA5 1 81758 1.22312E-5 40879 0 8.13087E-6
17-67256526-C-T p.Val1198Met missense ABCA5 1 81742 1.22336E-5 40871 0 8.66686E-6
17-67256534-C-T p.Arg1195Gln missense ABCA5 4 81662 4.89824E-5 40831 0 2.1039E-4
17-67256545-C-T p.Trp1191* stop_gained ABCA5 1 81578 1.22582E-5 40789 0 3.1904E-5
17-67256552-A-C p.Ile1189Ser missense+splice_region ABCA5 1 81440 1.2279E-5 40720 0 NA
17-67257260-A-T c.3564+6T>A splice_region ABCA5 1 81178 1.23186E-5 40589 0 3.19E-5
17-67257265-C-G c.3564+1G>C splice_donor ABCA5 1 81396 1.22856E-5 40698 0 NA
17-67257265-C-A c.3564+1G>T splice_donor ABCA5 1 81396 1.22856E-5 40698 0 NA
17-67257281-C-T p.Leu1183Leu synonymous ABCA5 5246 81660 0.064242 40830 224 0.127964
17-67257281-C-G p.Leu1183Leu synonymous ABCA5 5 81916 6.10381E-5 40958 0 0.00260417
17-67257290-T-C p.Leu1180Leu synonymous ABCA5 2 82104 2.43593E-5 41052 0 NA
17-67257304-T-C p.Ile1176Val missense ABCA5 2 82284 2.43061E-5 41142 0 NA
17-67257313-T-C p.Ile1173Val missense ABCA5 28 82362 3.39963E-4 41181 0 8.61134E-4
17-67257316-T-C p.Ile1172Val missense ABCA5 1 82376 1.21395E-5 41188 0 NA
17-67257327-T-C p.Tyr1168Cys missense ABCA5 1 82428 1.21318E-5 41214 0 NA
17-67257330-T-C p.His1167Arg missense ABCA5 7 82428 8.49226E-5 41214 0 8.09029E-5
17-67257337-T-G p.Ile1165Leu missense ABCA5 6 82450 7.27714E-5 41225 0 4.0268E-5
17-67257355-C-T p.Gly1159Arg missense ABCA5 234 82398 0.00283987 41199 2 0.0166835
17-67257373-C-G p.Glu1153Gln missense ABCA5 1 82314 1.21486E-5 41157 0 NA
17-67257381-G-C p.Ala1150Gly missense ABCA5 1 82216 1.21631E-5 41108 0 NA
17-67257385-T-A p.Ile1149Phe missense ABCA5 3 82202 3.64955E-5 41101 0 NA
17-67257391-C-G p.Ala1147Pro missense ABCA5 2 82024 2.43831E-5 41012 0 3.19326E-5
17-67257395-C-T p.Ala1145Ala synonymous ABCA5 2 81860 2.4432E-5 40930 0 3.19387E-5
17-67257396-G-A p.Ala1145Val missense ABCA5 21 81860 2.56536E-4 40930 0 0.00100908
17-67257397-C-T p.Ala1145Thr missense ABCA5 1 81858 1.22163E-5 40929 0 4.30071E-6
17-67257400-C-G p.Ala1144Pro missense+splice_region ABCA5 3 81614 3.67584E-5 40807 0 4.41357E-6
17-67257812-T-C p.Leu1131Leu synonymous ABCA5 603 80572 0.00748399 40286 19 0.0144133
17-67257824-A-G p.Phe1127Phe synonymous ABCA5 1 80750 1.23839E-5 40375 0 NA
17-67257842-A-G p.Tyr1121Tyr synonymous ABCA5 5 80736 6.19302E-5 40368 0 1.20449E-4
17-67257843-T-C p.Tyr1121Cys missense ABCA5 2 80710 2.47801E-5 40355 0 5.48059E-6
17-67257863-T-C p.Pro1114Pro synonymous ABCA5 1 79890 1.25172E-5 39945 0 5.97514E-6
17-67257865-G-A p.Pro1114Ser missense ABCA5 1 79786 1.25335E-5 39893 0 6.1571E-6
17-67257889-C-T p.Val1106Ile missense+splice_region ABCA5 21 77748 2.70103E-4 38874 1 0.00125
17-67260878-C-G p.Val1105Leu missense+splice_region ABCA5 2 80270 2.49159E-5 40135 0 2.1377E-4
17-67260904-T-C p.Tyr1096Cys missense ABCA5 2 81962 2.44016E-5 40981 0 5.96059E-5
17-67260907-A-G p.Leu1095Ser missense ABCA5 1 81986 1.21972E-5 40993 0 3.18593E-5
17-67260917-G-T p.His1092Asn missense ABCA5 3 82216 3.64892E-5 41108 0 6.71682E-5
17-67260917-G-A p.His1092Tyr missense ABCA5 2 82216 2.43262E-5 41108 0 8.39602E-6
17-67260924-C-T p.Leu1089Leu synonymous ABCA5 1 82314 1.21486E-5 41157 0 3.42706E-4
17-67260926-A-G p.Leu1089Leu synonymous ABCA5 35956 81702 0.440087 40851 8206 0.52625
17-67260956-T-C p.Ile1079Val missense ABCA5 1 82554 1.21133E-5 41277 0 NA
17-67260967-G-A p.Pro1075Leu missense ABCA5 1 82500 1.21212E-5 41250 0 NA
17-67260972-A-G p.Asp1073Asp synonymous ABCA5 4 82520 4.84731E-5 41260 0 NA
17-67260981-A-G p.Ala1070Ala synonymous ABCA5 3 82530 3.63504E-5 41265 0 2.47502E-5
17-67260999-T-C p.Ala1064Ala synonymous ABCA5 1 82090 1.21818E-5 41045 0 2.49215E-5
17-67261006-G-T p.Pro1062Gln missense ABCA5 1 81500 1.22699E-5 40750 0 NA
17-67261023-TTTAAG-T p.Leu1055fs frameshift ABCA5 1 81016 1.23432E-5 40508 0 3.18878E-5
17-67261029-T-C p.Gln1054Gln synonymous ABCA5 5 81098 6.16538E-5 40549 0 1.01E-4
17-67261036-T-G p.Tyr1052Ser missense ABCA5 5 80524 6.20933E-5 40262 0 9.56084E-5
17-67261040-C-A p.Ala1051Ser missense ABCA5 1 80242 1.24623E-5 40121 0 NA
17-67261048-TA-T c.3145-3delT splice_region ABCA5 3 78652 3.81427E-5 39326 0 3.38943E-4
17-67261048-T-TA c.3145-3_3145-2insT splice_region ABCA5 1 78670 1.27113E-5 39335 0 6.541E-5
17-67264079-A-AT c.3144+4_3144+5insA splice_region ABCA5 188 81688 0.00230144 40844 0 0.0014893
17-67264087-A-G p.His1047His synonymous ABCA5 3 81988 3.65907E-5 40994 0 NA
17-67264098-C-T p.Ala1044Thr missense ABCA5 4 82272 4.86192E-5 41136 0 9.26925E-5
17-67264115-T-G p.Tyr1038Ser missense ABCA5 4 82414 4.85354E-5 41207 0 NA
17-67264120-T-G p.Pro1036Pro synonymous ABCA5 1 82438 1.21303E-5 41219 0 NA
17-67264130-G-A p.Thr1033Ile missense ABCA5 1 82510 1.21197E-5 41255 0 1.19616E-5
17-67264134-C-T p.Val1032Ile missense ABCA5 1 82522 1.2118E-5 41261 0 8.3696E-6
17-67264137-T-C p.Ile1031Val missense ABCA5 3 82522 3.63539E-5 41261 0 6.37227E-5
17-67264156-T-G p.Gln1024His missense ABCA5 1 82482 1.21239E-5 41241 0 NA
17-67264170-C-T p.Glu1020Lys missense ABCA5 1 82308 1.21495E-5 41154 0 NA
17-67264177-A-T p.Phe1017Leu missense ABCA5 1 82076 1.21838E-5 41038 0 NA
17-67264198-C-T c.3031-1G>A splice_acceptor ABCA5 2 80882 2.47274E-5 40441 1 NA
17-67266748-G-C c.3030+6C>G splice_region ABCA5 8 82090 9.7454E-5 41045 0 6.28141E-4
17-67266756-G-T p.Gln1010Lys missense+splice_region ABCA5 1 82200 1.21655E-5 41100 0 NA
17-67266756-G-C p.Gln1010Glu missense+splice_region ABCA5 1 82200 1.21655E-5 41100 0 8.26405E-6
17-67266760-G-T p.Phe1008Leu missense ABCA5 1 82272 1.21548E-5 41136 0 8.2631E-6
17-67266769-A-G p.Ser1005Ser synonymous ABCA5 1 82266 1.21557E-5 41133 0 6.26566E-4
17-67266770-C-T p.Ser1005Asn missense ABCA5 1 82332 1.21459E-5 41166 0 NA
17-67266782-A-G p.Ile1001Thr missense ABCA5 5 82488 6.06149E-5 41244 0 9.08836E-5
17-67266806-TAA-T p.Tyr993fs frameshift ABCA5 1 82496 1.21218E-5 41248 0 NA
17-67266807-A-G p.Tyr993His missense ABCA5 1 82492 1.21224E-5 41246 0 NA
17-67266812-T-C p.Tyr991Cys missense ABCA5 1 82496 1.21218E-5 41248 0 NA
17-67266819-T-A p.Asn989Tyr missense ABCA5 1 82494 1.21221E-5 41247 0 NA
17-67266828-T-C p.Ile986Val missense ABCA5 76 82452 9.21748E-4 41226 0 0.00111557
17-67266856-C-T p.Met976Ile missense ABCA5 1 82242 1.21592E-5 41121 0 NA
17-67266858-T-C p.Met976Val missense ABCA5 1 82118 1.21776E-5 41059 0 3.1904E-5
17-67266867-T-C p.Asn973Asp missense ABCA5 1 81640 1.22489E-5 40820 0 4.81255E-6
17-67266887-T-C p.Tyr966Cys missense ABCA5 1 80960 1.23518E-5 40480 0 0.00100806
17-67266890-T-C p.Asp965Gly missense+splice_region ABCA5 2 80878 2.47286E-5 40439 0 3.40605E-5
17-67266893-T-C c.2893-2A>G splice_acceptor ABCA5 1 80698 1.23919E-5 40349 0 5.23977E-6
17-67267297-T-C c.2892+6A>G splice_region ABCA5 1 82454 1.2128E-5 41227 0 4.06022E-6
17-67267301-A-T c.2892+2T>A splice_donor ABCA5 1 82468 1.21259E-5 41234 0 NA
17-67267302-C-A c.2892+1G>T splice_donor ABCA5 1 82490 1.21227E-5 41245 0 NA
17-67267305-T-C p.Lys964Glu missense+splice_region ABCA5 3 82550 3.63416E-5 41275 0 NA
17-67267313-T-C p.His961Arg missense ABCA5 1 82606 1.21057E-5 41303 0 8.26556E-6
17-67267316-A-G p.Met960Thr missense ABCA5 1 82632 1.21018E-5 41316 0 NA
17-67267317-T-C p.Met960Val missense ABCA5 38045 81832 0.464916 40916 8891 0.501156
17-67267320-C-T p.Val959Met missense ABCA5 4 82652 4.83957E-5 41326 0 3.18471E-5
17-67267334-C-T p.Ser954Asn missense ABCA5 2 82742 2.41715E-5 41371 0 NA
17-67267347-C-T p.Val950Met missense ABCA5 3 82778 3.62415E-5 41389 0 4.95409E-5
17-67267348-G-A p.Ser949Ser synonymous ABCA5 117 82798 0.00141308 41399 2 0.00125
17-67267351-T-C p.Val948Val synonymous ABCA5 1 82820 1.20744E-5 41410 0 3.1837E-5
17-67267355-T-A p.Tyr947Phe missense ABCA5 4 82840 4.82859E-5 41420 0 2.22887E-4
17-67267355-T-C p.Tyr947Cys missense ABCA5 2 82840 2.41429E-5 41420 0 1.27364E-4
17-67267363-G-C p.Asp944Glu missense ABCA5 2 82862 2.41365E-5 41431 0 NA
17-67267374-T-A p.Met941Leu missense ABCA5 1 82876 1.20662E-5 41438 0 NA
17-67267375-C-T p.Thr940Thr synonymous ABCA5 2 82884 2.41301E-5 41442 0 1.65273E-5
17-67267375-C-G p.Thr940Thr synonymous ABCA5 1 82884 1.20651E-5 41442 0 4.95819E-5
17-67267376-G-A p.Thr940Met missense ABCA5 32 82894 3.86035E-4 41447 0 3.22298E-4
17-67267383-T-C p.Met938Val missense ABCA5 1 82898 1.2063E-5 41449 0 NA
17-67267409-A-G p.Ile929Thr missense ABCA5 1 82916 1.20604E-5 41458 0 3.1837E-5
17-67267414-A-T p.Asp927Glu missense ABCA5 1 82918 1.20601E-5 41459 0 NA
17-67267418-C-T p.Ser926Asn missense ABCA5 4 82886 4.82591E-5 41443 0 4.43813E-5
17-67267425-C-G p.Asp924His missense ABCA5 1 82868 1.20674E-5 41434 0 3.18451E-5
17-67267431-C-CAGCAGAATTT p.Asp923fs frameshift ABCA5 1 82796 1.20779E-5 41398 0 NA
17-67267432-T-G c.2765-2A>C splice_acceptor ABCA5 1 82786 1.20793E-5 41393 0 4.09259E-6
17-67270083-C-A c.*530+1G>T splice_donor ABCA5 2 83224 2.40315E-5 41612 0 NA
17-67270084-C-A c.*530G>T splice_region ABCA5 2 83224 2.40315E-5 41612 0 3.19326E-5
17-67270099-C-A c.2764+1G>T splice_donor ABCA5 1 83286 1.20068E-5 41643 0 4.17411E-6
17-67270102-G-A p.Ala921Val missense+splice_region ABCA5 2 83310 2.40067E-5 41655 0 NA
17-67270123-C-G p.Ser914Thr missense ABCA5 2 83316 2.4005E-5 41658 0 2.0677E-5
17-67270134-T-C p.Lys910Lys synonymous ABCA5 1 83334 1.19999E-5 41667 0 8.26228E-6
17-67270143-T-A p.Lys907Asn missense ABCA5 2 83306 2.40079E-5 41653 0 4.06352E-6
17-67270143-T-C p.Lys907Lys synonymous ABCA5 2 83306 2.40079E-5 41653 0 8.25314E-6
17-67270158-T-C p.Leu902Leu synonymous ABCA5 10 83248 1.20123E-4 41624 0 6.05366E-5
17-67270160-G-A p.Leu902Leu synonymous ABCA5 2 83248 2.40246E-5 41624 0 6.40656E-5
17-67270165-T-C p.Tyr900Cys missense ABCA5 3 83244 3.60386E-5 41622 0 NA
17-67270166-A-G p.Tyr900His missense ABCA5 2 83242 2.40263E-5 41621 0 0.00125313
17-67270180-A-T p.Leu895His missense ABCA5 3 83176 3.60681E-5 41588 0 3.19224E-5
17-67270208-AAG-A p.Ser885fs frameshift ABCA5 1 83010 1.20467E-5 41505 0 NA
17-67270209-A-G p.Ser885Ser synonymous ABCA5 46 83012 5.54137E-4 41506 0 0.00753769
17-67270212-G-C p.His884Gln missense ABCA5 7 82968 8.43699E-5 41484 1 5.03525E-4
17-67270252-A-G p.Ile871Thr missense ABCA5 86 82078 0.00104778 41039 0 0.00344593
17-67270262-G-A p.Leu868Leu synonymous ABCA5 1 81722 1.22366E-5 40861 0 3.30929E-5
17-67270269-C-CACTGATCTCACTGATTTA c.2595-1_2595insTAAATCAGTGAGATCAGT splice_acceptor ABCA5 1 81460 1.2276E-5 40730 0 NA
17-67270277-G-A c.2595-8C>T splice_region ABCA5 10 81080 1.23335E-4 40540 0 0.00118719
17-67273783-C-T p.Val865Met missense+splice_region ABCA5 10 82116 1.21779E-4 41058 0 7.1632E-4
17-67273799-A-C p.Ser859Arg missense ABCA5 1 82340 1.21448E-5 41170 0 NA
17-67273799-A-G p.Ser859Ser synonymous ABCA5 1 82340 1.21448E-5 41170 0 1.65777E-5
17-67273802-T-G p.Glu858Asp missense ABCA5 1 82352 1.2143E-5 41176 0 NA
17-67273806-C-T p.Arg857His missense ABCA5 8 82362 9.71322E-5 41181 0 6.37267E-5
17-67273807-G-A p.Arg857Cys missense ABCA5 1 82370 1.21403E-5 41185 0 1.08954E-4
17-67273834-C-T p.Ala848Thr missense ABCA5 1 82544 1.21148E-5 41272 0 1.17211E-4
17-67273839-G-T p.Thr846Lys missense ABCA5 43 82572 5.20758E-4 41286 0 8.60695E-4
17-67273861-G-A p.Leu839Phe missense ABCA5 1 82610 1.21051E-5 41305 0 NA
17-67273869-G-A p.Thr836Ile missense ABCA5 2 82600 2.42131E-5 41300 0 NA
17-67273882-C-A p.Ala832Ser missense ABCA5 67776 82032 0.826214 41016 28228 0.891875
17-67273882-C-G p.Ala832Pro missense ABCA5 1 82604 1.2106E-5 41302 0 6.38162E-5
17-67273884-G-A p.Ala831Val missense ABCA5 1 82598 1.21068E-5 41299 0 NA
17-67273884-G-C p.Ala831Gly missense ABCA5 1 82598 1.21068E-5 41299 0 8.2174E-6
17-67273885-C-T p.Ala831Thr missense ABCA5 20 82596 2.42142E-4 41298 0 0.00202429
17-67273910-G-A p.Ser822Ser synonymous ABCA5 1 82524 1.21177E-5 41262 0 NA
17-67273922-T-C p.Glu818Glu synonymous ABCA5 2 82308 2.4299E-5 41154 0 4.35973E-6
17-67273927-C-A p.Asp817Tyr missense ABCA5 63 82034 7.67974E-4 41017 0 0.00252525
17-67273928-A-T p.Phe816Leu missense ABCA5 2 82042 2.43778E-5 41021 0 1.66697E-5
17-67273933-A-AT p.Ser815fs frameshift ABCA5 2 81984 2.4395E-5 40992 0 NA
17-67273945-T-A p.Met811Leu missense ABCA5 1 81786 1.2227E-5 40893 0 9.02486E-6
17-67273947-T-G p.Glu810Ala missense ABCA5 2 81812 2.44463E-5 40906 0 NA
17-67273949-T-C p.Glu809Glu synonymous ABCA5 1 81774 1.22288E-5 40887 0 NA
17-67273975-C-A p.Val801Leu missense ABCA5 1 81240 1.23092E-5 40620 0 NA
17-67273977-C-T p.Ser800Asn missense ABCA5 4 80972 4.93998E-5 40486 0 1.76078E-5
17-67273981-A-C p.Tyr799Asp missense+splice_region ABCA5 1 80824 1.23726E-5 40412 0 NA
17-67273986-A-G c.2393-3T>C splice_region ABCA5 1 80004 1.24994E-5 40002 0 3.18593E-5
17-67280125-C-A p.Lys787Asn missense ABCA5 3 83042 3.61263E-5 41521 0 NA
17-67280135-A-T p.Val784Glu missense ABCA5 1 83044 1.20418E-5 41522 0 NA
17-67280136-C-T p.Val784Ile missense ABCA5 2 83026 2.40888E-5 41513 0 6.37511E-5
17-67280137-G-A p.Asp783Asp synonymous ABCA5 7 83030 8.43069E-5 41515 0 1.24265E-4
17-67280146-A-C p.Thr780Thr synonymous ABCA5 1 83054 1.20404E-5 41527 0 NA
17-67280149-C-T p.Thr779Thr synonymous ABCA5 7 83048 8.42886E-5 41524 1 1.22668E-5
17-67280150-G-A p.Thr779Met missense ABCA5 5 83040 6.02119E-5 41520 0 1.0804E-4
17-67280161-A-G p.Gly775Gly synonymous ABCA5 1 83058 1.20398E-5 41529 0 3.18532E-5
17-67280163-C-G p.Gly775Arg missense ABCA5 3 83052 3.61219E-5 41526 0 NA
17-67280177-C-T p.Gly770Asp missense ABCA5 1 82970 1.20525E-5 41485 0 4.12133E-6
17-67280184-T-C p.Asn768Asp missense ABCA5 712 82912 0.00858742 41456 22 0.0164797
17-67280192-C-T p.Ser765Asn missense ABCA5 1 82872 1.20668E-5 41436 0 3.53619E-5
17-67280194-G-C p.Asp764Glu missense ABCA5 1 82860 1.20685E-5 41430 0 1.75273E-5
17-67280200-G-A p.Ala762Ala synonymous ABCA5 1 82736 1.20866E-5 41368 0 NA
17-67280204-GA-G p.Ser761fs frameshift ABCA5 2 82216 2.43262E-5 41108 0 9.68823E-6
17-67280204-G-C p.Ser761Cys missense ABCA5 1 82216 1.21631E-5 41108 0 6.4E-5
17-67280210-A-C p.Leu759Trp missense ABCA5 1 82082 1.21829E-5 41041 0 9.55901E-5
17-67280215-T-TG c.2273-3_2273-2insC splice_region ABCA5 1 81808 1.22237E-5 40904 0 NA
17-67280220-G-GA c.2273-8_2273-7insT splice_region ABCA5 14 81784 1.71183E-4 40892 0 1.61749E-4
17-67282031-A-G c.2272+8T>C splice_region ABCA5 3 82794 3.62345E-5 41397 0 1.27413E-4
17-67282040-TG-T p.Ser757fs frameshift ABCA5 2 82864 2.41359E-5 41432 0 NA
17-67282046-T-C p.Lys755Lys synonymous ABCA5 7 82878 8.44615E-5 41439 0 4.42963E-5
17-67282054-T-C p.Met753Val missense ABCA5 1 82912 1.2061E-5 41456 0 1.20341E-5
17-67282075-A-G p.Tyr746His missense ABCA5 1 83024 1.20447E-5 41512 0 NA
17-67282076-C-T p.Val745Val synonymous ABCA5 8 83024 9.63577E-5 41512 0 1.59593E-4
17-67282103-T-C p.Leu736Leu synonymous ABCA5 6 83136 7.21709E-5 41568 0 2.79033E-5
17-67282106-A-G p.Thr735Thr synonymous ABCA5 3 83124 3.60907E-5 41562 0 NA
17-67282107-G-C p.Thr735Ser missense ABCA5 2 83122 2.4061E-5 41561 0 NA
17-67282120-T-C p.Ile731Val missense ABCA5 1 83132 1.20291E-5 41566 0 3.1841E-5
17-67282124-T-C p.Gln729Gln synonymous ABCA5 1 83138 1.20282E-5 41569 0 8.24647E-6
17-67282126-G-T p.Gln729Lys missense ABCA5 1 83138 1.20282E-5 41569 0 NA
17-67282146-G-GTTAAT p.Ser722fs frameshift ABCA5 1 83110 1.20322E-5 41555 0 NA
17-67282146-GA-G p.Ser722fs frameshift ABCA5 1 83114 1.20317E-5 41557 0 NA
17-67282149-TCTGTGGCAC-T p.Cys718_Glu721delinsTer stop_gained ABCA5 1 83084 1.2036E-5 41542 0 NA
17-67282151-T-C p.Thr720Thr synonymous ABCA5 1 83078 1.20369E-5 41539 0 NA
17-67282159-A-C p.Cys718Gly missense ABCA5 2 83062 2.40784E-5 41531 0 8.27979E-6
17-67282160-A-G p.Tyr717Tyr synonymous ABCA5 5 83044 6.0209E-5 41522 0 2.00895E-5
17-67282180-T-TCAGGCGGTAGCCGATCCCCCATTTACTTTTGAGGAACATTGA c.2133-3_2133-2insTCAATGTTCCTCAAAAGTAAATGGGGGATCGGCTACCGCCTG splice_region ABCA5 5 82894 6.0318E-5 41447 2 NA
17-67282358-A-G c.2132+4T>C splice_region ABCA5 2 82932 2.41161E-5 41466 0 NA
17-67282363-T-G p.Ser711Arg missense+splice_region ABCA5 2 82960 2.4108E-5 41480 0 NA
17-67282365-A-C p.Leu710Arg missense ABCA5 1 82968 1.20528E-5 41484 0 NA
17-67282369-G-A p.Arg709Cys missense ABCA5 4 82986 4.82009E-5 41493 0 6.37267E-5
17-67282371-T-C p.Tyr708Cys missense ABCA5 14 83018 1.68638E-4 41509 0 6.25E-4
17-67282375-C-T p.Gly707Ser missense ABCA5 2 83032 2.40871E-5 41516 0 6.37186E-5
17-67282375-C-A p.Gly707Cys missense ABCA5 1 83032 1.20435E-5 41516 0 4.19048E-6
17-67282375-CGATCCCCCATTTACTTTTGAG-C p.Leu700_Ile706del conservative_inframe_deletion ABCA5 2 83032 2.40871E-5 41516 0 3.18593E-5
17-67282376-G-A p.Ile706Ile synonymous ABCA5 3 83054 3.61211E-5 41527 0 4.14145E-4
17-67282376-G-C p.Ile706Met missense ABCA5 1 83054 1.20404E-5 41527 0 NA
17-67282383-C-T p.Trp704* stop_gained ABCA5 2 83088 2.40709E-5 41544 0 NA
17-67282402-T-C p.Met1? start_lost ABCA5 3 83106 3.60985E-5 41553 0 9.25086E-5
17-67282421-C-T p.Leu691Leu synonymous ABCA5 5 83040 6.02119E-5 41520 0 1.32433E-4
17-67282429-C-T p.Gly689Arg missense ABCA5 2 82996 2.40975E-5 41498 0 2.48649E-5
17-67282430-T-C p.Gln688Gln synonymous ABCA5 1 82994 1.20491E-5 41497 0 4.36095E-6
17-67282449-C-T p.Arg682Lys missense ABCA5 4 82878 4.82637E-5 41439 0 1.27445E-4
17-67282456-C-G c.2042-4G>C splice_region ABCA5 1 82770 1.20817E-5 41385 0 8.45437E-6
17-67283746-A-T c.2041+8T>A splice_region ABCA5 1 82678 1.20951E-5 41339 0 2.50417E-5
17-67283755-T-A p.Ala680Ala splice_region+synonymous ABCA5 1 82784 1.20796E-5 41392 0 NA
17-67283779-G-T p.Phe672Leu missense ABCA5 1 82794 1.20782E-5 41397 0 NA
17-67283780-A-G p.Phe672Ser missense ABCA5 1 82796 1.20779E-5 41398 0 NA
17-67283785-A-C p.Thr670Thr synonymous ABCA5 1 82782 1.20799E-5 41391 0 NA
17-67283789-C-T p.Ser669Asn missense ABCA5 1 82786 1.20793E-5 41393 0 4.12133E-5
17-67283798-G-A p.Thr666Ile missense ABCA5 2 82778 2.4161E-5 41389 0 NA
17-67283802-C-T p.Val665Met missense ABCA5 1 82740 1.20861E-5 41370 0 3.98629E-6
17-67283804-C-T p.Arg664Gln missense ABCA5 3 82738 3.6259E-5 41369 0 1.99314E-5
17-67283807-T-C p.Asn663Ser missense ABCA5 10 82728 1.20878E-4 41364 0 0.00100705
17-67283838-C-A p.Val653Leu missense ABCA5 14 82760 1.69164E-4 41380 0 8.24511E-5
17-67283844-G-A p.His651Tyr missense ABCA5 4 82796 4.83115E-5 41398 0 5.03525E-4
17-67283846-C-T p.Arg650Gln missense ABCA5 1 82798 1.20776E-5 41399 0 1.19603E-5
17-67283847-G-A p.Arg650* stop_gained ABCA5 1 82796 1.20779E-5 41398 0 3.98772E-6
17-67283859-C-G p.Asp646His missense ABCA5 1 82830 1.20729E-5 41415 0 NA
17-67283891-A-G p.Ile635Thr missense+splice_region ABCA5 1 82854 1.20694E-5 41427 0 NA
17-67283897-G-A c.1903-5C>T splice_region ABCA5 4 82794 4.83127E-5 41397 0 6.36902E-5
17-67285320-T-G p.Lys634Gln missense+splice_region ABCA5 2 82904 2.41243E-5 41452 0 6.37796E-5
17-67285328-C-G p.Gly631Ala missense ABCA5 1 82942 1.20566E-5 41471 0 6.25782E-4
17-67285353-G-A p.Leu623Leu synonymous ABCA5 2 83032 2.40871E-5 41516 0 3.19142E-5
17-67285360-T-C p.Lys620Lys synonymous ABCA5 1 83052 1.20406E-5 41526 0 NA
17-67285360-T-G p.Lys620Asn missense ABCA5 3 83052 3.61219E-5 41526 0 3.31702E-5
17-67285363-T-C p.Gln619Gln synonymous ABCA5 1 83058 1.20398E-5 41529 0 4.0294E-6
17-67285384-A-G p.Ala612Ala synonymous ABCA5 1 82970 1.20525E-5 41485 0 NA
17-67285390-G-A p.Asn610Asn synonymous ABCA5 2 82922 2.41191E-5 41461 0 4.07854E-6
17-67285391-T-C p.Asn610Ser missense ABCA5 5 82936 6.02874E-5 41468 0 6.25E-4
17-67285393-A-G p.Asp609Asp synonymous ABCA5 1 82926 1.20589E-5 41463 0 1.66561E-5
17-67285407-G-C p.Gln605Glu missense ABCA5 2 82804 2.41534E-5 41402 0 NA
17-67285409-A-C p.Met604Arg missense ABCA5 7 82796 8.45452E-5 41398 0 3.34314E-5
17-67285413-C-G p.Asp603His missense ABCA5 4 82730 4.83501E-5 41365 0 3.34773E-5
17-67285413-C-T p.Asp603Asn missense ABCA5 5 82730 6.04376E-5 41365 0 3.79689E-5
17-67286010-A-G p.Ile592Thr missense ABCA5 3 82066 3.65559E-5 41033 0 NA
17-67286014-T-C p.Ile591Val missense ABCA5 2 82182 2.43362E-5 41091 0 3.18492E-5
17-67286016-T-C p.Asn590Ser missense ABCA5 1 82222 1.21622E-5 41111 0 3.18532E-5
17-67286018-G-C p.Asn589Lys missense ABCA5 1 82304 1.21501E-5 41152 0 8.40138E-6
17-67286022-G-C p.Ala588Gly missense ABCA5 1 82300 1.21507E-5 41150 0 4.03701E-6
17-67286027-T-C p.Ile586Met missense ABCA5 1 82342 1.21445E-5 41171 0 NA
17-67286029-T-A p.Ile586Leu missense ABCA5 4 82368 4.85625E-5 41184 0 3.34074E-4
17-67286033-TTTGA-T p.Ile583fs frameshift ABCA5 1 82410 1.21345E-5 41205 0 1.66806E-5
17-67286034-T-C p.Lys584Arg missense ABCA5 1 82440 1.213E-5 41220 0 3.18654E-5
17-67286080-C-G p.Asp569His missense ABCA5 1 82656 1.20983E-5 41328 0 NA
17-67286088-A-AT p.Ile566fs frameshift ABCA5 1 82676 1.20954E-5 41338 0 1.19942E-5
17-67286108-G-A p.Gly559Gly synonymous ABCA5 1 82576 1.21101E-5 41288 0 3.99824E-6
17-67286116-T-C p.Met557Val missense ABCA5 2 82528 2.42342E-5 41264 0 NA
17-67286122-T-G p.Arg555Arg synonymous ABCA5 2 82494 2.42442E-5 41247 0 3.18715E-5
17-67286122-T-C p.Arg555Gly missense ABCA5 1 82494 1.21221E-5 41247 0 NA
17-67286124-G-T p.Ala554Glu missense ABCA5 1 82466 1.21262E-5 41233 0 NA
17-67286139-T-C p.Asp549Gly missense ABCA5 13 82252 1.58051E-4 41126 0 NA
17-67286142-A-G p.Ile548Thr missense ABCA5 3 82158 3.6515E-5 41079 0 8.35562E-6
17-67286153-T-A p.Arg544Ser missense ABCA5 1 81860 1.2216E-5 40930 0 NA
17-67286163-T-C p.Tyr541Cys missense ABCA5 11 81440 1.35069E-4 40720 0 6.25E-4
17-67286164-A-G p.Tyr541His missense ABCA5 5 81404 6.1422E-5 40702 1 1.71904E-5
17-67286165-T-C p.Ile540Met missense ABCA5 1 81402 1.22847E-5 40701 0 6.37267E-5
17-67286184-AG-A c.1607-7delC splice_region ABCA5 10 79828 1.25269E-4 39914 0 7.07571E-5
17-67287353-T-G c.1606+4A>C splice_region ABCA5 1 81232 1.23104E-5 40616 0 NA
17-67287358-A-G p.Asp535Asp splice_region+synonymous ABCA5 3028 81218 0.0372824 40609 75 0.075625
17-67287376-T-C p.Gly529Gly synonymous ABCA5 10 82130 1.21758E-4 41065 0 1.91877E-4
17-67287379-A-G p.Cys528Cys synonymous ABCA5 2 82202 2.43303E-5 41101 0 9.56389E-5
17-67287389-T-C p.Asn525Ser missense ABCA5 2 82320 2.42954E-5 41160 0 4.00452E-6
17-67287389-T-G p.Asn525Thr missense ABCA5 3 82320 3.64431E-5 41160 0 NA
17-67287395-A-C p.Leu523Trp missense ABCA5 1 82418 1.21333E-5 41209 0 NA
17-67287446-T-A p.Glu506Val missense ABCA5 1 82236 1.21601E-5 41118 0 NA
17-67287447-C-A p.Glu506* stop_gained ABCA5 1 82212 1.21637E-5 41106 0 NA
17-67287450-A-G p.Tyr505His missense ABCA5 1 82142 1.2174E-5 41071 0 5.00158E-5
17-67287451-T-C p.Ile504Met missense ABCA5 1 82132 1.21755E-5 41066 0 6.66945E-5
17-67287453-T-A p.Ile504Leu missense ABCA5 1 82070 1.21847E-5 41035 0 NA
17-67287465-A-C p.Leu500Val missense+splice_region ABCA5 11 81650 1.34721E-4 40825 0 5.04032E-4
17-67287475-A-G c.1496-8T>C splice_region ABCA5 3 81122 3.69813E-5 40561 0 6.08664E-5
17-67290789-T-G c.1495+7A>C splice_region ABCA5 1 81838 1.22193E-5 40919 0 8.2526E-6
17-67290797-T-G p.Arg498Ser missense+splice_region ABCA5 1 81954 1.2202E-5 40977 0 NA
17-67290811-C-T p.Val494Met missense ABCA5 1 82004 1.21945E-5 41002 0 1.65057E-5
17-67290812-A-G p.Asn493Asn synonymous ABCA5 12 82022 1.46302E-4 41011 0 1.73305E-4
17-67290831-T-G p.Tyr487Ser missense ABCA5 1 81896 1.22106E-5 40948 0 NA
17-67290835-T-C p.Thr486Ala missense ABCA5 1 81832 1.22202E-5 40916 0 3.18593E-5
17-67290840-T-C p.Gln484Arg missense ABCA5 11796 81076 0.145493 40538 926 0.156318
17-67290847-C-G p.Gly482Arg missense ABCA5 1 81506 1.2269E-5 40753 0 NA
17-67290853-T-C p.Ile480Val missense+splice_region ABCA5 2 81284 2.46051E-5 40642 0 NA
17-67293328-A-G c.1436+4T>C splice_region ABCA5 6 82770 7.249E-5 41385 0 8.28693E-6
17-67293329-T-C c.1436+3A>G splice_region ABCA5 1 82762 1.20828E-5 41381 0 1.65728E-5
17-67293337-G-C p.Ala477Ala synonymous ABCA5 1 82848 1.20703E-5 41424 0 1.59347E-4
17-67293342-C-T p.Glu476Lys missense ABCA5 1 82654 1.20986E-5 41327 0 0.0298787
17-67293343-T-C p.Lys475Lys synonymous ABCA5 17 82870 2.05141E-4 41435 0 8.87849E-5
17-67293347-C-T p.Gly474Glu missense ABCA5 3 82852 3.62091E-5 41426 0 5.05511E-4
17-67293357-C-T p.Glu471Lys missense ABCA5 2 82920 2.41196E-5 41460 0 NA
17-67293361-A-G p.Ser469Ser synonymous ABCA5 1 82946 1.2056E-5 41473 0 4.4214E-5
17-67293363-A-C p.Ser469Ala missense ABCA5 721 82938 0.00869324 41469 22 0.0165042
17-67293363-A-T p.Ser469Thr missense ABCA5 1 82946 1.2056E-5 41473 0 NA
17-67293370-C-T p.Glu466Glu synonymous ABCA5 2 82952 2.41103E-5 41476 0 3.18776E-5
17-67293389-C-T p.Ser460Asn missense ABCA5 1 82984 1.20505E-5 41492 0 NA
17-67293393-T-C p.Ile459Val missense ABCA5 2 82996 2.40975E-5 41498 0 8.26255E-6
17-67293420-AC-CA p.GluLeu449AspVal missense ABCA5 1 82992 1.20494E-5 41496 0 NA
17-67293421-C-T p.Glu449Glu synonymous ABCA5 1 82984 1.20505E-5 41492 0 3.18593E-5
17-67293428-T-A p.Tyr447Phe missense ABCA5 1 82976 1.20517E-5 41488 0 NA
17-67293442-C-T p.Lys442Lys synonymous ABCA5 2 82934 2.41156E-5 41467 0 1.27551E-4
17-67293455-G-A p.Ser438Leu missense ABCA5 2 82850 2.414E-5 41425 0 8.26952E-6
17-67293459-G-C p.Pro437Ala missense ABCA5 13 82834 1.5694E-4 41417 0 2.23257E-4
17-67293465-GAA-G p.Phe434fs frameshift ABCA5 1 82810 1.20758E-5 41405 0 NA
17-67293470-TA-T p.Tyr433fs frameshift ABCA5 1 82770 1.20817E-5 41385 0 NA
17-67293473-A-G p.Leu432Ser missense ABCA5 1 82762 1.20828E-5 41381 0 NA
17-67293477-A-T p.Ser431Thr missense ABCA5 1 82726 1.20881E-5 41363 0 8.28871E-6
17-67293485-C-T p.Arg428Gln missense ABCA5 5 82584 6.05444E-5 41292 0 7.47235E-5
17-67293486-G-A p.Arg428Trp missense ABCA5 1 82564 1.21118E-5 41282 0 7.54168E-5
17-67293500-C-T p.Gly423Glu missense+splice_region ABCA5 1 82430 1.21315E-5 41215 0 NA
17-67297277-T-C c.1267+3A>G splice_region ABCA5 2 80718 2.47776E-5 40359 0 NA
17-67297318-T-C p.Tyr410Cys missense ABCA5 1 82762 1.20828E-5 41381 0 6.37389E-5
17-67297326-A-G p.Ser407Ser synonymous ABCA5 3 82836 3.62161E-5 41418 0 1.71421E-5
17-67297329-A-G p.Asn406Asn synonymous ABCA5 1 82972 1.20523E-5 41486 0 0.00100705
17-67297349-T-C p.Ile400Val missense ABCA5 1 83026 1.20444E-5 41513 0 8.25191E-6
17-67297359-T-C p.Leu396Leu synonymous ABCA5 3 83006 3.6142E-5 41503 0 4.12752E-6
17-67297374-T-C p.Ala391Ala synonymous ABCA5 2 82946 2.41121E-5 41473 0 8.41255E-6
17-67297380-C-T p.Leu389Leu synonymous ABCA5 1 82882 1.20653E-5 41441 0 4.2213E-6
17-67297394-A-C p.Ser385Ala missense ABCA5 1 82792 1.20785E-5 41396 0 NA
17-67297396-G-C p.Ala384Gly missense ABCA5 6 82738 7.25181E-5 41369 0 3.30857E-5
17-67297397-C-T p.Ala384Thr missense ABCA5 1 82740 1.20861E-5 41370 0 NA
17-67297398-AC-A p.Gly383fs frameshift ABCA5 1 82716 1.20896E-5 41358 0 NA
17-67297398-A-G p.Gly383Gly synonymous ABCA5 1 82716 1.20896E-5 41358 0 NA
17-67297400-C-T p.Gly383Ser missense ABCA5 1 82684 1.20942E-5 41342 0 NA
17-67297406-TA-T p.Phe380fs frameshift ABCA5 1 82610 1.21051E-5 41305 0 4.41645E-6
17-67297420-T-C p.His376Arg missense ABCA5 1 82352 1.2143E-5 41176 0 3.18817E-5
17-67297427-C-G p.Val374Leu missense+splice_region ABCA5 3 82110 3.65364E-5 41055 0 3.18898E-5
17-67298852-T-C c.1119+7A>G splice_region ABCA5 5 79880 6.25939E-5 39940 0 3.8553E-5
17-67298858-C-A c.1119+1G>T splice_donor ABCA5 1 80342 1.24468E-5 40171 0 NA
17-67298881-G-A p.Thr366Ile missense ABCA5 2 82194 2.43327E-5 41097 0 9.05928E-6
17-67298901-GAAAAGCCACACT-G p.Leu355_Leu358del disruptive_inframe_deletion ABCA5 2 82458 2.42548E-5 41229 0 3.83413E-5
17-67298907-C-G p.Trp357Cys missense ABCA5 5 82514 6.05958E-5 41257 0 1.67844E-5
17-67298909-A-T p.Trp357Arg missense ABCA5 1 82540 1.21153E-5 41270 0 NA
17-67298911-A-T p.Val356Glu missense ABCA5 3 82562 3.63363E-5 41281 0 3.77789E-5
17-67298915-A-G p.Leu355Leu synonymous ABCA5 1 82586 1.21086E-5 41293 0 NA
17-67298916-C-T p.Ser354Ser synonymous ABCA5 100 82568 0.00121112 41284 0 8.61079E-4
17-67298919-T-C p.Lys353Lys synonymous ABCA5 1 82592 1.21077E-5 41296 0 1.66978E-5
17-67298928-A-C p.Ser350Arg missense ABCA5 1 82628 1.21024E-5 41314 0 3.18674E-5
17-67298935-ATGAGG-A p.Leu347fs frameshift ABCA5 1 82576 1.21101E-5 41288 0 NA
17-67298957-T-C p.Ile341Val missense ABCA5 1 82498 1.21215E-5 41249 0 NA
17-67298987-C-G p.Glu331Gln missense ABCA5 1 82070 1.21847E-5 41035 0 NA
17-67298995-C-A p.Gly328Val missense ABCA5 2 81906 2.44182E-5 40953 0 6.37714E-5
17-67298999-CAT-C p.His326fs frameshift ABCA5 9 81804 1.10019E-4 40902 0 5.03525E-4
17-67299008-A-AT p.Ser324fs frameshift ABCA5 1 81326 1.22962E-5 40663 0 NA
17-67299017-A-G p.Phe321Leu missense ABCA5 12 80552 1.48972E-4 40276 0 7.28368E-4
17-67299046-A-C p.Val311Gly missense+splice_region ABCA5 1 78386 1.27574E-5 39193 0 NA
17-67299051-T-C c.931-4A>G splice_region ABCA5 1 77670 1.2875E-5 38835 0 2.45128E-5
17-67300756-T-C p.Thr191Thr synonymous ABCA5 1 78220 1.27845E-5 39110 0 NA
17-67300757-G-A p.Thr191Ile missense ABCA5 3 78462 3.82351E-5 39231 0 NA
17-67300769-T-A p.Lys187Ile missense ABCA5 1 79420 1.25913E-5 39710 0 NA
17-67300776-GTTC-G p.Glu184del conservative_inframe_deletion ABCA5 2 79638 2.51136E-5 39819 0 5.57693E-6
17-67300788-TATCAC-T p.Cys179fs frameshift ABCA5 2 80954 2.47054E-5 40477 0 NA
17-67300799-A-C p.Leu177* stop_gained ABCA5 1 81054 1.23375E-5 40527 0 NA
17-67300800-A-C p.Leu177Val missense ABCA5 14 81098 1.72631E-4 40549 0 6.30517E-4
17-67300822-A-G p.Tyr306Tyr synonymous ABCA5 1 82124 1.21767E-5 41062 0 NA
17-67300835-A-G p.Leu302Pro missense ABCA5 4 82504 4.84825E-5 41252 0 NA
17-67300854-T-C p.Ser296Gly missense ABCA5 1 82872 1.20668E-5 41436 0 NA
17-67300869-A-G p.Phe291Leu missense ABCA5 2 82910 2.41225E-5 41455 0 7.21917E-5
17-67300870-T-C p.Leu290Leu synonymous ABCA5 6 82900 7.23764E-5 41450 0 1.6697E-5
17-67300877-G-A p.Ser288Phe missense ABCA5 3 82906 3.61856E-5 41453 0 3.33117E-5
17-67300877-G-C p.Ser288Cys missense ABCA5 1 82908 1.20616E-5 41454 0 6.25E-4
17-67300885-C-T p.Ala285Ala synonymous ABCA5 6 82894 7.23816E-5 41447 0 3.6194E-5
17-67300886-G-A p.Ala285Val missense ABCA5 3 82896 3.61899E-5 41448 0 2.49227E-5
17-67300905-G-T p.Leu279Ile missense ABCA5 2 82888 2.41289E-5 41444 0 NA
17-67300910-A-G p.Met277Thr missense ABCA5 1 82872 1.20668E-5 41436 0 2.49E-5
17-67300925-C-G p.Ser272Thr missense ABCA5 29 82778 3.50335E-4 41389 0 0.00108418
17-67300927-T-C p.Thr271Thr synonymous ABCA5 1 82760 1.20831E-5 41380 0 8.3102E-6
17-67300928-G-C p.Thr271Arg missense ABCA5 1 82712 1.20901E-5 41356 0 NA
17-67300930-A-G p.Tyr270Tyr synonymous ABCA5 1 82718 1.20893E-5 41359 0 3.18532E-5
17-67300941-C-T p.Val267Ile missense ABCA5 2 82492 2.42448E-5 41246 0 4.25474E-6
17-67300942-C-T p.Trp266* stop_gained ABCA5 1 82544 1.21148E-5 41272 0 6.37633E-5
17-67300958-TG-T c.789-8delC splice_region ABCA5 35 82226 4.25656E-4 41113 0 0.00105196
17-67300959-G-A c.789-8C>T splice_region ABCA5 2 82194 2.43327E-5 41097 0 8.38997E-6
17-67302867-A-G p.Trp263Arg missense+splice_region ABCA5 6 75668 7.92938E-5 37834 0 2.59387E-4
17-67302869-A-G p.Phe262Ser missense ABCA5 3 75810 3.95726E-5 37905 0 8.82561E-5
17-67302873-C-A p.Ala261Ser missense ABCA5 60 76534 7.83965E-4 38267 0 0.00112663
17-67302879-C-A p.Asp259Tyr missense ABCA5 1 78266 1.27769E-5 39133 0 NA
17-67302882-G-A p.His258Tyr missense ABCA5 1 78396 1.27558E-5 39198 0 2.01304E-5
17-67302906-C-A p.Glu250* stop_gained ABCA5 1 80754 1.23833E-5 40377 0 3.21461E-5
17-67302908-T-C p.Lys249Arg missense ABCA5 1 80894 1.23619E-5 40447 0 NA
17-67302910-TA-T p.Ile248fs frameshift ABCA5 1 80894 1.23619E-5 40447 0 8.8987E-6
17-67302911-A-AT p.Ile248fs frameshift ABCA5 5 80896 6.18078E-5 40448 0 0.00755287
17-67302911-A-G p.Ile248Thr missense ABCA5 2 80924 2.47145E-5 40462 0 7.59694E-5
17-67302911-AT-A p.Ile248fs frameshift ABCA5 5 80922 6.17879E-5 40461 0 5.29172E-4
17-67302933-C-T p.Val241Ile missense ABCA5 15 81892 1.83168E-4 40946 0 5.03525E-4
17-67302934-G-A p.Ile240Ile synonymous ABCA5 1 82100 1.21803E-5 41050 0 7.68233E-5
17-67302966-A-C p.Ser230Ala missense ABCA5 2 82626 2.42055E-5 41313 0 NA
17-67302981-G-C p.Leu225Val missense ABCA5 2 82808 2.41523E-5 41404 0 NA
17-67302982-G-T p.Tyr224* stop_gained ABCA5 1 82814 1.20753E-5 41407 0 NA
17-67302993-T-G p.Ile221Leu missense ABCA5 1 82860 1.20685E-5 41430 0 NA
17-67303001-C-T p.Arg218Gln missense ABCA5 1 82828 1.20732E-5 41414 0 6.41026E-5
17-67303005-G-A p.Pro217Ser missense ABCA5 2 82850 2.414E-5 41425 0 6.11875E-5
17-67303010-G-T p.Thr215Asn missense ABCA5 3 82838 3.62153E-5 41419 0 3.27343E-4
17-67303032-T-C p.Thr208Ala missense ABCA5 2 82552 2.42272E-5 41276 0 NA
17-67303053-T-C p.Lys201Glu missense ABCA5 1 82358 1.21421E-5 41179 0 4.25829E-6
17-67303055-G-A p.Thr200Ile missense ABCA5 1 82390 1.21374E-5 41195 0 4.97934E-5
17-67303056-T-C p.Thr200Ala missense ABCA5 5 82408 6.06737E-5 41204 0 5.03525E-4
17-67303061-T-A p.Glu198Val missense ABCA5 1 82228 1.21613E-5 41114 0 NA
17-67303083-C-T p.Val191Ile missense ABCA5 1 81264 1.23056E-5 40632 0 1.96363E-5
17-67303085-T-C p.Asn190Ser missense ABCA5 136 81022 0.00167856 40511 2 0.0110775
17-67303100-A-G c.559-5T>C splice_region ABCA5 1 80140 1.24782E-5 40070 0 1.02173E-5
17-67304413-A-T c.558+8T>A splice_region ABCA5 2 81614 2.45056E-5 40807 0 3.18552E-5
17-67304422-T-C p.Gln186Arg missense+splice_region ABCA5 1 81984 1.21975E-5 40992 0 1.65637E-5
17-67304425-A-G p.Ile185Thr missense ABCA5 2 82102 2.43599E-5 41051 0 NA
17-67304426-T-A p.Ile185Leu missense ABCA5 1 82126 1.21764E-5 41063 0 NA
17-67304436-A-T p.Asp181Glu missense ABCA5 3 82340 3.64343E-5 41170 0 NA
17-67304447-C-T p.Ala178Thr missense ABCA5 11332 82144 0.137953 41072 808 0.138497
17-67304452-A-G p.Leu176Ser missense ABCA5 1 82496 1.21218E-5 41248 0 3.98692E-6
17-67304456-C-T p.Val175Ile missense ABCA5 2 82496 2.42436E-5 41248 0 3.18613E-5
17-67304491-C-T p.Cys163Tyr missense ABCA5 1 82470 1.21256E-5 41235 0 1.65278E-5
17-67304498-T-C p.Lys161Glu missense ABCA5 2 82442 2.42595E-5 41221 0 1.59236E-4
17-67304502-A-G p.Cys159Cys synonymous ABCA5 2 82382 2.42771E-5 41191 0 3.98991E-6
17-67304503-C-T p.Cys159Tyr missense ABCA5 1 82370 1.21403E-5 41185 0 2.5481E-4
17-67304512-A-G c.470-3T>C splice_region ABCA5 3 82164 3.65123E-5 41082 0 4.13572E-5
17-67304513-T-TG c.470-5_470-4insC splice_region ABCA5 1 82164 1.21708E-5 41082 0 3.99754E-6
17-67304514-G-A c.470-5C>T splice_region ABCA5 1 82170 1.21699E-5 41085 0 NA
17-67304515-G-T c.470-6C>A splice_region ABCA5 1 82138 1.21746E-5 41069 0 4.00013E-6
17-67305407-T-TG p.Arg156fs frameshift ABCA5 4 82400 4.85437E-5 41200 0 4.26435E-5
17-67305430-C-T p.Val148Ile missense ABCA5 10 82688 1.20937E-4 41344 0 7.85285E-5
17-67305432-G-A p.Pro147Leu missense ABCA5 1 82728 1.20878E-5 41364 0 5.01153E-5
17-67305439-T-C p.Met145Val missense ABCA5 9 82766 1.0874E-4 41383 0 5.03525E-4
17-67305453-C-T p.Arg140His missense ABCA5 2 82790 2.41575E-5 41395 0 8.39356E-6
17-67305462-T-C p.Tyr137Cys missense ABCA5 2 82874 2.4133E-5 41437 0 2.48184E-5
17-67305463-A-G p.Tyr137His missense ABCA5 1 82884 1.20651E-5 41442 0 NA
17-67305488-A-G p.Gly128Gly synonymous ABCA5 32 82922 3.85905E-4 41461 1 9.75255E-4
17-67305495-A-T p.Phe126Tyr missense ABCA5 2 82944 2.41127E-5 41472 0 4.10253E-6
17-67305501-C-T p.Ser124Asn missense ABCA5 1 82924 1.20592E-5 41462 0 3.18634E-5
17-67305503-C-T p.Pro123Pro synonymous ABCA5 4 82906 4.82474E-5 41453 0 1.59276E-4
17-67305504-G-A p.Pro123Leu missense ABCA5 2 82902 2.41249E-5 41451 0 6.37349E-5
17-67305505-G-A p.Pro123Ser missense ABCA5 1 82916 1.20604E-5 41458 0 4.15272E-6
17-67305508-TAGAG-T p.Lys122fs frameshift ABCA5 1 82950 1.20555E-5 41475 0 1.65659E-5
17-67305518-G-A p.Ser118Ser synonymous ABCA5 7 82888 8.44513E-5 41444 0 7.49051E-5
17-67305519-G-A p.Ser118Phe missense ABCA5 14 82870 1.68939E-4 41435 0 6.3464E-4
17-67305529-T-C p.Met115Val missense ABCA5 1 82858 1.20688E-5 41429 0 NA
17-67305543-G-A p.Thr110Ile missense ABCA5 5 82666 6.04844E-5 41333 0 9.56816E-5
17-67305547-A-G p.Tyr109His missense ABCA5 1 82660 1.20978E-5 41330 0 NA
17-67305564-A-T p.Val103Asp missense+splice_region ABCA5 1 82476 1.21247E-5 41238 0 NA
17-67305569-A-G c.308-5T>C splice_region ABCA5 32 82310 3.88774E-4 41155 0 4.13907E-4
17-67309240-T-C p.Leu100Leu synonymous ABCA5 5 81336 6.14734E-5 40668 0 2.51269E-5
17-67309244-T-C p.His99Arg missense ABCA5 8 81444 9.8227E-5 40722 0 2.87026E-4
17-67309253-G-A p.Ser96Phe missense ABCA5 2 81724 2.44726E-5 40862 0 4.0256E-6
17-67309258-T-C p.Lys94Lys synonymous ABCA5 1 81824 1.22214E-5 40912 0 1.6621E-5
17-67309271-C-T p.Ser90Asn missense ABCA5 10 81948 1.22029E-4 40974 0 1.59449E-4
17-67309272-T-C p.Ser90Gly missense ABCA5 1 81972 1.21993E-5 40986 0 NA
17-67309278-T-C p.Thr88Ala missense ABCA5 1 82048 1.2188E-5 41024 0 NA
17-67309292-G-A p.Pro83Leu missense ABCA5 1 82156 1.2172E-5 41078 0 1.66094E-5
17-67309295-G-C p.Thr82Ser missense ABCA5 1 82144 1.21737E-5 41072 0 3.99936E-6
17-67309298-T-C p.Tyr81Cys missense ABCA5 3 82166 3.65115E-5 41083 0 4.78164E-4
17-67309300-T-C p.Gly80Gly synonymous ABCA5 2 82154 2.43445E-5 41077 0 1.20012E-5
17-67309305-G-C p.Leu79Val missense ABCA5 1 82126 1.21764E-5 41063 0 3.18918E-5
17-67309350-T-C p.Ile64Val missense ABCA5 2 81856 2.44332E-5 40928 0 3.18796E-5
17-67309370-T-G p.Lys57Thr missense ABCA5 4 81412 4.91328E-5 40706 0 1.2191E-5
17-67309371-T-A p.Lys57* stop_gained ABCA5 1 81388 1.22868E-5 40694 0 NA
17-67309379-G-A p.Pro54Leu missense ABCA5 1 81206 1.23144E-5 40603 0 NA
17-67309389-T-C p.Met51Val missense ABCA5 1 81024 1.2342E-5 40512 0 NA
17-67309405-C-A p.Trp45Cys missense ABCA5 10 80084 1.24869E-4 40042 0 3.34726E-5
17-67309405-C-T p.Trp45* stop_gained ABCA5 1 80084 1.24869E-5 40042 0 4.78181E-6
17-67309411-TA-T p.Leu43fs frameshift ABCA5 5 79560 6.28457E-5 39780 0 1.60406E-4
17-67309429-A-C p.Leu37Leu synonymous ABCA5 2 78556 2.54595E-5 39278 0 2.916E-5
17-67309432-A-T p.Ile36Ile synonymous ABCA5 7 78308 8.93906E-5 39154 0 1.25951E-4
17-67309443-A-G c.103-6T>C splice_region ABCA5 1 76922 1.30002E-5 38461 0 7.0084E-6
17-67310452-T-A c.102+3A>T splice_region ABCA5 10 81798 1.22252E-4 40899 0 1.91034E-4
17-67310454-C-T c.102+1G>A splice_donor ABCA5 1 81878 1.22133E-5 40939 0 4.00413E-6
17-67310462-C-T p.Ser32Asn missense ABCA5 1 82182 1.21681E-5 41091 0 8.2791E-6
17-67310467-CT-C p.Lys30fs frameshift ABCA5 1 82268 1.21554E-5 41134 0 8.27582E-6
17-67310474-G-A p.Thr28Ile missense ABCA5 1 82336 1.21454E-5 41168 0 1.65377E-5
17-67310486-A-T p.Ile24Asn missense ABCA5 1 82550 1.21139E-5 41275 0 NA
17-67310495-T-C p.Asn21Ser missense ABCA5 2 82558 2.42254E-5 41279 0 6.25E-4
17-67310508-G-C p.Leu17Val missense ABCA5 1 82596 1.21071E-5 41298 0 2.4784E-5
17-67310509-T-C p.Thr16Thr synonymous ABCA5 13 82588 1.57408E-4 41294 1 2.54728E-4
17-67310513-C-G p.Arg15Thr missense ABCA5 5 82586 6.05429E-5 41293 0 3.1841E-5
17-67310516-G-A p.Thr14Ile missense ABCA5 13 82576 1.57431E-4 41288 0 4.45945E-4
17-67310550-T-C p.Thr3Ala missense ABCA5 1 82066 1.21853E-5 41033 0 NA
17-67310553-A-G p.Ser2Pro missense ABCA5 2 82004 2.43891E-5 41002 0 8.28102E-6
17-67310580-G-C c.-24C>G 5_prime_UTR_premature_start_codon_gain ABCA5 23 80652 2.85176E-4 40326 0 6.69131E-4
17-67310604-G-A c.-48C>T 5_prime_UTR_premature_start_codon_gain ABCA5 1 77342 1.29296E-5 38671 0 1.67381E-5
17-67310611-C-T c.-55G>A 5_prime_UTR_premature_start_codon_gain ABCA5 2 76104 2.62798E-5 38052 0 NA
17-67310638-G-A c.-82C>T 5_prime_UTR_premature_start_codon_gain ABCA5 12 70878 1.69305E-4 35439 0 1.91034E-4
17-67310703-T-C c.-147A>G 5_prime_UTR_premature_start_codon_gain ABCA5 1 52200 1.91571E-5 26100 0 NA
17-67310742-G-C c.-186C>G splice_region ABCA5 1 35350 2.82885E-5 17675 0 3.1835E-5
17-67310771-T-C c.-215A>G 5_prime_UTR_premature_start_codon_gain ABCA5 1 24304 4.11455E-5 12152 0 NA
17-67310866-A-C c.-310T>G 5_prime_UTR_premature_start_codon_gain ABCA5 1 3090 3.23625E-4 1545 0 3.1839E-5
17-67323215-T-A c.-38A>T 5_prime_UTR_premature_start_codon_gain ABCA5 1 1254 7.97448E-4 627 0 NA