Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
16-2326680-G-A p.Arg1704* stop_gained ABCA3 2 82938 2.41144E-5 41469 0 8.34822E-6
16-2326689-C-T p.Glu1701Lys missense ABCA3 67 82998 8.07248E-4 41499 1 0.00187922
16-2326691-G-A p.Ala1700Val missense ABCA3 1 82992 1.20494E-5 41496 0 1.19826E-5
16-2326692-C-T p.Ala1700Thr missense ABCA3 1 82974 1.2052E-5 41487 0 2.79624E-5
16-2326693-G-A p.Thr1699Thr synonymous ABCA3 24 83012 2.89115E-4 41506 0 0.0015121
16-2326697-G-A p.Pro1698Leu missense ABCA3 1 83030 1.20438E-5 41515 0 8.31878E-6
16-2326699-C-T p.Pro1697Pro synonymous ABCA3 1 83020 1.20453E-5 41510 0 6.25E-4
16-2326700-G-A p.Pro1697Leu missense ABCA3 1 83044 1.20418E-5 41522 0 3.18431E-5
16-2326703-T-C p.Gln1696Arg missense ABCA3 2 83056 2.40801E-5 41528 0 3.18492E-5
16-2326705-C-T p.Leu1695Leu synonymous ABCA3 2 83070 2.40761E-5 41535 0 3.98826E-6
16-2326714-G-A p.Phe1692Phe synonymous ABCA3 2 83122 2.4061E-5 41561 0 4.97785E-5
16-2326738-C-T p.Ser1684Ser synonymous ABCA3 1 83250 1.2012E-5 41625 0 1.65631E-5
16-2326738-C-A p.Ser1684Ser synonymous ABCA3 2 83250 2.4024E-5 41625 0 3.18532E-5
16-2326739-G-A p.Ser1684Leu missense ABCA3 1 83256 1.20111E-5 41628 0 1.19411E-5
16-2326750-C-T p.Val1680Val synonymous ABCA3 1 83266 1.20097E-5 41633 0 NA
16-2326752-C-T p.Val1680Met missense ABCA3 4 83272 4.80354E-5 41636 0 2.56623E-4
16-2326753-G-A p.Ser1679Ser synonymous ABCA3 2 83276 2.40165E-5 41638 0 5.03525E-4
16-2326761-C-T p.Asp1677Asn missense ABCA3 3 83272 3.60265E-5 41636 0 8.27636E-6
16-2326762-G-T p.Asp1676Glu missense ABCA3 2 83272 2.40177E-5 41636 0 3.18573E-5
16-2326767-C-T p.Val1675Met missense ABCA3 2 83292 2.40119E-5 41646 0 3.18593E-5
16-2326768-G-A p.Gly1674Gly synonymous ABCA3 13 83288 1.56085E-4 41644 0 3.50408E-4
16-2326770-C-T p.Gly1674Ser missense ABCA3 6 83290 7.20375E-5 41645 0 3.10369E-4
16-2326771-G-A p.Tyr1673Tyr synonymous ABCA3 4 83294 4.80227E-5 41647 0 4.96533E-5
16-2326788-T-C p.Lys1668Glu missense ABCA3 3 83256 3.60334E-5 41628 0 3.97912E-6
16-2326810-T-C c.4984-4A>G splice_region ABCA3 4 83122 4.8122E-5 41561 0 6.37227E-5
16-2326810-T-G c.4984-4A>C splice_region ABCA3 1 83122 1.20305E-5 41561 0 3.18613E-5
16-2327592-C-A c.4983+6G>T splice_region ABCA3 1 81058 1.23368E-5 40529 0 NA
16-2327601-C-T p.Ala1660Ala synonymous ABCA3 1 81364 1.22904E-5 40682 0 2.80622E-5
16-2327607-G-C p.Ser1658Arg missense ABCA3 2 81568 2.45194E-5 40784 0 1.60192E-5
16-2327615-C-A p.Asp1656Tyr missense ABCA3 1 81720 1.22369E-5 40860 0 NA
16-2327618-G-A p.Arg1655Cys missense ABCA3 1 81738 1.22342E-5 40869 0 1.71057E-5
16-2327622-C-T p.Pro1653Pro synonymous ABCA3 9 81788 1.10041E-4 40894 0 3.4153E-5
16-2327627-G-A p.Leu1652Leu synonymous ABCA3 1 81884 1.22124E-5 40942 0 8.51354E-6
16-2327637-G-A p.Val1648Val synonymous ABCA3 127 81986 0.00154904 40993 0 0.00114309
16-2327641-A-G p.Met1647Thr missense ABCA3 2 82040 2.43784E-5 41020 0 NA
16-2327653-T-G p.Glu1643Ala missense ABCA3 1 82062 1.21859E-5 41031 0 NA
16-2327657-C-T p.Asp1642Asn missense ABCA3 2 82098 2.43611E-5 41049 0 NA
16-2327666-C-T p.Val1639Ile missense ABCA3 5 82038 6.09474E-5 41019 0 4.25351E-5
16-2327667-G-A p.Ser1638Ser synonymous ABCA3 1 82002 1.21948E-5 41001 0 3.18634E-5
16-2327883-G-C p.Pro1636Ala missense ABCA3 4 81218 4.92502E-5 40609 0 3.18918E-5
16-2327884-A-G p.Phe1635Phe synonymous ABCA3 1 81226 1.23113E-5 40613 0 7.15717E-5
16-2327888-G-T p.Thr1634Asn missense ABCA3 1 81314 1.2298E-5 40657 0 1.621E-5
16-2327893-G-C p.Asp1632Glu missense ABCA3 1 81466 1.22751E-5 40733 0 6.45161E-4
16-2327897-A-G p.Val1631Ala missense ABCA3 2 81556 2.4523E-5 40778 0 NA
16-2327898-C-T p.Val1631Met missense ABCA3 3 81592 3.67683E-5 40796 0 9.56633E-5
16-2327903-G-A p.Ala1629Val missense ABCA3 2 81764 2.44606E-5 40882 0 NA
16-2327910-ACTC-A p.Glu1626del conservative_inframe_deletion ABCA3 2 81938 2.44087E-5 40969 0 9.64568E-5
16-2327912-T-A p.Glu1626Val missense ABCA3 1 81990 1.21966E-5 40995 0 NA
16-2327913-C-A p.Glu1626* stop_gained ABCA3 1 82048 1.2188E-5 41024 0 8.65516E-6
16-2327919-G-A p.Leu1624Leu synonymous ABCA3 7 82144 8.52162E-5 41072 0 1.20518E-5
16-2327920-C-T p.Ala1623Ala synonymous ABCA3 2 82176 2.4338E-5 41088 0 6.37918E-5
16-2327921-G-A p.Ala1623Val missense ABCA3 4 82224 4.86476E-5 41112 0 4.30849E-5
16-2327924-T-G p.Glu1622Ala missense ABCA3 3 82342 3.64334E-5 41171 0 4.01265E-6
16-2327929-T-C p.Gln1620Gln synonymous ABCA3 2 82382 2.42771E-5 41191 0 4.29023E-5
16-2327932-C-T p.Gly1619Gly synonymous ABCA3 2 82424 2.42648E-5 41212 0 1.71521E-5
16-2327944-C-T p.Val1615Val synonymous ABCA3 1 82500 1.21212E-5 41250 0 NA
16-2327946-C-T p.Val1615Met missense ABCA3 2 82488 2.4246E-5 41244 0 7.70535E-5
16-2327946-C-A p.Val1615Leu missense ABCA3 1 82488 1.2123E-5 41244 0 NA
16-2327955-G-A p.Arg1612Trp missense ABCA3 2 82486 2.42465E-5 41243 0 1.71474E-5
16-2327965-G-T p.Gly1608Gly synonymous ABCA3 1 82588 1.21083E-5 41294 0 8.48608E-6
16-2327967-C-T p.Gly1608Ser missense ABCA3 1 82592 1.21077E-5 41296 0 1.69699E-5
16-2327986-G-A p.Leu1601Leu synonymous ABCA3 4 82670 4.83851E-5 41335 0 4.00048E-6
16-2328004-C-T p.Leu1595Leu synonymous ABCA3 1 82700 1.20919E-5 41350 0 NA
16-2328026-A-G p.Val1588Ala missense ABCA3 1 82776 1.20808E-5 41388 0 NA
16-2328031-G-C p.Ile1586Met missense ABCA3 1 82804 1.20767E-5 41402 0 1.59795E-5
16-2328031-G-T p.Ile1586Ile synonymous ABCA3 1 82804 1.20767E-5 41402 0 1.19847E-5
16-2328042-G-A p.Arg1583Trp missense ABCA3 1 82770 1.20817E-5 41385 0 NA
16-2328044-G-C p.Thr1582Ser missense ABCA3 1 82790 1.20788E-5 41395 0 2.52802E-5
16-2328076-G-A c.4719-6C>T splice_region ABCA3 1 82722 1.20887E-5 41361 0 8.48033E-6
16-2328291-G-A p.His1572His splice_region+synonymous ABCA3 3 82838 3.62153E-5 41419 0 6.3743E-5
16-2328293-G-A p.His1572Tyr missense ABCA3 1 82850 1.207E-5 41425 0 8.3446E-6
16-2328303-G-C p.Ile1568Met missense ABCA3 1 82856 1.20691E-5 41428 0 NA
16-2328305-T-C p.Ile1568Val missense ABCA3 1 82860 1.20685E-5 41430 0 4.03939E-6
16-2328325-C-T p.Arg1561Gln missense ABCA3 5 82880 6.03282E-5 41440 0 6.37146E-5
16-2328332-G-A p.Arg1559* stop_gained ABCA3 1 82848 1.20703E-5 41424 0 8.31048E-6
16-2328339-G-A p.Thr1556Thr synonymous ABCA3 6 82866 7.24061E-5 41433 0 6.25E-4
16-2328341-T-C p.Thr1556Ala missense ABCA3 5 82860 6.03427E-5 41430 0 3.32358E-5
16-2328352-A-G p.Leu1552Pro missense ABCA3 1 82882 1.20653E-5 41441 0 8.00897E-6
16-2328358-C-T p.Arg1550Gln missense ABCA3 2 82834 2.41447E-5 41417 0 3.18715E-5
16-2328365-C-T p.Val1548Met missense ABCA3 3 82864 3.62039E-5 41432 0 1.9996E-5
16-2328366-G-A p.Pro1547Pro synonymous ABCA3 1 82880 1.20656E-5 41440 0 3.81889E-4
16-2328376-C-A p.Gly1544Val missense ABCA3 1 82886 1.20648E-5 41443 0 8.29944E-6
16-2328390-G-A p.Asp1539Asp synonymous ABCA3 26 82846 3.13835E-4 41423 0 9.55597E-5
16-2328417-G-A p.Ile1530Ile synonymous ABCA3 1 82812 1.20755E-5 41406 0 8.30124E-6
16-2328420-C-T p.Leu1529Leu synonymous ABCA3 1 82798 1.20776E-5 41399 0 NA
16-2328425-C-T p.Ala1528Thr missense ABCA3 4 82724 4.83536E-5 41362 0 1.19902E-5
16-2328426-G-A p.Ile1527Ile synonymous ABCA3 1 82718 1.20893E-5 41359 0 5.81115E-5
16-2328432-G-A p.Thr1525Thr synonymous ABCA3 1 82640 1.21007E-5 41320 0 2.49107E-5
16-2328434-T-C p.Thr1525Ala missense ABCA3 2 82584 2.42178E-5 41292 0 NA
16-2328438-C-T p.Leu1523Leu synonymous ABCA3 1 82558 1.21127E-5 41279 0 2.40196E-5
16-2328445-C-T p.Arg1521Gln missense ABCA3 2 82426 2.42642E-5 41213 0 5.03525E-4
16-2328459-A-G p.Ser1516Ser splice_region+synonymous ABCA3 3 82202 3.64955E-5 41101 0 4.24371E-4
16-2328460-C-CTG c.4548-2_4548-1insCA splice_acceptor ABCA3 3 82212 3.6491E-5 41106 0 NA
16-2328461-T-TGTACGTCCTGACC c.4548-3_4548-2insGGTCAGGACGTAC splice_region ABCA3 1 82152 1.21726E-5 41076 0 NA
16-2328940-G-A c.4547+4C>T splice_region ABCA3 1 82040 1.21892E-5 41020 0 7.98053E-6
16-2328941-C-T c.4547+3G>A splice_region ABCA3 17 82078 2.0712E-4 41039 0 3.82385E-4
16-2328946-G-C p.Tyr1515* stop_gained ABCA3 1 82268 1.21554E-5 41134 0 NA
16-2328949-C-T p.Thr1514Thr synonymous ABCA3 4 82320 4.85909E-5 41160 0 3.18654E-5
16-2328959-A-C p.Leu1511Arg missense ABCA3 1 82542 1.2115E-5 41271 0 NA
16-2328964-G-C p.Asn1509Lys missense ABCA3 2 82580 2.42189E-5 41290 0 8.28157E-6
16-2328970-A-C p.His1507Gln missense ABCA3 1 82672 1.2096E-5 41336 0 NA
16-2328975-G-T p.Pro1506Thr missense ABCA3 1 82662 1.20975E-5 41331 0 3.98371E-6
16-2328990-C-T p.Gly1501Ser missense ABCA3 5 82770 6.04084E-5 41385 0 NA
16-2328993-G-A p.Arg1500Trp missense ABCA3 1 82760 1.20831E-5 41380 0 NA
16-2328996-G-A p.Leu1499Leu synonymous ABCA3 8 82790 9.663E-5 41395 0 9.55657E-5
16-2329009-G-A p.Cys1494Cys synonymous ABCA3 2 82842 2.41423E-5 41421 0 6.37105E-5
16-2329010-C-G p.Cys1494Ser missense ABCA3 1 82850 1.207E-5 41425 0 8.28569E-6
16-2329021-G-T p.His1490Gln missense ABCA3 1 82890 1.20642E-5 41445 0 8.28706E-6
16-2329026-G-A p.Arg1489Cys missense ABCA3 1 82882 1.20653E-5 41441 0 3.18634E-5
16-2329041-G-A p.Arg1484Trp missense ABCA3 1 82874 1.20665E-5 41437 0 3.18735E-5
16-2329055-A-G p.Met1479Thr missense ABCA3 1 82862 1.20683E-5 41431 0 3.18654E-5
16-2329060-C-G p.Leu1477Leu synonymous ABCA3 3 82828 3.62196E-5 41414 0 NA
16-2329060-C-A p.Leu1477Leu synonymous ABCA3 3 82828 3.62196E-5 41414 0 8.30165E-6
16-2329062-G-A p.Leu1477Leu synonymous ABCA3 1 82802 1.2077E-5 41401 0 NA
16-2329070-C-T p.Arg1474Gln missense ABCA3 2 82736 2.41733E-5 41368 0 3.18634E-5
16-2329071-G-A p.Arg1474Trp missense ABCA3 177 82722 0.0021397 41361 0 0.0052754
16-2329084-G-T p.Asp1469Glu missense ABCA3 1 82508 1.212E-5 41254 0 3.99074E-6
16-2329098-C-T p.Asp1465Asn missense ABCA3 6 82138 7.30478E-5 41069 0 6.25E-4
16-2329105-C-T p.Pro1462Pro synonymous ABCA3 2 81616 2.4505E-5 40808 0 7.64618E-5
16-2329116-C-T p.Gly1459Ser missense ABCA3 1 81846 1.22181E-5 40923 0 1.68127E-5
16-2329121-C-T p.Arg1457Gln missense ABCA3 5 81762 6.11531E-5 40881 0 1.64779E-4
16-2329122-G-A p.Arg1457Trp missense ABCA3 1 81692 1.22411E-5 40846 0 3.36298E-5
16-2329127-C-T p.Arg1455Gln missense ABCA3 4 81620 4.90076E-5 40810 0 8.41609E-6
16-2329128-G-A p.Arg1455Trp missense ABCA3 2 81574 2.45176E-5 40787 0 8.41893E-6
16-2329133-T-TTTCCGACATCAGAGCTGATTCTGTGACCCCCGACAAA c.4360-3_4360-2insTTTGTCGGGGGTCACAGAATCAGCTCTGATGTCGGAA splice_region ABCA3 2 81528 2.45314E-5 40764 1 NA
16-2329133-T-TTTCCGACATCAGAGCTGATTCTGTGACCCCCGACAAAGGCATCCCCAGAAGTGA c.4360-3_4360-2insTCACTTCTGGGGATGCCTTTGTCGGGGGTCACAGAATCAGCTCTGATGTCGGAA splice_region ABCA3 2 81530 2.45308E-5 40765 1 NA
16-2329133-T-TTTCCGACATCAGAGCTGATTCTGTGACCCCCGACAAAGGCATCCCCA c.4360-3_4360-2insTGGGGATGCCTTTGTCGGGGGTCACAGAATCAGCTCTGATGTCGGAA splice_region ABCA3 1 81530 1.22654E-5 40765 0 NA
16-2331024-C-G c.4359+4G>C splice_region ABCA3 1 81464 1.22754E-5 40732 0 NA
16-2331025-C-T c.4359+3G>A splice_region ABCA3 1 81518 1.22672E-5 40759 0 NA
16-2331034-G-A p.Val1451Val synonymous ABCA3 3 82032 3.65711E-5 41016 0 5.98458E-5
16-2331060-C-T p.Gly1443Arg missense ABCA3 4 82884 4.82602E-5 41442 0 8.35887E-5
16-2331074-C-G p.Gly1438Ala missense ABCA3 1 83110 1.20322E-5 41555 0 3.97839E-6
16-2331096-C-T p.Gly1431Arg missense ABCA3 1 83186 1.20213E-5 41593 0 8.25587E-6
16-2331097-G-A p.Thr1430Thr synonymous ABCA3 2 83182 2.40437E-5 41591 0 2.47688E-5
16-2331100-C-T p.Leu1429Leu synonymous ABCA3 1 83188 1.2021E-5 41594 0 NA
16-2331112-A-G p.Thr1425Thr synonymous ABCA3 1 83182 1.20218E-5 41591 0 NA
16-2331113-G-A p.Thr1425Ile missense ABCA3 1 83178 1.20224E-5 41589 0 3.3018E-5
16-2331134-T-C p.Asn1418Ser missense ABCA3 12 83134 1.44345E-4 41567 0 5.03525E-4
16-2331145-C-T p.Leu1414Leu synonymous ABCA3 1 83066 1.20386E-5 41533 0 2.78552E-5
16-2331151-G-A p.Phe1412Phe synonymous ABCA3 1 83026 1.20444E-5 41513 0 2.47803E-5
16-2331172-C-T p.Ala1405Ala synonymous ABCA3 5 82914 6.03034E-5 41457 0 3.58437E-5
16-2331173-G-A p.Ala1405Val missense ABCA3 4 82912 4.82439E-5 41456 0 5.03525E-4
16-2331174-C-T p.Ala1405Thr missense ABCA3 14 82896 1.68886E-4 41448 0 3.18431E-4
16-2331174-C-A p.Ala1405Ser missense ABCA3 1 82896 1.20633E-5 41448 0 1.65412E-5
16-2331175-G-A p.Leu1404Leu synonymous ABCA3 8 82906 9.64948E-5 41453 0 3.58454E-5
16-2331192-C-T p.Val1399Met missense ABCA3 2 82848 2.41406E-5 41424 0 8.27856E-6
16-2331193-G-A p.Ala1398Ala synonymous ABCA3 3 82856 3.62074E-5 41428 0 9.55353E-5
16-2331204-G-A p.Pro1395Ser missense ABCA3 1 82774 1.20811E-5 41387 0 8.28281E-6
16-2331207-C-T p.Val1394Met missense ABCA3 1 82784 1.20796E-5 41392 0 NA
16-2331209-C-T p.Arg1393Gln missense ABCA3 15 82790 1.81181E-4 41395 0 5.9811E-5
16-2331210-G-A p.Arg1393Trp missense ABCA3 1 82780 1.20802E-5 41390 0 1.65692E-5
16-2331216-C-T p.Glu1391Lys missense ABCA3 2 82804 2.41534E-5 41402 0 5.18403E-5
16-2331229-G-A c.4165-7C>T splice_region ABCA3 3 82744 3.62564E-5 41372 0 3.99087E-6
16-2331230-C-T c.4165-8G>A splice_region ABCA3 821 82682 0.00992961 41341 7 0.0118899
16-2331374-A-C c.4164+8T>G splice_region ABCA3 4 82932 4.82323E-5 41466 0 6.25E-4
16-2331377-G-A c.4164+5C>T splice_region ABCA3 2 82914 2.41214E-5 41457 0 6.25E-4
16-2331385-G-A p.Ser1387Ser synonymous ABCA3 1 82934 1.20578E-5 41467 0 4.12541E-5
16-2331397-G-C p.Ile1383Met missense ABCA3 1 82936 1.20575E-5 41468 0 4.37846E-5
16-2331400-A-C p.Ile1382Met missense ABCA3 2 82928 2.41173E-5 41464 0 3.18471E-5
16-2331408-G-C p.Pro1380Ala missense ABCA3 1 82920 1.20598E-5 41460 0 NA
16-2331419-A-T p.Leu1376Gln missense ABCA3 3 82956 3.61638E-5 41478 0 8.25082E-6
16-2331422-G-C p.Ser1375Cys missense ABCA3 2 82962 2.41074E-5 41481 0 8.25069E-6
16-2331424-G-C p.Asp1374Glu missense ABCA3 6 82956 7.23275E-5 41478 0 3.1841E-5
16-2331427-C-T p.Pro1373Pro synonymous ABCA3 13 82954 1.56713E-4 41477 0 7.56369E-5
16-2331428-G-A p.Pro1373Leu missense ABCA3 1 82950 1.20555E-5 41475 0 5.03525E-4
16-2331430-A-G p.Ser1372Ser synonymous ABCA3 73866 82794 0.892166 41397 33006 0.922628
16-2331432-T-C p.Ser1372Gly missense ABCA3 1 82988 1.20499E-5 41494 0 NA
16-2331435-G-T p.Pro1371Thr missense ABCA3 1 82994 1.20491E-5 41497 0 8.26255E-6
16-2331437-G-T p.Ala1370Asp missense ABCA3 4 82996 4.81951E-5 41498 0 NA
16-2331439-C-T p.Leu1369Leu synonymous ABCA3 1 83008 1.2047E-5 41504 0 NA
16-2331457-G-A p.Asp1363Asp synonymous ABCA3 5 83062 6.0196E-5 41531 0 4.96065E-5
16-2331460-C-T p.Ala1362Ala synonymous ABCA3 3 83064 3.61167E-5 41532 0 3.18471E-5
16-2331461-G-A p.Ala1362Val missense ABCA3 32 83050 3.8531E-4 41525 0 0.00125156
16-2331463-T-C p.Val1361Val synonymous ABCA3 1 83072 1.20378E-5 41536 0 3.98016E-6
16-2331475-C-T p.Glu1357Glu synonymous ABCA3 1 83086 1.20357E-5 41543 0 3.98023E-6
16-2331494-C-T p.Arg1351Gln missense ABCA3 7 82994 8.43434E-5 41497 0 1.65766E-5
16-2331495-G-T p.Arg1351Arg synonymous ABCA3 1 82992 1.20494E-5 41496 0 8.28844E-6
16-2331497-G-C p.Thr1350Ser missense ABCA3 1 82972 1.20523E-5 41486 0 3.18959E-5
16-2331497-G-A p.Thr1350Ile missense ABCA3 1 82972 1.20523E-5 41486 0 8.28967E-6
16-2331499-G-A p.Tyr1349Tyr synonymous ABCA3 1 82952 1.20552E-5 41476 0 3.1902E-5
16-2333183-T-G c.4035+4A>C splice_region ABCA3 2 82232 2.43214E-5 41116 0 9.13125E-6
16-2333191-G-A p.Thr1344Ile missense ABCA3 1 82356 1.21424E-5 41178 0 4.01294E-6
16-2333194-C-T p.Arg1343Gln missense ABCA3 5 82410 6.06722E-5 41205 0 2.55281E-4
16-2333195-G-A p.Arg1343Trp missense ABCA3 8 82404 9.70827E-5 41202 0 3.19183E-5
16-2333196-C-A p.Arg1342Ser missense ABCA3 1 82442 1.21297E-5 41221 0 8.73256E-6
16-2333203-C-T p.Arg1340Gln missense ABCA3 1 82502 1.21209E-5 41251 0 4.00404E-5
16-2333204-G-A p.Arg1340Trp missense ABCA3 1 82476 1.21247E-5 41238 0 2.56832E-5
16-2333210-C-T p.Ala1338Thr missense ABCA3 48 82540 5.81536E-4 41270 0 4.36045E-4
16-2333210-C-A p.Ala1338Ser missense ABCA3 2 82540 2.42307E-5 41270 0 NA
16-2333211-G-A p.Cys1337Cys synonymous ABCA3 3 82608 3.63161E-5 41304 0 6.38244E-5
16-2333212-C-T p.Cys1337Tyr missense ABCA3 1 82614 1.21045E-5 41307 0 3.99856E-6
16-2333232-C-T p.Gln1330Gln synonymous ABCA3 1 82792 1.20785E-5 41396 0 NA
16-2333238-C-A p.Leu1328Leu synonymous ABCA3 14 82822 1.69037E-4 41411 0 0.00100705
16-2333241-G-A p.Asn1327Asn synonymous ABCA3 1 82846 1.20706E-5 41423 0 NA
16-2333245-G-T p.Thr1326Asn missense ABCA3 4 82836 4.82882E-5 41418 0 6.37755E-5
16-2333249-C-T p.Glu1325Lys missense ABCA3 1 82844 1.20709E-5 41422 0 NA
16-2333262-C-G p.Leu1320Leu synonymous ABCA3 1 82868 1.20674E-5 41434 0 3.1904E-5
16-2333276-C-T p.Ala1316Thr missense ABCA3 2 82804 2.41534E-5 41402 0 1.59728E-5
16-2333277-G-A p.Cys1315Cys synonymous ABCA3 2 82794 2.41563E-5 41397 0 3.19122E-5
16-2333277-G-C p.Cys1315Trp missense ABCA3 1 82794 1.20782E-5 41397 0 3.9938E-6
16-2333281-C-T p.Gly1314Glu missense ABCA3 1 82846 1.20706E-5 41423 0 NA
16-2333289-G-A p.Ala1311Ala synonymous ABCA3 4 82850 4.828E-5 41425 0 6.38121E-5
16-2333294-T-C p.Met1310Val missense ABCA3 2 82806 2.41528E-5 41403 0 NA
16-2333295-G-A p.Ser1309Ser synonymous ABCA3 1 82838 1.20718E-5 41419 0 NA
16-2333308-C-T p.Arg1305Gln missense ABCA3 8 82738 9.66908E-5 41369 0 6.3955E-5
16-2333313-G-A p.Val1303Val synonymous ABCA3 6 82594 7.26445E-5 41297 0 5.2E-5
16-2333319-C-T p.Pro1301Pro synonymous ABCA3 3 82630 3.63064E-5 41315 0 1.88012E-4
16-2333320-G-T p.Pro1301Gln missense ABCA3 1 82578 1.21098E-5 41289 0 4.00074E-6
16-2333325-G-A p.Ser1299Ser synonymous ABCA3 4 82430 4.8526E-5 41215 0 4.18978E-5
16-2333333-C-T p.Ala1297Thr missense ABCA3 2 82388 2.42754E-5 41194 0 8.38237E-6
16-2333334-A-G p.Tyr1296Tyr synonymous ABCA3 2 82412 2.42683E-5 41206 0 2.51463E-5
16-2333362-G-A c.3863-3C>T splice_region ABCA3 1 81798 1.22252E-5 40899 0 8.43825E-6
16-2334281-A-G p.Tyr1287Tyr splice_region+synonymous ABCA3 4 80400 4.97512E-5 40200 0 4.80388E-5
16-2334283-A-T p.Tyr1287Asn missense ABCA3 2 80526 2.48367E-5 40263 0 NA
16-2334301-C-T p.Ala1281Thr missense ABCA3 14 80982 1.72878E-4 40491 0 0.00100705
16-2334301-C-A p.Ala1281Ser missense ABCA3 1 80984 1.23481E-5 40492 0 7.99022E-6
16-2334302-G-A p.Ala1280Ala synonymous ABCA3 2 81168 2.46403E-5 40584 0 3.99272E-6
16-2334310-C-T p.Glu1278Lys missense ABCA3 2 81504 2.45387E-5 40752 0 1.1605E-4
16-2334311-G-A p.Ser1277Ser synonymous ABCA3 2 81596 2.4511E-5 40798 0 0.00151057
16-2334314-G-T p.Ser1276Ser synonymous ABCA3 1 81826 1.22211E-5 40913 0 3.18756E-5
16-2334331-G-A p.Arg1271Trp missense ABCA3 3 82412 3.64025E-5 41206 0 1.65284E-5
16-2334331-G-T p.Arg1271Arg synonymous ABCA3 1 82412 1.21342E-5 41206 0 7.96153E-6
16-2334332-C-T p.Thr1270Thr synonymous ABCA3 2 82456 2.42554E-5 41228 0 4.13189E-5
16-2334346-C-G p.Glu1266Gln missense ABCA3 2 82776 2.41616E-5 41388 0 NA
16-2334347-G-A p.Tyr1265Tyr synonymous ABCA3 1 82820 1.20744E-5 41410 0 4.12834E-5
16-2334358-T-C p.Ser1262Gly missense ABCA3 120 82930 0.001447 41465 0 0.00111536
16-2334361-C-T p.Val1261Ile missense ABCA3 1 82964 1.20534E-5 41482 0 3.97747E-6
16-2334364-C-T p.Ala1260Thr missense ABCA3 2 82948 2.41115E-5 41474 0 8.25314E-6
16-2334394-G-A p.Leu1250Leu synonymous ABCA3 2 83032 2.40871E-5 41516 0 7.95437E-6
16-2334400-C-T p.Val1248Met missense ABCA3 5 83020 6.02265E-5 41510 0 0.00100806
16-2334421-G-T p.Leu1241Ile missense ABCA3 1 82930 1.20584E-5 41465 0 3.18756E-5
16-2334442-C-T c.3704-4G>A splice_region ABCA3 1 82370 1.21403E-5 41185 0 7.95855E-6
16-2334443-G-A c.3704-5C>T splice_region ABCA3 1 82342 1.21445E-5 41171 0 1.65306E-5
16-2334444-T-C c.3704-6A>G splice_region ABCA3 2 82298 2.43019E-5 41149 0 4.95909E-5
16-2334446-G-T c.3704-8C>A splice_region ABCA3 1 82246 1.21586E-5 41123 0 7.95906E-6
16-2334772-G-A c.3703+8C>T splice_region ABCA3 1 81112 1.23286E-5 40556 0 1.96595E-5
16-2334777-C-T c.3703+3G>A splice_region ABCA3 1 81298 1.23004E-5 40649 0 1.20785E-5
16-2334787-G-A p.Arg1232Arg synonymous ABCA3 2 81708 2.44774E-5 40854 0 5.2095E-5
16-2334789-G-A p.Arg1232Cys missense ABCA3 1 81802 1.22246E-5 40901 0 3.19081E-5
16-2334816-C-T p.Ala1223Thr missense ABCA3 1 82540 1.21153E-5 41270 0 1.59683E-4
16-2334817-G-A p.Ile1222Ile synonymous ABCA3 3 82604 3.63179E-5 41302 0 6.78204E-5
16-2334823-T-C p.Ser1220Ser synonymous ABCA3 2 82690 2.41867E-5 41345 0 NA
16-2334824-G-A p.Ser1220Leu missense ABCA3 6 82696 7.25549E-5 41348 0 3.58892E-5
16-2334850-C-T p.Thr1211Thr synonymous ABCA3 4 82696 4.83699E-5 41348 0 9.58222E-5
16-2334851-G-A p.Thr1211Met missense ABCA3 2 82726 2.41762E-5 41363 0 1.39528E-4
16-2334859-A-T p.Thr1208Thr synonymous ABCA3 1 82768 1.2082E-5 41384 0 NA
16-2334860-G-C p.Thr1208Ser missense ABCA3 2 82756 2.41674E-5 41378 0 2.49688E-5
16-2334866-G-A p.Ala1206Val missense ABCA3 11 82682 1.3304E-4 41341 0 1.08157E-4
16-2334870-C-T p.Gly1205Arg missense ABCA3 11 82710 1.32995E-4 41355 0 5.07327E-4
16-2334871-CAAG-C p.Phe1203del disruptive_inframe_deletion ABCA3 7 82714 8.4629E-5 41357 0 8.31712E-5
16-2334881-A-T p.Phe1201Tyr missense ABCA3 17 82778 2.05369E-4 41389 0 0.0015121
16-2334894-A-C p.Tyr1197Asp missense ABCA3 1 82674 1.20957E-5 41337 0 NA
16-2334918-C-T p.Gly1189Ser missense ABCA3 3 82658 3.62941E-5 41329 0 0.001875
16-2334923-A-G p.Leu1187Pro missense ABCA3 1 82648 1.20995E-5 41324 0 3.18872E-5
16-2334927-G-GGCATGATGGT p.Leu1186fs frameshift ABCA3 1 82628 1.21024E-5 41314 0 NA
16-2334937-C-T p.Leu1182Leu synonymous ABCA3 2 82566 2.4223E-5 41283 0 NA
16-2334942-T-C p.Thr1181Ala missense ABCA3 3 82478 3.63733E-5 41239 0 3.58955E-5
16-2334943-G-A p.Asp1180Asp synonymous ABCA3 7 82498 8.48505E-5 41249 0 3.18776E-5
16-2334947-G-C p.Ala1179Gly missense ABCA3 1 82452 1.21283E-5 41226 0 NA
16-2334949-C-T p.Met1178Ile missense ABCA3 2 82436 2.42612E-5 41218 0 6.37796E-5
16-2334957-C-T p.Gly1176Ser missense ABCA3 1 82248 1.21584E-5 41124 0 2.39462E-5
16-2334958-G-A p.Asp1175Asp synonymous ABCA3 9 82216 1.09468E-4 41108 0 7.5835E-5
16-2334960-C-A p.Asp1175Tyr missense ABCA3 1 82198 1.21657E-5 41099 0 NA
16-2334963-G-A p.Arg1174Trp missense ABCA3 3 82088 3.65461E-5 41044 0 1.27551E-4
16-2334964-C-T p.Thr1173Thr synonymous ABCA3 5 82064 6.09281E-5 41032 0 1.75762E-4
16-2334965-G-A p.Thr1173Met missense ABCA3 8 82086 9.74588E-5 41043 0 5.04541E-4
16-2334974-C-T p.Arg1170His missense ABCA3 3 81708 3.67161E-5 40854 0 5.04541E-4
16-2334978-C-T p.Val1169Met missense ABCA3 11 81454 1.35046E-4 40727 0 2.47132E-4
16-2334979-G-A p.Asp1168Asp synonymous ABCA3 4 81378 4.91533E-5 40689 0 1.44888E-4
16-2334979-G-T p.Asp1168Glu missense ABCA3 1 81378 1.22883E-5 40689 0 8.52282E-6
16-2334980-T-A p.Asp1168Val missense ABCA3 1 81296 1.23007E-5 40648 0 4.00638E-6
16-2334981-C-T p.Asp1168Asn missense ABCA3 3 81240 3.69276E-5 40620 0 5.04541E-4
16-2334986-G-A p.Ala1166Val missense ABCA3 9 80906 1.1124E-4 40453 0 6.37877E-5
16-2335003-C-T c.3484-4G>A splice_region ABCA3 3 79520 3.77264E-5 39760 0 5.27302E-5
16-2335004-G-A c.3484-5C>T splice_region ABCA3 3 79486 3.77425E-5 39743 0 2.03262E-5
16-2335005-G-A c.3484-6C>T splice_region ABCA3 1 79348 1.26027E-5 39674 0 4.06345E-6
16-2335440-C-T c.3483+3G>A splice_region ABCA3 1 80118 1.24816E-5 40059 0 NA
16-2335452-C-T p.Leu1158Leu synonymous ABCA3 5 80682 6.19717E-5 40341 0 NA
16-2335456-C-A p.Ser1157Ile missense ABCA3 17 80910 2.1011E-4 40455 0 4.619E-4
16-2335473-G-A p.Ile1151Ile synonymous ABCA3 1 81536 1.22645E-5 40768 0 3.18573E-5
16-2335518-G-T p.Val1136Val synonymous ABCA3 1 81936 1.22046E-5 40968 0 NA
16-2335521-T-G p.Gly1135Gly synonymous ABCA3 2 81934 2.44099E-5 40967 0 1.44651E-5
16-2335538-C-T p.Val1130Met missense ABCA3 1 81916 1.22076E-5 40958 0 4.3882E-6
16-2335544-T-TG p.Lys1128fs frameshift ABCA3 2 81900 2.442E-5 40950 0 NA
16-2335553-C-T p.Val1125Met missense ABCA3 22 81822 2.68876E-4 40911 1 0.00101215
16-2335554-G-A p.Ala1124Ala synonymous ABCA3 1 81776 1.22285E-5 40888 0 NA
16-2335556-C-A p.Ala1124Ser missense ABCA3 1 81780 1.22279E-5 40890 0 NA
16-2335563-G-A p.Ser1121Ser synonymous ABCA3 4 81718 4.89488E-5 40859 0 1.28753E-4
16-2335569-C-T p.Ala1119Ala synonymous ABCA3 2 81686 2.4484E-5 40843 0 1.59236E-4
16-2335570-G-A p.Ala1119Val missense ABCA3 1 81674 1.22438E-5 40837 0 6.36902E-5
16-2335571-C-T p.Ala1119Thr missense ABCA3 3 81670 3.67332E-5 40835 0 NA
16-2335572-C-T p.Leu1118Leu synonymous ABCA3 2 81704 2.44786E-5 40852 0 2.93272E-5
16-2335591-G-C p.Ala1112Gly missense ABCA3 4 81560 4.90437E-5 40780 0 3.84852E-5
16-2335608-G-A p.Phe1106Phe synonymous ABCA3 1 81348 1.22929E-5 40674 0 3.18512E-5
16-2335614-C-A p.Leu1104Leu synonymous ABCA3 1 81322 1.22968E-5 40661 0 4.3501E-5
16-2335631-C-T p.Asp1099Asn missense ABCA3 1 80962 1.23515E-5 40481 0 7.02606E-5
16-2335638-C-G p.Lys1096Asn missense ABCA3 3 80794 3.71315E-5 40397 0 4.2525E-4
16-2335642-C-T p.Arg1095Gln missense ABCA3 9 80680 1.11552E-4 40340 0 1.27429E-4
16-2335643-G-A p.Arg1095Trp missense ABCA3 4 80616 4.96179E-5 40308 0 3.18654E-5
16-2335646-C-T p.Gly1094Ser missense+splice_region ABCA3 1 80532 1.24174E-5 40266 0 3.87237E-5
16-2335647-C-T p.Glu1093Glu splice_region+synonymous ABCA3 65 80492 8.07534E-4 40246 0 5.36051E-4
16-2335647-C-CTCGTTAAA c.3279-1_3279insTTTAACGA splice_acceptor ABCA3 7 80496 8.69608E-5 40248 3 NA
16-2335651-C-T c.3279-4G>A splice_region ABCA3 1 80294 1.24542E-5 40147 0 4.81325E-5
16-2335651-C-A c.3279-4G>T splice_region ABCA3 2 80294 2.49085E-5 40147 0 3.18593E-5
16-2335652-G-A c.3279-5C>T splice_region ABCA3 4 80304 4.98107E-5 40152 0 9.63391E-5
16-2335653-G-A c.3279-6C>T splice_region ABCA3 2 80286 2.49109E-5 40143 0 6.47115E-6
16-2336687-G-A c.3278+8C>T splice_region ABCA3 1 81368 1.22898E-5 40684 0 3.99962E-6
16-2336695-T-TCGTTAAACTGGTCCTTGGCAG p.Ala1086_Asn1092dup conservative_inframe_insertion ABCA3 1 81782 1.22276E-5 40891 0 NA
16-2336696-C-T p.Glu1093Lys missense+splice_region ABCA3 1 81828 1.22208E-5 40914 0 1.59766E-5
16-2336709-C-T p.Lys1088Lys synonymous ABCA3 2 82214 2.43268E-5 41107 0 3.18796E-5
16-2336726-C-T p.Ala1083Thr missense ABCA3 6 82396 7.28191E-5 41198 0 1.59439E-4
16-2336727-G-A p.Ser1082Ser synonymous ABCA3 1 82448 1.21289E-5 41224 0 3.9846E-5
16-2336729-T-C p.Ser1082Gly missense ABCA3 1 82498 1.21215E-5 41249 0 3.98349E-6
16-2336731-C-T p.Arg1081Gln missense ABCA3 2 82528 2.42342E-5 41264 0 9.56328E-5
16-2336732-G-A p.Arg1081Trp missense ABCA3 9 82576 1.08991E-4 41288 0 1.27462E-4
16-2336732-G-T p.Arg1081Arg synonymous ABCA3 1 82578 1.21098E-5 41289 0 8.25846E-6
16-2336733-G-A p.Pro1080Pro synonymous ABCA3 12 82596 1.45285E-4 41298 0 3.98235E-6
16-2336735-G-C p.Pro1080Ala missense ABCA3 2 82630 2.42043E-5 41315 0 NA
16-2336739-G-A p.Pro1078Pro synonymous ABCA3 14 82700 1.69287E-4 41350 0 5.03525E-4
16-2336742-G-A p.Phe1077Phe synonymous ABCA3 22 82722 2.65951E-4 41361 0 3.18715E-4
16-2336753-C-T p.Val1074Ile missense ABCA3 1 82786 1.20793E-5 41393 0 NA
16-2336754-C-T p.Val1073Val synonymous ABCA3 1 82802 1.2077E-5 41401 0 NA
16-2336765-C-T p.Ala1070Thr missense ABCA3 1 82876 1.20662E-5 41438 0 NA
16-2336766-G-A p.His1069His synonymous ABCA3 25 82896 3.01583E-4 41448 0 2.62565E-4
16-2336774-C-T p.Gly1067Arg missense ABCA3 1 82948 1.20557E-5 41474 0 3.18715E-5
16-2336778-C-T p.Leu1065Leu synonymous ABCA3 14 82972 1.68732E-4 41486 0 7.64867E-4
16-2336804-C-T p.Val1057Met missense ABCA3 4 83006 4.81893E-5 41503 0 3.2987E-5
16-2336807-C-T p.Val1056Ile missense ABCA3 67 83018 8.07054E-4 41509 0 0.0020141
16-2336807-C-A p.Val1056Phe missense ABCA3 20 83016 2.40917E-4 41508 0 3.18634E-5
16-2336808-G-A p.Ala1055Ala synonymous ABCA3 8 83026 9.63554E-5 41513 0 6.36345E-5
16-2336818-G-A p.Thr1052Ile missense ABCA3 1 83032 1.20435E-5 41516 0 NA
16-2336835-C-T p.Ala1046Ala synonymous ABCA3 3 82900 3.61882E-5 41450 0 5.03525E-4
16-2336844-G-A p.Asn1043Asn synonymous ABCA3 1 82962 1.20537E-5 41481 0 8.25273E-6
16-2336861-C-T p.Val1038Ile missense ABCA3 21 82930 2.53226E-4 41465 0 2.55135E-4
16-2336862-G-A p.Val1037Val synonymous ABCA3 1 82924 1.20592E-5 41462 0 2.47827E-5
16-2336865-C-T p.Thr1036Thr synonymous ABCA3 1 82912 1.2061E-5 41456 0 6.25E-4
16-2336869-C-T p.Arg1035His missense ABCA3 1 82896 1.20633E-5 41448 0 2.78603E-5
16-2336870-G-A p.Arg1035Cys missense ABCA3 5 82856 6.03457E-5 41428 0 4.13298E-5
16-2336878-A-G p.Val1032Ala missense ABCA3 1 82920 1.20598E-5 41460 0 NA
16-2336881-T-C p.Asp1031Gly missense ABCA3 4 82894 4.82544E-5 41447 0 1.194E-5
16-2336883-T-G p.Arg1030Ser missense ABCA3 1 82908 1.20616E-5 41454 0 8.28377E-6
16-2336889-G-A p.Ser1028Ser synonymous ABCA3 1 82928 1.20587E-5 41464 0 NA
16-2336892-C-T p.Ala1027Ala synonymous ABCA3 2 82904 2.41243E-5 41452 0 2.48959E-5
16-2336900-C-T p.Val1025Met missense ABCA3 2 82952 2.41103E-5 41476 0 8.3275E-6
16-2336908-C-T p.Arg1022Gln missense ABCA3 5 82908 6.03078E-5 41454 0 9.56206E-5
16-2336909-G-A p.Arg1022Trp missense ABCA3 2 82888 2.41289E-5 41444 0 7.97067E-6
16-2336910-C-T p.Glu1021Glu synonymous ABCA3 1 82894 1.20636E-5 41447 0 NA
16-2336913-A-G p.Asn1020Asn synonymous ABCA3 1 82884 1.20651E-5 41442 0 NA
16-2336916-A-G p.Phe1019Phe synonymous ABCA3 1 82874 1.20665E-5 41437 0 NA
16-2336921-C-T p.Gly1018Ser missense ABCA3 6 82762 7.2497E-5 41381 0 2.54972E-4
16-2336921-C-A p.Gly1018Cys missense ABCA3 1 82762 1.20828E-5 41381 0 NA
16-2336922-G-A p.Gly1017Gly synonymous ABCA3 2 82688 2.41873E-5 41344 0 3.40843E-5
16-2336927-C-A p.Gly1016Trp missense ABCA3 1 82714 1.20899E-5 41357 0 2.57334E-5
16-2336967-A-T p.Gly1002Gly splice_region+synonymous ABCA3 1 81604 1.22543E-5 40802 0 NA
16-2336971-G-A c.3005-3C>T splice_region ABCA3 1 81576 1.22585E-5 40788 0 1.0077E-5
16-2338027-C-T p.Gly1002Ser missense+splice_region ABCA3 2 80852 2.47366E-5 40426 0 8.81104E-6
16-2338028-G-A p.Leu1001Leu splice_region+synonymous ABCA3 15 80806 1.8563E-4 40403 0 1.27413E-4
16-2338031-C-T p.Val1000Val synonymous ABCA3 3 80932 3.70682E-5 40466 0 4.12014E-6
16-2338036-C-T p.Glu999Lys missense ABCA3 1 81146 1.23235E-5 40573 0 8.20479E-6
16-2338037-G-A p.Arg998Arg synonymous ABCA3 3 81082 3.69996E-5 40541 0 4.4586E-4
16-2338038-C-T p.Arg998His missense ABCA3 1 81168 1.23201E-5 40584 0 1.63706E-5
16-2338041-G-A p.Pro997Leu missense ABCA3 1 81258 1.23065E-5 40629 0 8.15348E-6
16-2338052-C-A p.Glu993Asp missense ABCA3 3 81800 3.66748E-5 40900 0 3.43968E-5
16-2338054-C-T p.Glu993Lys missense ABCA3 1 81838 1.22193E-5 40919 0 3.1835E-5
16-2338058-C-G p.Gln991His missense ABCA3 1 81950 1.22026E-5 40975 0 3.62845E-5
16-2338065-G-A p.Ala989Val missense ABCA3 2 82090 2.43635E-5 41045 0 3.18451E-5
16-2338067-G-A p.Asp988Asp synonymous ABCA3 16 82120 1.94837E-4 41060 0 1.0049E-4
16-2338092-T-G p.Gln980Pro missense ABCA3 6 82406 7.28102E-5 41203 0 4.39584E-5
16-2338111-C-T p.Gly974Arg missense ABCA3 1 82342 1.21445E-5 41171 0 2.00982E-5
16-2338112-G-A p.Pro973Pro synonymous ABCA3 2 82362 2.4283E-5 41181 0 2.00976E-5
16-2338121-G-A p.Phe970Phe synonymous ABCA3 1 82358 1.21421E-5 41179 0 NA
16-2338123-A-G p.Phe970Leu missense ABCA3 2 82320 2.42954E-5 41160 0 0.0015121
16-2338129-C-T p.Val968Met missense ABCA3 5 82222 6.0811E-5 41111 0 9.55962E-5
16-2338133-G-A p.Thr966Thr synonymous ABCA3 22 82216 2.67588E-4 41108 0 0.00252525
16-2338141-C-T p.Gly964Ser missense ABCA3 2 82140 2.43487E-5 41070 0 1.07236E-5
16-2338142-G-A p.Tyr963Tyr synonymous ABCA3 2 82152 2.43451E-5 41076 0 2.15346E-5
16-2338147-C-T p.Glu962Lys missense ABCA3 5 82134 6.08761E-5 41067 0 0.0010101
16-2338150-C-T p.Gly961Ser missense ABCA3 2 82128 2.43522E-5 41064 0 5.05051E-4
16-2338155-G-A p.Thr959Ile missense ABCA3 3 82118 3.65328E-5 41059 0 1.14734E-5
16-2338158-A-G p.Leu958Pro missense ABCA3 2 82126 2.43528E-5 41063 0 NA
16-2338159-G-A p.Leu958Leu synonymous ABCA3 2 82114 2.43564E-5 41057 0 NA
16-2338171-G-A p.Pro954Ser missense ABCA3 1 82094 1.21812E-5 41047 0 NA
16-2338174-C-T p.Asp953Asn missense ABCA3 29 82018 3.53581E-4 41009 0 0.00202224
16-2338175-G-A p.Asp952Asp synonymous ABCA3 64 82024 7.80259E-4 41012 0 0.00146885
16-2338177-C-T p.Asp952Asn missense ABCA3 9 81988 1.09772E-4 40994 0 0.00151668
16-2338178-G-A p.Phe951Phe synonymous ABCA3 1 82020 1.21921E-5 41010 0 3.18654E-5
16-2338187-C-T p.Ser948Ser synonymous ABCA3 4 81954 4.88079E-5 40977 0 8.70178E-6
16-2338188-G-A p.Ser948Leu missense ABCA3 5 81984 6.09875E-5 40992 0 6.25E-4
16-2338197-T-C p.Asn945Ser missense ABCA3 1 81938 1.22043E-5 40969 0 NA
16-2338210-G-A p.Leu941Phe missense ABCA3 1 81892 1.22112E-5 40946 0 3.29652E-5
16-2338222-C-T p.Val937Ile missense ABCA3 1 81750 1.22324E-5 40875 0 3.18654E-5
16-2338235-C-T p.Val932Val synonymous ABCA3 43 81562 5.27206E-4 40781 0 8.60201E-4
16-2338236-A-C p.Val932Gly missense ABCA3 1 81546 1.2263E-5 40773 0 NA
16-2338250-C-T p.Ala927Ala synonymous ABCA3 2 81438 2.45586E-5 40719 0 5.05051E-4
16-2338255-C-A p.Val926Leu missense ABCA3 2 81460 2.45519E-5 40730 0 NA
16-2338256-C-A p.Met925Ile missense ABCA3 1 81470 1.22745E-5 40735 0 NA
16-2338268-G-A p.Arg921Arg synonymous ABCA3 2 81040 2.46792E-5 40520 0 4.55664E-5
16-2338269-C-T p.Arg921His missense ABCA3 1 81026 1.23417E-5 40513 0 4.57896E-5
16-2338282-C-T p.Ala917Thr missense ABCA3 3 80592 3.72245E-5 40296 0 7.69191E-5
16-2338283-G-A p.Ala916Ala synonymous ABCA3 1 80542 1.24159E-5 40271 0 0.00253036
16-2338286-C-T p.Lys915Lys synonymous ABCA3 1 80490 1.24239E-5 40245 0 NA
16-2338292-C-T p.Leu913Leu synonymous ABCA3 1 80240 1.24626E-5 40120 0 2.70944E-5
16-2338300-T-C p.Met911Val missense ABCA3 2 79984 2.5005E-5 39992 0 5.39002E-6
16-2338307-G-C p.Phe908Leu missense ABCA3 1 79584 1.25653E-5 39792 0 NA
16-2338310-T-C p.Gln907Gln synonymous ABCA3 2 79478 2.51642E-5 39739 0 1.13213E-5
16-2338328-G-A p.Leu901Leu splice_region+synonymous ABCA3 2 78066 2.56193E-5 39033 0 4.0016E-5
16-2338335-G-A c.2701-5C>T splice_region ABCA3 1 77290 1.29383E-5 38645 0 3.25195E-5
16-2339437-C-A p.Gly900Trp missense+splice_region ABCA3 1 79430 1.25897E-5 39715 0 NA
16-2339456-G-A p.Thr893Thr synonymous ABCA3 2 80276 2.4914E-5 40138 0 3.18573E-5
16-2339460-C-T p.Arg892His missense ABCA3 19 80402 2.36313E-4 40201 0 4.46002E-4
16-2339465-C-T p.Glu890Glu synonymous ABCA3 1 80632 1.2402E-5 40316 0 2.36172E-5
16-2339468-C-T p.Glu889Glu synonymous ABCA3 2 80736 2.47721E-5 40368 0 NA
16-2339470-C-T p.Glu889Lys missense ABCA3 3 80756 3.71489E-5 40378 0 NA
16-2339471-G-A p.Ile888Ile synonymous ABCA3 1 80782 1.2379E-5 40391 0 1.13404E-4
16-2339479-C-G p.Ala886Pro missense ABCA3 1 81032 1.23408E-5 40516 0 NA
16-2339488-C-T p.Gly883Ser missense ABCA3 4 81110 4.93157E-5 40555 0 4.51732E-5
16-2339488-C-CG p.Gly883fs frameshift ABCA3 1 81110 1.23289E-5 40555 0 NA
16-2339489-G-A p.Asp882Asp synonymous ABCA3 6 81120 7.39645E-5 40560 0 4.10546E-4
16-2339491-C-T p.Asp882Asn missense ABCA3 7 81130 8.62813E-5 40565 0 4.14039E-4
16-2339492-G-A p.Ser881Ser synonymous ABCA3 2 81132 2.46512E-5 40566 0 5.09892E-5
16-2339521-T-C p.Ser872Gly missense ABCA3 30 81276 3.69113E-4 40638 0 0.00253036
16-2339534-G-C p.Asp867Glu missense ABCA3 1 81176 1.23189E-5 40588 0 5.1717E-6
16-2339537-G-A p.Ser866Ser synonymous ABCA3 5 81130 6.16295E-5 40565 0 2.22944E-4
16-2339542-C-T p.Ala865Thr missense ABCA3 6 81078 7.40028E-5 40539 0 1.09234E-5
16-2339544-C-G p.Arg864Pro missense ABCA3 1 81078 1.23338E-5 40539 0 NA
16-2339545-G-A p.Arg864Cys missense ABCA3 1 81068 1.23353E-5 40534 0 1.10977E-5
16-2339547-C-T p.Arg863Lys missense ABCA3 9 81086 1.10993E-4 40543 0 3.42185E-5
16-2339594-C-G p.Met847Ile missense ABCA3 3 80292 3.73636E-5 40146 0 3.18451E-5
16-2339596-T-C p.Met847Val missense ABCA3 5 80226 6.23239E-5 40113 0 6.36943E-5
16-2339608-C-G p.Val843Leu missense ABCA3 10 79716 1.25445E-4 39858 0 5.41298E-4
16-2339618-G-A p.Val839Val synonymous ABCA3 4 78910 5.06907E-5 39455 0 0.00314136
16-2339621-C-CCGAAGGAAGA c.2514-1_2514insTCTTCCTTCG splice_acceptor ABCA3 1 78746 1.26991E-5 39373 0 NA
16-2339622-C-CGAAGGAAGACTTCCTCCATGGTGG c.2514-2_2514-1insCCACCATGGAGGAAGTCTTCCTTC splice_acceptor ABCA3 1 78722 1.27029E-5 39361 0 NA
16-2339628-C-T c.2514-7G>A splice_region ABCA3 2 78158 2.55892E-5 39079 0 6.52375E-6
16-2339629-G-A c.2514-8C>T splice_region ABCA3 879 77986 0.0112713 38993 15 0.0221352
16-2339629-G-C c.2514-8C>G splice_region ABCA3 5 78080 6.40369E-5 39040 0 6.53979E-6
16-2342141-C-T p.Arg838Gln missense+splice_region ABCA3 1 83270 1.20091E-5 41635 0 3.97826E-6
16-2342145-G-A p.Leu837Phe missense ABCA3 2 83308 2.40073E-5 41654 0 3.9781E-6
16-2342176-C-T p.Gly826Gly synonymous ABCA3 1 83362 1.19959E-5 41681 0 3.18796E-5
16-2342177-C-T p.Gly826Glu missense ABCA3 2 83362 2.39917E-5 41681 0 5.03525E-4
16-2342194-C-T p.Leu820Leu synonymous ABCA3 3 83340 3.59971E-5 41670 0 1.98863E-5
16-2342197-C-G p.Glu819Asp missense ABCA3 1 83342 1.19988E-5 41671 0 NA
16-2342208-T-G p.Lys816Gln missense ABCA3 2 83334 2.39998E-5 41667 0 1.27494E-4
16-2342220-T-C p.Lys812Glu missense ABCA3 1 83302 1.20045E-5 41651 0 NA
16-2342222-G-C p.Ala811Gly missense ABCA3 1 83300 1.20048E-5 41650 0 NA
16-2342243-A-C c.2415-4T>G splice_region ABCA3 7 83204 8.41306E-5 41602 0 9.15644E-5
16-2345559-ATACCTGTGCGTGCCCTCCCTGGGAGGCG-A c.2414+4_2414+31delCGCCTCCCAGGGAGGGCACGCACAGGTA splice_region ABCA3 2 81222 2.46239E-5 40611 0 1.65366E-5
16-2345585-G-A c.2414+6C>T splice_region ABCA3 1 81562 1.22606E-5 40781 0 NA
16-2345586-C-T c.2414+5G>A splice_region ABCA3 6 81596 7.3533E-5 40798 0 0.00125
16-2345586-C-A c.2414+5G>T splice_region ABCA3 3 81596 3.67665E-5 40798 0 3.18512E-5
16-2345587-G-A c.2414+4C>T splice_region ABCA3 1 81668 1.22447E-5 40834 0 4.02049E-5
16-2345594-T-C p.His804Arg missense ABCA3 1 81870 1.22145E-5 40935 0 8.25069E-6
16-2345596-C-T p.Thr803Thr synonymous ABCA3 3 81922 3.66202E-5 40961 0 1.65006E-5
16-2345611-A-G p.Leu798Leu synonymous ABCA3 1 82270 1.21551E-5 41135 0 4.94805E-5
16-2345616-T-C p.Ile797Val missense ABCA3 3 82390 3.64122E-5 41195 0 3.18492E-5
16-2345628-C-T p.Glu793Lys missense ABCA3 1 82518 1.21186E-5 41259 0 5.98731E-5
16-2345629-G-A p.Ala792Ala synonymous ABCA3 7 82552 8.4795E-5 41276 0 9.55414E-5
16-2345630-G-A p.Ala792Val missense ABCA3 1 82560 1.21124E-5 41280 0 5.03525E-4
16-2345632-C-T p.Gly791Gly synonymous ABCA3 1 82582 1.21092E-5 41291 0 NA
16-2345637-C-T p.Ala790Thr missense ABCA3 1 82688 1.20937E-5 41344 0 2.47345E-5
16-2345642-C-A p.Ser788Ile missense ABCA3 1 82752 1.20843E-5 41376 0 3.98622E-6
16-2345650-C-T p.Thr785Thr synonymous ABCA3 1 82848 1.20703E-5 41424 0 3.18451E-5
16-2345650-C-G p.Thr785Thr synonymous ABCA3 10 82848 1.20703E-4 41424 0 9.55353E-5
16-2345654-G-A p.Ala784Val missense ABCA3 1 82930 1.20584E-5 41465 0 NA
16-2345655-C-T p.Ala784Thr missense ABCA3 2 82928 2.41173E-5 41464 0 3.98343E-6
16-2345656-G-A p.Asn783Asn synonymous ABCA3 2 82964 2.41068E-5 41482 0 5.03525E-4
16-2345664-C-G p.Val781Leu missense ABCA3 4 83020 4.81812E-5 41510 0 5.03525E-4
16-2345664-C-T p.Val781Met missense ABCA3 1 83020 1.20453E-5 41510 0 1.99073E-5
16-2345665-G-A p.His780His synonymous ABCA3 88 83036 0.00105978 41518 0 0.00130565
16-2345668-G-A p.His779His synonymous ABCA3 1 83068 1.20383E-5 41534 0 8.24511E-6
16-2345671-G-T p.His778Gln missense ABCA3 1 83078 1.20369E-5 41539 0 6.25E-4
16-2345672-T-C p.His778Arg missense ABCA3 143 83082 0.00172119 41541 1 0.00394879
16-2345684-G-A p.Ser774Phe missense ABCA3 11 83138 1.3231E-4 41569 0 3.54557E-4
16-2345688-T-C p.Ile773Val missense ABCA3 1 83154 1.20259E-5 41577 0 NA
16-2345696-G-A p.Pro770Leu missense ABCA3 145 83138 0.00174409 41569 0 0.00241992
16-2345696-G-T p.Pro770Gln missense ABCA3 2 83138 2.40564E-5 41569 0 8.24661E-6
16-2345701-G-A p.Cys768Cys synonymous ABCA3 3 83130 3.60881E-5 41565 0 NA
16-2345707-C-T p.Pro766Pro synonymous ABCA3 9 83104 1.08298E-4 41552 0 0.00125
16-2345708-G-A p.Pro766Leu missense ABCA3 4 83112 4.81278E-5 41556 0 3.18532E-5
16-2345709-G-A p.Pro766Ser missense ABCA3 131 83108 0.00157626 41554 0 0.0019219
16-2345722-C-T p.Thr761Thr synonymous ABCA3 1 83072 1.20378E-5 41536 0 6.25E-4
16-2345723-G-A p.Thr761Met missense ABCA3 6 83076 7.2223E-5 41538 0 6.36862E-5
16-2345723-G-T p.Thr761Lys missense ABCA3 2 83076 2.40743E-5 41538 0 8.25232E-6
16-2345723-G-C p.Thr761Arg missense ABCA3 21 83076 2.52781E-4 41538 0 7.56731E-5
16-2345727-T-C p.Met760Val missense ABCA3 1 83062 1.20392E-5 41531 0 6.37146E-5
16-2345735-C-T p.Gly757Asp missense ABCA3 1 82950 1.20555E-5 41475 0 3.9868E-6
16-2345736-C-T p.Gly757Ser missense ABCA3 1 82952 1.20552E-5 41476 0 3.18512E-5
16-2345737-G-A p.Ala756Ala synonymous ABCA3 276 82914 0.00332875 41457 0 0.00875
16-2347323-C-T c.2263+7G>A splice_region ABCA3 2 81970 2.43992E-5 40985 0 1.67451E-5
16-2347330-C-T p.Gly755Ser missense+splice_region ABCA3 1 82242 1.21592E-5 41121 0 4.00811E-6
16-2347331-G-A p.Tyr754Tyr splice_region+synonymous ABCA3 6 82260 7.29395E-5 41130 0 4.16917E-5
16-2347352-C-T p.Ser747Ser synonymous ABCA3 5 82632 6.05092E-5 41316 0 1.59755E-4
16-2347361-G-A p.Cys744Cys synonymous ABCA3 2 82752 2.41686E-5 41376 0 4.14635E-5
16-2347372-G-A p.Leu741Leu synonymous ABCA3 1 82822 1.20741E-5 41411 0 NA
16-2347377-C-G p.Gly739Ala missense ABCA3 34 82876 4.10251E-4 41438 0 6.37999E-4
16-2347383-G-C p.Ala737Gly missense ABCA3 4 82874 4.8266E-5 41437 0 3.98156E-6
16-2347393-C-T p.Ala734Thr missense ABCA3 1 82898 1.2063E-5 41449 0 3.19244E-5
16-2347394-G-A p.Ile733Ile synonymous ABCA3 45 82904 5.42797E-4 41452 0 3.74132E-4
16-2347394-G-T p.Ile733Ile synonymous ABCA3 4 82906 4.82474E-5 41453 0 6.37959E-5
16-2347398-C-T p.Arg732His missense ABCA3 2 82932 2.41161E-5 41466 0 3.19061E-5
16-2347402-C-A p.Asp731Tyr missense ABCA3 1 82950 1.20555E-5 41475 0 NA
16-2347403-T-G p.Gly730Gly synonymous ABCA3 1 82944 1.20563E-5 41472 0 NA
16-2347420-C-T p.Glu725Lys missense ABCA3 2 82952 2.41103E-5 41476 0 8.26487E-6
16-2347421-G-C p.Asp724Glu missense ABCA3 12 82952 1.44662E-4 41476 0 1.31288E-4
16-2347426-T-C p.Met723Val missense ABCA3 2 82944 2.41127E-5 41472 0 3.97826E-6
16-2347430-G-A p.His721His synonymous ABCA3 1 82924 1.20592E-5 41462 0 3.18613E-5
16-2347440-A-T p.Leu718Gln missense ABCA3 2 82918 2.41202E-5 41459 0 NA
16-2347444-C-T p.Val717Met missense ABCA3 2 82912 2.4122E-5 41456 0 4.77414E-5
16-2347446-A-G p.Ile716Thr missense ABCA3 1 82906 1.20619E-5 41453 0 8.26173E-6
16-2347452-C-T p.Arg714His missense ABCA3 3 82858 3.62065E-5 41429 0 8.26351E-6
16-2347453-G-A p.Arg714Cys missense ABCA3 1 82852 1.20697E-5 41426 0 0.00100705
16-2347467-C-T p.Arg709Gln missense ABCA3 10 82858 1.20688E-4 41429 0 1.91192E-4
16-2347468-G-A p.Arg709Trp missense ABCA3 145 82840 0.00175036 41420 0 0.00188078
16-2347469-C-A p.Gln708His missense ABCA3 1 82864 1.2068E-5 41432 0 NA
16-2347474-G-A p.Leu707Phe missense ABCA3 45 82846 5.43176E-4 41423 0 9.24391E-4
16-2347487-G-A p.Ala702Ala synonymous ABCA3 1 82750 1.20846E-5 41375 0 3.98019E-6
16-2347488-G-A p.Ala702Val missense ABCA3 1 82708 1.20907E-5 41354 0 NA
16-2347498-A-C p.Ser699Ala missense ABCA3 12 82630 1.45226E-4 41315 0 1.9129E-4
16-2347504-C-A p.Ala697Ser missense ABCA3 1 82524 1.21177E-5 41262 0 NA
16-2347505-G-A p.Asp696Asp synonymous ABCA3 1 82532 1.21165E-5 41266 0 8.27993E-6
16-2347514-C-T p.Ser693Ser synonymous ABCA3 2 82370 2.42807E-5 41185 0 1.59327E-4
16-2347515-G-A p.Ser693Leu missense ABCA3 34 82382 4.12712E-4 41191 0 2.86917E-4
16-2347532-T-C p.Ile687Met missense ABCA3 6 82066 7.31119E-5 41033 0 6.38621E-5
16-2347545-A-G c.2053-5T>C splice_region ABCA3 4 81804 4.88974E-5 40902 0 NA
16-2347546-G-A c.2053-6C>T splice_region ABCA3 1 81798 1.22252E-5 40899 0 NA
16-2347759-C-T c.2052+8G>A splice_region ABCA3 8 81872 9.77135E-5 40936 0 6.36902E-5
16-2347760-G-A c.2052+7C>T splice_region ABCA3 9 81914 1.09871E-4 40957 0 8.42866E-5
16-2347763-A-G c.2052+4T>C splice_region ABCA3 1 82064 1.21856E-5 41032 0 8.34934E-6
16-2347771-G-C p.Ser683Cys missense ABCA3 1 82334 1.21457E-5 41167 0 3.99754E-6
16-2347778-C-T p.Ala681Thr missense ABCA3 7 82456 8.48938E-5 41228 0 2.4975E-5
16-2347778-C-A p.Ala681Ser missense ABCA3 1 82456 1.21277E-5 41228 0 3.18552E-5
16-2347779-G-A p.Ile680Ile synonymous ABCA3 3 82546 3.63434E-5 41273 0 1.19717E-5
16-2347782-G-A p.Leu679Leu synonymous ABCA3 1 82568 1.21112E-5 41284 0 2.49393E-5
16-2347787-C-T p.Ala678Thr missense ABCA3 7 82592 8.4754E-5 41296 0 9.56915E-5
16-2347788-G-A p.Ile677Ile synonymous ABCA3 12 82626 1.45233E-4 41313 0 4.34426E-4
16-2347792-C-G p.Gly676Ala missense ABCA3 2 82660 2.41955E-5 41330 0 NA
16-2347793-C-T p.Gly676Ser missense ABCA3 7 82672 8.4672E-5 41336 0 9.55779E-5
16-2347807-C-T p.Arg671His missense ABCA3 6 82784 7.24778E-5 41392 0 3.31235E-5
16-2347808-G-A p.Arg671Cys missense ABCA3 1 82762 1.20828E-5 41381 0 5.79557E-5
16-2347815-G-T p.Gly668Gly synonymous ABCA3 1 82832 1.20726E-5 41416 0 8.27499E-6
16-2347820-C-T p.Gly667Arg missense ABCA3 1 82902 1.20624E-5 41451 0 1.59176E-5
16-2347821-G-A p.Ser666Ser synonymous ABCA3 6 82902 7.23746E-5 41451 0 1.27486E-4
16-2347830-G-T p.Arg663Arg synonymous ABCA3 16 82954 1.92878E-4 41477 0 1.07474E-4
16-2347832-G-A p.Arg663Cys missense ABCA3 2 82942 2.41132E-5 41471 0 8.26679E-6
16-2347837-C-T p.Arg661Gln missense ABCA3 2 82958 2.41086E-5 41479 0 1.59266E-4
16-2347838-G-A p.Arg661Trp missense ABCA3 2 82948 2.41115E-5 41474 0 3.18532E-5
16-2347848-C-T p.Lys657Lys synonymous ABCA3 1 82990 1.20496E-5 41495 0 NA
16-2347853-C-T p.Asp656Asn missense ABCA3 2 83002 2.40958E-5 41501 0 6.37308E-5
16-2347859-G-C p.Leu654Val missense ABCA3 20 82980 2.41022E-4 41490 0 0.003125
16-2347862-C-T p.Gly653Ser missense ABCA3 3 83004 3.61428E-5 41502 0 4.13012E-5
16-2347863-G-A p.Ile652Ile synonymous ABCA3 6 83008 7.22822E-5 41504 0 7.95564E-5
16-2347877-T-C p.Met648Val missense ABCA3 1 83018 1.20456E-5 41509 0 3.97766E-6
16-2347879-T-C p.Gln647Arg missense ABCA3 1 83020 1.20453E-5 41510 0 8.25846E-6
16-2347889-C-T p.Glu644Lys missense ABCA3 3 82988 3.61498E-5 41494 0 9.56145E-5
16-2347894-G-A p.Pro642Leu missense ABCA3 1 82968 1.20528E-5 41484 0 NA
16-2347906-C-T p.Arg638His missense ABCA3 11 82896 1.32696E-4 41448 0 2.22834E-4
16-2347907-G-A p.Arg638Cys missense ABCA3 1 82886 1.20648E-5 41443 0 1.65322E-5
16-2347924-T-TGG c.1897-3_1897-2insCC splice_region ABCA3 1 82696 1.20925E-5 41348 0 NA
16-2347929-C-T c.1897-7G>A splice_region ABCA3 1 82644 1.21001E-5 41322 0 3.18735E-5
16-2347930-G-A c.1897-8C>T splice_region ABCA3 1 82620 1.21036E-5 41310 0 6.37227E-5
16-2348391-G-A p.Ala631Val missense ABCA3 1 83086 1.20357E-5 41543 0 8.2394E-6
16-2348391-G-T p.Ala631Asp missense ABCA3 1 83086 1.20357E-5 41543 0 NA
16-2348392-C-T p.Ala631Thr missense ABCA3 12 83084 1.44432E-4 41542 0 1.27502E-4
16-2348393-G-A p.Tyr630Tyr synonymous ABCA3 12 83108 1.4439E-4 41554 0 5.02587E-4
16-2348396-G-C p.Phe629Leu missense ABCA3 1 83156 1.20256E-5 41578 0 8.23913E-6
16-2348408-C-A p.Glu625Asp missense ABCA3 1 83192 1.20204E-5 41596 0 3.18715E-5
16-2348414-G-A p.Val623Val synonymous ABCA3 130 83222 0.00156209 41611 0 0.00353751
16-2348426-G-A p.Asp619Asp synonymous ABCA3 8 83238 9.611E-5 41619 0 4.94356E-5
16-2348435-G-T p.Ile616Ile synonymous ABCA3 3 83246 3.60378E-5 41623 0 NA
16-2348440-C-T p.Asp615Asn missense ABCA3 2 83236 2.40281E-5 41618 0 2.78379E-5
16-2348441-G-A p.His614His synonymous ABCA3 3 83236 3.60421E-5 41618 0 4.1197E-5
16-2348447-C-T p.Pro612Pro synonymous ABCA3 1 83222 1.20161E-5 41611 0 4.11991E-5
16-2348448-G-A p.Pro612Leu missense ABCA3 5 83226 6.00774E-5 41613 0 1.59076E-5
16-2348453-C-T p.Leu610Leu synonymous ABCA3 2 83226 2.4031E-5 41613 0 8.24022E-6
16-2348469-C-T p.Arg605Gln missense ABCA3 6 83190 7.21241E-5 41595 0 5.03525E-4
16-2348470-G-A p.Arg605Trp missense ABCA3 2 83192 2.40408E-5 41596 0 3.97728E-6
16-2348477-A-G p.Val602Val synonymous ABCA3 9 83188 1.08189E-4 41594 0 1.59337E-4
16-2348495-T-A p.Glu596Asp missense ABCA3 3 83174 3.6069E-5 41587 0 3.97769E-6
16-2348503-C-A p.Gly594Trp missense ABCA3 1 83164 1.20244E-5 41582 0 3.18674E-5
16-2348503-C-T p.Gly594Arg missense ABCA3 4 83164 4.80977E-5 41582 0 3.18674E-5
16-2348515-C-T p.Ala590Thr missense ABCA3 2 83128 2.40593E-5 41564 0 8.24769E-6
16-2348517-C-T p.Arg589Gln missense ABCA3 91 83096 0.00109512 41548 0 0.00258126
16-2348518-G-A p.Arg589Trp missense ABCA3 14 83100 1.68472E-4 41550 0 0.00100705
16-2348528-G-C p.Pro585Pro synonymous ABCA3 13088 82596 0.158458 41298 1118 0.14339
16-2348533-G-A p.Pro584Ser missense ABCA3 24 83022 2.8908E-4 41511 0 6.28931E-4
16-2348544-G-GT c.1742-4_1742-3insA splice_region ABCA3 1 82888 1.20645E-5 41444 0 NA
16-2348547-G-C c.1742-6C>G splice_region ABCA3 1 82826 1.20735E-5 41413 0 3.98584E-6
16-2349397-C-T c.1741+7G>A splice_region ABCA3 2 82506 2.42407E-5 41253 0 1.19724E-5
16-2349400-T-C c.1741+4A>G splice_region ABCA3 1 82618 1.21039E-5 41309 0 6.39018E-5
16-2349410-G-A p.Leu579Phe missense ABCA3 1 82802 1.2077E-5 41401 0 NA
16-2349413-T-C p.Met578Val missense ABCA3 3 82852 3.62091E-5 41426 0 3.98248E-6
16-2349414-GGA-G p.Ser577fs frameshift ABCA3 2 82882 2.41307E-5 41441 0 3.19224E-5
16-2349415-G-A p.Ser577Phe missense ABCA3 2 82886 2.41295E-5 41443 0 NA
16-2349423-G-A p.Thr574Thr synonymous ABCA3 36 82910 4.34206E-4 41455 1 0.00118158
16-2349434-C-T p.Gly571Arg missense ABCA3 1 82978 1.20514E-5 41489 0 1.59194E-5
16-2349435-G-A p.Ala570Ala synonymous ABCA3 2 82982 2.41016E-5 41491 0 6.38855E-5
16-2349441-G-A p.Asn568Asn synonymous ABCA3 3 83040 3.61272E-5 41520 0 1.1937E-5
16-2349442-T-C p.Asn568Ser missense ABCA3 2 83036 2.40859E-5 41518 0 8.26132E-6
16-2349447-G-A p.Gly566Gly synonymous ABCA3 1 83054 1.20404E-5 41527 0 8.25955E-6
16-2349450-C-T p.Leu565Leu synonymous ABCA3 2 83060 2.4079E-5 41530 0 NA
16-2349453-C-A p.Leu564Leu synonymous ABCA3 2 83080 2.40732E-5 41540 0 1.65169E-5
16-2349455-G-A p.Leu564Leu synonymous ABCA3 2 83086 2.40714E-5 41543 0 NA
16-2349456-G-A p.Val563Val synonymous ABCA3 3 83090 3.61054E-5 41545 0 NA
16-2349458-C-T p.Val563Ile missense ABCA3 23 83092 2.76802E-4 41546 0 0.001875
16-2349459-G-A p.Thr562Thr synonymous ABCA3 2 83096 2.40685E-5 41548 0 5.96768E-5
16-2349464-T-A p.Ile561Phe missense ABCA3 3 83088 3.61063E-5 41544 0 3.1955E-5
16-2349473-C-T p.Glu558Lys missense ABCA3 3 83134 3.60863E-5 41567 0 5.56961E-5
16-2349481-T-C p.Asn555Ser missense ABCA3 8 83132 9.62325E-5 41566 0 2.55542E-4
16-2349491-G-T p.Leu552Met missense ABCA3 1 83118 1.20311E-5 41559 0 3.97893E-5
16-2349500-C-T p.Val549Ile missense ABCA3 4 83110 4.8129E-5 41555 0 6.36775E-5
16-2349504-C-T p.Ala547Ala synonymous ABCA3 6 83092 7.22091E-5 41546 0 1.59632E-4
16-2349505-G-A p.Ala547Val missense ABCA3 15 83088 1.80531E-4 41544 0 9.0873E-5
16-2349507-C-T p.Arg546Arg synonymous ABCA3 4 83092 4.81394E-5 41546 0 0.00125
16-2349533-C-T p.Val538Met missense+splice_region ABCA3 2 83022 2.409E-5 41511 0 1.994E-5
16-2349535-T-TTGGACAGGTGCTTGATCTTGATCCCC c.1612-3_1612-2insGGGGATCAAGATCAAGCACCTGTCCA splice_region ABCA3 1 83010 1.20467E-5 41505 0 NA
16-2349537-C-A c.1612-4G>T splice_region ABCA3 1 83004 1.20476E-5 41502 0 NA
16-2350000-C-T c.1611+6G>A splice_region ABCA3 12 83060 1.44474E-4 41530 0 6.25E-4
16-2350000-C-A c.1611+6G>T splice_region ABCA3 2 83060 2.4079E-5 41530 0 NA
16-2350005-C-A c.1611+1G>T splice_donor ABCA3 1 83108 1.20325E-5 41554 0 8.23873E-6
16-2350008-T-C p.Lys537Glu missense+splice_region ABCA3 2 83138 2.40564E-5 41569 0 NA
16-2350013-A-C p.Leu535Arg missense ABCA3 2 83194 2.40402E-5 41597 0 NA
16-2350017-G-A p.His534Tyr missense ABCA3 2 83192 2.40408E-5 41596 0 6.3857E-5
16-2350021-G-T p.Ile532Ile synonymous ABCA3 1 83216 1.20169E-5 41608 0 3.98023E-6
16-2350033-C-T p.Ala528Ala synonymous ABCA3 15 83238 1.80206E-4 41619 0 4.47199E-4
16-2350045-C-G p.Glu524Asp missense ABCA3 1 83268 1.20094E-5 41634 0 4.37532E-5
16-2350053-C-T p.Glu522Lys missense ABCA3 2 83262 2.40206E-5 41631 0 3.19387E-5
16-2350068-C-T p.Glu517Lys missense ABCA3 25 83290 3.00156E-4 41645 0 2.02828E-4
16-2350069-G-A p.Asn516Asn synonymous ABCA3 4 83284 4.80284E-5 41642 0 5.03525E-4
16-2350078-T-C p.Ala513Ala synonymous ABCA3 1 83296 1.20054E-5 41648 0 8.23832E-6
16-2350086-C-T p.Glu511Lys missense ABCA3 1 83286 1.20068E-5 41643 0 8.23845E-6
16-2350087-G-A p.Pro510Pro synonymous ABCA3 2 83280 2.40154E-5 41640 0 3.19142E-5
16-2350093-A-G p.Ser508Ser synonymous ABCA3 1 83262 1.20103E-5 41631 0 NA
16-2350094-C-A p.Ser508Ile missense ABCA3 1 83262 1.20103E-5 41631 0 1.64769E-5
16-2350115-G-T p.Ala501Glu missense ABCA3 658 83208 0.00790789 41604 13 0.0251762
16-2350115-G-A p.Ala501Val missense ABCA3 2 83228 2.40304E-5 41614 0 6.38488E-5
16-2350120-C-A p.Ala499Ala synonymous ABCA3 4 83242 4.80527E-5 41621 0 1.59096E-5
16-2350120-C-T p.Ala499Ala synonymous ABCA3 3 83242 3.60395E-5 41621 0 2.47174E-5
16-2350125-T-G p.Arg498Arg synonymous ABCA3 1 83234 1.20143E-5 41617 0 NA
16-2350142-T-TA p.Tyr492fs frameshift ABCA3 4 83214 4.80688E-5 41607 0 1.59122E-5
16-2350143-A-G p.Tyr492His missense ABCA3 1 83208 1.20181E-5 41604 0 NA
16-2350148-G-C p.Pro490Arg missense+splice_region ABCA3 2 83200 2.40385E-5 41600 0 NA
16-2350149-G-T p.Pro490Thr missense+splice_region ABCA3 1 83186 1.20213E-5 41593 0 NA
16-2350157-G-A c.1468-8C>T splice_region ABCA3 2 83152 2.40523E-5 41576 0 1.64902E-5
16-2353972-T-A p.Met489Leu missense+splice_region ABCA3 53 81772 6.48144E-4 40886 1 0.00453629
16-2353980-A-T p.Phe486Tyr missense ABCA3 1 82118 1.21776E-5 41059 0 6.61408E-5
16-2353984-A-T p.Tyr485Asn missense ABCA3 1 82108 1.21791E-5 41054 0 NA
16-2354002-C-T p.Gly479Ser missense ABCA3 7 82516 8.4832E-5 41258 0 3.58689E-5
16-2354003-G-C p.Phe478Leu missense ABCA3 1 82548 1.21142E-5 41274 0 3.30104E-5
16-2354003-G-A p.Phe478Phe synonymous ABCA3 1 82548 1.21142E-5 41274 0 9.07786E-5
16-2354005-A-G p.Phe478Leu missense ABCA3 5 82632 6.05092E-5 41316 0 6.37024E-5
16-2354009-C-A p.Gly476Gly synonymous ABCA3 3 82732 3.62617E-5 41366 0 2.475E-5
16-2354018-G-T p.Val473Val synonymous ABCA3 1 82882 1.20653E-5 41441 0 NA
16-2354020-C-T p.Val473Ile missense ABCA3 10 82860 1.20685E-4 41430 0 5.03525E-4
16-2354021-G-A p.Ala472Ala synonymous ABCA3 1 82862 1.20683E-5 41431 0 3.18776E-5
16-2354026-C-G p.Glu471Gln missense ABCA3 1 82938 1.20572E-5 41469 0 NA
16-2354029-T-G p.Met470Leu missense ABCA3 1 82972 1.20523E-5 41486 0 1.19371E-5
16-2354046-C-A p.Gly464Val missense ABCA3 1 82916 1.20604E-5 41458 0 NA
16-2354054-C-T p.Val461Val synonymous ABCA3 8 82922 9.64762E-5 41461 0 6.37389E-5
16-2354058-G-A p.Ser460Phe missense ABCA3 1 82910 1.20613E-5 41455 0 1.64908E-5
16-2354059-A-G p.Ser460Pro missense ABCA3 1 82906 1.20619E-5 41453 0 NA
16-2354074-TC-T p.Met455fs frameshift ABCA3 1 82754 1.2084E-5 41377 0 NA
16-2354089-C-T p.Gly450Arg missense ABCA3 1 82596 1.21071E-5 41298 0 3.18715E-5
16-2354090-G-A p.Phe449Phe synonymous ABCA3 1 82632 1.21018E-5 41316 0 2.47508E-5
16-2354101-C-T p.Asp446Asn missense ABCA3 1 82418 1.21333E-5 41209 0 6.37105E-5
16-2354102-G-A p.Asp445Asp synonymous ABCA3 2 82410 2.42689E-5 41205 0 3.18512E-5
16-2354107-C-T p.Asp444Asn missense ABCA3 1 82312 1.21489E-5 41156 0 NA
16-2354110-C-T p.Val443Met missense ABCA3 3 82212 3.6491E-5 41106 0 7.56701E-5
16-2354116-C-T p.Val441Ile missense ABCA3 2 81924 2.44129E-5 40962 0 3.18728E-5
16-2354117-G-A p.Pro440Pro synonymous ABCA3 5 81842 6.10933E-5 40921 0 1.15708E-4
16-2354129-G-A p.Asp436Asp synonymous ABCA3 1 81224 1.23116E-5 40612 0 NA
16-2354133-C-T p.Arg435Gln missense ABCA3 3 80888 3.70883E-5 40444 0 0.00100705
16-2354139-T-C p.Gln433Arg missense ABCA3 2 80538 2.4833E-5 40269 0 1.65664E-5
16-2354154-G-A c.1286-3C>T splice_region ABCA3 1 78956 1.26653E-5 39478 0 3.18613E-5
16-2354158-G-A c.1286-7C>T splice_region ABCA3 1 78462 1.2745E-5 39231 0 NA
16-2358448-C-T c.1285+3G>A splice_region ABCA3 1 83302 1.20045E-5 41651 0 8.2462E-6
16-2358456-G-A p.Ala427Val missense ABCA3 2 83314 2.40056E-5 41657 0 1.5907E-5
16-2358486-A-G p.Met417Thr missense ABCA3 2 83344 2.39969E-5 41672 0 NA
16-2358487-T-C p.Met417Val missense ABCA3 4 83346 4.79927E-5 41673 0 8.23791E-6
16-2358489-G-C p.Ala416Gly missense ABCA3 2 83352 2.39946E-5 41676 1 NA
16-2358496-C-T p.Ala414Thr missense ABCA3 1 83364 1.19956E-5 41682 0 3.9764E-6
16-2358497-G-A p.Val413Val synonymous ABCA3 3 83360 3.59885E-5 41680 0 5.03525E-4
16-2358504-G-C p.Ser411Cys missense ABCA3 1 83360 1.19962E-5 41680 0 NA
16-2358515-G-A p.Ser407Ser synonymous ABCA3 1 83364 1.19956E-5 41682 0 3.18431E-5
16-2358516-G-A p.Ser407Phe missense ABCA3 1 83362 1.19959E-5 41681 0 3.9763E-6
16-2358525-T-C p.Lys404Arg missense ABCA3 1 83352 1.19973E-5 41676 0 NA
16-2358528-T-C p.Gln403Arg missense ABCA3 1 83356 1.19967E-5 41678 0 3.18451E-5
16-2358533-C-T p.Leu401Leu synonymous ABCA3 2 83346 2.39964E-5 41673 0 7.95273E-6
16-2358533-C-G p.Leu401Leu synonymous ABCA3 1 83346 1.19982E-5 41673 0 NA
16-2358549-T-C p.Tyr396Cys missense ABCA3 1 83322 1.20016E-5 41661 0 2.47121E-5
16-2358553-G-A p.Arg395Trp missense ABCA3 4 83310 4.80134E-5 41655 0 1.97694E-4
16-2358556-G-A p.Pro394Ser missense ABCA3 2 83318 2.40044E-5 41659 0 3.9764E-6
16-2358562-C-CGAAGAAGTAGGGGATGTAGGT p.Phe391_Val392insThrTyrIleProTyrPhePhe conservative_inframe_insertion ABCA3 1 83296 1.20054E-5 41648 0 1.64745E-5
16-2358563-G-A p.Phe391Phe synonymous ABCA3 3 83292 3.60179E-5 41646 0 1.64747E-5
16-2358578-G-A p.Tyr386Tyr synonymous ABCA3 3 83282 3.60222E-5 41641 0 1.59061E-5
16-2358583-T-C p.Thr385Ala missense ABCA3 5 83262 6.00514E-5 41631 0 6.25E-4
16-2358593-G-C p.Leu381Leu synonymous ABCA3 1 83226 1.20155E-5 41613 0 6.36943E-5
16-2358596-G-A p.Phe380Phe synonymous ABCA3 1 83206 1.20184E-5 41603 0 3.97801E-6
16-2358605-G-A p.Phe377Phe synonymous ABCA3 2 83138 2.40564E-5 41569 0 3.18593E-5
16-2367276-G-T c.1111+8C>A splice_region ABCA3 1 82280 1.21536E-5 41140 0 8.25491E-6
16-2367278-G-T c.1111+6C>A splice_region ABCA3 1 82344 1.21442E-5 41172 0 NA
16-2367289-C-T p.Ser369Asn missense ABCA3 3 82720 3.62669E-5 41360 0 2.78658E-5
16-2367292-A-T p.Phe368Tyr missense ABCA3 1 82790 1.20788E-5 41395 0 NA
16-2367298-G-C p.Thr366Ser missense ABCA3 1 82886 1.20648E-5 41443 0 3.18532E-5
16-2367298-G-A p.Thr366Ile missense ABCA3 1 82886 1.20648E-5 41443 0 8.24729E-6
16-2367325-G-A p.Thr357Ile missense ABCA3 1 83064 1.20389E-5 41532 0 NA
16-2367331-A-G p.Ile355Thr missense ABCA3 1 83082 1.20363E-5 41541 0 8.24443E-6
16-2367332-T-G p.Ile355Leu missense ABCA3 1 83074 1.20375E-5 41537 0 NA
16-2367336-G-A p.Phe353Phe synonymous ABCA3 9855 82794 0.11903 41397 834 0.17021
16-2367338-A-G p.Phe353Leu missense ABCA3 3 83064 3.61167E-5 41532 0 2.47329E-5
16-2367342-C-T p.Leu351Leu synonymous ABCA3 3 83072 3.61133E-5 41536 0 3.97893E-6
16-2367348-G-A p.Phe349Phe synonymous ABCA3 1 83036 1.2043E-5 41518 0 NA
16-2367353-C-T p.Ala348Thr missense ABCA3 1 82994 1.20491E-5 41497 0 3.18593E-5
16-2367366-G-A p.Pro343Pro synonymous ABCA3 12 83004 1.44571E-4 41502 0 2.86679E-4
16-2367367-G-A p.Pro343Leu missense ABCA3 1 82992 1.20494E-5 41496 0 NA
16-2367367-G-T p.Pro343His missense ABCA3 1 82992 1.20494E-5 41496 0 3.9813E-6
16-2367371-C-T p.Asp342Asn missense ABCA3 1 82922 1.20595E-5 41461 0 6.25E-4
16-2367372-G-A p.Ser341Ser synonymous ABCA3 1 82916 1.20604E-5 41458 0 5.03525E-4
16-2367375-G-A p.Arg340Arg synonymous ABCA3 1 82918 1.20601E-5 41459 0 8.24906E-6
16-2367376-C-T p.Arg340His missense ABCA3 1 82906 1.20619E-5 41453 0 5.03525E-4
16-2367377-G-A p.Arg340Cys missense ABCA3 4 82930 4.82335E-5 41465 0 3.18674E-5
16-2367384-C-T p.Val337Val synonymous ABCA3 1 82880 1.20656E-5 41440 0 1.19484E-5
16-2367386-C-T p.Val337Met missense ABCA3 3 82868 3.62022E-5 41434 0 2.38996E-5
16-2367387-G-C p.Ala336Ala synonymous ABCA3 52 82850 6.2764E-4 41425 0 0.004375
16-2367642-T-C c.990+7A>G splice_region ABCA3 1 82880 1.20656E-5 41440 0 NA
16-2367642-T-G c.990+7A>C splice_region ABCA3 5 82880 6.03282E-5 41440 0 3.18654E-5
16-2367652-G-A p.Val329Val synonymous ABCA3 1 83000 1.20482E-5 41500 0 NA
16-2367654-C-T p.Val329Ile missense ABCA3 1 83004 1.20476E-5 41502 0 NA
16-2367657-A-G p.Cys328Arg missense ABCA3 1 83010 1.20467E-5 41505 0 6.76202E-5
16-2367667-G-C p.Thr324Thr synonymous ABCA3 1 83014 1.20462E-5 41507 0 9.55536E-5
16-2367672-T-C p.Met323Val missense ABCA3 1 83038 1.20427E-5 41519 0 8.24212E-6
16-2367681-C-T p.Ala320Thr missense ABCA3 4 83070 4.81522E-5 41535 0 6.59413E-5
16-2367682-G-A p.Ala319Ala synonymous ABCA3 1 83066 1.20386E-5 41533 0 2.38646E-5
16-2367684-C-T p.Ala319Thr missense ABCA3 10 83036 1.2043E-4 41518 0 6.37227E-5
16-2367685-G-A p.Ile318Ile synonymous ABCA3 60 83076 7.2223E-4 41538 0 0.00178367
16-2367688-G-A p.Leu317Leu synonymous ABCA3 7 83112 8.42237E-5 41556 0 8.24307E-5
16-2367697-G-C p.Leu314Leu synonymous ABCA3 9 83116 1.08282E-4 41558 0 0.0020141
16-2367728-T-C p.His304Arg missense ABCA3 1 82918 1.20601E-5 41459 0 NA
16-2367744-G-T p.Leu299Ile missense ABCA3 2 82662 2.41949E-5 41331 0 3.97937E-6
16-2367745-C-T p.Gly298Gly synonymous ABCA3 1 82628 1.21024E-5 41314 0 8.25069E-6
16-2367755-C-T p.Arg295His missense ABCA3 1 82290 1.21521E-5 41145 0 3.18431E-5
16-2367764-T-A p.Glu292Val missense+splice_region ABCA3 240 81626 0.00294024 40813 1 0.00267618
16-2367767-T-TTCAGCCTCCTTTCCTTCTCCTGCACGACAGCAC c.874-3_874-2insGTGCTGTCGTGCAGGAGAAGGAAAGGAGGCTGA splice_region ABCA3 2 81446 2.45561E-5 40723 1 NA
16-2367772-A-T c.874-7T>A splice_region ABCA3 3 81080 3.70005E-5 40540 0 8.26405E-6
16-2369581-C-T c.873+1G>A splice_donor ABCA3 2 82868 2.41348E-5 41434 0 NA
16-2369587-G-A p.Leu290Leu synonymous ABCA3 2 82924 2.41185E-5 41462 0 NA
16-2369592-C-T p.Arg288Lys missense ABCA3 660 82986 0.00795315 41493 5 0.00979704
16-2369608-C-T p.Val283Met missense ABCA3 1 83048 1.20412E-5 41524 0 1.64995E-5
16-2369609-G-A p.Val282Val synonymous ABCA3 7 83052 8.42845E-5 41526 0 1.59561E-4
16-2369616-C-T p.Arg280His missense ABCA3 69 83054 8.30785E-4 41527 1 9.97922E-4
16-2369617-G-A p.Arg280Cys missense ABCA3 12 83092 1.44418E-4 41546 0 1.71609E-4
16-2369618-G-A p.Ala279Ala synonymous ABCA3 1 83100 1.20337E-5 41550 0 8.24674E-6
16-2369622-A-G p.Ile278Thr missense ABCA3 1 83124 1.20302E-5 41562 0 NA
16-2369623-T-C p.Ile278Val missense ABCA3 1 83140 1.20279E-5 41570 0 NA
16-2369624-G-A p.Thr277Thr synonymous ABCA3 3 83132 3.60872E-5 41566 0 3.29859E-5
16-2369625-G-C p.Thr277Ser missense ABCA3 2 83136 2.4057E-5 41568 0 NA
16-2369630-C-T p.Ala275Ala synonymous ABCA3 1 83142 1.20276E-5 41571 0 3.18918E-5
16-2369631-G-A p.Ala275Val missense ABCA3 5 83156 6.0128E-5 41578 0 0.00373087
16-2369632-C-T p.Ala275Thr missense ABCA3 2 83150 2.40529E-5 41575 0 3.19E-5
16-2369633-G-A p.Thr274Thr synonymous ABCA3 33 83162 3.96816E-4 41581 0 0.00125
16-2369633-GGTGTA-G p.Tyr273fs frameshift ABCA3 1 83162 1.20247E-5 41581 0 8.24701E-6
16-2369635-T-C p.Thr274Ala missense ABCA3 5 83154 6.01294E-5 41577 0 3.19489E-5
16-2369637-T-C p.Tyr273Cys missense ABCA3 1 83170 1.20236E-5 41585 0 3.98419E-6
16-2369645-G-A p.Ser270Ser synonymous ABCA3 1 83170 1.20236E-5 41585 0 3.98318E-6
16-2369652-A-G p.Leu268Pro missense ABCA3 1 83178 1.20224E-5 41589 0 3.9854E-6
16-2369656-G-A p.Leu267Leu synonymous ABCA3 1 83166 1.20241E-5 41583 0 NA
16-2369686-C-A p.Val257Leu missense ABCA3 2 83088 2.40709E-5 41544 0 1.65055E-5
16-2369686-C-T p.Val257Met missense ABCA3 3 83088 3.61063E-5 41544 0 3.19509E-5
16-2369687-G-A p.Leu256Leu synonymous ABCA3 3 83106 3.60985E-5 41553 0 8.75733E-5
16-2369690-G-A p.Phe255Phe synonymous ABCA3 5 83140 6.01395E-5 41570 0 3.19183E-5
16-2369693-G-T p.Pro254Pro synonymous ABCA3 12 83140 1.44335E-4 41570 0 5.97015E-5
16-2369694-G-C p.Pro254Arg missense ABCA3 1 83142 1.20276E-5 41571 0 3.97972E-6
16-2369698-C-G p.Asp253His missense ABCA3 1 83122 1.20305E-5 41561 0 NA
16-2369701-C-T p.Ala252Thr missense ABCA3 2 83062 2.40784E-5 41531 0 4.95376E-5
16-2369702-G-A p.Ile251Ile synonymous ABCA3 63 83078 7.58324E-4 41539 0 0.00151057
16-2369708-C-T p.Pro249Pro synonymous ABCA3 13 83034 1.56562E-4 41517 0 1.23532E-4