Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
9-139902111-G-T n.884C>A splice_region ABCA2 1 62768 1.59317E-5 31384 0 NA
9-139902382-C-T p.Ter2437Ter stop_retained ABCA2 1 81954 1.2202E-5 40977 0 3.19E-5
9-139902395-C-T p.Asp2433Asn missense ABCA2 1 81774 1.22288E-5 40887 0 8.25117E-6
9-139902397-G-T p.Thr2432Lys missense ABCA2 1 81732 1.22351E-5 40866 0 NA
9-139902398-T-C p.Thr2432Ala missense ABCA2 2 81730 2.44708E-5 40865 0 NA
9-139902414-G-C p.Ala2426Ala splice_region+synonymous ABCA2 1 81234 1.23101E-5 40617 0 8.61074E-6
9-139902415-G-A p.Ala2426Val missense+splice_region ABCA2 1 81206 1.23144E-5 40603 0 3.18756E-5
9-139902420-TG-T c.7276-5delC splice_region ABCA2 1 81026 1.23417E-5 40513 0 NA
9-139902421-G-A c.7276-5C>T splice_region ABCA2 6 80976 7.4096E-5 40488 0 1.24701E-5
9-139902680-TCTGGACCATG-T n.443_*7delCATGGTCCAG splice_region ABCA2 1 37094 2.69585E-5 18547 0 NA
9-139902771-GGCCAGTTCTCCCCCGACCCCACCCGCGGCTGGAGCCACCAGGCAGCCTGGGTCCAGTGGGCAGAGCCCTGGACAGCCATGAGAGCAGCCTGCTCA-G c.7275+2_7275+96delTGAGCAGGCTGCTCTCATGGCTGTCCAGGGCTCTGCCCACTGGACCCAGGCTGCCTGGTGGCTCCAGCCGCGGGTGGGGTCGGGGGAGAACTGGC splice_donor ABCA2 1 56772 1.76143E-5 28386 0 NA
9-139902866-A-C c.7275+2T>G splice_donor ABCA2 1 75918 1.31721E-5 37959 0 NA
9-139902869-C-T p.Arg2425Gln missense+splice_region ABCA2 3 76448 3.92424E-5 38224 0 0.00160772
9-139902879-C-T p.Glu2422Lys missense ABCA2 3 77850 3.85356E-5 38925 0 1.29899E-5
9-139902880-G-A p.Phe2421Phe synonymous ABCA2 1 77984 1.28231E-5 38992 0 NA
9-139902897-C-T p.Glu2416Lys missense ABCA2 1 79292 1.26116E-5 39646 0 1.06712E-4
9-139902903-C-T p.Glu2414Lys missense ABCA2 1 79696 1.25477E-5 39848 0 6.13632E-6
9-139902904-C-T p.Thr2413Thr synonymous ABCA2 1 79700 1.25471E-5 39850 0 5.17224E-5
9-139902904-C-G p.Thr2413Thr synonymous ABCA2 3 79700 3.76412E-5 39850 0 6.12407E-6
9-139902905-G-A p.Thr2413Met missense ABCA2 1 79682 1.25499E-5 39841 0 3.18593E-5
9-139902907-G-A p.Asp2412Asp synonymous ABCA2 1 79842 1.25247E-5 39921 0 6.06039E-6
9-139902909-C-T p.Asp2412Asn missense ABCA2 1 79892 1.25169E-5 39946 0 NA
9-139902911-A-C p.Leu2411Arg missense ABCA2 2 79938 2.50194E-5 39969 0 6.01019E-6
9-139902919-G-A p.Pro2408Pro synonymous ABCA2 9 79992 1.12511E-4 39996 0 1.90931E-4
9-139902925-G-A p.Asp2406Asp synonymous ABCA2 1 80138 1.24785E-5 40069 0 1.13924E-5
9-139902929-G-T p.Ala2405Glu missense ABCA2 6 80334 7.46882E-5 40167 0 4.38866E-5
9-139902938-G-A p.Ala2402Val missense ABCA2 1 80410 1.24363E-5 40205 0 NA
9-139902939-C-G p.Ala2402Pro missense ABCA2 1 80402 1.24375E-5 40201 0 5.4556E-6
9-139902939-C-T p.Ala2402Thr missense ABCA2 1 80402 1.24375E-5 40201 0 1.09112E-5
9-139902941-C-T p.Arg2401Gln missense ABCA2 8 80430 9.94654E-5 40215 0 3.18776E-5
9-139902949-C-T p.Thr2398Thr synonymous ABCA2 2 80520 2.48385E-5 40260 0 3.6324E-5
9-139902950-G-A p.Thr2398Met missense ABCA2 5 80534 6.20856E-5 40267 0 3.56532E-5
9-139902952-G-T p.Pro2397Pro synonymous ABCA2 1 80618 1.24042E-5 40309 0 NA
9-139902961-C-T p.Arg2394Arg synonymous ABCA2 1 80686 1.23937E-5 40343 0 NA
9-139902962-C-T p.Arg2394Gln missense ABCA2 68 80694 8.4269E-4 40347 0 0.00250313
9-139902964-G-A p.Pro2393Pro synonymous ABCA2 1 80738 1.23857E-5 40369 0 4.858E-6
9-139902966-G-T p.Pro2393Thr missense ABCA2 3 80752 3.71508E-5 40376 0 3.18695E-5
9-139902968-C-T p.Arg2392Gln missense ABCA2 13 80760 1.60971E-4 40380 1 0.0020284
9-139902969-G-A p.Arg2392Trp missense ABCA2 1 80828 1.2372E-5 40414 0 8.00811E-5
9-139902976-G-A p.Ser2389Ser synonymous ABCA2 1 80932 1.23561E-5 40466 0 2.3146E-5
9-139902979-G-A p.Leu2388Leu synonymous ABCA2 6 80986 7.40869E-5 40493 0 8.78696E-5
9-139902982-C-T p.Leu2387Leu synonymous ABCA2 2 80980 2.46975E-5 40490 0 2.09749E-5
9-139902990-C-T p.Gly2385Ser missense ABCA2 4 81062 4.93449E-5 40531 0 5.57103E-5
9-139902998-G-A p.Ser2382Phe missense ABCA2 1 81192 1.23165E-5 40596 0 NA
9-139903008-C-T p.Ala2379Thr missense ABCA2 4 81244 4.92344E-5 40622 0 4.46721E-5
9-139903013-G-A p.Pro2377Leu missense ABCA2 1 81272 1.23044E-5 40636 0 NA
9-139903015-C-A p.Pro2376Pro synonymous ABCA2 1 81242 1.23089E-5 40621 0 NA
9-139903021-C-T p.Thr2374Thr synonymous ABCA2 17 81250 2.09231E-4 40625 0 0.00151515
9-139903022-G-A p.Thr2374Met missense ABCA2 1 81242 1.23089E-5 40621 0 3.19122E-5
9-139903028-T-C p.Gln2372Arg missense ABCA2 1 81284 1.23025E-5 40642 0 1.91388E-4
9-139903033-C-T p.Glu2370Glu synonymous ABCA2 15 81298 1.84506E-4 40649 0 1.48684E-4
9-139903054-C-T c.343-7G>A splice_region ABCA2 1 81224 1.23116E-5 40612 0 3.19366E-5
9-139903068-C-G p.Val2359Leu missense ABCA2 1 81008 1.23445E-5 40504 0 NA
9-139903069-G-C p.Phe2358Leu missense ABCA2 1 80998 1.2346E-5 40499 0 1.28064E-5
9-139903069-G-A p.Phe2358Phe synonymous ABCA2 2 80998 2.4692E-5 40499 0 1.27008E-5
9-139903176-C-T c.7068+7G>A splice_region ABCA2 175 80832 0.00216498 40416 2 0.00453413
9-139903176-C-A c.7068+7G>T splice_region ABCA2 1 80836 1.23707E-5 40418 0 NA
9-139903225-C-T p.Leu2342Leu synonymous ABCA2 1 81454 1.22769E-5 40727 0 NA
9-139903230-C-T p.Val2341Met missense ABCA2 7 81428 8.59655E-5 40714 0 1.73455E-5
9-139903231-G-A p.Gly2340Gly synonymous ABCA2 3 81422 3.68451E-5 40711 0 6.77897E-5
9-139903252-G-A p.Ser2333Ser synonymous ABCA2 1 81588 1.22567E-5 40794 0 2.58124E-5
9-139903270-C-G p.Ser2327Ser synonymous ABCA2 7 81610 8.57738E-5 40805 0 6.57016E-5
9-139903273-G-C p.Ile2326Met missense ABCA2 1 81648 1.22477E-5 40824 0 NA
9-139903282-C-T p.Ser2323Ser synonymous ABCA2 3 81602 3.67638E-5 40801 0 8.34056E-6
9-139903294-G-A p.Tyr2319Tyr synonymous ABCA2 3 81536 3.67936E-5 40768 0 4.89505E-5
9-139903319-TCCTGCAGGGGGGGAGGTCAGAGGCCTGGCAGCGCCCCCCCACCCCGTAGCGCCCCCTCCACAACCCTGCCCGGGACGGCGCA-T p.Glu2311fs frameshift ABCA2 8 81218 9.85003E-5 40609 0 NA
9-139903320-C-T p.Glu2311Lys missense+splice_region ABCA2 1 81218 1.23125E-5 40609 0 NA
9-139903324-CA-C c.6931-5delT splice_region ABCA2 2 81098 2.46615E-5 40549 0 2.87693E-5
9-139903325-A-AG c.6931-6_6931-5insC splice_region ABCA2 2 81064 2.46719E-5 40532 0 8.49748E-6
9-139903327-G-A c.6931-7C>T splice_region ABCA2 388 81034 0.00478811 40517 2 0.0089074
9-139903327-G-T c.6931-7C>A splice_region ABCA2 3 81048 3.70151E-5 40524 0 6.4082E-5
9-139903327-G-C c.6931-7C>G splice_region ABCA2 1 81048 1.23384E-5 40524 0 5.77879E-5
9-139903328-G-A c.6931-8C>T splice_region ABCA2 1 81044 1.2339E-5 40522 0 9.57781E-6
9-139903328-G-T c.6931-8C>A splice_region ABCA2 2 81044 2.4678E-5 40522 0 3.20349E-5
9-139903395-C-T c.6930+8G>A splice_region ABCA2 4 79726 5.01718E-5 39863 0 1.30234E-4
9-139903396-G-A c.6930+7C>T splice_region ABCA2 56 79676 7.02847E-4 39838 0 0.00167565
9-139903406-G-A p.Leu2309Leu synonymous ABCA2 4 79976 5.0015E-5 39988 0 3.23353E-5
9-139903412-G-C p.Ala2307Ala synonymous ABCA2 1 80044 1.24931E-5 40022 0 NA
9-139903419-G-A p.Pro2305Leu missense ABCA2 1 79966 1.25053E-5 39983 0 8.84924E-6
9-139903429-G-A p.Arg2302Cys missense ABCA2 2 79884 2.50363E-5 39942 0 3.21502E-5
9-139903439-C-T p.Arg2298Arg synonymous ABCA2 1 79574 1.25669E-5 39787 0 8.72631E-6
9-139903440-C-T p.Arg2298Gln missense ABCA2 3 79488 3.77415E-5 39744 0 0.00125
9-139903440-C-G p.Arg2298Pro missense ABCA2 3 79488 3.77415E-5 39744 0 5.04541E-4
9-139903441-G-A p.Arg2298Trp missense ABCA2 2 79372 2.51978E-5 39686 0 4.50602E-5
9-139903442-C-T p.Val2297Val synonymous ABCA2 1 79412 1.25926E-5 39706 0 3.20862E-5
9-139903456-C-T p.Val2293Met missense ABCA2 4 78638 5.0866E-5 39319 0 8.18773E-6
9-139903465-T-C p.Ser2290Gly missense ABCA2 3 78046 3.84389E-5 39023 0 8.20183E-6
9-139903476-C-T p.Arg2286Gln missense ABCA2 1 76664 1.30439E-5 38332 0 NA
9-139903478-C-T p.Val2285Val synonymous ABCA2 4 76438 5.233E-5 38219 0 3.1957E-5
9-139903480-C-A p.Val2285Leu missense ABCA2 1 76278 1.31099E-5 38139 0 NA
9-139903481-C-T p.Thr2284Thr synonymous ABCA2 5 75954 6.58293E-5 37977 0 3.71508E-5
9-139903481-C-G p.Thr2284Thr synonymous ABCA2 2 75954 2.63317E-5 37977 0 4.12786E-6
9-139903486-T-G p.Ile2283Leu missense ABCA2 1 75460 1.32521E-5 37730 0 4.13394E-6
9-139903505-C-G p.Arg2276Arg splice_region+synonymous ABCA2 1 71580 1.39704E-5 35790 0 1.25818E-5
9-139903507-TG-T c.6828-3delC splice_region ABCA2 14 71006 1.97166E-4 35503 0 6.07339E-4
9-139903513-G-C c.6828-8C>G splice_region ABCA2 1 69964 1.42931E-5 34982 0 NA
9-139903802-CTGG-C n.653_655delCCA splice_region ABCA2 2 52120 3.8373E-5 26060 0 NA
9-139903803-T-C n.655A>G splice_region ABCA2 10 50252 1.98997E-4 25126 0 2.54496E-5
9-139903803-TG-CT n.654_655delCAinsAG splice_region ABCA2 1 50366 1.98547E-5 25183 0 NA
9-139903804-G-C n.654C>G splice_region ABCA2 9 50722 1.77438E-4 25361 0 NA
9-139903805-G-C n.653C>G splice_region ABCA2 9 51530 1.74656E-4 25765 0 NA
9-139903814-C-T c.6827+8G>A splice_region ABCA2 33 57084 5.78095E-4 28542 0 0.00187735
9-139903815-G-C c.6827+7C>G splice_region ABCA2 3 54270 5.52792E-5 27135 0 NA
9-139903816-G-C c.6827+6C>G splice_region ABCA2 4 55892 7.15666E-5 27946 0 NA
9-139903818-T-C c.6827+4A>G splice_region ABCA2 2 57256 3.49308E-5 28628 0 NA
9-139903820-A-C c.6827+2T>G splice_donor ABCA2 1 58776 1.70137E-5 29388 0 NA
9-139903855-C-T p.Arg2265Gln missense ABCA2 1 73810 1.35483E-5 36905 0 5.0843E-5
9-139903856-G-C p.Arg2265Gly missense ABCA2 2 73714 2.71319E-5 36857 0 NA
9-139903860-G-A n.696C>T splice_region ABCA2 2 74826 2.67287E-5 37413 0 NA
9-139903861-C-T p.Arg2263His missense ABCA2 1 74848 1.33604E-5 37424 0 5.91856E-5
9-139903862-G-A p.Arg2263Cys missense ABCA2 1 75240 1.32908E-5 37620 0 NA
9-139903866-G-A p.Asn2261Asn synonymous ABCA2 1 76460 1.30787E-5 38230 0 5.77957E-5
9-139903887-C-T p.Thr2254Thr synonymous ABCA2 1 78516 1.27363E-5 39258 0 2.77198E-5
9-139903896-C-T p.Ala2251Ala synonymous ABCA2 3 78976 3.79862E-5 39488 0 6.25E-4
9-139903902-G-A p.Cys2249Cys synonymous ABCA2 2 79356 2.52029E-5 39678 0 5.05051E-4
9-139903914-GCTGTGGGACATGCACAGGCTGGCACCGGAAGGGGTGCTGTGGGGTGGGGGCACAAAGAGGGGGTGGGGGCGCCCTCAC-G p.Ser1fs frameshift ABCA2 13 79900 1.62703E-4 39950 5 NA
9-139903985-G-A c.6734+8C>T splice_region ABCA2 7 81648 8.57339E-5 40824 0 7.27567E-5
9-139903986-C-T c.6734+7G>A splice_region ABCA2 1 81702 1.22396E-5 40851 0 NA
9-139904006-G-C p.Leu2241Val missense ABCA2 1 82384 1.21383E-5 41192 0 NA
9-139904036-CA-TG p.LeuAsp2230LeuAsn missense ABCA2 1 82636 1.21013E-5 41318 0 NA
9-139904037-A-G p.Leu2230Leu synonymous ABCA2 55806 80896 0.689849 40448 19327 0.695625
9-139904045-G-C p.Leu2228Val missense ABCA2 2 82710 2.41809E-5 41355 0 NA
9-139904055-G-A p.Phe2224Phe synonymous ABCA2 5 82730 6.04376E-5 41365 0 4.0222E-6
9-139904064-G-A p.Ala2221Ala synonymous ABCA2 2 82714 2.41797E-5 41357 0 NA
9-139904083-G-T p.Thr2215Lys missense ABCA2 1 82612 1.21048E-5 41306 0 NA
9-139904094-G-A p.Asp2211Asp splice_region+synonymous ABCA2 2 82304 2.43002E-5 41152 0 1.91388E-4
9-139904214-G-A c.6630+7C>T splice_region ABCA2 17 82400 2.06311E-4 41200 0 1.3007E-4
9-139904227-G-A p.Ile2208Ile synonymous ABCA2 18 82496 2.18192E-4 41248 0 0.0020141
9-139904234-G-A p.Ala2206Val missense ABCA2 1 82496 1.21218E-5 41248 0 1.21645E-5
9-139904236-T-G p.Pro2205Pro synonymous ABCA2 1 82502 1.21209E-5 41251 0 0.00125
9-139904246-A-G p.Ile2202Thr missense ABCA2 4 82512 4.84778E-5 41256 0 NA
9-139904247-T-C p.Ile2202Val missense ABCA2 2 82494 2.42442E-5 41247 0 2.57648E-5
9-139904254-G-A p.Ile2199Ile synonymous ABCA2 1 82458 1.21274E-5 41229 0 3.18796E-5
9-139904257-G-A p.Ala2198Ala synonymous ABCA2 1 82462 1.21268E-5 41231 0 NA
9-139904260-C-T p.Thr2197Thr synonymous ABCA2 6 82404 7.2812E-5 41202 0 6.03854E-5
9-139904284-G-A p.Gly2189Gly synonymous ABCA2 2 82436 2.42612E-5 41218 0 NA
9-139904287-G-A p.Ser2188Ser synonymous ABCA2 1 82450 1.21286E-5 41225 0 2.61689E-5
9-139904298-C-T p.Gly2185Ser missense ABCA2 1 82494 1.21221E-5 41247 0 3.18918E-5
9-139904302-C-T p.Pro2183Pro synonymous ABCA2 3 82486 3.63698E-5 41243 0 3.51543E-5
9-139904310-C-T p.Asp2181Asn missense ABCA2 7 82432 8.49185E-5 41216 0 6.25E-4
9-139904313-C-T p.Ala2180Thr missense ABCA2 6 82382 7.28314E-5 41191 0 0.00100908
9-139904314-G-A p.Tyr2179Tyr synonymous ABCA2 3 82388 3.64131E-5 41194 0 1.06538E-4
9-139904326-C-T p.Glu2175Glu synonymous ABCA2 2 82300 2.43013E-5 41150 0 NA
9-139904335-C-T p.Glu2172Glu synonymous ABCA2 2 82220 2.4325E-5 41110 0 NA
9-139904343-C-T p.Ala2170Thr missense ABCA2 1 82128 1.21761E-5 41064 0 1.63689E-5
9-139904347-C-G p.Lys2168Asn missense ABCA2 1 82122 1.2177E-5 41061 0 4.09944E-6
9-139904352-CCACCTGGCCAGGGAACGCAGGTGTCAGTGGAGGCAGGGCCACCCAGCGTGCTGACTCCCTGCCCCGCCCCACAGATCCT-C p.Val2166_Val2167del splice_acceptor ABCA2 9 82068 1.09665E-4 41034 2 NA
9-139904355-C-T p.Val2166Met missense+splice_region ABCA2 1 82064 1.21856E-5 41032 0 7.0013E-5
9-139904429-C-T c.6495+6G>A splice_region ABCA2 3 80460 3.72856E-5 40230 0 4.4778E-6
9-139904430-C-T c.6495+5G>A splice_region ABCA2 2 80430 2.48663E-5 40215 0 NA
9-139904432-C-T c.6495+3G>A splice_region ABCA2 2 80374 2.48837E-5 40187 0 7.81087E-5
9-139904436-C-A p.Arg2165Leu missense+splice_region ABCA2 5 80278 6.22836E-5 40139 0 0.00253036
9-139904436-C-G p.Arg2165Pro missense+splice_region ABCA2 1 80278 1.24567E-5 40139 0 NA
9-139904444-G-A p.Asp2162Asp synonymous ABCA2 83 80028 0.00103714 40014 0 0.00151822
9-139904448-T-C p.Lys2161Arg missense ABCA2 3 80084 3.74607E-5 40042 0 6.3804E-5
9-139904459-C-G p.Gly2157Gly synonymous ABCA2 2 79820 2.50564E-5 39910 0 1.37099E-5
9-139904463-C-T p.Arg2156His missense ABCA2 6 79612 7.53655E-5 39806 0 1.37646E-4
9-139904464-G-A p.Arg2156Cys missense ABCA2 1 79544 1.25717E-5 39772 0 6.25E-4
9-139904469-C-T p.Arg2154Gln missense ABCA2 1 79550 1.25707E-5 39775 0 3.18796E-5
9-139904471-C-A p.Thr2153Thr synonymous ABCA2 1 79432 1.25894E-5 39716 0 1.37314E-5
9-139904483-C-T p.Leu2149Leu synonymous ABCA2 1 79302 1.261E-5 39651 0 NA
9-139904493-C-T p.Arg2146Gln missense ABCA2 1 79056 1.26493E-5 39528 0 3.18796E-5
9-139904494-G-A p.Arg2146Trp missense ABCA2 1 78978 1.26618E-5 39489 0 1.35117E-4
9-139904494-G-C p.Arg2146Gly missense ABCA2 2 78978 2.53235E-5 39489 0 2.70234E-5
9-139904498-C-T p.Thr2144Thr synonymous ABCA2 1 78886 1.26765E-5 39443 0 6.69667E-5
9-139904509-C-T p.Asp2141Asn missense ABCA2 1 78736 1.27007E-5 39368 0 3.9427E-5
9-139904509-C-G p.Asp2141His missense ABCA2 1 78736 1.27007E-5 39368 0 1.31423E-5
9-139904510-G-A p.Phe2140Phe synonymous ABCA2 1 78666 1.2712E-5 39333 0 1.31237E-5
9-139904518-C-T p.Ala2138Thr missense ABCA2 2 78466 2.54887E-5 39233 0 3.89924E-5
9-139904521-C-T p.Asp2137Asn missense ABCA2 3 78564 3.81854E-5 39282 0 1.59459E-4
9-139904528-C-T p.Pro2134Pro synonymous ABCA2 1 78340 1.27649E-5 39170 0 NA
9-139904529-G-A p.Pro2134Leu missense ABCA2 1 78412 1.27532E-5 39206 0 4.42776E-6
9-139904546-C-T p.Gln2128Gln synonymous ABCA2 1 78620 1.27194E-5 39310 0 NA
9-139904554-C-G p.Val2126Leu missense ABCA2 2 78570 2.5455E-5 39285 0 NA
9-139904558-G-C p.Leu2124Leu synonymous ABCA2 1 78576 1.27265E-5 39288 0 NA
9-139904561-CA-C p.Leu2123fs frameshift ABCA2 1 78552 1.27304E-5 39276 0 4.51284E-6
9-139904575-C-T p.Val2119Met missense+splice_region ABCA2 2 78486 2.54823E-5 39243 0 1.36798E-5
9-139904576-GCTGGGGACACGGCAGCTGTCAGCGCGTGAGGACGCGGCGGCCCCGCCCACCCAGGGCTCCCGCCCCAC-G c.6353+1_6354-1delGTGGGGCGGGAGCCCTGGGTGGGCGGGGCCGCCGCGTCCTCACGCGCTGACAGCTGCCGTGTCCCCAG splice_acceptor ABCA2 6 78382 7.65482E-5 39191 0 NA
9-139904576-G-A p.Ser2118Ser splice_region+synonymous ABCA2 1 78384 1.27577E-5 39192 0 1.36924E-5
9-139904580-G-A c.6354-4C>T splice_region ABCA2 3 78522 3.82059E-5 39261 0 6.29644E-5
9-139904637-C-T c.6353+8G>A splice_region ABCA2 4 78528 5.09372E-5 39264 0 1.59602E-4
9-139904638-G-A c.6353+7C>T splice_region ABCA2 2 78374 2.55187E-5 39187 0 6.00298E-5
9-139904658-C-T p.Val2114Ile missense ABCA2 62 79084 7.83977E-4 39542 0 0.00153169
9-139904659-G-A p.Phe2113Phe synonymous ABCA2 1 79122 1.26387E-5 39561 0 4.88043E-5
9-139904674-C-T p.Thr2108Thr synonymous ABCA2 1 79324 1.26065E-5 39662 0 0.001875
9-139904674-C-G p.Thr2108Thr synonymous ABCA2 1 79324 1.26065E-5 39662 0 NA
9-139904677-C-T p.Thr2107Thr synonymous ABCA2 9 79252 1.13562E-4 39626 0 2.23328E-4
9-139904681-C-T p.Ser2106Asn missense ABCA2 2 79376 2.51965E-5 39688 0 3.1904E-5
9-139904686-G-A p.Asp2104Asp synonymous ABCA2 22 79358 2.77225E-4 39679 0 2.10444E-4
9-139904689-G-A p.Gly2103Gly synonymous ABCA2 28 79310 3.53045E-4 39655 0 0.00406091
9-139904689-G-T p.Gly2103Gly synonymous ABCA2 1 79310 1.26088E-5 39655 0 NA
9-139904691-C-T p.Gly2103Ser missense ABCA2 2 79400 2.51889E-5 39700 0 1.45438E-5
9-139904695-C-G p.Leu2101Leu synonymous ABCA2 2 79490 2.51604E-5 39745 0 6.25E-4
9-139904716-C-G p.Lys2094Asn missense ABCA2 1 79530 1.25739E-5 39765 0 NA
9-139904722-C-T p.Ala2092Ala synonymous ABCA2 2184 79446 0.0274904 39723 45 0.061609
9-139904725-A-G p.Gly2091Gly synonymous ABCA2 1 79440 1.25881E-5 39720 0 NA
9-139904728-G-A p.Asn2090Asn synonymous ABCA2 5 79508 6.28868E-5 39754 0 1.31827E-4
9-139904734-G-A p.Gly2088Gly synonymous ABCA2 2 79408 2.51864E-5 39704 0 7.94155E-5
9-139904755-G-A p.Gly2081Gly synonymous ABCA2 1 79316 1.26078E-5 39658 0 1.44134E-5
9-139904755-G-T p.Gly2081Gly synonymous ABCA2 1 79316 1.26078E-5 39658 0 0.00101937
9-139904772-G-C p.Leu2076Val missense ABCA2 3 78962 3.7993E-5 39481 0 3.19244E-5
9-139904781-G-A p.Arg2073Cys missense ABCA2 2 78506 2.54758E-5 39253 0 0.00257202
9-139904788-G-A p.Ala2070Ala synonymous ABCA2 3 78042 3.84408E-5 39021 0 2.57897E-5
9-139904798-C-T p.Arg2067His missense ABCA2 2 77182 2.59128E-5 38591 0 0.0015448
9-139904803-A-C p.Ile2065Met missense ABCA2 1 76668 1.30433E-5 38334 0 NA
9-139904810-C-T p.Arg2063Gln missense ABCA2 2 75936 2.6338E-5 37968 0 7.373E-5
9-139904823-C-A p.Val2059Phe missense+splice_region ABCA2 1 74124 1.34909E-5 37062 0 NA
9-139904827-G-A c.6175-4C>T splice_region ABCA2 3 73352 4.08987E-5 36676 0 6.13806E-6
9-139904980-G-A p.Ala1438Val missense ABCA2 2 60556 3.30273E-5 30278 0 NA
9-139904990-G-A p.Pro1435Ser missense ABCA2 5 65612 7.62056E-5 32806 0 3.26733E-5
9-139904997-C-T p.Glu1432Glu synonymous ABCA2 3 69274 4.33063E-5 34637 0 1.51828E-4
9-139904999-C-T p.Glu1432Lys missense ABCA2 1 69906 1.43049E-5 34953 0 9.8095E-6
9-139905009-G-T p.Ala1428Ala synonymous ABCA2 2 72838 2.74582E-5 36419 0 9.66806E-5
9-139905015-AC-A p.Gly1426fs frameshift ABCA2 3 73770 4.06669E-5 36885 0 3.48821E-4
9-139905016-C-A p.Gly1426Val missense ABCA2 1 74308 1.34575E-5 37154 0 1.24818E-5
9-139905016-C-T p.Gly1426Asp missense ABCA2 1 74308 1.34575E-5 37154 0 9.03865E-6
9-139905021-CT-C p.Gln1424fs frameshift ABCA2 1 75660 1.3217E-5 37830 0 8.27061E-6
9-139905021-C-T p.Gln1424Gln synonymous ABCA2 1 75658 1.32174E-5 37829 0 8.87469E-6
9-139905027-C-G p.Gln1422His missense ABCA2 201 75920 0.00264752 37960 0 0.00372727
9-139905031-C-G p.Gly1421Ala missense ABCA2 2 75908 2.63477E-5 37954 0 NA
9-139905034-A-AC p.Val1420fs frameshift ABCA2 6 75706 7.9254E-5 37853 0 1.61467E-4
9-139905034-A-ACCCCACCCAGG p.Val1420fs frameshift ABCA2 1 75720 1.32066E-5 37860 0 8.69565E-6
9-139905034-A-AGCC p.Val1420delinsGlyLeu conservative_inframe_insertion ABCA2 1 75720 1.32066E-5 37860 0 NA
9-139905039-A-C p.Gly1418Gly synonymous ABCA2 12 73632 1.62973E-4 36816 0 0.00145436
9-139905040-C-A p.Gly1418Val missense ABCA2 1 75044 1.33255E-5 37522 0 NA
9-139905041-C-G p.Gly1418Arg missense ABCA2 1 75496 1.32457E-5 37748 0 NA
9-139905042-CAGG-C p.Leu1417del disruptive_inframe_deletion ABCA2 2 75806 2.63831E-5 37903 0 NA
9-139905043-A-C p.Leu1417Arg missense ABCA2 6 74672 8.03514E-5 37336 0 1.06833E-4
9-139905043-AG-CA p.Leu1417Trp missense ABCA2 1 74974 1.3338E-5 37487 0 NA
9-139905044-G-A p.Leu1417Leu synonymous ABCA2 2 75020 2.66596E-5 37510 0 4.24319E-6
9-139905048-C-T p.Trp1415* stop_gained ABCA2 38 76838 4.94547E-4 38419 0 9.61908E-4
9-139905050-A-C p.Trp1415Gly missense ABCA2 8 76170 1.05028E-4 38085 0 1.02148E-5
9-139905051-C-T p.Gly1414Gly synonymous ABCA2 1 76820 1.30174E-5 38410 0 NA
9-139905057-A-G p.His1412His synonymous ABCA2 44 77680 5.66426E-4 38840 0 5.07379E-4
9-139905060-C-A p.Gly1411Gly synonymous ABCA2 1 78072 1.28087E-5 39036 0 3.21709E-5
9-139905061-CCA-C p.Gly1411fs frameshift ABCA2 1 78312 1.27694E-5 39156 0 NA
9-139905067-C-A p.Gly1409Val missense ABCA2 2 78724 2.54052E-5 39362 0 4.0437E-6
9-139905078-C-T p.Leu2056Leu synonymous ABCA2 2 79334 2.52099E-5 39667 0 1.21056E-5
9-139905090-C-T p.Lys2052Lys synonymous ABCA2 2 79802 2.5062E-5 39901 0 NA
9-139905107-C-T p.Asp2047Asn missense ABCA2 11 80116 1.37301E-4 40058 0 6.44714E-5
9-139905108-G-A p.Ala2046Ala synonymous ABCA2 4 80120 4.99251E-5 40060 0 6.42839E-5
9-139905111-G-A p.Asp2045Asp synonymous ABCA2 3 80152 3.74289E-5 40076 0 5.03525E-4
9-139905112-T-C p.Asp2045Gly missense ABCA2 1 80150 1.24766E-5 40075 0 NA
9-139905117-C-T p.Arg2043Arg synonymous ABCA2 31 80248 3.86302E-4 40124 0 8.01179E-4
9-139905118-C-T p.Arg2043Gln missense ABCA2 5 80268 6.22913E-5 40134 0 9.61169E-5
9-139905127-C-T p.Arg2040Gln missense ABCA2 1 80238 1.24629E-5 40119 0 3.20184E-5
9-139905129-C-T p.Gln2039Gln synonymous ABCA2 1 80240 1.24626E-5 40120 0 3.19877E-5
9-139905130-T-C p.Gln2039Arg missense ABCA2 8 80280 9.96512E-5 40140 0 5.05553E-5
9-139905133-C-T p.Arg2038Gln missense ABCA2 3 80264 3.73767E-5 40132 0 8.42531E-6
9-139905141-G-A p.Ala2035Ala synonymous ABCA2 5288 80026 0.0660785 40013 209 0.14125
9-139905147-G-A p.Asp2033Asp synonymous ABCA2 20 80148 2.49538E-4 40074 0 2.87705E-4
9-139905170-T-G p.Lys2026Gln missense ABCA2 12 79890 1.50207E-4 39945 0 6.70841E-4
9-139905177-C-T p.Val2023Val synonymous ABCA2 11 79488 1.38386E-4 39744 0 3.1957E-5
9-139905185-T-C p.Met2021Val missense ABCA2 1 79288 1.26122E-5 39644 0 NA
9-139905186-G-T p.Arg2020Arg synonymous ABCA2 1 79230 1.26215E-5 39615 0 4.04223E-6
9-139905187-C-T p.Arg2020His missense+splice_region ABCA2 2 79154 2.52672E-5 39577 0 3.63883E-5
9-139905188-G-A p.Arg2020Cys missense+splice_region ABCA2 7 79036 8.85672E-5 39518 0 8.08826E-5
9-139905195-G-A c.6057-6C>T splice_region ABCA2 2 78960 2.53293E-5 39480 0 8.09271E-5
9-139905419-A-C c.6056+6T>G splice_region ABCA2 28 72378 3.86858E-4 36189 0 0.0219158
9-139905421-T-C c.6056+4A>G splice_region ABCA2 11 73224 1.50224E-4 36612 0 0.0138619
9-139905423-A-C c.6056+2T>G splice_donor ABCA2 1 74290 1.34608E-5 37145 0 0.00456235
9-139905427-T-C p.Pro2018Pro splice_region+synonymous ABCA2 2 75408 2.65224E-5 37704 0 5.20291E-4
9-139905431-C-T p.Arg2017Gln missense ABCA2 4 76434 5.23327E-5 38217 0 6.26566E-4
9-139905432-G-A p.Arg2017Trp missense ABCA2 1 76716 1.30351E-5 38358 0 5.95004E-6
9-139905435-G-A p.Arg2016Trp missense ABCA2 1 77630 1.28816E-5 38815 0 1.01522E-5
9-139905439-G-A p.Phe2014Phe synonymous ABCA2 14 78752 1.77773E-4 39376 0 1.09712E-4
9-139905448-C-T p.Gln2011Gln synonymous ABCA2 1 79664 1.25527E-5 39832 0 4.24131E-6
9-139905454-C-A p.Met2009Ile missense ABCA2 3 80130 3.74392E-5 40065 0 1.05039E-4
9-139905457-G-A p.Ile2008Ile synonymous ABCA2 4 80322 4.97996E-5 40161 0 9.73568E-5
9-139905466-G-A p.Leu2005Leu synonymous ABCA2 1 80792 1.23775E-5 40396 0 NA
9-139905468-G-A p.Leu2005Phe missense ABCA2 1 80860 1.23671E-5 40430 0 NA
9-139905472-G-A p.Gly2003Gly synonymous ABCA2 1 80968 1.23506E-5 40484 0 9.69243E-5
9-139905477-C-T p.Val2002Met missense ABCA2 3 81098 3.69923E-5 40549 0 3.91512E-5
9-139905478-G-A p.Val2001Val synonymous ABCA2 2 81112 2.46573E-5 40556 0 1.93768E-5
9-139905481-G-A p.Gly2000Gly synonymous ABCA2 4 81216 4.92514E-5 40608 0 1.14729E-4
9-139905490-C-A p.Ala1997Ala synonymous ABCA2 1 81544 1.22633E-5 40772 0 NA
9-139905490-C-T p.Ala1997Ala synonymous ABCA2 4 81544 4.90533E-5 40772 0 4.87325E-5
9-139905491-G-A p.Ala1997Val missense ABCA2 4 81508 4.90749E-5 40754 0 6.33026E-5
9-139905505-T-A p.Gly1992Gly synonymous ABCA2 1 81756 1.22315E-5 40878 0 8.78518E-6
9-139905510-G-A p.Arg1991Cys missense ABCA2 3 81798 3.66757E-5 40899 0 0.00151057
9-139905532-C-A p.Pro1983Pro synonymous ABCA2 25 82070 3.04618E-4 41035 0 0.004375
9-139905532-C-T p.Pro1983Pro synonymous ABCA2 3 82070 3.65542E-5 41035 0 6.38325E-5
9-139905541-C-T p.Met1980Ile missense ABCA2 1 82100 1.21803E-5 41050 0 3.18959E-5
9-139905552-A-G p.Phe1977Leu missense ABCA2 1 82152 1.21726E-5 41076 0 NA
9-139905556-GCCTGCGGGGAGACAGCTCAGGGCCTGTGCTCTGGGCCTTGCGGGGCCCCCACCGCCTTCCCCGCCCCACGGGCCCCCTCA-G p.Gly1975fs frameshift ABCA2 7 82116 8.52453E-5 41058 0 NA
9-139905556-G-A p.Gly1975Gly splice_region+synonymous ABCA2 2 82116 2.43558E-5 41058 0 NA
9-139905561-C-T c.5924-4G>A splice_region ABCA2 3 82142 3.65221E-5 41071 0 2.53902E-5
9-139905562-G-A c.5924-5C>T splice_region ABCA2 33 82178 4.01567E-4 41089 0 3.04517E-4
9-139905577-G-A p.Pro2024Leu missense ABCA2 1 82196 1.2166E-5 41098 0 NA
9-139905597-C-T p.Pro2017Pro synonymous ABCA2 3 82200 3.64963E-5 41100 0 4.03812E-5
9-139905598-G-A p.Pro2017Leu missense ABCA2 3 82214 3.64901E-5 41107 0 6.25782E-4
9-139905602-C-A p.Ala2016Ser missense ABCA2 2 82214 2.43268E-5 41107 0 8.43085E-6
9-139905610-G-A p.Ala2013Val missense ABCA2 27 82284 3.28132E-4 41142 0 0.00101331
9-139905618-C-T p.Ala2010Ala synonymous ABCA2 2 82338 2.42901E-5 41169 0 1.17887E-4
9-139905619-G-A p.Ala2010Val missense ABCA2 2 82294 2.43031E-5 41147 0 5.0528E-5
9-139905626-G-A p.Arg2008Cys missense ABCA2 3 82346 3.64316E-5 41173 0 4.20705E-5
9-139905629-C-T p.Ala2007Thr missense ABCA2 5 82412 6.06708E-5 41206 0 3.22776E-5
9-139905631-C-T p.Gly2006Glu missense ABCA2 1 82458 1.21274E-5 41229 0 NA
9-139905648-G-A p.Tyr1971Tyr synonymous ABCA2 4 82672 4.8384E-5 41336 0 5.88008E-5
9-139905657-G-A p.Asn1968Asn synonymous ABCA2 59 82746 7.13025E-4 41373 0 5.72599E-4
9-139905660-G-C p.Ile1967Met missense ABCA2 1 82776 1.20808E-5 41388 0 NA
9-139905669-G-A p.Asn1964Asn synonymous ABCA2 2 82794 2.41563E-5 41397 0 NA
9-139905675-G-A p.Ala1962Ala synonymous ABCA2 2 82820 2.41488E-5 41410 0 8.39602E-6
9-139905689-G-A p.Leu1958Phe missense ABCA2 1 82850 1.207E-5 41425 0 4.03265E-6
9-139905696-G-A p.Gly1955Gly synonymous ABCA2 25 82824 3.01845E-4 41412 0 1.69382E-4
9-139905701-G-A p.Leu1954Leu synonymous ABCA2 1 82850 1.207E-5 41425 0 1.6824E-5
9-139905703-T-C p.Asn1953Ser missense ABCA2 1 82830 1.20729E-5 41415 0 NA
9-139905705-G-A p.Tyr1952Tyr synonymous ABCA2 1 82802 1.2077E-5 41401 0 3.18817E-5
9-139905711-G-A p.Pro1950Pro synonymous ABCA2 3 82790 3.62363E-5 41395 0 1.2101E-5
9-139905723-G-A p.Phe1946Phe synonymous ABCA2 3 82806 3.62293E-5 41403 0 5.64853E-5
9-139905742-C-G p.Ser1940Thr missense ABCA2 1 82600 1.21065E-5 41300 0 NA
9-139905753-C-T p.Lys1936Lys synonymous ABCA2 5 82486 6.06163E-5 41243 0 3.18939E-4
9-139905759-G-C p.Asp1934Glu missense+splice_region ABCA2 2 82302 2.43007E-5 41151 0 4.06213E-6
9-139905760-TCCTGCGGGGTGGCCGGGGTCAGGGGCACAGGGGTGGCCGGGGTGAGGGGCACAGCCTCCGCAGGGTCCGCCACCCCCACCATGTCGTCACCGCCCCA-T p.Asp1934fs frameshift ABCA2 9 82288 1.09372E-4 41144 1 NA
9-139905765-CGGGGTGGCCGGGGTCAGGGGCACA-C c.5800-28_5800-5delTGTGCCCCTGACCCCGGCCACCCC splice_region ABCA2 28 82040 3.41297E-4 41020 0 3.89112E-4
9-139905765-C-G c.5800-4G>C splice_region ABCA2 2 82040 2.43784E-5 41020 0 4.11123E-6
9-139905766-G-A c.5800-5C>T splice_region ABCA2 4 82094 4.87246E-5 41047 0 6.37511E-5
9-139905851-C-T c.5799+8G>A splice_region ABCA2 88 81612 0.00107827 40806 0 0.00140181
9-139905852-G-A c.5799+7C>T splice_region ABCA2 15 81568 1.83896E-4 40784 0 2.9074E-4
9-139905856-C-T c.5799+3G>A splice_region ABCA2 1 81706 1.2239E-5 40853 0 NA
9-139905871-G-A p.Phe1929Phe synonymous ABCA2 9 81828 1.09987E-4 40914 0 5.05561E-4
9-139905895-C-A p.Val1921Val synonymous ABCA2 794 81898 0.00969499 40949 2 0.0109915
9-139905897-C-T p.Val1921Met missense ABCA2 1 81870 1.22145E-5 40935 0 8.21875E-6
9-139905898-G-A p.Thr1920Thr synonymous ABCA2 3 81892 3.66336E-5 40946 0 3.28539E-5
9-139905904-G-A p.Thr1918Thr synonymous ABCA2 28 81862 3.42039E-4 40931 0 7.96686E-4
9-139905912-C-T p.Gly1916Ser missense ABCA2 1 81716 1.22375E-5 40858 0 1.09054E-5
9-139905913-G-A p.Ile1915Ile synonymous ABCA2 1 81738 1.22342E-5 40869 0 4.40131E-5
9-139905919-G-A p.Leu1913Leu synonymous ABCA2 4 81722 4.89464E-5 40861 0 NA
9-139905928-G-A p.Val1910Val synonymous ABCA2 4 81698 4.89608E-5 40849 0 3.18674E-5
9-139905943-G-A p.Tyr1905Tyr synonymous ABCA2 2 81454 2.45537E-5 40727 0 0.00203252
9-139905949-G-A p.Ser1903Ser synonymous ABCA2 1 81286 1.23022E-5 40643 0 6.30915E-5
9-139905963-C-T p.Glu1899Lys missense ABCA2 1 81028 1.23414E-5 40514 0 0.001875
9-139905964-G-A p.Phe1898Phe synonymous ABCA2 6 80990 7.40832E-5 40495 0 1.85474E-5
9-139905973-G-A p.Ser1895Ser synonymous ABCA2 2 80838 2.47408E-5 40419 0 NA
9-139905979-C-T p.Pro1893Pro synonymous ABCA2 3 80648 3.71987E-5 40324 0 2.29712E-4
9-139905994-C-T p.Thr1888Thr synonymous ABCA2 2 80336 2.48954E-5 40168 0 2.4487E-5
9-139906004-CACCTGCGGGCAGGTGGCGGGCAGTGGTCACCAGGCAGCCCCGGTCCCACCTGAGGCCGCTCCCCCCTCCGCTTCCGCTT-C p.Trp1885fs frameshift ABCA2 8 80202 9.97481E-5 40101 0 NA
9-139906006-C-T p.Gly1884Gly splice_region+synonymous ABCA2 1 80182 1.24716E-5 40091 0 9.56999E-5
9-139906010-C-T c.5652-4G>A splice_region ABCA2 4 80082 4.99488E-5 40041 0 1.78593E-4
9-139906011-G-A c.5652-5C>T splice_region ABCA2 2 80164 2.49489E-5 40082 0 6.02192E-5
9-139906014-C-A c.5652-8G>T splice_region ABCA2 6 80112 7.48951E-5 40056 0 5.57501E-6
9-139906079-C-G c.5651+7G>C splice_region ABCA2 1 80872 1.23652E-5 40436 0 NA
9-139906079-C-T c.5651+7G>A splice_region ABCA2 3 80872 3.70957E-5 40436 0 7.34214E-4
9-139906080-G-A c.5651+6C>T splice_region ABCA2 3 80872 3.70957E-5 40436 0 4.44976E-5
9-139906093-G-C p.Leu1882Val missense ABCA2 1 81052 1.23378E-5 40526 0 NA
9-139906094-C-T p.Leu1881Leu synonymous ABCA2 3 81086 3.69978E-5 40543 0 6.32175E-6
9-139906096-G-A p.Leu1881Leu synonymous ABCA2 1 81116 1.2328E-5 40558 0 NA
9-139906111-C-T p.Val1876Ile missense ABCA2 3 81144 3.69713E-5 40572 0 9.72006E-5
9-139906127-G-A p.Pro1870Pro synonymous ABCA2 2 81178 2.46372E-5 40589 0 1.23643E-5
9-139906130-C-T p.Ser1869Ser synonymous ABCA2 3 81144 3.69713E-5 40572 0 1.85563E-5
9-139906133-C-T p.Thr1868Thr synonymous ABCA2 4 81158 4.92866E-5 40579 0 6.38244E-5
9-139906133-C-G p.Thr1868Thr synonymous ABCA2 2 81158 2.46433E-5 40579 0 0.00155119
9-139906141-C-A p.Ala1866Ser missense ABCA2 1 81144 1.23238E-5 40572 0 NA
9-139906142-C-T p.Pro1865Pro synonymous ABCA2 1 81146 1.23235E-5 40573 0 6.38692E-5
9-139906143-G-A p.Pro1865Leu missense ABCA2 3 81144 3.69713E-5 40572 0 4.81371E-5
9-139906151-G-A p.Phe1862Phe synonymous ABCA2 4 81092 4.93267E-5 40546 0 2.49482E-5
9-139906162-G-A p.Leu1859Leu synonymous ABCA2 1 81140 1.23244E-5 40570 0 NA
9-139906175-G-A p.Cys1854Cys synonymous ABCA2 1 81064 1.23359E-5 40532 0 4.91884E-5
9-139906184-G-A p.Pro1851Pro synonymous ABCA2 6 80948 7.41217E-5 40474 0 1.27722E-4
9-139906199-G-A p.Leu1846Leu splice_region+synonymous ABCA2 1 80804 1.23756E-5 40402 0 NA
9-139906201-GCTGCAGGGGTGGGGGCGGCTGGTGAGAGACCCGGGGCAGGGCGGGGATGGGGGATGAGAAGGGCCGGGGCACCCCATGGCCACGCCGGGCGCAC-G c.5535+1_5536-1delGTGCGCCCGGCGTGGCCATGGGGTGCCCCGGCCCTTCTCATCCCCCATCCCCGCCCTGCCCCGGGTCTCTCACCAGCCGCCCCCACCCCTGCAG splice_acceptor ABCA2 9 80774 1.11422E-4 40387 2 NA
9-139906206-AG-GT c.5536-6_5536-5delCTinsAC splice_region ABCA2 1 80654 1.23986E-5 40327 0 NA
9-139906207-G-T c.5536-6C>A splice_region ABCA2 10 80708 1.23903E-4 40354 0 2.552E-4
9-139906288-G-A c.5535+8C>T splice_region ABCA2 1 80056 1.24913E-5 40028 0 1.87928E-4
9-139906290-G-T c.5535+6C>A splice_region ABCA2 1 80074 1.24884E-5 40037 0 NA
9-139906292-G-A c.5535+4C>T splice_region ABCA2 1 80100 1.24844E-5 40050 0 1.75352E-4
9-139906293-C-T c.5535+3G>A splice_region ABCA2 18 80166 2.24534E-4 40083 0 5.74676E-4
9-139906307-C-T p.Val1842Met missense ABCA2 3 80436 3.72967E-5 40218 0 9.33045E-6
9-139906314-C-T p.Ala1839Ala synonymous ABCA2 40 80544 4.96623E-4 40272 0 7.13235E-4
9-139906317-C-T p.Leu1838Leu synonymous ABCA2 1 81264 1.23056E-5 40632 0 NA
9-139906326-G-A p.Ile1835Ile synonymous ABCA2 1 81536 1.22645E-5 40768 0 2.38663E-4
9-139906344-G-A p.Ser1829Ser synonymous ABCA2 3 81838 3.66578E-5 40919 0 3.18878E-5
9-139906359-G-A p.His1824His synonymous ABCA2 55498 81502 0.68094 40751 18982 0.684953
9-139906383-G-A p.Ala1816Ala synonymous ABCA2 3 82224 3.64857E-5 41112 0 3.18756E-5
9-139906388-C-T p.Val1815Met missense ABCA2 1 82222 1.21622E-5 41111 0 8.46038E-6
9-139906395-G-A p.Val1812Val synonymous ABCA2 10 82272 1.21548E-4 41136 0 1.01343E-4
9-139906400-C-G p.Val1811Leu missense ABCA2 1 82226 1.21616E-5 41113 0 NA
9-139906401-G-A p.Phe1810Phe synonymous ABCA2 332 82248 0.00403657 41124 6 0.00835033
9-139906407-G-A p.Ala1808Ala synonymous ABCA2 1 82236 1.21601E-5 41118 0 1.68651E-5
9-139906410-C-T p.Pro1807Pro synonymous ABCA2 3 82202 3.64955E-5 41101 0 4.21528E-5
9-139906416-G-A p.Phe1805Phe synonymous ABCA2 141 82220 0.00171491 41110 0 0.00248614
9-139906423-A-G p.Met1803Thr missense ABCA2 12 82196 1.45993E-4 41098 0 5.64963E-5
9-139906431-G-A p.Ile1800Ile synonymous ABCA2 1 82082 1.21829E-5 41041 0 0.00100908
9-139906442-T-C p.Ile1797Val missense ABCA2 2 82014 2.43861E-5 41007 0 8.41411E-6
9-139906446-G-A p.Ile1795Ile synonymous ABCA2 20 81904 2.44188E-4 40952 0 6.25E-4
9-139906452-G-A p.Val1793Val synonymous ABCA2 1 81744 1.22333E-5 40872 0 4.84829E-5
9-139906458-C-A p.Thr1791Thr synonymous ABCA2 1 81628 1.22507E-5 40814 0 NA
9-139906469-GCCTGGGGCAAGGAAGCCCTCAGTCCTCACGGCCGGGGCTGCAGTGCCCACCTGCCCCACCTCATCCCCCACTGGCCACACTTA-G p.Leu1788fs frameshift ABCA2 12 81480 1.47275E-4 40740 6 NA
9-139906474-G-A c.5361-4C>T splice_region ABCA2 1 81494 1.22708E-5 40747 0 8.41298E-6
9-139906566-G-C p.Ser1783Cys missense ABCA2 1 82164 1.21708E-5 41082 0 NA
9-139906577-G-A p.Ser1779Ser synonymous ABCA2 4 82008 4.87757E-5 41004 0 0.00151057
9-139906598-G-A p.Asn1772Asn synonymous ABCA2 1 81820 1.2222E-5 40910 0 NA
9-139906602-G-A p.Thr1771Ile missense ABCA2 1 81754 1.22318E-5 40877 0 6.47391E-5
9-139906606-C-T p.Val1770Ile missense ABCA2 1 81594 1.22558E-5 40797 0 1.21494E-5
9-139906607-G-A p.Thr1769Thr synonymous ABCA2 2 81574 2.45176E-5 40787 0 2.02577E-5
9-139906613-GCCTGCACACGGCGGGGCGGGGGCGGCAGCTTCAGGCCCCAGCTCCTCCCCGCCCCGGCCCCAGCTCCTCCCCGCCCCGCCCCGCCCTGCCTATGTCAGCTCA-G p.Gly1767fs frameshift ABCA2 9 81350 1.10633E-4 40675 4 NA
9-139906620-C-T c.5300-6G>A splice_region ABCA2 1 81078 1.23338E-5 40539 0 NA
9-139906622-C-T c.5300-8G>A splice_region ABCA2 5 80880 6.182E-5 40440 0 8.53854E-6
9-139906710-A-C c.5299+7T>G splice_region ABCA2 2 80580 2.48201E-5 40290 0 4.21411E-6
9-139906717-C-T p.Gly1767Ser missense+splice_region ABCA2 1 80850 1.23686E-5 40425 0 1.06297E-5
9-139906718-G-A p.Tyr1766Tyr splice_region+synonymous ABCA2 21 80880 2.59644E-4 40440 0 2.2984E-4
9-139906724-C-T p.Ala1764Ala synonymous ABCA2 2 81088 2.46646E-5 40544 0 1.55799E-4
9-139906727-C-G p.Pro1763Pro synonymous ABCA2 1 81258 1.23065E-5 40629 0 6.41725E-5
9-139906734-C-T p.Gly1761Asp missense ABCA2 1 81502 1.22696E-5 40751 0 9.28919E-6
9-139906739-G-A p.Ser1759Ser synonymous ABCA2 12 81658 1.46954E-4 40829 0 6.25E-4
9-139906751-G-A p.Asn1755Asn synonymous ABCA2 1 81862 1.22157E-5 40931 0 NA
9-139906753-T-G p.Asn1755His missense ABCA2 1 81902 1.22097E-5 40951 0 NA
9-139906759-G-A p.Arg1753Cys missense ABCA2 1 81988 1.21969E-5 40994 0 NA
9-139906762-G-A p.Leu1752Leu synonymous ABCA2 2 82072 2.43688E-5 41036 0 NA
9-139906763-G-A p.Ile1751Ile synonymous ABCA2 1 82080 1.21832E-5 41040 0 3.19898E-5
9-139906769-G-A p.Asn1749Asn synonymous ABCA2 23 82114 2.80098E-4 41057 0 1.77953E-4
9-139906777-G-C p.Leu1747Val missense ABCA2 1 82194 1.21663E-5 41097 0 NA
9-139906798-T-G p.Met1740Leu missense ABCA2 1 82102 1.218E-5 41051 0 NA
9-139906826-AACCTGCAGAAGGAAGAGGACACAGAAAGGCCCCAGGACCTCAGACCTGGGTCCCTGCAGACCTCGGGCGGCGCTACACACAGCGGGGCCCAGGCCCGCAGCCTCGCTC-A p.Val1730fs frameshift ABCA2 5 82196 6.08302E-5 41098 1 NA
9-139906828-C-T p.Val1730Ile missense+splice_region ABCA2 19 82134 2.31329E-4 41067 0 0.00201816
9-139906829-C-CACGCCGGGCGCACCATGTCCCACACGTAG c.5188-2_5188-1insCTACGTGTGGGACATGGTGCGCCCGGCGT splice_acceptor ABCA2 1 82162 1.21711E-5 41081 0 NA
9-139906834-G-A c.5188-6C>T splice_region ABCA2 4 82182 4.86725E-5 41091 0 2.6039E-4
9-139906930-C-T c.5187+7G>A splice_region ABCA2 1 82370 1.21403E-5 41185 0 3.19101E-5
9-139906930-C-G c.5187+7G>C splice_region ABCA2 1 82370 1.21403E-5 41185 0 4.47996E-5
9-139906931-G-A c.5187+6C>T splice_region ABCA2 2 82344 2.42884E-5 41172 0 4.24347E-5
9-139906941-G-A p.Ala1728Val missense ABCA2 4 82486 4.84931E-5 41243 0 6.38529E-5
9-139906955-C-T p.Ala1723Ala synonymous ABCA2 1 82596 1.21071E-5 41298 0 2.02703E-5
9-139906956-G-A p.Ala1723Val missense ABCA2 2 82604 2.42119E-5 41302 0 NA
9-139906958-G-C p.Ile1722Met missense ABCA2 1 82638 1.2101E-5 41319 0 3.37536E-5
9-139906973-G-T p.Pro1717Pro synonymous ABCA2 1 82756 1.20837E-5 41378 0 NA
9-139906979-G-C p.Ala1715Ala synonymous ABCA2 1 82768 1.2082E-5 41384 0 6.38284E-5
9-139906981-C-A p.Ala1715Ser missense ABCA2 2 82778 2.4161E-5 41389 0 5.03525E-4
9-139906990-C-T p.Gly1712Ser missense ABCA2 287 82804 0.00346602 41402 0 0.00379731
9-139906998-G-A p.Ala1709Val missense ABCA2 1 82858 1.20688E-5 41429 0 2.82867E-5
9-139906999-C-A p.Ala1709Ser missense ABCA2 1 82884 1.20651E-5 41442 0 1.68177E-5
9-139907000-T-G p.Pro1708Pro synonymous ABCA2 1 82880 1.20656E-5 41440 0 NA
9-139907008-A-C p.Ser1706Ala missense ABCA2 1 82846 1.20706E-5 41423 0 NA
9-139907015-G-A p.Ser1066Phe missense ABCA2 2 82888 2.41289E-5 41444 0 6.3804E-5
9-139907018-G-A p.Thr1065Met missense ABCA2 4 82874 4.8266E-5 41437 0 4.20274E-5
9-139907028-G-C p.Thr1699Ser missense ABCA2 2 82888 2.41289E-5 41444 0 NA
9-139907040-TACCTGGGCAGGCAGGTGGGAGGGGCGGTGAGGCTAGGCAGGCAGTGAGGCTAGAGGGGCAGGAGTTGAGACTAGGTGGCTGGTGGCCGGCCACCCTCACCCACAGCCTCCCCACCCAGCTC-T p.Tyr1695fs frameshift ABCA2 2 82838 2.41435E-5 41419 0 NA
9-139907042-C-T p.Gly1057Asp missense ABCA2 2 82848 2.41406E-5 41424 0 NA
9-139907055-G-T p.Pro1053Thr missense ABCA2 2 82766 2.41645E-5 41383 0 NA
9-139907056-T-A p.Pro1052Pro synonymous ABCA2 1 82696 1.20925E-5 41348 0 3.20102E-5
9-139907056-T-G p.Pro1052Pro synonymous ABCA2 2 82696 2.4185E-5 41348 0 4.05838E-6
9-139907061-G-A p.Leu1051Phe missense ABCA2 1 82672 1.2096E-5 41336 0 4.06233E-6
9-139907065-C-A p.Pro1049Pro synonymous ABCA2 1 82600 1.21065E-5 41300 0 4.06461E-6
9-139907066-G-A p.Pro1049Leu missense ABCA2 1 82630 1.21021E-5 41315 0 9.56389E-5
9-139907072-G-A p.Ala1047Val missense ABCA2 2 82560 2.42248E-5 41280 0 8.13365E-6
9-139907073-CTAGG-C p.Cys1045fs frameshift ABCA2 1 82506 1.21203E-5 41253 0 3.19E-5
9-139907078-CA-C p.Cys1045fs frameshift ABCA2 1 82312 1.21489E-5 41156 0 3.18898E-5
9-139907080-G-A p.Ala1044Ala synonymous ABCA2 1 82348 1.21436E-5 41174 0 NA
9-139907082-CAGTGAGGCTAGAGGGG-C p.Leu1042fs frameshift ABCA2 1 82260 1.21566E-5 41130 0 3.19203E-5
9-139907093-G-A c.3123-4C>T splice_region ABCA2 1 82316 1.21483E-5 41158 0 NA
9-139907096-G-A c.3123-7C>T splice_region ABCA2 1 82316 1.21483E-5 41158 0 NA
9-139907164-C-T p.Arg1694Gln missense+splice_region ABCA2 1 82472 1.21253E-5 41236 0 NA
9-139907165-G-C p.Arg1694Gly missense+splice_region ABCA2 1 82502 1.21209E-5 41251 0 NA
9-139907167-T-A p.His1693Leu missense ABCA2 1 82500 1.21212E-5 41250 0 NA
9-139907179-C-T p.Arg1689His missense ABCA2 14 82442 1.69816E-4 41221 0 6.25E-4
9-139907180-G-T p.Arg1689Ser missense ABCA2 2 82454 2.42559E-5 41227 0 8.08499E-6
9-139907180-G-A p.Arg1689Cys missense ABCA2 2 82454 2.42559E-5 41227 0 1.6919E-5
9-139907184-G-A p.Ser1687Ser synonymous ABCA2 3 82390 3.64122E-5 41195 0 2.5382E-5
9-139907190-G-A p.Phe1685Phe synonymous ABCA2 1 82356 1.21424E-5 41178 0 NA
9-139907199-G-A p.Tyr1682Tyr synonymous ABCA2 2 82264 2.4312E-5 41132 0 3.18857E-5
9-139907219-C-T p.Gly1676Ser missense ABCA2 35 81626 4.28785E-4 40813 0 9.39143E-4
9-139907220-G-A p.Thr1675Thr synonymous ABCA2 3 81598 3.67656E-5 40799 0 6.37796E-5
9-139907228-C-T p.Asp1673Asn missense ABCA2 13 81006 1.60482E-4 40503 0 2.56858E-5
9-139907229-G-A p.Thr1672Thr synonymous ABCA2 7 80940 8.64838E-5 40470 0 6.37592E-5
9-139907229-G-C p.Thr1672Thr synonymous ABCA2 3 80942 3.70636E-5 40471 0 3.18796E-5
9-139907235-G-T p.Ile1670Ile synonymous ABCA2 1 80544 1.24156E-5 40272 0 4.07024E-6
9-139907237-T-C p.Ile1670Val missense ABCA2 21 80354 2.61344E-4 40177 0 5.78674E-4
9-139907254-C-T p.Arg1664Gln missense ABCA2 1 78286 1.27737E-5 39143 0 3.66079E-5
9-139907255-G-A p.Arg1664Trp missense ABCA2 17 78062 2.17776E-4 39031 0 1.11711E-4
9-139907265-C-A p.Pro1660Pro synonymous ABCA2 8 76414 1.04693E-4 38207 0 3.19061E-5
9-139907265-C-T p.Pro1660Pro synonymous ABCA2 2 76414 2.61732E-5 38207 0 6.38121E-5
9-139907272-C-T p.Gly1658Glu missense ABCA2 6 76932 7.7991E-5 38466 0 7.92605E-5
9-139907295-G-A p.Phe1650Phe synonymous ABCA2 4 76084 5.25735E-5 38042 0 1.04396E-4
9-139907300-C-T p.Gly1649Ser missense ABCA2 3 75638 3.96626E-5 37819 0 6.09162E-5
9-139907301-G-A p.Thr1648Thr synonymous ABCA2 6 75588 7.93777E-5 37794 0 9.56938E-5
9-139907310-C-T p.Ala1645Ala synonymous ABCA2 4 74854 5.34374E-5 37427 0 1.276E-4
9-139907311-G-A p.Ala1645Val missense ABCA2 4 75024 5.33163E-5 37512 0 5.09165E-4
9-139907315-A-G p.Ser1644Pro missense ABCA2 1 75152 1.33064E-5 37576 0 NA
9-139907326-C-T p.Arg1640His missense ABCA2 1 73738 1.35615E-5 36869 0 9.57121E-5
9-139907331-G-A p.Pro1638Pro synonymous ABCA2 2 73592 2.71769E-5 36796 0 1.87484E-5
9-139907333-G-C p.Pro1638Ala missense ABCA2 1 73456 1.36136E-5 36728 0 3.1902E-5
9-139907334-C-T p.Glu1637Glu synonymous ABCA2 2 73430 2.72368E-5 36715 0 NA
9-139907338-C-A p.Arg1636Leu missense ABCA2 1 73354 1.36325E-5 36677 0 NA
9-139907339-G-A p.Arg1636Trp missense ABCA2 1 73504 1.36047E-5 36752 0 6.67289E-5
9-139907347-C-T p.Arg1633His missense ABCA2 2 72958 2.7413E-5 36479 0 1.12556E-4
9-139907348-G-A p.Arg1633Cys missense ABCA2 3 72928 4.11365E-5 36464 0 3.19142E-5
9-139907349-C-T p.Pro1632Pro synonymous ABCA2 1 72822 1.37321E-5 36411 0 6.25E-4
9-139907350-G-A p.Pro1632Leu missense ABCA2 1 73012 1.36964E-5 36506 0 3.17723E-5
9-139907354-G-T p.Leu1631Met missense ABCA2 1 73268 1.36485E-5 36634 0 NA
9-139907361-T-C p.Ala1628Ala synonymous ABCA2 1 72450 1.38026E-5 36225 0 NA
9-139907364-C-T p.Ser1627Ser synonymous ABCA2 4 72616 5.50843E-5 36308 0 NA
9-139907365-G-A p.Ser1627Leu missense ABCA2 2 72778 2.74808E-5 36389 0 7.43505E-5
9-139907368-G-A p.Thr1626Met missense ABCA2 1 72632 1.3768E-5 36316 0 1.53808E-5
9-139907377-TCTGTGGGCACAGCATGGTGCGGTGAGAAGGACCCCTCACTGCCCCTGCCCCCCCAGCAGGCCCCCTGAACCACTAC-T c.4867+1_4868-1delGTAGTGGTTCAGGGGGCCTGCTGGGGGGGCAGGGGCAGTGAGGGGTCCTTCTCACCGCACCATGCTGTGCCCACAG splice_acceptor ABCA2 12 73046 1.6428E-4 36523 4 NA
9-139907459-C-T p.Gly1621Glu missense ABCA2 1 64578 1.54851E-5 32289 0 NA
9-139907463-C-T p.Ala1620Thr missense ABCA2 1 63292 1.57998E-5 31646 0 8.64289E-6
9-139907464-G-A p.Thr1619Thr synonymous ABCA2 1 63240 1.58128E-5 31620 0 1.6854E-5
9-139907469-G-C p.Pro1618Ala missense ABCA2 1 61906 1.61535E-5 30953 0 3.19224E-5
9-139907470-C-T p.Pro1617Pro synonymous ABCA2 6 61350 9.77995E-5 30675 0 1.77999E-4
9-139907471-G-A p.Pro1617Leu missense ABCA2 3 61548 4.87424E-5 30774 0 0.00104603
9-139907472-G-A p.Pro1617Ser missense ABCA2 6 61234 9.79848E-5 30617 0 8.04156E-6
9-139907481-C-T p.Val1614Ile missense ABCA2 250 59640 0.00419182 29820 2 0.0115232
9-139907482-G-A p.Asn1613Asn synonymous ABCA2 8 59776 1.33833E-4 29888 0 6.25E-4
9-139907491-C-T p.Gln1610Gln synonymous ABCA2 1 59070 1.69291E-5 29535 0 1.35283E-5
9-139907492-T-C p.Gln1610Arg missense ABCA2 1 58906 1.69762E-5 29453 0 1.34091E-5
9-139907494-C-T p.Leu1609Leu synonymous ABCA2 2 58526 3.41728E-5 29263 0 NA
9-139907507-G-A p.Pro1605Leu missense ABCA2 6 58256 1.02994E-4 29128 0 2.74499E-4
9-139907512-C-T p.Ala1603Ala synonymous ABCA2 2 57702 3.46608E-5 28851 0 0.00154959
9-139907513-G-A p.Ala1603Val missense ABCA2 1 57892 1.72735E-5 28946 0 5.93627E-6
9-139907517-G-A p.Pro1602Ser missense ABCA2 2 58076 3.44376E-5 29038 0 5.78831E-6
9-139907518-C-T p.Ser1601Ser synonymous ABCA2 2 57500 3.47826E-5 28750 0 1.15747E-5
9-139907533-G-A p.Pro1596Pro synonymous ABCA2 1 58598 1.70654E-5 29299 0 0.00154321
9-139907537-G-A p.Ser1595Leu missense ABCA2 1 58422 1.71168E-5 29211 0 3.19244E-5
9-139907554-G-A p.Phe1589Phe synonymous ABCA2 5 60186 8.30758E-5 30093 0 0.00153846
9-139907561-G-A p.Ser1587Phe missense ABCA2 2 61274 3.26403E-5 30637 0 NA
9-139907572-C-T p.Gly1583Gly synonymous ABCA2 1 61422 1.62808E-5 30711 0 NA
9-139907574-CCT-C p.Gln1582fs frameshift ABCA2 1 61740 1.6197E-5 30870 0 NA
9-139907578-T-C p.Thr1581Thr synonymous ABCA2 2 62200 3.21543E-5 31100 0 3.1953E-5
9-139907596-C-A p.Met1575Ile missense ABCA2 1 63014 1.58695E-5 31507 0 0.00101833
9-139907604-C-T p.Asp1573Asn missense ABCA2 2 62238 3.21347E-5 31119 0 5.68634E-5
9-139907605-G-A p.Phe1572Phe synonymous ABCA2 3 62304 4.8151E-5 31152 0 5.0813E-4
9-139907612-C-T p.Arg1570Gln missense ABCA2 1 61962 1.61389E-5 30981 0 5.0813E-4
9-139907613-G-A p.Arg1570Trp missense ABCA2 1 61980 1.61342E-5 30990 0 NA
9-139907618-G-T p.Ala1568Glu missense ABCA2 1 62268 1.60596E-5 31134 0 NA
9-139907618-G-A p.Ala1568Val missense ABCA2 2 62268 3.21192E-5 31134 0 1.80545E-5
9-139907629-C-T p.Ser1564Ser synonymous ABCA2 26 62094 4.1872E-4 31047 1 0.00437938
9-139907630-G-A p.Ser1564Leu missense ABCA2 1 62306 1.60498E-5 31153 0 5.20111E-5
9-139907638-G-A p.Ser1561Ser synonymous ABCA2 2 62834 3.18299E-5 31417 0 0.00202634
9-139907644-C-G p.Leu1559Leu synonymous ABCA2 1 63186 1.58263E-5 31593 0 NA
9-139907653-C-A p.Thr1556Thr synonymous ABCA2 2 62490 3.20051E-5 31245 0 6.37511E-5
9-139907670-C-T p.Gly1551Ser missense ABCA2 1 63392 1.57749E-5 31696 0 6.25E-4
9-139907671-G-C p.Asn1550Lys missense ABCA2 1 63536 1.57391E-5 31768 0 NA
9-139907671-G-A p.Asn1550Asn synonymous ABCA2 1 63536 1.57391E-5 31768 0 3.18817E-5
9-139907676-C-T p.Ala1549Thr missense ABCA2 12 63496 1.88988E-4 31748 0 3.82653E-4
9-139907677-G-A p.Pro1548Pro synonymous ABCA2 7 63502 1.10233E-4 31751 0 0.0010142
9-139907692-G-A p.Cys1543Cys synonymous ABCA2 1 62354 1.60375E-5 31177 0 4.42022E-5
9-139907710-C-T p.Ser1537Ser synonymous ABCA2 1 61304 1.63121E-5 30652 0 3.18939E-5
9-139907713-C-T p.Pro1536Pro synonymous ABCA2 2 60864 3.28601E-5 30432 0 9.56755E-5
9-139907720-C-T p.Arg1534Gln missense ABCA2 2 60648 3.29772E-5 30324 0 3.58577E-5
9-139907721-G-A p.Arg1534Trp missense ABCA2 1 60456 1.6541E-5 30228 0 3.63029E-5
9-139907725-C-T p.Thr1532Thr synonymous ABCA2 1 60578 1.65076E-5 30289 0 1.89487E-5
9-139907726-G-A p.Thr1532Met missense ABCA2 1 60208 1.66091E-5 30104 0 9.97596E-6
9-139907739-G-T p.Gln1528Lys missense ABCA2 1 59676 1.67572E-5 29838 0 NA
9-139907747-C-T p.Ser1525Asn missense ABCA2 2 58298 3.43065E-5 29149 0 3.19326E-5
9-139907752-G-A p.Asp1523Asp synonymous ABCA2 1 57764 1.73118E-5 28882 0 1.16286E-4
9-139907754-C-T p.Asp1523Asn missense ABCA2 2 57866 3.45626E-5 28933 0 3.19591E-5
9-139907759-G-A p.Ser1521Leu missense ABCA2 1 57594 1.73629E-5 28797 0 6.1177E-6
9-139907765-C-T p.Arg1519Gln missense ABCA2 8 57702 1.38643E-4 28851 0 6.33714E-4
9-139907766-G-A p.Arg1519Trp missense ABCA2 2 57130 3.50079E-5 28565 0 3.88672E-5
9-139907766-G-T p.Arg1519Arg synonymous ABCA2 1 57130 1.75039E-5 28565 0 3.19795E-5
9-139907769-GCCTGCGGGCACCGACAGTGTGAGGTGGGGCTGCCAGTCTCCGCCCCTCGCCAGCCCCGCCCCCTCGCCCGCCTGGCCCACCAAGGCTGTCCCCGCCCCTTCACTCGCCCCACCCACCAAGGCTGCCCCCGCTGGAGGCCTCA-G p.Leu1518fs frameshift ABCA2 2 57518 3.47717E-5 28759 1 NA
9-139907770-C-T p.Arg1517Arg splice_region+synonymous ABCA2 1 57428 1.74131E-5 28714 0 NA
9-139907774-C-T c.4551-4G>A splice_region ABCA2 5 57396 8.71141E-5 28698 0 5.46349E-4
9-139907775-G-A c.4551-5C>T splice_region ABCA2 3 57406 5.22593E-5 28703 0 1.91926E-4
9-139907914-G-A p.Arg1517Trp missense+splice_region ABCA2 1 77692 1.28713E-5 38846 0 4.36788E-6
9-139907921-G-A p.Arg1514Arg synonymous ABCA2 32 77964 4.10446E-4 38982 0 0.00158713
9-139907921-G-C p.Arg1514Arg synonymous ABCA2 20 77964 2.56529E-4 38982 0 2.3807E-4
9-139907921-G-T p.Arg1514Arg synonymous ABCA2 1 77964 1.28264E-5 38982 0 NA
9-139907922-C-T p.Arg1514His missense ABCA2 8 78022 1.02535E-4 39011 0 9.18997E-5
9-139907924-G-GCGCTC p.Arg1514fs frameshift ABCA2 1 78152 1.27956E-5 39076 0 NA
9-139907927-C-T p.Glu1512Glu synonymous ABCA2 1 78454 1.27463E-5 39227 0 NA
9-139907933-G-A p.Asn1510Asn synonymous ABCA2 3 78710 3.81146E-5 39355 0 4.61148E-5
9-139907939-G-A p.Tyr1508Tyr synonymous ABCA2 1 79030 1.26534E-5 39515 0 0.00125
9-139907942-G-A p.Pro1507Pro synonymous ABCA2 15 79240 1.89298E-4 39620 1 0.0020202
9-139907948-G-A p.Phe1505Phe synonymous ABCA2 1 79388 1.25964E-5 39694 0 6.37714E-5
9-139907957-A-T p.Arg1502Arg synonymous ABCA2 1 79554 1.25701E-5 39777 0 4.14779E-6
9-139907958-C-T p.Arg1502His missense ABCA2 4 79574 5.02677E-5 39787 0 1.13914E-4
9-139907959-G-A p.Arg1502Cys missense ABCA2 2 79574 2.51338E-5 39787 0 1.2449E-5
9-139907960-G-T p.Pro1501Pro synonymous ABCA2 1 79596 1.25634E-5 39798 0 3.09253E-5
9-139907962-G-T p.Pro1501Thr missense ABCA2 1 79628 1.25584E-5 39814 0 NA
9-139907969-G-T p.Tyr1498* stop_gained ABCA2 2 79622 2.51187E-5 39811 0 NA
9-139907969-G-A p.Tyr1498Tyr synonymous ABCA2 5 79622 6.27967E-5 39811 0 3.18796E-5
9-139907976-T-C p.His1496Arg missense ABCA2 1 79724 1.25433E-5 39862 0 NA
9-139907993-C-T p.Leu1490Leu synonymous ABCA2 1 79786 1.25335E-5 39893 0 6.37633E-5
9-139908002-C-T p.Pro1487Pro synonymous ABCA2 4 79568 5.02715E-5 39784 0 2.94615E-5
9-139908005-G-A p.Pro1486Pro synonymous ABCA2 5 79592 6.28204E-5 39796 0 2.18742E-5
9-139908020-C-T c.4448-5G>A splice_region ABCA2 1 79432 1.25894E-5 39716 0 NA
9-139908280-C-T c.4447+4G>A splice_region ABCA2 65 72568 8.95712E-4 36284 0 0.001875
9-139908291-C-T p.Pro1480Pro synonymous ABCA2 64 73124 8.75226E-4 36562 0 0.00354251
9-139908304-G-A p.Ala1476Val missense ABCA2 1 74108 1.34938E-5 37054 0 NA
9-139908321-G-A p.Cys1470Cys synonymous ABCA2 4 75276 5.31378E-5 37638 0 1.27462E-4
9-139908327-G-A p.Phe1468Phe synonymous ABCA2 4 75562 5.29367E-5 37781 0 3.18613E-5
9-139908332-A-G p.Phe1467Leu missense ABCA2 2 76048 2.62992E-5 38024 0 3.18654E-5
9-139908334-G-C p.Ala1466Gly missense ABCA2 1 76004 1.31572E-5 38002 0 NA
9-139908360-T-G p.Ala1457Ala synonymous ABCA2 1 76692 1.30392E-5 38346 0 3.19468E-5
9-139908376-C-T p.Arg1452His missense ABCA2 1 75932 1.31697E-5 37966 0 NA
9-139908419-G-A p.Arg1438Cys missense ABCA2 5 76548 6.53185E-5 38274 0 6.13718E-5
9-139908419-G-T p.Arg1438Ser missense ABCA2 1 76548 1.30637E-5 38274 0 5.03525E-4
9-139908420-C-T p.Val1437Val synonymous ABCA2 7 76806 9.11387E-5 38403 0 6.38366E-5
9-139908434-C-T p.Gly1433Arg missense ABCA2 1 78652 1.27142E-5 39326 0 4.08287E-6
9-139908435-G-A p.Gly1432Gly synonymous ABCA2 3 78576 3.81796E-5 39288 0 5.04032E-4
9-139908438-G-A p.Asp1431Asp synonymous ABCA2 163 79212 0.00205777 39606 3 0.00655242
9-139908441-C-T p.Leu1430Leu synonymous ABCA2 1 79732 1.2542E-5 39866 0 NA
9-139908448-C-T p.Arg1428His missense ABCA2 14 80066 1.74856E-4 40033 0 2.5533E-4
9-139908450-G-T p.Ser1427Arg missense ABCA2 2 80236 2.49265E-5 40118 0 9.57426E-5
9-139908450-G-A p.Ser1427Ser synonymous ABCA2 1 80236 1.24632E-5 40118 0 NA
9-139908457-T-G p.Gln1425Pro missense ABCA2 1 80590 1.24085E-5 40295 0 NA
9-139908460-C-G p.Gly1424Ala missense ABCA2 1 80624 1.24033E-5 40312 0 4.09205E-6
9-139908461-C-T p.Gly1424Ser missense ABCA2 1 80710 1.239E-5 40355 0 9.57365E-5
9-139908462-G-A p.Val1423Val synonymous ABCA2 2 80754 2.47666E-5 40377 0 7.77771E-5
9-139908462-G-C p.Val1423Val synonymous ABCA2 1 80754 1.23833E-5 40377 0 NA
9-139908464-C-A p.Val1423Phe missense ABCA2 899 80888 0.0111141 40444 8 0.00957661
9-139908468-C-T p.Ser1421Ser synonymous ABCA2 8 81106 9.86364E-5 40553 0 6.38488E-5
9-139908469-G-A p.Ser1421Leu missense ABCA2 6 81084 7.39973E-5 40542 0 2.86636E-5
9-139908490-TCTGTGCAGAGAGGTAGAGGCTGAGCAGGTGGTTGCACGCTACCCTCTCCCTACTGGCTGCCCTCATGCCGCTCCCCCGCAACCCTGCTCCCCCTCCCTTGCTGTCCCAGCCTCACCCTGCCACCCCCAC-T c.4240+1_4241-1del splice_acceptor ABCA2 2 81260 2.46124E-5 40630 1 NA
9-139908494-T-C c.4241-4A>G splice_region ABCA2 60 81226 7.3868E-4 40613 0 0.0013089
9-139908617-C-T c.4240+3G>A splice_region ABCA2 2 80194 2.49395E-5 40097 0 2.50897E-5
9-139908628-C-A p.Ser1411Ile missense ABCA2 1 80272 1.24576E-5 40136 0 NA
9-139908631-A-T p.Val1410Asp missense ABCA2 1 80302 1.2453E-5 40151 0 2.42442E-5
9-139908632-C-T p.Val1410Ile missense ABCA2 1 80324 1.24496E-5 40162 0 1.20937E-5
9-139908633-A-G p.Asn1409Asn synonymous ABCA2 2 80344 2.4893E-5 40172 0 4.25058E-6
9-139908634-T-TTGTCTGGGTCCTGTGGGTTATCAAAGAGGG p.Asp1408_Asn1409insThrLeuPheAspAsnProGlnAspProAsp conservative_inframe_insertion ABCA2 1 80342 1.24468E-5 40171 0 NA
9-139908635-T-C p.Asn1409Asp missense ABCA2 1 80364 1.24434E-5 40182 0 NA
9-139908636-G-C p.Asp1408Glu missense ABCA2 2 80360 2.4888E-5 40180 0 1.27526E-5
9-139908641-G-C p.Pro1407Ala missense ABCA2 2 80360 2.4888E-5 40180 0 2.38886E-5
9-139908642-G-A p.Asp1406Asp synonymous ABCA2 2 80346 2.48923E-5 40173 0 4.24838E-6
9-139908651-G-T p.Asn1403Lys missense ABCA2 4 80428 4.97339E-5 40214 0 3.81159E-5
9-139908664-G-A p.Pro1399Leu missense ABCA2 2 80622 2.48071E-5 40311 0 6.37471E-5
9-139908667-C-T p.Arg1398His missense ABCA2 4 80564 4.965E-5 40282 0 6.94766E-5
9-139908668-G-T p.Arg1398Ser missense ABCA2 5 80634 6.20086E-5 40317 0 1.38102E-4
9-139908668-G-A p.Arg1398Cys missense ABCA2 2 80636 2.48028E-5 40318 0 6.25E-4
9-139908674-C-T p.Asp1396Asn missense ABCA2 6 80722 7.43292E-5 40361 0 9.12325E-5
9-139908679-T-C p.Tyr1394Cys missense ABCA2 6 80876 7.41876E-5 40438 0 9.18619E-5
9-139908680-A-G p.Tyr1394His missense ABCA2 1 80906 1.236E-5 40453 0 NA
9-139908682-A-G p.Val1393Ala missense ABCA2 4 80906 4.94401E-5 40453 0 7.93313E-5
9-139908683-C-T p.Val1393Ile missense ABCA2 10 80962 1.23515E-4 40481 1 2.34884E-4
9-139908684-G-A p.Asp1392Asp synonymous ABCA2 2 80970 2.47005E-5 40485 0 3.18878E-5
9-139908686-C-T p.Asp1392Asn missense ABCA2 6 81000 7.40741E-5 40500 0 1.55878E-4
9-139908687-G-A p.Thr1391Thr synonymous ABCA2 9 81032 1.11067E-4 40516 0 6.37796E-5
9-139908695-C-A p.Gly1389Cys missense ABCA2 1 81184 1.23177E-5 40592 0 3.18674E-5
9-139908700-C-T p.Gly1387Glu missense ABCA2 1 81294 1.2301E-5 40647 0 6.25E-4
9-139908704-C-T p.Glu1386Lys missense ABCA2 1 81292 1.23013E-5 40646 0 0.00100908
9-139908704-C-G p.Glu1386Gln missense ABCA2 1 81292 1.23013E-5 40646 0 NA
9-139908707-C-T p.Asp1385Asn missense ABCA2 1 81340 1.22941E-5 40670 0 4.3321E-5
9-139908708-G-A p.Gly1384Gly synonymous ABCA2 1 81320 1.22971E-5 40660 0 5.04541E-4
9-139908712-C-T p.Arg1383His missense ABCA2 4 81382 4.91509E-5 40691 0 5.38317E-5
9-139908713-G-A p.Arg1383Cys missense ABCA2 3 81412 3.68496E-5 40706 0 3.22657E-5
9-139908723-C-G p.Val1379Val synonymous ABCA2 1 81510 1.22684E-5 40755 0 3.18573E-5
9-139908727-G-A p.Ser1378Phe missense ABCA2 8 81512 9.81451E-5 40756 0 6.42206E-5
9-139908729-T-C p.Ser1377Ser synonymous ABCA2 1 81510 1.22684E-5 40755 0 7.01459E-5
9-139908732-C-T p.Ala1376Ala synonymous ABCA2 58 81434 7.12233E-4 40717 0 0.00375
9-139908733-G-A p.Ala1376Val missense ABCA2 6 81378 7.373E-5 40689 0 3.22393E-5
9-139908735-C-T p.Ser1375Ser synonymous ABCA2 3 81362 3.68723E-5 40681 0 6.25E-4
9-139908738-C-A p.Gln1374His missense ABCA2 1 81360 1.22911E-5 40680 0 NA
9-139908744-C-T p.Ser1372Ser synonymous ABCA2 1 81288 1.23019E-5 40644 0 1.65618E-5
9-139908753-C-T p.Ser1369Ser synonymous ABCA2 3 81078 3.70014E-5 40539 0 0.00201816
9-139908754-G-A p.Ser1369Leu missense ABCA2 4 81084 4.93316E-5 40542 0 2.25912E-5
9-139908757-TGGGTCAGCTCCGAGCACC-T p.Arg1362_Thr1367del disruptive_inframe_deletion ABCA2 8 81048 9.87069E-5 40524 0 2.27061E-5
9-139908759-G-A p.Thr1367Thr synonymous ABCA2 4 81022 4.93693E-5 40511 0 2.07488E-4
9-139908767-C-G p.Glu1365Gln missense ABCA2 1 80828 1.2372E-5 40414 0 NA
9-139908768-C-T p.Ser1364Ser synonymous ABCA2 15 80842 1.85547E-4 40421 0 0.00201613
9-139908769-G-A p.Ser1364Leu missense ABCA2 3 80798 3.71296E-5 40399 0 4.80642E-5
9-139908775-C-T p.Arg1362Gln missense ABCA2 1 80682 1.23943E-5 40341 0 6.37714E-5
9-139908776-G-A p.Arg1362Trp missense ABCA2 8 80662 9.91793E-5 40331 0 1.64324E-4
9-139908778-G-A p.Ala1361Val missense ABCA2 3 80594 3.72236E-5 40297 0 NA
9-139908786-G-C p.Gly1358Gly synonymous ABCA2 2 80484 2.48497E-5 40242 0 6.37633E-5
9-139908791-C-T p.Ala1357Thr missense ABCA2 1 80230 1.24642E-5 40115 0 5.70662E-5
9-139908797-C-T p.Gly1355Ser missense ABCA2 1 80078 1.24878E-5 40039 0 4.37871E-6
9-139908802-C-T p.Gly1353Glu missense ABCA2 5 80000 6.25E-5 40000 0 2.0389E-4
9-139908803-C-A p.Gly1353Trp missense ABCA2 4 79968 5.002E-5 39984 0 8.01068E-5
9-139908807-C-T p.Ala1351Ala synonymous ABCA2 2 79736 2.50828E-5 39868 0 5.0449E-5
9-139908808-G-A p.Ala1351Val missense ABCA2 4 79604 5.02487E-5 39802 0 3.41612E-5
9-139908810-C-T p.Pro1350Pro synonymous ABCA2 2 79502 2.51566E-5 39751 0 8.86368E-5
9-139908811-G-A p.Pro1350Leu missense ABCA2 6 79448 7.55211E-5 39724 0 1.96351E-4
9-139908819-C-T p.Ala1347Ala synonymous ABCA2 2 79164 2.5264E-5 39582 0 1.14094E-4
9-139908820-G-A p.Ala1347Val missense ABCA2 2 79002 2.53158E-5 39501 0 0.00202429
9-139908828-G-A p.Leu1344Leu synonymous ABCA2 1 78982 1.26611E-5 39491 0 2.02511E-5
9-139908858-T-G c.4004-2A>C splice_acceptor ABCA2 1 78364 1.2761E-5 39182 0 NA
9-139908860-C-T c.4004-4G>A splice_region ABCA2 1 78236 1.27818E-5 39118 0 1.04316E-5
9-139908861-C-T c.4004-5G>A splice_region ABCA2 2 78254 2.55578E-5 39127 0 6.26959E-4
9-139908861-C-A c.4004-5G>T splice_region ABCA2 1 78254 1.27789E-5 39127 0 6.26959E-4
9-139908862-G-A c.4004-6C>T splice_region ABCA2 3 78218 3.83543E-5 39109 0 1.276E-4
9-139909135-C-T c.4003+7G>A splice_region ABCA2 161 81338 0.00197939 40669 1 0.00481628
9-139909136-C-T c.4003+6G>A splice_region ABCA2 1 81358 1.22914E-5 40679 0 4.321E-6
9-139909140-A-ACCTGGT c.4003+1_4003+2insACCAGG splice_donor ABCA2 3 81390 3.68596E-5 40695 0 3.1957E-5
9-139909142-C-T p.Asp1335Asn missense+splice_region ABCA2 3 81480 3.68189E-5 40740 0 5.53986E-5
9-139909161-C-T p.Ser1328Ser synonymous ABCA2 16 81636 1.95992E-4 40818 0 0.00625
9-139909161-C-A p.Ser1328Ser synonymous ABCA2 3 81636 3.67485E-5 40818 0 6.37227E-5
9-139909164-C-G p.Gln1327His missense ABCA2 3 81670 3.67332E-5 40835 0 NA
9-139909165-T-G p.Gln1327Pro missense ABCA2 1 81684 1.22423E-5 40842 0 NA
9-139909196-C-T p.Glu1317Lys missense ABCA2 3 81620 3.67557E-5 40810 0 1.41559E-5
9-139909200-C-T p.Leu1315Leu synonymous ABCA2 2 81586 2.4514E-5 40793 0 1.27805E-4
9-139909203-G-A p.Thr1314Thr synonymous ABCA2 1 81588 1.22567E-5 40794 0 NA
9-139909206-C-T p.Thr1313Thr synonymous ABCA2 506 81588 0.00620189 40794 1 0.01375
9-139909221-G-A p.Phe1308Phe synonymous ABCA2 2 81576 2.4517E-5 40788 0 3.18695E-5
9-139909233-G-A p.His1304His synonymous ABCA2 1 81572 1.22591E-5 40786 0 NA
9-139909252-C-T p.Arg1298His missense ABCA2 1 81392 1.22862E-5 40696 0 6.7397E-5
9-139909253-G-A p.Arg1298Cys missense ABCA2 3 81390 3.68596E-5 40695 0 8.96968E-5
9-139909262-GCTGCAGGGGCGGTGGAGGGGGAGGCTGCGGCAGGGACGCCCAGGCAGGAGTGCGCCCACCTCCACCACCTGCAACTGCCCCCCGACCCGTGCGCCCTCACAC-G c.3882+1_3883-1del splice_acceptor ABCA2 10 81388 1.22868E-4 40694 3 NA
9-139909265-G-A c.3883-3C>T splice_region ABCA2 3 81348 3.68786E-5 40674 0 1.91119E-4
9-139909268-G-A c.3883-6C>T splice_region ABCA2 1 81324 1.22965E-5 40662 0 5.02343E-5
9-139909358-C-T c.3882+7G>A splice_region ABCA2 1 81904 1.22094E-5 40952 0 NA
9-139909362-C-T c.3882+3G>A splice_region ABCA2 1 81944 1.22035E-5 40972 0 NA
9-139909376-G-A p.Arg1291Cys missense ABCA2 12 82162 1.46053E-4 41081 0 9.83901E-5
9-139909380-G-A p.Phe1289Phe synonymous ABCA2 1 82228 1.21613E-5 41114 0 3.18674E-5
9-139909385-C-T p.Ala1288Thr missense ABCA2 1 82314 1.21486E-5 41157 0 1.15687E-5
9-139909404-G-A p.Ser1281Ser synonymous ABCA2 11 82302 1.33654E-4 41151 0 2.86825E-4
9-139909422-G-A p.Leu1275Leu synonymous ABCA2 2 82550 2.42277E-5 41275 0 0.00100908
9-139909428-C-T p.Thr1273Thr synonymous ABCA2 14 82596 1.695E-4 41298 0 5.03525E-4
9-139909429-G-A p.Thr1273Met missense ABCA2 2 82582 2.42184E-5 41291 0 5.03525E-4
9-139909432-C-G p.Ser1272Thr missense ABCA2 1 82618 1.21039E-5 41309 0 NA
9-139909440-T-G p.Ser1269Ser synonymous ABCA2 1 82676 1.20954E-5 41338 0 NA
9-139909443-G-A p.Val1268Val synonymous ABCA2 1 82686 1.20939E-5 41343 0 3.18593E-5
9-139909451-G-A p.Leu1266Leu synonymous ABCA2 1 82700 1.20919E-5 41350 0 1.7954E-5
9-139909454-A-G p.Cys1265Arg missense ABCA2 1 82706 1.2091E-5 41353 0 8.38237E-6
9-139909455-G-A p.Ser1264Ser synonymous ABCA2 1 82718 1.20893E-5 41359 0 8.93384E-6
9-139909464-A-G p.His1261His synonymous ABCA2 1 82702 1.20916E-5 41351 0 2.65986E-5
9-139909466-G-A p.His1261Tyr missense ABCA2 1 82698 1.20922E-5 41349 0 4.12974E-6
9-139909471-C-A p.Arg1259Leu missense ABCA2 1 82652 1.20989E-5 41326 0 NA
9-139909472-G-A p.Arg1259Cys missense ABCA2 1 82642 1.21004E-5 41321 0 1.41138E-4
9-139909480-T-A p.Gln1256Leu missense ABCA2 7 82606 8.47396E-5 41303 0 8.22795E-6
9-139909484-A-G p.Ser1255Pro missense ABCA2 1 82548 1.21142E-5 41274 0 NA
9-139909485-C-A p.Val1254Val synonymous ABCA2 1 82560 1.21124E-5 41280 0 3.70099E-5
9-139909487-C-T p.Val1254Met missense ABCA2 1 82526 1.21174E-5 41263 0 NA
9-139909493-G-A p.Leu1252Phe missense ABCA2 1 82450 1.21286E-5 41225 0 NA
9-139909493-G-C p.Leu1252Val missense ABCA2 3 82450 3.63857E-5 41225 0 1.23631E-5
9-139909496-C-T p.Glu1251Lys missense ABCA2 2 82406 2.42701E-5 41203 0 3.18817E-5
9-139909497-G-A p.Ser1250Ser synonymous ABCA2 14 82396 1.69911E-4 41198 0 5.03525E-4
9-139909498-G-A p.Ser1250Phe missense ABCA2 3 82398 3.64087E-5 41199 0 NA
9-139909509-C-T p.Leu1246Leu synonymous ABCA2 1 82142 1.2174E-5 41071 0 NA
9-139909512-C-T p.Pro1245Pro synonymous ABCA2 10 81968 1.21999E-4 40984 0 2.23414E-4
9-139909513-G-A p.Pro1245Leu missense ABCA2 3 82012 3.658E-5 41006 0 6.37714E-5
9-139909520-G-A p.Arg1243Trp missense ABCA2 1 81836 1.22196E-5 40918 0 2.54427E-5
9-139909522-C-T p.Gly1242Asp missense ABCA2 1 81816 1.22225E-5 40908 0 8.90668E-5
9-139909523-C-G p.Gly1242Arg missense ABCA2 2 81800 2.44499E-5 40900 0 NA
9-139909529-G-C p.Pro1240Ala missense ABCA2 3 81690 3.67242E-5 40845 0 3.18654E-5
9-139909532-T-C p.Ser1239Gly missense ABCA2 1 81522 1.22666E-5 40761 0 2.19566E-5
9-139909553-T-TG c.3698-5_3698-4insC splice_region ABCA2 1 80562 1.24128E-5 40281 0 1.45753E-5
9-139909557-G-A c.3698-8C>T splice_region ABCA2 1 80354 1.24449E-5 40177 0 3.71782E-5
9-139909867-T-C p.Gln1232Gln splice_region+synonymous ABCA2 1 80558 1.24134E-5 40279 0 NA
9-139909870-G-C p.Pro1231Pro synonymous ABCA2 2 80620 2.48077E-5 40310 0 5.61924E-5
9-139909879-C-T p.Pro1228Pro synonymous ABCA2 1 80858 1.23674E-5 40429 0 1.13185E-5
9-139909879-C-G p.Pro1228Pro synonymous ABCA2 1 80858 1.23674E-5 40429 0 NA
9-139909880-G-A p.Pro1228Leu missense ABCA2 11 80876 1.36011E-4 40438 0 1.91669E-4
9-139909884-C-T p.Glu1227Lys missense ABCA2 1 80888 1.23628E-5 40444 0 4.804E-5
9-139909885-G-A p.Ala1226Ala synonymous ABCA2 30 80826 3.71168E-4 40413 0 0.00571792
9-139909887-C-T p.Ala1226Thr missense ABCA2 2 80846 2.47384E-5 40423 0 1.31521E-4
9-139909888-G-A p.Pro1225Pro synonymous ABCA2 10 80844 1.23695E-4 40422 0 1.62694E-4
9-139909889-G-A p.Pro1225Leu missense ABCA2 1 80876 1.23646E-5 40438 0 7.8559E-5
9-139909893-G-A p.Arg1224Trp missense ABCA2 3 80052 3.74756E-5 40026 0 7.66754E-5
9-139909900-C-A p.Leu1221Leu synonymous ABCA2 1 80682 1.23943E-5 40341 0 NA
9-139909904-G-A p.Thr1220Met missense ABCA2 2 80740 2.47709E-5 40370 0 3.19264E-5
9-139909910-C-T p.Arg1218His missense ABCA2 3 80906 3.70801E-5 40453 0 8.89205E-5
9-139909912-G-A p.Tyr1217Tyr synonymous ABCA2 1 81086 1.23326E-5 40543 0 3.19264E-5
9-139909913-T-C p.Tyr1217Cys missense ABCA2 1 80978 1.2349E-5 40489 0 6.25E-4
9-139909915-C-T p.Gly1216Gly synonymous ABCA2 1 81144 1.23238E-5 40572 0 NA
9-139909918-G-A p.Asp1215Asp synonymous ABCA2 275 81172 0.00338787 40586 2 0.00507099
9-139909921-G-A p.Gly1214Gly synonymous ABCA2 8 81256 9.84543E-5 40628 0 0.00101215
9-139909939-G-A p.Phe1208Phe synonymous ABCA2 1 81728 1.22357E-5 40864 0 4.13955E-6
9-139909942-G-A p.Leu1207Leu synonymous ABCA2 1 81804 1.22243E-5 40902 0 NA
9-139909945-C-T p.Pro1206Pro synonymous ABCA2 1 81786 1.2227E-5 40893 0 4.1247E-6
9-139909953-C-T p.Gly1204Ser missense ABCA2 1 82202 1.21652E-5 41101 0 4.05973E-6
9-139909954-G-A p.Cys1203Cys synonymous ABCA2 4 82220 4.865E-5 41110 0 6.38978E-5
9-139909963-G-A p.Leu1200Leu synonymous ABCA2 2 82452 2.42565E-5 41226 0 NA
9-139909992-G-A p.Arg1191Cys missense ABCA2 5 82614 6.05224E-5 41307 0 4.02253E-6
9-139909995-C-T p.Asp1190Asn missense ABCA2 2 82634 2.42031E-5 41317 0 NA
9-139910011-C-T p.Glu1184Glu synonymous ABCA2 567 82684 0.00685743 41342 7 0.013416
9-139910022-G-T p.His1181Asn missense ABCA2 1 82628 1.21024E-5 41314 0 NA
9-139910034-G-A p.Leu1177Leu synonymous ABCA2 2 82534 2.42324E-5 41267 0 NA
9-139910045-C-T p.Arg1173His missense ABCA2 8 82400 9.70874E-5 41200 0 5.05051E-4
9-139910047-GCCTAGGACAAGGCCAGACCCAGGGTCAGGGGGCAGGGGAGGCGCCGCCCGCACCCCTGCCCACACGGCACCCCACTCA-G p.Gly1172fs frameshift ABCA2 13 82368 1.57828E-4 41184 6 NA
9-139910119-C-T c.3514+8G>A splice_region ABCA2 1 80602 1.24066E-5 40301 0 NA
9-139910131-C-T p.Lys1170Lys synonymous ABCA2 22 80092 2.74684E-4 40046 0 1.91669E-4
9-139910142-G-A p.Leu1167Leu synonymous ABCA2 2 79546 2.51427E-5 39773 0 NA
9-139910155-G-A p.Ile1162Ile synonymous ABCA2 1 78508 1.27376E-5 39254 0 NA
9-139910158-G-A p.Ala1161Ala synonymous ABCA2 3 78072 3.84261E-5 39036 0 NA
9-139910161-G-A p.Arg1160Arg synonymous ABCA2 3 77026 3.89479E-5 38513 0 6.25E-4
9-139910162-C-T p.Arg1160His missense ABCA2 1 76654 1.30456E-5 38327 0 3.1953E-5
9-139910164-G-A p.Arg1159Arg synonymous ABCA2 1 76232 1.31179E-5 38116 0 NA
9-139910165-C-T p.Arg1159His missense ABCA2 2 75818 2.6379E-5 37909 0 NA
9-139910167-C-T p.Ala1158Ala synonymous ABCA2 18 75336 2.3893E-4 37668 0 3.19223E-4
9-139910168-G-A p.Ala1158Val missense ABCA2 1 75220 1.32943E-5 37610 0 1.26968E-4