Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
7-48211089-T-C p.His3His synonymous ABCA13 17 80758 2.10505E-4 40379 0 7.6438E-4
7-48211090-G-A p.Ala4Thr missense ABCA13 24 80764 2.97162E-4 40382 0 2.5481E-4
7-48211091-C-T p.Ala4Val missense ABCA13 1 80760 1.23824E-5 40380 0 NA
7-48211092-C-T p.Ala4Ala synonymous ABCA13 2 80798 2.47531E-5 40399 0 2.11652E-5
7-48211092-CG-C p.Cys6fs frameshift ABCA13 1 80798 1.23765E-5 40399 0 NA
7-48211097-G-A p.Cys6Tyr missense ABCA13 5 80890 6.18123E-5 40445 0 5.80114E-5
7-48211097-GC-G p.Gln7fs frameshift ABCA13 1 80890 1.23625E-5 40445 0 NA
7-48211098-C-A p.Cys6* stop_gained ABCA13 7 80896 8.65309E-5 40448 0 1.27462E-4
7-48211099-CAGT-C p.Gln7_Phe8delinsLeu disruptive_inframe_deletion ABCA13 2 80908 2.47194E-5 40454 0 1.15996E-4
7-48211101-G-C p.Gln7His missense ABCA13 2 80926 2.47139E-5 40463 0 7.05099E-6
7-48211110-C-T p.Ala10Ala synonymous ABCA13 1 81002 1.23454E-5 40501 0 3.18552E-5
7-48211148-C-T p.Pro23Leu missense+splice_region ABCA13 1 80882 1.23637E-5 40441 0 5.81531E-5
7-48211149-G-A p.Pro23Pro splice_region+synonymous ABCA13 3 80858 3.71021E-5 40429 0 2.23029E-4
7-48211156-G-A c.69+7G>A splice_region ABCA13 1 80764 1.23818E-5 40382 0 NA
7-48232552-C-T c.70-4C>T splice_region ABCA13 2 79614 2.51212E-5 39807 0 6.99689E-4
7-48232559-C-G p.Leu25Val missense ABCA13 1 80210 1.24673E-5 40105 0 3.39732E-5
7-48232580-T-C p.Trp32Arg missense ABCA13 151 80632 0.00187271 40316 2 0.00452166
7-48232596-T-C p.Phe37Ser missense ABCA13 1 80812 1.23744E-5 40406 0 6.37796E-5
7-48232616-C-T p.Arg44Cys missense ABCA13 3 80786 3.71351E-5 40393 0 6.52533E-5
7-48232617-G-A p.Arg44His missense ABCA13 7 80766 8.66701E-5 40383 0 7.94591E-5
7-48232617-G-C p.Arg44Pro missense ABCA13 1 80766 1.23814E-5 40383 0 2.62502E-4
7-48232626-A-C p.Glu47Ala missense ABCA13 1 80744 1.23848E-5 40372 0 NA
7-48232645-C-T p.Asp53Asp synonymous ABCA13 4 80592 4.96327E-5 40296 0 3.19081E-5
7-48232656-T-G c.163+7T>G splice_region ABCA13 19 80318 2.3656E-4 40159 0 6.28931E-4
7-48237825-TA-T c.164-8delA splice_region ABCA13 5 82572 6.05532E-5 41286 0 0.00134138
7-48237829-TCTAGG-T p.Cys55fs frameshift ABCA13 5 82608 6.05268E-5 41304 0 0.00147634
7-48237838-T-A p.Tyr56* stop_gained ABCA13 2 82610 2.42101E-5 41305 0 0.00244347
7-48237839-T-TGA p.Leu57fs frameshift ABCA13 6 82636 7.26076E-5 41318 0 0.00258978
7-48237840-T-C p.Leu57Ser missense ABCA13 13 82666 1.57259E-4 41333 0 1.98539E-4
7-48237840-T-TACG p.Leu57_Gln58insArg disruptive_inframe_insertion ABCA13 6 82648 7.2597E-5 41324 0 0.00246188
7-48237842-C-A p.Gln58Lys missense ABCA13 2 82640 2.42014E-5 41320 0 NA
7-48237842-C-CG p.Gln58fs frameshift ABCA13 4 82618 4.84156E-5 41309 0 0.00265344
7-48237844-G-C p.Gln58His missense ABCA13 1 82622 1.21033E-5 41311 0 0.00339464
7-48237846-C-A p.Pro59His missense ABCA13 1 82654 1.20986E-5 41327 0 0.00366123
7-48237847-C-T p.Pro59Pro synonymous ABCA13 1 82708 1.20907E-5 41354 0 5.03525E-4
7-48237848-C-T p.Arg60* stop_gained ABCA13 3 82710 3.62713E-5 41355 0 5.1254E-5
7-48237853-T-G p.Asp61Glu missense ABCA13 5 82720 6.04449E-5 41360 0 6.37146E-5
7-48237857-C-T p.Pro63Ser missense ABCA13 1 82742 1.20858E-5 41371 0 8.04887E-6
7-48237866-G-A p.Gly66Ser missense ABCA13 1 82758 1.20834E-5 41379 0 NA
7-48237867-G-A p.Gly66Asp missense ABCA13 1 82758 1.20834E-5 41379 0 0.00125
7-48237870-T-G p.Val67Gly missense ABCA13 1 82756 1.20837E-5 41378 0 8.47903E-6
7-48237878-T-C p.Phe70Leu missense ABCA13 2 82756 2.41674E-5 41378 0 1.69374E-5
7-48237904-T-C p.Thr78Thr synonymous ABCA13 1 82744 1.20855E-5 41372 0 6.36862E-5
7-48237905-G-T p.Gly79* stop_gained ABCA13 1 82744 1.20855E-5 41372 0 4.21443E-5
7-48237906-G-C p.Gly79Ala missense ABCA13 12 82728 1.45054E-4 41364 0 2.54793E-4
7-48237919-G-A p.Arg83Arg synonymous ABCA13 33 82714 3.98965E-4 41357 0 8.68041E-4
7-48237951-A-G p.His94Arg missense ABCA13 8 82652 9.67914E-5 41326 0 5.03525E-4
7-48237957-G-A p.Arg96His missense+splice_region ABCA13 1 82638 1.2101E-5 41319 0 6.37064E-5
7-48258950-G-C c.288-1G>C splice_acceptor ABCA13 8 82448 9.70309E-5 41224 0 2.22973E-4
7-48258979-C-T p.Pro106Ser missense ABCA13 1 82620 1.21036E-5 41310 0 8.32584E-6
7-48258990-C-T p.Val109Val synonymous ABCA13 1 82656 1.20983E-5 41328 0 2.42041E-5
7-48259001-C-A p.Ala113Asp missense ABCA13 2 82664 2.41943E-5 41332 0 NA
7-48259002-C-T p.Ala113Ala synonymous ABCA13 2 82668 2.41932E-5 41334 0 NA
7-48259002-C-G p.Ala113Ala synonymous ABCA13 2 82668 2.41932E-5 41334 0 NA
7-48259014-G-A p.Glu117Glu synonymous ABCA13 7 82662 8.46822E-5 41331 0 1.40964E-4
7-48259031-A-G p.Glu123Gly missense ABCA13 1 82622 1.21033E-5 41311 0 1.65741E-5
7-48259040-A-G p.His126Arg missense ABCA13 3 82594 3.63222E-5 41297 0 2.48591E-5
7-48259051-G-A p.Asp130Asn missense ABCA13 3 82558 3.63381E-5 41279 0 3.18756E-5
7-48259056-G-A p.Lys131Lys synonymous ABCA13 1 82556 1.2113E-5 41278 0 NA
7-48259057-G-A p.Ala132Thr missense ABCA13 9 82538 1.09041E-4 41269 0 2.8997E-4
7-48259058-C-G p.Ala132Gly missense ABCA13 1 82528 1.21171E-5 41264 0 3.19061E-5
7-48259067-T-G p.Leu135* stop_gained ABCA13 1 82498 1.21215E-5 41249 0 NA
7-48259072-AGACTTTGGGTAG-A p.Arg137_Glu141delinsLys disruptive_inframe_deletion ABCA13 11 82482 1.33362E-4 41241 0 1.24267E-4
7-48259073-G-T p.Arg137Ile missense ABCA13 6 82484 7.27414E-5 41242 0 1.69242E-4
7-48259081-G-A p.Val140Ile missense ABCA13 2 82454 2.42559E-5 41227 0 NA
7-48259082-T-C p.Val140Ala missense ABCA13 1 82444 1.21294E-5 41222 0 8.28583E-6
7-48259086-A-G p.Glu141Glu synonymous ABCA13 2 82426 2.42642E-5 41213 0 3.18552E-5
7-48259087-C-T p.Arg142* stop_gained ABCA13 4 82402 4.85425E-5 41201 0 7.45712E-5
7-48259088-G-A p.Arg142Gln missense ABCA13 14 82382 1.6994E-4 41191 0 0.00352467
7-48259102-G-A p.Asp147Asn missense+splice_region ABCA13 1 82338 1.21451E-5 41169 0 NA
7-48259106-A-G c.439+4A>G splice_region ABCA13 1 82316 1.21483E-5 41158 0 NA
7-48260884-C-T p.Ser149Phe missense ABCA13 1 77248 1.29453E-5 38624 0 1.4246E-5
7-48260894-C-T p.Ser152Ser synonymous ABCA13 31 77216 4.01471E-4 38608 0 8.28184E-4
7-48260896-G-GT p.Thr156fs frameshift ABCA13 1 77180 1.29567E-5 38590 0 3.18654E-5
7-48260896-G-T p.Ser153Ile missense ABCA13 1 77184 1.29561E-5 38592 0 NA
7-48260906-A-G p.Thr156Thr splice_region+synonymous ABCA13 1 77144 1.29628E-5 38572 0 1.43287E-5
7-48266869-A-G p.Asn160Ser missense ABCA13 34 82292 4.13163E-4 41146 0 6.69643E-4
7-48266873-G-A p.Lys161Lys synonymous ABCA13 23 82328 2.7937E-4 41164 0 0.0025
7-48266876-C-A p.Thr162Thr synonymous ABCA13 1061 82292 0.0128931 41146 11 0.0594159
7-48266876-C-T p.Thr162Thr synonymous ABCA13 2 82336 2.42907E-5 41168 0 5.79691E-5
7-48266876-C-G p.Thr162Thr synonymous ABCA13 1 82336 1.21454E-5 41168 0 1.07657E-4
7-48266877-G-A p.Glu163Lys missense ABCA13 5 82368 6.07032E-5 41184 0 2.87301E-4
7-48266881-A-C p.Glu164Ala missense ABCA13 2 82404 2.42707E-5 41202 0 6.37959E-5
7-48266883-G-A p.Val165Ile missense ABCA13 1 82416 1.21336E-5 41208 0 8.28144E-6
7-48266889-T-C p.Leu167Leu synonymous ABCA13 1 82456 1.21277E-5 41228 0 8.28157E-6
7-48266910-C-T p.Gln174* stop_gained ABCA13 2 82520 2.42365E-5 41260 0 NA
7-48266940-T-A p.Leu184Ile missense ABCA13 1 82378 1.21392E-5 41189 0 8.59912E-4
7-48266945-G-GCGACCA p.Leu185_Pro186insArgPro disruptive_inframe_insertion ABCA13 1 82366 1.21409E-5 41183 0 0.00106635
7-48266947-C-T p.Pro186Leu missense ABCA13 1 82468 1.21259E-5 41234 0 2.4853E-5
7-48266948-G-A p.Pro186Pro synonymous ABCA13 7 82468 8.48814E-5 41234 0 1.16487E-4
7-48266951-A-AT p.Leu188fs frameshift ABCA13 1 82356 1.21424E-5 41178 0 0.00136936
7-48266956-A-G p.His189Arg missense ABCA13 1 82488 1.2123E-5 41244 0 NA
7-48266968-A-G p.Asp193Gly missense ABCA13 1 82496 1.21218E-5 41248 0 8.28803E-6
7-48266974-T-G p.Val195Gly missense ABCA13 1 82494 1.21221E-5 41247 0 NA
7-48266974-T-A p.Val195Glu missense ABCA13 2 82494 2.42442E-5 41247 0 NA
7-48266976-G-A p.Glu196Lys missense ABCA13 22 82494 2.66686E-4 41247 1 0.003125
7-48266977-A-C p.Glu196Ala missense ABCA13 1 82494 1.21221E-5 41247 0 NA
7-48266990-T-A p.Asp200Glu missense ABCA13 3 82448 3.63866E-5 41224 1 8.03258E-6
7-48267010-A-G p.Gln207Arg missense ABCA13 1 82314 1.21486E-5 41157 0 3.1837E-5
7-48269416-T-G c.633-6T>G splice_region ABCA13 1 82560 1.21124E-5 41280 0 NA
7-48269418-C-G c.633-4C>G splice_region ABCA13 1 82568 1.21112E-5 41284 0 NA
7-48269433-C-T p.Ser215Phe missense ABCA13 1 82650 1.20992E-5 41325 0 NA
7-48269438-G-A p.Glu217Lys missense ABCA13 6 82652 7.25935E-5 41326 1 7.45527E-5
7-48269440-A-T p.Glu217Asp missense ABCA13 2 82636 2.42025E-5 41318 0 NA
7-48269456-C-A p.Pro223Thr missense ABCA13 1 82680 1.20948E-5 41340 0 NA
7-48269463-A-G p.Asn225Ser missense ABCA13 42 82716 5.07761E-4 41358 0 5.03525E-4
7-48269468-AC-A p.Thr227fs frameshift ABCA13 1 82728 1.20878E-5 41364 0 NA
7-48269482-T-A p.Val231Val synonymous ABCA13 19 82740 2.29635E-4 41370 0 2.22902E-4
7-48269496-T-C p.Leu236Pro missense ABCA13 1 82760 1.20831E-5 41380 0 NA
7-48269501-G-C p.Val238Leu missense ABCA13 1 82770 1.20817E-5 41385 0 NA
7-48269511-C-T p.Ser241Leu missense ABCA13 6 82744 7.25128E-5 41372 0 1.59226E-4
7-48269517-T-C p.Leu243Pro missense ABCA13 1 82752 1.20843E-5 41376 0 3.1841E-5
7-48269519-A-G p.Thr244Ala missense ABCA13 2 82746 2.41704E-5 41373 0 2.40807E-5
7-48269523-T-A p.Phe245Tyr missense ABCA13 4 82734 4.83477E-5 41367 0 8.28185E-6
7-48269538-G-T p.Gly250Val missense ABCA13 1 82712 1.20901E-5 41356 0 NA
7-48269548-C-A p.Val253Val synonymous ABCA13 1 82696 1.20925E-5 41348 0 8.29201E-6
7-48269551-C-T p.Thr254Thr splice_region+synonymous ABCA13 1 82674 1.20957E-5 41337 0 6.43439E-5
7-48269552-G-A p.Glu255Lys missense+splice_region ABCA13 4 82674 4.83828E-5 41337 0 1.60918E-5
7-48273616-G-C p.Glu255Asp missense+splice_region ABCA13 2 82698 2.41844E-5 41349 0 NA
7-48273622-T-G p.Val257Val synonymous ABCA13 91 82712 0.0011002 41356 1 0.00553877
7-48273627-A-G p.His259Arg missense ABCA13 1 82724 1.20884E-5 41362 0 NA
7-48273630-T-C p.Leu260Pro missense ABCA13 1 82736 1.20866E-5 41368 0 4.01407E-6
7-48273631-G-T p.Leu260Leu synonymous ABCA13 1 82738 1.20863E-5 41369 0 4.01361E-6
7-48273638-C-A p.Gln263Lys missense ABCA13 2 82734 2.41739E-5 41367 0 3.18451E-5
7-48273651-GGGA-G p.Trp267_Asp268delinsCys disruptive_inframe_deletion ABCA13 6 82742 7.25146E-5 41371 0 4.98331E-5
7-48273652-G-C p.Trp267Cys missense ABCA13 1 82736 1.20866E-5 41368 0 NA
7-48273662-A-G p.Lys271Glu missense ABCA13 1 82752 1.20843E-5 41376 0 4.01204E-6
7-48273664-A-C p.Lys271Asn missense ABCA13 2 82754 2.4168E-5 41377 0 9.55353E-5
7-48273682-A-C p.Lys277Asn missense ABCA13 1 82756 1.20837E-5 41378 0 NA
7-48273685-C-A p.Ser278Ser synonymous ABCA13 5 82746 6.04259E-5 41373 0 5.79816E-5
7-48273685-C-T p.Ser278Ser synonymous ABCA13 1 82746 1.20852E-5 41373 0 1.65662E-5
7-48273690-T-A p.Phe280Tyr missense ABCA13 1 82756 1.20837E-5 41378 0 NA
7-48273697-T-A p.Phe282Leu missense ABCA13 1 82762 1.20828E-5 41381 0 8.02375E-6
7-48273700-T-A p.Asp283Glu missense ABCA13 1 82762 1.20828E-5 41381 0 NA
7-48273705-T-C p.Leu285Pro missense ABCA13 1 82746 1.20852E-5 41373 0 NA
7-48273711-C-T p.Thr287Met missense ABCA13 8 82734 9.66954E-5 41367 0 1.20373E-5
7-48273712-G-A p.Thr287Thr synonymous ABCA13 5 82734 6.04346E-5 41367 0 0.00100705
7-48273726-A-G p.Asn292Ser missense ABCA13 1 82696 1.20925E-5 41348 0 6.37389E-5
7-48273735-C-T p.Ala295Val missense ABCA13 1 82646 1.20998E-5 41323 0 NA
7-48273747-A-T p.Glu299Val missense+splice_region ABCA13 3 82576 3.63302E-5 41288 0 5.03525E-4
7-48273749-G-T c.897+1G>T splice_donor ABCA13 2 82566 2.4223E-5 41283 0 4.01381E-6
7-48273753-A-G p.His301Arg missense ABCA13 1 82516 1.21189E-5 41258 0 NA
7-48273772-A-G p.Ser307Ser synonymous ABCA13 822 82250 0.00999392 41125 16 0.0222668
7-48273776-C-T p.Arg309Cys missense ABCA13 2 82182 2.43362E-5 41091 0 4.96985E-5
7-48273777-G-A p.Arg309His missense ABCA13 10 82130 1.21758E-4 41065 0 4.97034E-5
7-48273799-G-C p.Trp316Cys missense ABCA13 1 81700 1.22399E-5 40850 0 3.18451E-5
7-48273823-G-A c.*18G>A splice_region ABCA13 20 80862 2.47335E-4 40431 0 2.22859E-4
7-48273830-C-T c.*19+6C>T splice_region ABCA13 23 80352 2.86241E-4 40176 0 7.32484E-4
7-48273831-G-A c.*19+7G>A splice_region ABCA13 3 80316 3.73525E-5 40158 0 1.22389E-5
7-48278835-C-T c.*20-3C>T splice_region ABCA13 1 82486 1.21233E-5 41243 0 NA
7-48278853-TC-T p.Leu306fs frameshift ABCA13 2 82556 2.4226E-5 41278 0 6.37146E-5
7-48278867-G-T p.Met309Ile missense ABCA13 69 82588 8.35472E-4 41294 0 7.0086E-4
7-48278868-G-T p.Val310Leu missense ABCA13 2 82606 2.42113E-5 41303 0 8.29132E-6
7-48278890-C-T p.Thr317Ile missense ABCA13 7 82642 8.47027E-5 41321 0 6.36821E-5
7-48278891-A-C p.Thr317Thr synonymous ABCA13 3 82640 3.6302E-5 41320 0 4.01294E-6
7-48278897-G-T p.Glu319Asp missense ABCA13 4 82648 4.8398E-5 41324 0 NA
7-48278913-T-C p.Trp325Arg missense ABCA13 2 82654 2.41973E-5 41327 0 8.29848E-6
7-48278916-G-A p.Gly326Ser missense ABCA13 25 82666 3.02422E-4 41333 0 0.001875
7-48278917-G-GCAGC p.His327fs frameshift ABCA13 1 82662 1.20975E-5 41331 0 NA
7-48278919-C-T p.His327Tyr missense ABCA13 2 82658 2.41961E-5 41329 0 2.49041E-5
7-48278921-C-T p.His327His synonymous ABCA13 3 82648 3.62985E-5 41324 0 6.64231E-5
7-48278922-G-A p.Val328Ile missense ABCA13 3 82652 3.62968E-5 41326 0 2.22859E-4
7-48278954-C-T p.Ala338Ala synonymous ABCA13 1 82718 1.20893E-5 41359 0 6.37511E-5
7-48278960-C-T p.Asn340Asn synonymous ABCA13 5 82716 6.04478E-5 41358 0 NA
7-48278988-C-T p.Arg350* stop_gained ABCA13 2 82718 2.41785E-5 41359 0 9.5584E-5
7-48278997-C-CGGTA p.Gln353fs frameshift ABCA13 25 82728 3.02195E-4 41364 0 2.32686E-4
7-48278999-A-G p.Gln353Gln synonymous ABCA13 1 82734 1.20869E-5 41367 0 NA
7-48279000-C-A p.Gln354Lys missense+splice_region ABCA13 1 82726 1.20881E-5 41363 0 1.7304E-5
7-48280464-G-T p.Val355Leu missense+splice_region ABCA13 6 80496 7.45379E-5 40248 0 2.22902E-4
7-48280473-C-T p.Gln358* stop_gained ABCA13 4 80838 4.94817E-5 40419 0 3.82958E-5
7-48280508-C-T p.Leu369Leu synonymous ABCA13 86 82464 0.00104288 41232 1 0.00210164
7-48280512-G-T p.Gly371Cys missense ABCA13 1 82562 1.21121E-5 41281 0 NA
7-48280522-A-G p.His374Arg missense ABCA13 1 82572 1.21106E-5 41286 0 NA
7-48280533-G-C p.Ala378Pro missense ABCA13 17 82554 2.05926E-4 41277 0 5.03525E-4
7-48280543-A-G p.Asn381Ser missense ABCA13 3 82548 3.63425E-5 41274 0 8.29655E-6
7-48280547-G-T p.Gln382His missense ABCA13 4 82522 4.84719E-5 41261 0 6.36618E-5
7-48280549-T-C p.Phe383Ser missense ABCA13 2 82514 2.42383E-5 41257 0 8.04085E-6
7-48280551-G-A p.Glu384Lys missense ABCA13 14 82522 1.69652E-4 41261 0 5.09489E-4
7-48280556-A-G p.Glu385Glu synonymous ABCA13 1 82528 1.21171E-5 41264 0 1.20608E-5
7-48280558-A-C p.Glu386Ala missense ABCA13 35 82534 4.24068E-4 41267 0 0.00105075
7-48280559-G-C p.Glu386Asp missense ABCA13 2 82534 2.42324E-5 41267 0 8.2861E-6
7-48280560-A-G p.Ser387Gly missense ABCA13 1 82530 1.21168E-5 41265 0 NA
7-48280564-A-G p.Lys388Arg missense ABCA13 1 82518 1.21186E-5 41259 0 NA
7-48280593-A-C p.Thr398Pro missense ABCA13 1 82550 1.21139E-5 41275 0 3.1839E-5
7-48280598-A-C p.Ala399Ala synonymous ABCA13 2 82554 2.42266E-5 41277 0 3.1841E-5
7-48280633-G-A p.Gly411Asp missense ABCA13 1 82520 1.21183E-5 41260 0 NA
7-48280649-T-C p.His416His synonymous ABCA13 1 82480 1.21242E-5 41240 0 1.65659E-5
7-48280652-A-G p.Thr417Thr synonymous ABCA13 4 82464 4.8506E-5 41232 0 NA
7-48280659-A-G p.Lys420Glu missense ABCA13 1 82414 1.21339E-5 41207 0 NA
7-48280670-C-T c.*384+7C>T splice_region ABCA13 224 82258 0.00272314 41129 2 0.010625
7-48280671-G-A c.*384+8G>A splice_region ABCA13 1 82262 1.21563E-5 41131 0 8.28789E-6
7-48284168-C-G c.*482-5C>G splice_region ABCA13 692 81742 0.00846566 40871 3 0.00752415
7-48284171-A-G c.*482-2A>G splice_acceptor ABCA13 2 81834 2.44397E-5 40917 0 4.05091E-6
7-48284173-A-AT p.Leu422fs frameshift ABCA13 2 81842 2.44373E-5 40921 0 3.18552E-5
7-48284179-G-A p.Gln423Gln synonymous ABCA13 40 81934 4.88198E-4 40967 1 0.0020141
7-48284184-T-A p.Leu425Gln missense ABCA13 801 81940 0.00977545 40970 21 0.0217156
7-48284185-G-T p.Leu425Leu synonymous ABCA13 3 81974 3.6597E-5 40987 0 8.55915E-6
7-48284199-G-A p.Ser430Asn missense ABCA13 1 82080 1.21832E-5 41040 0 4.02706E-6
7-48284204-C-T p.Leu432Leu synonymous ABCA13 5 82104 6.08984E-5 41052 0 3.1841E-5
7-48284212-C-A p.Asn434Lys missense ABCA13 10 82156 1.2172E-4 41078 0 0.00100705
7-48284213-C-T p.Leu435Leu synonymous ABCA13 1 82152 1.21726E-5 41076 0 NA
7-48284219-C-G p.Gln437Glu missense ABCA13 1 82188 1.21672E-5 41094 0 4.02327E-6
7-48284222-T-A p.Trp438Arg missense ABCA13 3 82208 3.64928E-5 41104 0 3.1841E-5
7-48284226-C-T p.Pro439Leu missense ABCA13 1 82234 1.21604E-5 41117 0 5.83042E-5
7-48284227-G-A p.Pro439Pro synonymous ABCA13 1 82232 1.21607E-5 41116 0 1.66531E-5
7-48284229-C-T p.Ala440Val missense ABCA13 1 82244 1.21589E-5 41122 0 NA
7-48284233-G-GA p.Arg443fs frameshift ABCA13 1 82258 1.21569E-5 41129 0 4.02317E-6
7-48284238-G-T p.Arg443Ile missense ABCA13 1 82286 1.21527E-5 41143 0 8.05082E-6
7-48284247-A-G p.Gln446Arg missense ABCA13 2 82314 2.42972E-5 41157 0 NA
7-48284250-T-C p.Leu447Pro missense ABCA13 3 82322 3.64423E-5 41161 0 NA
7-48284254-T-C p.Asp448Asp synonymous ABCA13 133 82328 0.00161549 41164 0 0.00305655
7-48284271-C-T p.Ala454Val missense ABCA13 1 82352 1.2143E-5 41176 0 NA
7-48284272-G-C p.Ala454Ala synonymous ABCA13 1 82356 1.21424E-5 41178 0 4.06802E-6
7-48284273-A-G p.Ile455Val missense ABCA13 2 82356 2.42848E-5 41178 0 3.18552E-5
7-48284275-A-G p.Ile455Met missense ABCA13 4 82360 4.85673E-5 41180 0 NA
7-48284297-C-G p.Gln463Glu missense ABCA13 1 82414 1.21339E-5 41207 0 NA
7-48285071-ACCTTAGGTGAATAATAATCAATTTGTCTACTTTG-A c.*610-37_*610-4delCCTTAGGTGAATAATAATCAATTTGTCTACTTTG splice_region ABCA13 1 80778 1.23796E-5 40389 0 NA
7-48285114-C-T p.Leu466Phe missense ABCA13 1 81902 1.22097E-5 40951 0 NA
7-48285123-C-T p.Leu469Leu synonymous ABCA13 2 82036 2.43795E-5 41018 0 0.00125
7-48285152-G-T p.Trp478Cys missense ABCA13 1 82186 1.21675E-5 41093 0 NA
7-48285153-T-C p.Phe479Leu missense ABCA13 31 82200 3.77129E-4 41100 0 1.91107E-4
7-48285167-A-G p.Gln483Gln synonymous ABCA13 1094 82212 0.0133071 41106 13 0.0594159
7-48285168-T-C p.Leu484Leu synonymous ABCA13 2 82238 2.43197E-5 41119 0 0.00151057
7-48285182-G-A p.Lys488Lys synonymous ABCA13 1 82250 1.21581E-5 41125 0 NA
7-48285188-G-A p.Val490Val synonymous ABCA13 3 82240 3.64786E-5 41120 0 8.10747E-6
7-48285208-A-G p.Gln497Arg missense+splice_region ABCA13 2 82108 2.43582E-5 41054 0 NA
7-48285215-G-A c.*710+6G>A splice_region ABCA13 1 82004 1.21945E-5 41002 0 NA
7-48285467-C-T p.Ala500Val missense ABCA13 25 82338 3.03627E-4 41169 0 9.55901E-4
7-48285468-G-A p.Ala500Ala synonymous ABCA13 13 82352 1.57859E-4 41176 0 9.5584E-5
7-48285473-A-G p.Asn502Ser missense ABCA13 1 82376 1.21395E-5 41188 0 1.70891E-5
7-48285485-C-T p.Pro506Leu missense ABCA13 32224 81960 0.393167 40980 6471 0.448958
7-48285489-T-C p.Asn507Asn synonymous ABCA13 1 82422 1.21327E-5 41211 0 2.50217E-5
7-48285493-C-A p.Arg509Ser missense ABCA13 2 82436 2.42612E-5 41218 0 NA
7-48285507-G-T p.Lys513Asn missense ABCA13 1 82450 1.21286E-5 41225 0 3.18512E-5
7-48285509-A-G p.Glu514Gly missense ABCA13 3 82452 3.63848E-5 41226 0 NA
7-48285513-C-G p.Val515Val synonymous ABCA13 2 82464 2.4253E-5 41232 0 NA
7-48285519-G-A p.Leu517Leu synonymous ABCA13 1 82438 1.21303E-5 41219 0 3.19366E-5
7-48285521-C-T p.Pro518Leu missense ABCA13 3 82436 3.63919E-5 41218 0 2.81552E-5
7-48285522-G-A p.Pro518Pro synonymous ABCA13 4 82430 4.8526E-5 41215 0 0.00125
7-48285522-G-T p.Pro518Pro synonymous ABCA13 1 82430 1.21315E-5 41215 0 4.02269E-6
7-48285532-T-G p.Ser522Ala missense ABCA13 1 82460 1.21271E-5 41230 0 NA
7-48285550-C-T p.Leu528Phe missense ABCA13 1 82420 1.2133E-5 41210 0 NA
7-48285555-G-A p.Gln529Gln synonymous ABCA13 1 82408 1.21347E-5 41204 0 4.01748E-6
7-48285558-A-G p.Gly530Gly synonymous ABCA13 45 82384 5.46223E-4 41192 0 0.00101969
7-48285560-T-G p.Leu531Arg missense ABCA13 1 82388 1.21377E-5 41194 0 1.674E-5
7-48285583-GA-TT p.Glu539Leu missense ABCA13 2 82332 2.42919E-5 41166 0 NA
7-48285584-A-C p.Glu539Ala missense ABCA13 2 82330 2.42925E-5 41165 0 NA
7-48285585-G-A p.Glu539Glu synonymous ABCA13 2 82316 2.42966E-5 41158 0 4.01845E-6
7-48285587-C-T p.Thr540Met missense ABCA13 2 82286 2.43055E-5 41143 0 3.18674E-5
7-48285591-T-G p.Ser541Arg missense ABCA13 1 82296 1.21513E-5 41148 0 4.01936E-6
7-48285604-C-A p.Leu546Ile missense ABCA13 1 82276 1.21542E-5 41138 0 8.54E-6
7-48285606-A-G p.Leu546Leu synonymous ABCA13 3 82268 3.64662E-5 41134 0 4.42414E-5
7-48285627-T-C p.Ala553Ala splice_region+synonymous ABCA13 2 82148 2.43463E-5 41074 0 NA
7-48285628-G-C c.*878+1G>C splice_donor ABCA13 1 82134 1.21752E-5 41067 0 8.85269E-6
7-48287831-T-C c.*879-5T>C splice_region ABCA13 2 81840 2.44379E-5 40920 0 9.41957E-6
7-48287839-C-T p.Arg555Cys missense ABCA13 1 81934 1.22049E-5 40967 0 NA
7-48287840-G-A p.Arg555His missense ABCA13 11079 81138 0.136545 40569 743 0.17582
7-48287849-A-G p.Gln558Arg missense ABCA13 1 82024 1.21916E-5 41012 0 4.0282E-6
7-48287853-G-A p.Glu559Glu synonymous ABCA13 2 82054 2.43742E-5 41027 0 NA
7-48287857-A-G p.Ile561Val missense ABCA13 15 82074 1.82762E-4 41037 0 6.46635E-4
7-48287861-C-T p.Thr562Ile missense ABCA13 1 82078 1.21835E-5 41039 0 NA
7-48287872-AAT-A p.Met567fs frameshift ABCA13 1 82148 1.21732E-5 41074 0 NA
7-48287897-A-T p.Glu574Val missense ABCA13 2 82226 2.43232E-5 41113 0 4.01732E-6
7-48287902-T-C p.Leu576Leu synonymous ABCA13 1 82250 1.21581E-5 41125 0 5.03525E-4
7-48287911-C-T p.Gln579* stop_gained ABCA13 1 82242 1.21592E-5 41121 0 NA
7-48287914-G-A p.Glu580Lys missense ABCA13 2 82214 2.43268E-5 41107 0 3.3184E-5
7-48287939-C-A p.Ala588Glu missense ABCA13 1 82192 1.21666E-5 41096 0 1.60715E-5
7-48287956-C-T p.Arg594Trp missense ABCA13 14 82220 1.70275E-4 41110 0 9.64343E-5
7-48287969-T-A p.Leu598Gln missense ABCA13 1 82228 1.21613E-5 41114 0 NA
7-48287970-G-A p.Leu598Leu synonymous ABCA13 4 82226 4.86464E-5 41113 0 3.31912E-5
7-48287973-G-A p.Leu599Leu synonymous ABCA13 1 82218 1.21628E-5 41109 0 NA
7-48287988-TC-T p.Pro605fs frameshift ABCA13 2 82140 2.43487E-5 41070 0 NA
7-48287991-T-G p.Pro605Pro synonymous ABCA13 1 82100 1.21803E-5 41050 0 NA
7-48288001-G-A p.Val609Ile missense ABCA13 2 81980 2.43962E-5 40990 0 NA
7-48288002-TC-T p.Ser611fs frameshift ABCA13 1 81974 1.2199E-5 40987 0 NA
7-48288028-C-G p.Leu618Val missense ABCA13 2 81518 2.45345E-5 40759 0 5.04032E-4
7-48288802-A-T c.*1085-7A>T splice_region ABCA13 2 81922 2.44135E-5 40961 0 1.68112E-5
7-48288807-A-G c.*1085-2A>G splice_acceptor ABCA13 1 82040 1.21892E-5 41020 0 NA
7-48288817-A-G p.His625Arg missense ABCA13 1 82186 1.21675E-5 41093 0 2.01732E-5
7-48288820-C-T p.Thr626Ile missense ABCA13 1 82192 1.21666E-5 41096 0 9.5645E-5
7-48288829-A-G p.Lys629Arg missense ABCA13 1 82310 1.21492E-5 41155 0 NA
7-48288831-A-G p.Thr630Ala missense ABCA13 2 82322 2.42948E-5 41161 0 8.06452E-6
7-48288868-C-T p.Ala642Val missense ABCA13 2 82450 2.42571E-5 41225 0 1.66014E-5
7-48288882-A-G p.Ile647Val missense ABCA13 1 82512 1.21194E-5 41256 0 2.48868E-5
7-48288885-A-G p.Arg648Gly missense ABCA13 2 82526 2.42348E-5 41263 0 7.62924E-5
7-48288897-G-A p.Glu652Lys missense ABCA13 420 82516 0.00508992 41258 7 0.0101625
7-48288900-G-A p.Val653Met missense ABCA13 1 82538 1.21156E-5 41269 0 1.65815E-5
7-48288904-C-T p.Ala654Val missense ABCA13 1 82524 1.21177E-5 41262 0 6.37186E-5
7-48288912-G-A p.Val657Ile missense ABCA13 1 82528 1.21171E-5 41264 0 1.6061E-5
7-48288920-G-T p.Met659Ile missense ABCA13 17 82494 2.06076E-4 41247 0 1.16057E-4
7-48288926-G-C p.Glu661Asp missense ABCA13 1 82488 1.2123E-5 41244 0 4.1447E-5
7-48288928-G-A p.Ser662Asn missense ABCA13 1 82474 1.2125E-5 41237 0 NA
7-48288946-T-C p.Leu668Ser missense+splice_region ABCA13 1 82398 1.21362E-5 41199 0 3.21611E-5
7-48308587-G-A p.Glu672Glu synonymous ABCA13 2 78590 2.54485E-5 39295 0 1.24437E-5
7-48308588-G-A p.Glu673Lys missense ABCA13 28 78720 3.55691E-4 39360 0 1.60318E-4
7-48308592-C-T p.Ser674Phe missense ABCA13 11 78996 1.39248E-4 39498 0 1.27885E-4
7-48308598-G-A p.Cys676Tyr missense ABCA13 1 79286 1.26126E-5 39643 0 NA
7-48308598-G-GT p.Glu678fs frameshift ABCA13 1 79288 1.26122E-5 39644 0 NA
7-48308607-A-C p.Glu679Ala missense ABCA13 1 79660 1.25534E-5 39830 0 9.57365E-5
7-48308612-A-G p.Met681Val missense ABCA13 1 79872 1.252E-5 39936 0 6.3804E-5
7-48308659-C-T p.Asn696Asn synonymous ABCA13 1 79486 1.25808E-5 39743 0 5.26793E-5
7-48308659-C-G p.Asn696Lys missense ABCA13 1 79486 1.25808E-5 39743 0 NA
7-48311383-G-A c.*1340-1G>A splice_acceptor ABCA13 2 77516 2.58011E-5 38758 0 NA
7-48311384-G-A p.Arg707Arg splice_region+synonymous ABCA13 1 77550 1.28949E-5 38775 0 7.13674E-5
7-48311386-C-T p.Ala708Val missense+splice_region ABCA13 1 78388 1.27571E-5 39194 0 7.92833E-6
7-48311390-A-C p.Leu709Phe missense ABCA13 2 78796 2.5382E-5 39398 0 7.77532E-6
7-48311405-C-A p.His714Gln missense ABCA13 1 80970 1.23503E-5 40485 0 NA
7-48311412-A-C p.Met717Leu missense ABCA13 1 81428 1.22808E-5 40714 0 6.21157E-6
7-48311415-A-G p.Met718Val missense ABCA13 1 81548 1.22627E-5 40774 0 NA
7-48311417-G-A p.Met718Ile missense ABCA13 1 81592 1.22561E-5 40796 0 3.19366E-5
7-48311432-C-T p.His723His synonymous ABCA13 1 82068 1.2185E-5 41034 0 5.3408E-6
7-48311434-C-T p.Thr724Ile missense ABCA13 2 82176 2.4338E-5 41088 0 NA
7-48311434-C-A p.Thr724Asn missense ABCA13 1 82176 1.2169E-5 41088 0 NA
7-48311436-C-T p.Leu725Phe missense ABCA13 1 82204 1.21649E-5 41102 0 NA
7-48311441-G-A p.Glu726Glu synonymous ABCA13 1 82270 1.21551E-5 41135 0 3.05008E-5
7-48311450-A-G p.Gln729Gln synonymous ABCA13 1 82326 1.21468E-5 41163 0 4.60126E-6
7-48311450-A-T p.Gln729His missense ABCA13 1 82326 1.21468E-5 41163 0 NA
7-48311454-A-C p.Asn731His missense ABCA13 2 82354 2.42854E-5 41177 0 6.97512E-5
7-48311477-A-AT p.Glu741fs frameshift ABCA13 1 82408 1.21347E-5 41204 0 NA
7-48311478-T-G p.Phe739Val missense ABCA13 2 82418 2.42665E-5 41209 0 NA
7-48311481-T-C p.Phe740Leu missense ABCA13 13 82424 1.57721E-4 41212 0 0.00100705
7-48311485-A-C p.Glu741Ala missense ABCA13 146 82420 0.00177141 41210 4 0.00669736
7-48311495-G-A p.Leu744Leu synonymous ABCA13 3 82452 3.63848E-5 41226 0 9.50137E-6
7-48311531-T-C p.Ser756Ser synonymous ABCA13 3 82482 3.63716E-5 41241 0 NA
7-48311533-T-G p.Phe757Cys missense ABCA13 10 82478 1.21244E-4 41239 0 2.4908E-4
7-48311535-C-T p.His758Tyr missense ABCA13 1 82476 1.21247E-5 41238 0 NA
7-48311550-C-A p.Leu763Ile missense ABCA13 1 82454 1.2128E-5 41227 0 NA
7-48311550-C-G p.Leu763Val missense ABCA13 2 82454 2.42559E-5 41227 0 NA
7-48311552-C-T p.Leu763Leu synonymous ABCA13 2 82446 2.42583E-5 41223 0 NA
7-48311563-T-G p.Ile767Ser missense ABCA13 12680 82214 0.154232 41107 993 0.17406
7-48311572-T-C p.Ile770Thr missense ABCA13 13 82456 1.5766E-4 41228 0 1.42252E-4
7-48311584-G-C p.Trp774Ser missense ABCA13 3 82442 3.63892E-5 41221 0 6.37552E-5
7-48311584-G-A p.Trp774* stop_gained ABCA13 1 82442 1.21297E-5 41221 0 NA
7-48311585-G-A p.Trp774* stop_gained ABCA13 3 82420 3.63989E-5 41210 0 0.00125
7-48311587-C-A p.Thr775Lys missense ABCA13 2 82428 2.42636E-5 41214 0 NA
7-48311598-A-C p.Lys779Gln missense ABCA13 18 82404 2.18436E-4 41202 0 0.00302115
7-48311601-A-C p.Ser780Arg missense ABCA13 1 82408 1.21347E-5 41204 0 NA
7-48311602-G-A p.Ser780Asn missense ABCA13 1112 82396 0.0134958 41198 13 0.0579053
7-48311611-G-C p.Arg783Thr missense ABCA13 1 82406 1.2135E-5 41203 0 3.18756E-5
7-48311632-C-T p.Ala790Val missense ABCA13 1 82414 1.21339E-5 41207 0 4.02013E-6
7-48311641-T-G p.Leu793Arg missense ABCA13 10 82444 1.21294E-4 41222 0 5.86921E-4
7-48311641-T-C p.Leu793Pro missense ABCA13 1 82444 1.21294E-5 41222 0 NA
7-48311653-G-A p.Gly797Asp missense ABCA13 3 82464 3.63795E-5 41232 0 2.09055E-4
7-48311657-C-T p.Asn798Asn synonymous ABCA13 1 82464 1.21265E-5 41232 0 4.18186E-5
7-48311658-G-A p.Glu799Lys missense ABCA13 3128 82428 0.0379483 41214 67 0.0475
7-48311658-G-C p.Glu799Gln missense ABCA13 2 82462 2.42536E-5 41231 0 2.50954E-5
7-48311666-T-C p.Ile801Ile synonymous ABCA13 2 82468 2.42518E-5 41234 0 2.01055E-5
7-48311669-GA-G p.Met804fs frameshift ABCA13 1 82464 1.21265E-5 41232 0 8.04272E-6
7-48311670-A-C p.Lys803Gln missense ABCA13 4 82472 4.85013E-5 41236 0 NA
7-48311681-T-G p.Thr806Thr synonymous ABCA13 1 82490 1.21227E-5 41245 0 8.38462E-6
7-48311684-C-T p.Leu807Leu synonymous ABCA13 27 82464 3.27416E-4 41232 0 0.00274165
7-48311685-G-A p.Gly808Arg missense ABCA13 4 82458 4.85095E-5 41229 0 3.18756E-5
7-48311701-G-A p.Arg813Lys missense ABCA13 1 82472 1.21253E-5 41236 0 8.42119E-6
7-48311707-A-G p.Glu815Gly missense ABCA13 2 82466 2.42524E-5 41233 0 3.18471E-5
7-48311710-C-A p.Pro816Gln missense ABCA13 1 82464 1.21265E-5 41232 0 NA
7-48311715-A-C p.Asn818His missense ABCA13 1 82462 1.21268E-5 41231 0 3.18512E-5
7-48311777-G-A p.Trp838* stop_gained ABCA13 1 82298 1.2151E-5 41149 0 8.56384E-6
7-48311790-T-A p.Ser843Thr missense ABCA13 1 82256 1.21572E-5 41128 0 4.06997E-6
7-48311797-G-GA p.Arg847fs frameshift ABCA13 1 82248 1.21584E-5 41124 0 NA
7-48311803-G-T p.Arg847Ile missense ABCA13 79 82228 9.60743E-4 41114 3 0.00193402
7-48311833-T-A p.Leu857* stop_gained ABCA13 14 82126 1.7047E-4 41063 0 0.00125
7-48311836-A-T p.Asn858Ile missense ABCA13 1 82102 1.218E-5 41051 0 NA
7-48311844-G-A p.Val861Ile missense ABCA13 2 82074 2.43683E-5 41037 0 NA
7-48311858-G-A p.Glu865Glu synonymous ABCA13 1 82072 1.21844E-5 41036 0 NA
7-48311868-A-G p.Thr869Ala missense ABCA13 1 82058 1.21865E-5 41029 0 3.1837E-5
7-48311872-G-A p.Ser870Asn missense ABCA13 2 82050 2.43754E-5 41025 0 9.55597E-5
7-48311883-T-C p.Ser874Pro missense ABCA13 1 81980 1.21981E-5 40990 0 NA
7-48311884-C-T p.Ser874Phe missense ABCA13 106 81974 0.00129309 40987 1 0.00235759
7-48311885-C-G p.Ser874Ser synonymous ABCA13 2 81982 2.43956E-5 40991 0 NA
7-48311897-T-C p.His878His synonymous ABCA13 5 81926 6.10307E-5 40963 0 9.12439E-5
7-48311903-T-A p.Asp880Glu missense ABCA13 7 81864 8.55077E-5 40932 0 3.1835E-4
7-48311907-C-T p.Pro882Ser missense ABCA13 14 81818 1.71111E-4 40909 0 9.65111E-5
7-48311915-A-G p.Ser884Ser synonymous ABCA13 16 81800 1.95599E-4 40900 0 3.61981E-4
7-48311916-C-T p.Pro885Ser missense ABCA13 1 81784 1.22273E-5 40892 0 4.02191E-6
7-48311930-A-G p.Ile889Met missense ABCA13 1 81726 1.2236E-5 40863 0 8.28912E-6
7-48311937-G-A p.Val892Ile missense ABCA13 1 81668 1.22447E-5 40834 0 4.02363E-6
7-48311940-C-T p.Arg893Cys missense ABCA13 4 81658 4.89848E-5 40829 0 6.37105E-5
7-48311941-G-A p.Arg893His missense ABCA13 34 81642 4.16452E-4 40821 0 8.28765E-4
7-48311953-C-T p.Ala897Val missense ABCA13 1 81672 1.22441E-5 40836 0 4.02405E-6
7-48311955-A-G p.Ile898Val missense ABCA13 2 81666 2.449E-5 40833 0 8.29036E-6
7-48311958-A-G p.Ile899Val missense ABCA13 1 81710 1.22384E-5 40855 0 3.18552E-5
7-48311969-C-G p.Leu902Leu synonymous ABCA13 5 81716 6.11875E-5 40858 0 1.27445E-4
7-48312006-G-A p.Glu915Lys missense ABCA13 1 82000 1.21951E-5 41000 0 8.29559E-6
7-48312023-C-G p.Val920Val synonymous ABCA13 1 82090 1.21818E-5 41045 0 NA
7-48312026-C-T p.Tyr921Tyr synonymous ABCA13 1 82108 1.21791E-5 41054 0 6.25E-4
7-48312027-G-A p.Ala922Thr missense ABCA13 1208 82084 0.0147166 41042 50 0.0316843
7-48312027-G-T p.Ala922Ser missense ABCA13 1 82104 1.21797E-5 41052 0 NA
7-48312028-C-T p.Ala922Val missense ABCA13 1 82116 1.21779E-5 41058 0 NA
7-48312030-A-C p.Ile923Leu missense ABCA13 1 82118 1.21776E-5 41059 0 8.04233E-6
7-48312039-G-A p.Ala926Thr missense ABCA13 2 82104 2.43593E-5 41052 0 NA
7-48312052-T-C p.Phe930Ser missense ABCA13 1 82082 1.21829E-5 41041 0 1.60884E-5
7-48312056-A-C p.Ser931Ser synonymous ABCA13 8 82074 9.7473E-5 41037 0 0.0020141
7-48312066-G-A p.Glu935Lys missense ABCA13 1 82016 1.21927E-5 41008 0 NA
7-48312084-G-C p.Val941Leu missense ABCA13 4516 81912 0.0551323 40956 143 0.07
7-48312096-T-C p.Leu945Leu synonymous ABCA13 12 81950 1.46431E-4 40975 0 3.18492E-5
7-48312101-T-A p.Thr946Thr synonymous ABCA13 1 81932 1.22052E-5 40966 0 8.3051E-6
7-48312104-C-T p.His947His synonymous ABCA13 1 81950 1.22026E-5 40975 0 2.41392E-5
7-48312105-A-G p.Ile948Val missense ABCA13 2 81942 2.44075E-5 40971 0 8.3062E-6
7-48312109-A-G p.His949Arg missense ABCA13 1 81940 1.22041E-5 40970 0 NA
7-48312111-C-G p.Leu950Val missense ABCA13 1 81906 1.22091E-5 40953 0 NA
7-48312115-A-G p.Asn951Ser missense ABCA13 1 81920 1.2207E-5 40960 0 2.81566E-5
7-48312164-A-G p.Ser967Ser synonymous ABCA13 1 81732 1.22351E-5 40866 0 1.59317E-4
7-48312171-C-T p.Arg970* stop_gained ABCA13 2 81702 2.44792E-5 40851 0 2.50505E-5
7-48312172-G-A p.Arg970Gln missense ABCA13 3 81702 3.67188E-5 40851 0 5.01245E-5
7-48312196-T-G p.Ile978Ser missense ABCA13 1 81568 1.22597E-5 40784 0 8.06712E-6
7-48312200-G-C p.Gln979His missense ABCA13 243 81544 0.00297999 40772 2 0.0119048
7-48312207-G-GGCTCTT p.Ser983_Ser984insCysSer disruptive_inframe_insertion ABCA13 8 81490 9.81716E-5 40745 0 6.36862E-5
7-48312214-C-T p.Ser984Leu missense ABCA13 1 81464 1.22754E-5 40732 0 8.57736E-6
7-48312215-G-A p.Ser984Ser synonymous ABCA13 416 81448 0.00510755 40724 0 0.00956697
7-48312222-T-C p.Phe987Leu missense ABCA13 1 81442 1.22787E-5 40721 0 NA
7-48312230-A-G p.Thr989Thr synonymous ABCA13 1 81396 1.22856E-5 40698 0 NA
7-48312245-C-A p.His994Gln missense ABCA13 2 81318 2.45948E-5 40659 0 3.18471E-5
7-48312246-A-G p.Ile995Val missense ABCA13 5 81324 6.14825E-5 40662 0 NA
7-48312246-A-T p.Ile995Phe missense ABCA13 1 81324 1.22965E-5 40662 0 NA
7-48312252-G-T p.Asp997Tyr missense ABCA13 2 81312 2.45966E-5 40656 0 NA
7-48312252-G-C p.Asp997His missense ABCA13 4 81312 4.91932E-5 40656 0 8.99345E-5
7-48312259-T-C p.Ile999Thr missense ABCA13 1 81428 1.22808E-5 40714 0 2.84722E-5
7-48312260-A-G p.Ile999Met missense ABCA13 18 81434 2.21038E-4 40717 0 1.91071E-4
7-48312262-A-T p.Lys1000Ile missense ABCA13 11 81454 1.35046E-4 40727 0 0.00125
7-48312264-C-T p.Gln1001* stop_gained ABCA13 1 81448 1.22778E-5 40724 0 NA
7-48312268-T-A p.Phe1002Tyr missense ABCA13 1 81484 1.22723E-5 40742 0 3.1841E-5
7-48312291-G-A p.Ala1010Thr missense ABCA13 1 81714 1.22378E-5 40857 0 3.18613E-5
7-48312297-G-A p.Ala1012Thr missense ABCA13 7 81764 8.56122E-5 40882 0 9.69161E-5
7-48312298-C-A p.Ala1012Glu missense ABCA13 3 81774 3.66865E-5 40887 0 3.18634E-5
7-48312321-G-C p.Val1020Leu missense ABCA13 2 82038 2.43789E-5 41019 0 NA
7-48312326-TG-T p.Gly1023fs frameshift ABCA13 2 82074 2.43683E-5 41037 0 NA
7-48312354-C-G p.Gln1031Glu missense ABCA13 3 82212 3.6491E-5 41106 0 6.37064E-5
7-48312360-T-C p.Leu1033Leu synonymous ABCA13 1 82230 1.2161E-5 41115 0 NA
7-48312369-A-G p.Ile1036Val missense ABCA13 3 82234 3.64813E-5 41117 0 1.10884E-5
7-48312392-G-A p.Gln1043Gln synonymous ABCA13 1 82240 1.21595E-5 41120 0 1.13368E-5
7-48312404-CAT-C p.Met1048fs frameshift ABCA13 1 82200 1.21655E-5 41100 0 3.18451E-5
7-48312412-C-T p.Thr1050Ile missense ABCA13 1 82176 1.2169E-5 41088 0 3.39328E-5
7-48312432-G-A p.Val1057Met missense ABCA13 1 82166 1.21705E-5 41083 0 3.1839E-5
7-48312432-G-T p.Val1057Leu missense ABCA13 36 82166 4.38137E-4 41083 1 0.00117122
7-48312445-C-T p.Thr1061Ile missense ABCA13 1 82160 1.21714E-5 41080 0 5.03525E-4
7-48312453-GGCCTCAAACAGCT-G p.Leu1065fs frameshift ABCA13 2 82176 2.4338E-5 41088 0 NA
7-48312454-G-A p.Gly1064Asp missense ABCA13 1 82166 1.21705E-5 41083 0 NA
7-48312456-C-T p.Leu1065Phe missense ABCA13 1 82172 1.21696E-5 41086 0 NA
7-48312461-A-G p.Lys1066Lys synonymous ABCA13 1 82168 1.21702E-5 41084 0 NA
7-48312485-T-C p.Asp1074Asp synonymous ABCA13 3 82186 3.65026E-5 41093 0 NA
7-48312489-C-T p.Arg1076Cys missense ABCA13 1 82202 1.21652E-5 41101 0 2.11439E-5
7-48312490-G-A p.Arg1076His missense ABCA13 1114 82172 0.0135569 41086 13 0.0589124
7-48312498-T-G p.Leu1079Val missense ABCA13 3 82208 3.64928E-5 41104 0 NA
7-48312503-T-C p.Phe1080Phe synonymous ABCA13 2 82226 2.43232E-5 41113 0 2.01203E-5
7-48312504-C-A p.Gln1081Lys missense ABCA13 2 82224 2.43238E-5 41112 0 NA
7-48312514-G-A p.Ser1084Asn missense ABCA13 1 82246 1.21586E-5 41123 0 NA
7-48312517-A-C p.Gln1085Pro missense ABCA13 2 82266 2.43114E-5 41133 0 9.5124E-6
7-48312518-ATTC-A p.Phe1087del conservative_inframe_deletion ABCA13 1 82262 1.21563E-5 41131 0 NA
7-48312543-C-T p.Leu1094Leu synonymous ABCA13 1 82256 1.21572E-5 41128 0 NA
7-48312555-A-G p.Lys1098Glu missense ABCA13 1 82242 1.21592E-5 41121 0 4.03242E-6
7-48312559-G-A p.Cys1099Tyr missense ABCA13 1 82224 1.21619E-5 41112 0 NA
7-48312585-T-C p.Ser1108Pro missense ABCA13 1 82160 1.21714E-5 41080 0 3.40588E-5
7-48312588-TC-T p.Val1110fs frameshift ABCA13 1 82152 1.21726E-5 41076 0 3.18593E-5
7-48312590-C-T c.*2546C>T splice_region ABCA13 37 82136 4.50472E-4 41068 0 4.83438E-4
7-48312591-G-A p.Val1110Ile missense ABCA13 20 82124 2.43534E-4 41062 0 0.00251762
7-48312598-A-G p.Tyr1112Cys missense ABCA13 1 82114 1.21782E-5 41057 0 8.43298E-6
7-48312603-A-G p.Thr1114Ala missense ABCA13 3 82066 3.65559E-5 41033 0 9.55475E-5
7-48312603-A-T p.Thr1114Ser missense ABCA13 1 82066 1.21853E-5 41033 0 NA
7-48312606-AG-A p.Ser1115fs frameshift ABCA13 1 82032 1.21904E-5 41016 0 1.20801E-5
7-48312607-G-C p.Ser1115Thr missense ABCA13 1 82020 1.21921E-5 41010 0 4.02693E-6
7-48312630-C-G p.Pro1123Ala missense ABCA13 1 81878 1.22133E-5 40939 0 3.18573E-5
7-48312637-C-A p.Ala1125Glu missense ABCA13 3 81864 3.66461E-5 40932 0 2.54891E-4
7-48312649-C-T p.Ser1129Leu missense ABCA13 2 81914 2.44159E-5 40957 0 2.23571E-4
7-48312651-A-G p.Asn1130Asp missense ABCA13 2 81916 2.44153E-5 40958 0 NA
7-48312656-C-T p.Leu1131Leu synonymous ABCA13 2 81962 2.44016E-5 40981 0 6.25E-4
7-48312657-T-TCAG p.Ala1133dup conservative_inframe_insertion ABCA13 1 81960 1.22011E-5 40980 0 NA
7-48312660-G-A p.Ala1133Thr missense ABCA13 1 81962 1.22008E-5 40981 0 NA
7-48312674-G-A p.Val1137Val synonymous ABCA13 40940 81756 0.500758 40878 10206 0.538335
7-48312679-A-G p.Asn1139Ser missense ABCA13 1 82084 1.21826E-5 41042 0 4.02198E-6
7-48312679-A-C p.Asn1139Thr missense ABCA13 1 82084 1.21826E-5 41042 0 NA
7-48312703-C-T p.Thr1147Ile missense ABCA13 2 82200 2.43309E-5 41100 0 4.01978E-6
7-48312704-C-T p.Thr1147Thr synonymous ABCA13 1 82196 1.2166E-5 41098 0 6.64033E-5
7-48312705-G-A p.Val1148Ile missense ABCA13 1 82200 1.21655E-5 41100 0 5.03525E-4
7-48312708-T-C p.Ser1149Pro missense ABCA13 2 82202 2.43303E-5 41101 0 4.01936E-6
7-48312711-T-C p.Trp1150Arg missense ABCA13 1 82218 1.21628E-5 41109 0 4.01913E-6
7-48312723-T-G p.Trp1154Gly missense ABCA13 121 82210 0.00147184 41105 0 0.00215825
7-48312723-T-C p.Trp1154Arg missense ABCA13 1 82212 1.21637E-5 41106 0 1.60769E-5
7-48312735-T-C p.Trp1158Arg missense ABCA13 2 82180 2.43368E-5 41090 0 NA
7-48312743-C-G p.Thr1160Thr synonymous ABCA13 2 82168 2.43404E-5 41084 0 NA
7-48312752-A-G p.Gln1163Gln synonymous ABCA13 14 82170 1.70378E-4 41085 0 2.22987E-4
7-48312770-GA-G p.Asn1170fs frameshift ABCA13 2 82126 2.43528E-5 41063 0 2.49256E-5
7-48312771-A-T p.Asn1170Tyr missense ABCA13 3 82112 3.65355E-5 41056 0 3.18492E-5
7-48312774-G-A p.Val1171Ile missense ABCA13 2 82100 2.43605E-5 41050 0 NA
7-48312783-T-G p.Ser1174Ala missense ABCA13 1 82124 1.21767E-5 41062 0 NA
7-48312796-G-A p.Gly1178Asp missense ABCA13 1 82168 1.21702E-5 41084 0 5.03525E-4
7-48312819-T-C p.Leu1186Leu synonymous ABCA13 5 82178 6.08435E-5 41089 0 5.04032E-4
7-48312819-T-A p.Leu1186Met missense ABCA13 1 82178 1.21687E-5 41089 0 4.02126E-6
7-48312820-T-A p.Leu1186* stop_gained ABCA13 3 82178 3.65061E-5 41089 0 1.60871E-5
7-48312823-A-C p.Glu1187Ala missense ABCA13 1 82152 1.21726E-5 41076 0 2.01081E-5
7-48312837-G-A p.Val1192Ile missense ABCA13 9 82156 1.09548E-4 41078 0 1.27405E-4
7-48312851-C-T p.Cys1196Cys synonymous ABCA13 1 82040 1.21892E-5 41020 0 NA
7-48312855-G-T p.Gly1198Cys missense ABCA13 1 82002 1.21948E-5 41001 0 NA
7-48312860-A-G p.Ile1199Met missense ABCA13 2 81978 2.43968E-5 40989 0 1.66867E-5
7-48312871-A-G p.His1203Arg missense ABCA13 1 81884 1.22124E-5 40942 0 8.3492E-6
7-48312888-A-G p.Ile1209Val missense ABCA13 5 81696 6.12025E-5 40848 0 6.85523E-5
7-48312907-A-G p.Asn1215Ser missense ABCA13 1 81644 1.22483E-5 40822 0 NA
7-48312911-A-G p.Val1216Val synonymous ABCA13 1 81616 1.22525E-5 40808 0 4.0333E-6
7-48312915-C-G p.Gln1218Glu missense ABCA13 2 81614 2.45056E-5 40807 0 8.08636E-6
7-48312915-C-A p.Gln1218Lys missense ABCA13 1 81616 1.22525E-5 40808 0 5.04032E-4
7-48312918-G-A p.Ala1219Thr missense ABCA13 1 81656 1.22465E-5 40828 0 NA
7-48312922-A-G p.Asn1220Ser missense ABCA13 2 81700 2.44798E-5 40850 0 8.38068E-6
7-48312923-TG-T p.Asp1221fs frameshift ABCA13 23 81712 2.81476E-4 40856 0 5.09619E-4
7-48312939-G-A p.Glu1226Lys missense ABCA13 2 81758 2.44624E-5 40879 0 8.05575E-6
7-48312969-G-A p.Val1236Ile missense ABCA13 9 81702 1.10156E-4 40851 0 1.27584E-4
7-48312983-T-C p.Asn1240Asn synonymous ABCA13 1 81654 1.22468E-5 40827 0 8.06413E-6
7-48312986-A-T p.Ala1241Ala synonymous ABCA13 1 81626 1.2251E-5 40813 0 NA
7-48312990-G-A p.Val1243Ile missense ABCA13 3 81574 3.67764E-5 40787 0 9.55657E-5
7-48312997-T-TA p.Leu1248fs frameshift ABCA13 1 81500 1.22699E-5 40750 0 NA
7-48312999-A-G p.Lys1246Glu missense ABCA13 3 81468 3.68243E-5 40734 0 1.74605E-5
7-48313000-A-G p.Lys1246Arg missense ABCA13 38 81462 4.66475E-4 40731 0 4.68452E-4
7-48313003-A-T p.Lys1247Ile missense ABCA13 25 81436 3.0699E-4 40718 0 5.73504E-4
7-48313005-C-G p.Leu1248Val missense ABCA13 1 81420 1.2282E-5 40710 0 3.18674E-5
7-48313020-G-A p.Val1253Met missense ABCA13 1 81180 1.23183E-5 40590 0 3.63418E-5
7-48313022-G-C p.Val1253Val synonymous ABCA13 1 81130 1.23259E-5 40565 0 4.05337E-6
7-48313025-G-C p.Glu1254Asp missense ABCA13 1 81060 1.23365E-5 40530 0 NA
7-48313033-T-A p.Leu1257His missense ABCA13 3 80968 3.70517E-5 40484 0 3.18756E-5
7-48313045-AA-TT p.Glu1261Val missense ABCA13 1 80870 1.23655E-5 40435 0 NA
7-48313053-C-A p.Leu1264Met missense ABCA13 1 80848 1.23689E-5 40424 0 NA
7-48313070-A-G p.Thr1269Thr synonymous ABCA13 3 80968 3.70517E-5 40484 0 NA
7-48313084-A-G p.Glu1274Gly missense ABCA13 4 81100 4.93218E-5 40550 0 7.30873E-4
7-48313084-A-C p.Glu1274Ala missense ABCA13 3 81100 3.69914E-5 40550 0 1.30629E-5
7-48313091-A-C p.Thr1276Thr synonymous ABCA13 1800 81200 0.0221675 40600 81 0.0422378
7-48313098-G-T p.Glu1279* stop_gained ABCA13 1 81302 1.22998E-5 40651 0 NA
7-48313105-T-A p.Leu1281* stop_gained ABCA13 6 81412 7.36992E-5 40706 0 1.81932E-4
7-48313119-G-A p.Glu1286Lys missense ABCA13 1 81588 1.22567E-5 40794 0 1.95626E-5
7-48313126-T-C p.Phe1288Ser missense ABCA13 2 81654 2.44936E-5 40827 0 3.75629E-5
7-48313129-T-C p.Ile1289Thr missense ABCA13 2 81694 2.44816E-5 40847 0 3.18573E-5
7-48313138-G-A p.Ser1292Asn missense ABCA13 1 81748 1.22327E-5 40874 0 NA
7-48313139-C-T p.Ser1292Ser synonymous ABCA13 1 81746 1.2233E-5 40873 0 5.03875E-6
7-48313144-C-T p.Thr1294Ile missense ABCA13 1 81766 1.223E-5 40883 0 9.56145E-5
7-48313155-A-G p.Ile1298Val missense ABCA13 1811 81794 0.022141 40897 81 0.0422616
7-48313156-T-C p.Ile1298Thr missense ABCA13 2 81828 2.44415E-5 40914 0 5.06088E-6
7-48313157-A-G p.Ile1298Met missense ABCA13 2 81822 2.44433E-5 40911 0 1.51243E-5
7-48313167-C-T p.Leu1302Leu synonymous ABCA13 12 81808 1.46685E-4 40904 0 5.04541E-4
7-48313180-A-G p.Asn1306Ser missense ABCA13 1 81756 1.22315E-5 40878 0 NA
7-48313193-AAAT-A p.Asn1312del conservative_inframe_deletion ABCA13 2 81662 2.44912E-5 40831 0 3.18552E-5
7-48313210-A-G p.Tyr1316Cys missense ABCA13 2 81468 2.45495E-5 40734 0 4.42466E-6
7-48313213-G-A p.Gly1317Glu missense ABCA13 2 81402 2.45694E-5 40701 0 NA
7-48313231-T-A p.Ile1323Asn missense ABCA13 1 81164 1.23207E-5 40582 0 NA
7-48313244-A-G p.Leu1327Leu synonymous ABCA13 5 81052 6.16888E-5 40526 0 3.18512E-5
7-48313256-A-G p.Ile1331Met missense ABCA13 1103 81026 0.0136129 40513 13 0.0589124
7-48313274-A-G p.Val1337Val synonymous ABCA13 15 81170 1.84797E-4 40585 0 0.00100705
7-48313279-A-T p.His1339Leu missense ABCA13 1 81202 1.2315E-5 40601 0 3.18451E-5
7-48313284-C-T p.Arg1341* stop_gained ABCA13 2 81222 2.46239E-5 40611 0 6.30549E-5
7-48313285-G-A p.Arg1341Gln missense ABCA13 1 81250 1.23077E-5 40625 0 1.22609E-5
7-48313302-G-C p.Ala1347Pro missense ABCA13 2 81576 2.4517E-5 40788 0 3.18593E-5
7-48313303-CTGA-C p.Asp1348del conservative_inframe_deletion ABCA13 1 81594 1.22558E-5 40797 0 NA
7-48313320-G-C p.Val1353Leu missense ABCA13 1 81878 1.22133E-5 40939 0 NA
7-48313330-G-A p.Cys1356Tyr missense ABCA13 33 81998 4.02449E-4 40999 0 4.55818E-4
7-48313341-G-A p.Asp1360Asn missense ABCA13 115 82150 0.00139988 41075 0 0.00152973
7-48313341-G-C p.Asp1360His missense ABCA13 1 82156 1.2172E-5 41078 0 1.05157E-5
7-48313342-A-T p.Asp1360Val missense ABCA13 1 82172 1.21696E-5 41086 0 4.10769E-6
7-48313362-A-G p.Thr1367Ala missense ABCA13 1 82342 1.21445E-5 41171 0 NA
7-48313362-A-T p.Thr1367Ser missense ABCA13 1 82342 1.21445E-5 41171 0 NA
7-48313374-A-C p.Met1371Leu missense ABCA13 1 82398 1.21362E-5 41199 0 3.18532E-5
7-48313379-A-T p.Leu1372Phe missense ABCA13 3 82416 3.64007E-5 41208 0 9.91552E-5
7-48313380-C-T p.Arg1373Cys missense ABCA13 3 82416 3.64007E-5 41208 0 3.18634E-5
7-48313381-G-T p.Arg1373Leu missense ABCA13 5 82428 6.0659E-5 41214 0 4.14092E-4
7-48313381-G-A p.Arg1373His missense ABCA13 9 82428 1.09186E-4 41214 0 1.59266E-4
7-48313390-A-G p.Asp1376Gly missense ABCA13 1 82420 1.2133E-5 41210 0 NA
7-48313393-C-T p.Thr1377Met missense ABCA13 12 82432 1.45575E-4 41216 0 8.16073E-5
7-48313407-T-C p.Phe1382Leu missense ABCA13 1 82434 1.21309E-5 41217 0 4.06808E-6
7-48313418-G-A p.Glu1385Glu synonymous ABCA13 2 82458 2.42548E-5 41229 0 4.06342E-6
7-48313427-TAGC-T p.Ser1390del disruptive_inframe_deletion ABCA13 12 82454 1.45536E-4 41227 0 2.54826E-4
7-48313429-G-A p.Ser1389Asn missense ABCA13 2 82442 2.42595E-5 41221 0 NA
7-48313451-A-G p.Val1396Val synonymous ABCA13 1 82458 1.21274E-5 41229 0 NA
7-48313481-G-C p.Leu1406Phe missense ABCA13 2 82438 2.42607E-5 41219 0 4.04217E-6
7-48313484-G-A p.Leu1407Leu synonymous ABCA13 1 82424 1.21324E-5 41212 0 2.42546E-5
7-48313492-C-A p.Ser1410Tyr missense ABCA13 1 82424 1.21324E-5 41212 0 NA
7-48313504-A-C p.Gln1414Pro missense ABCA13 1 82416 1.21336E-5 41208 0 NA
7-48313509-C-T p.His1416Tyr missense ABCA13 10 82416 1.21336E-4 41208 0 6.25E-4
7-48313510-A-G p.His1416Arg missense ABCA13 25799 82182 0.313925 41091 4230 0.353831
7-48313516-A-C p.Gln1418Pro missense ABCA13 1 82436 1.21306E-5 41218 0 NA
7-48313520-T-C p.Asn1419Asn synonymous ABCA13 3 82442 3.63892E-5 41221 0 8.56238E-6
7-48313534-T-C p.Phe1424Ser missense ABCA13 1 82430 1.21315E-5 41215 0 NA
7-48313548-A-G p.Asn1429Asp missense ABCA13 3 82424 3.63972E-5 41212 0 NA
7-48313563-A-G p.Ile1434Val missense ABCA13 1109 82398 0.0134591 41199 13 0.0579637
7-48313575-G-GT p.Thr1439fs frameshift ABCA13 1 82380 1.21389E-5 41190 0 NA
7-48313578-A-G p.Thr1439Ala missense ABCA13 2 82388 2.42754E-5 41194 0 8.11939E-6
7-48313594-TA-T p.Lys1446fs frameshift ABCA13 6 82360 7.28509E-5 41180 0 3.1904E-5
7-48313599-A-AGCCATCTTCT p.Lys1446fs frameshift ABCA13 1 82364 1.21412E-5 41182 0 NA
7-48313600-A-T p.Lys1446Ile missense ABCA13 4 82358 4.85684E-5 41179 0 4.06474E-6
7-48313601-A-C p.Lys1446Asn missense ABCA13 1 82354 1.21427E-5 41177 0 8.52079E-6
7-48313605-CTT-C p.Cys1449fs frameshift ABCA13 2 82356 2.42848E-5 41178 0 4.06431E-6
7-48313617-A-G p.Asn1452Asp missense ABCA13 4 82322 4.85897E-5 41161 0 1.62153E-5
7-48313635-T-A p.Cys1458Ser missense ABCA13 1 82280 1.21536E-5 41140 0 8.61237E-6
7-48313638-G-T p.Val1459Phe missense ABCA13 1 82280 1.21536E-5 41140 0 NA
7-48313650-T-C p.Leu1463Leu synonymous ABCA13 2 82222 2.43244E-5 41111 0 1.74929E-5
7-48313652-G-C p.Leu1463Phe missense ABCA13 1 82226 1.21616E-5 41113 0 1.75193E-5
7-48313682-A-G p.Val1473Val synonymous ABCA13 1 82144 1.21737E-5 41072 0 4.10324E-6
7-48313689-A-G p.Thr1476Ala missense ABCA13 6 82140 7.3046E-5 41070 0 9.11195E-6
7-48313692-G-A p.Val1477Ile missense ABCA13 2 82128 2.43522E-5 41064 0 3.18776E-5
7-48313698-G-A p.Glu1479Lys missense ABCA13 2 82098 2.43611E-5 41049 0 NA
7-48313757-G-A p.Lys1498Lys synonymous ABCA13 6072 82078 0.0739784 41039 241 0.102823
7-48313758-C-T p.Gln1499* stop_gained ABCA13 1 82176 1.2169E-5 41088 0 9.2785E-6
7-48313768-T-A p.Met1502Lys missense ABCA13 6 82174 7.30158E-5 41087 0 2.94475E-4
7-48313771-G-A p.Ser1503Asn missense ABCA13 1 82176 1.2169E-5 41088 0 3.18634E-5
7-48313775-C-G p.Ile1504Met missense ABCA13 3 82182 3.65043E-5 41091 0 3.18674E-5
7-48313778-C-T p.Asn1505Asn synonymous ABCA13 13 82202 1.58147E-4 41101 0 2.23044E-4
7-48313779-A-C p.Asn1506His missense ABCA13 2 82208 2.43285E-5 41104 0 NA
7-48313780-A-G p.Asn1506Ser missense ABCA13 1 82206 1.21646E-5 41103 0 4.07402E-6
7-48313786-C-A p.Thr1508Lys missense ABCA13 6 82234 7.29625E-5 41117 0 1.27486E-4
7-48313788-A-G p.Thr1509Ala missense ABCA13 1 82226 1.21616E-5 41113 0 4.0627E-6
7-48313789-C-A p.Thr1509Lys missense ABCA13 1 82218 1.21628E-5 41109 0 3.18654E-5
7-48313804-C-T p.Ala1514Val missense ABCA13 4 82204 4.86594E-5 41102 0 7.25401E-4
7-48313809-C-G p.Gln1516Glu missense ABCA13 1 82220 1.21625E-5 41110 0 NA
7-48313814-C-T p.Ser1517Ser synonymous ABCA13 1 82216 1.21631E-5 41108 0 NA
7-48313816-A-G p.Asn1518Ser missense ABCA13 1 82220 1.21625E-5 41110 0 8.78009E-6
7-48313825-AT-A p.Phe1522fs frameshift ABCA13 1 82206 1.21646E-5 41103 0 NA
7-48313833-G-A p.Glu1524Lys missense ABCA13 2 82230 2.4322E-5 41115 0 NA
7-48313846-G-C p.Arg1528Thr missense ABCA13 2 82214 2.43268E-5 41107 0 NA
7-48313848-C-G p.Pro1529Ala missense ABCA13 1 82230 1.2161E-5 41115 0 2.5572E-5
7-48313850-A-G p.Pro1529Pro synonymous ABCA13 2 82234 2.43208E-5 41117 0 NA
7-48313852-T-A p.Ile1530Lys missense ABCA13 1 82230 1.2161E-5 41115 0 NA
7-48313854-G-A p.Glu1531Lys missense ABCA13 119 82226 0.00144723 41113 0 0.00121035
7-48313859-G-A p.Met1532Ile missense ABCA13 4 82246 4.86346E-5 41123 0 3.18613E-5
7-48313881-T-C p.Phe1540Leu missense ABCA13 6142 82204 0.0747166 41102 248 0.10423
7-48313885-A-G p.Gln1541Arg missense ABCA13 1 82290 1.21521E-5 41145 0 NA
7-48313893-T-C p.Trp1544Arg missense ABCA13 1 82330 1.21462E-5 41165 0 8.05873E-5
7-48313895-G-A p.Trp1544* stop_gained ABCA13 1 82326 1.21468E-5 41163 0 3.34661E-5
7-48313898-T-C p.Leu1545Leu synonymous ABCA13 2 82338 2.42901E-5 41169 0 3.18492E-5
7-48313901-T-C p.His1546His synonymous ABCA13 2 82362 2.4283E-5 41181 0 3.1841E-5
7-48313909-C-T p.Thr1549Ile missense ABCA13 1 82384 1.21383E-5 41192 0 NA
7-48313912-T-A p.Leu1550Gln missense ABCA13 1 82394 1.21368E-5 41197 0 NA
7-48313919-G-T p.Lys1552Asn missense ABCA13 1 82418 1.21333E-5 41209 0 1.61151E-5
7-48313927-A-G p.Gln1555Arg missense ABCA13 7 82420 8.49308E-5 41210 0 3.1839E-4
7-48313942-G-T p.Gly1560Val missense ABCA13 2 82418 2.42665E-5 41209 0 8.0588E-6
7-48313949-C-T p.Tyr1562Tyr synonymous ABCA13 9014 82252 0.10959 41126 532 0.128689
7-48313950-T-G p.Phe1563Val missense ABCA13 4 82428 4.85272E-5 41214 0 NA
7-48313993-T-A p.Leu1577* stop_gained ABCA13 1 82354 1.21427E-5 41177 0 NA
7-48313997-A-T p.Leu1578Phe missense ABCA13 1 82342 1.21445E-5 41171 0 NA
7-48313998-A-G p.Asn1579Asp missense ABCA13 1 82342 1.21445E-5 41171 0 6.66433E-5
7-48314003-AT-A p.Phe1581fs frameshift ABCA13 1 82300 1.21507E-5 41150 0 NA
7-48314006-T-G p.Phe1581Leu missense ABCA13 3 82322 3.64423E-5 41161 0 NA
7-48314008-C-T p.Ala1582Val missense ABCA13 1 82306 1.21498E-5 41153 0 NA
7-48314014-G-C p.Ser1584Thr missense ABCA13 1 82286 1.21527E-5 41143 0 6.3678E-5
7-48314027-G-A p.Lys1588Lys synonymous ABCA13 1 82276 1.21542E-5 41138 0 0.00100705
7-48314030-T-G p.Asp1589Glu missense ABCA13 1 82240 1.21595E-5 41120 0 8.312E-6
7-48314037-A-G p.Ser1592Gly missense ABCA13 2 82190 2.43339E-5 41095 0 NA
7-48314041-T-C p.Val1593Ala missense ABCA13 1 82158 1.21717E-5 41079 0 8.30579E-6
7-48314050-C-T p.Ser1596Phe missense ABCA13 2 82086 2.43647E-5 41043 0 8.30634E-6
7-48314050-C-G p.Ser1596Cys missense ABCA13 1 82086 1.21823E-5 41043 0 3.18492E-5
7-48314053-T-TCTGACATTTCTA p.Ile1597_Tyr1598insTerHisPheTyr stop_gained ABCA13 1 82052 1.21874E-5 41026 0 NA
7-48314065-C-A p.Ala1601Asp missense ABCA13 1 81866 1.22151E-5 40933 0 8.30551E-6
7-48314078-C-T p.Ala1605Ala synonymous ABCA13 1 81686 1.2242E-5 40843 0 4.02453E-6
7-48314089-C-G p.Ser1609Cys missense ABCA13 2 81386 2.45743E-5 40693 0 NA
7-48314092-A-C p.His1610Pro missense ABCA13 2 81244 2.46172E-5 40622 0 8.30537E-6
7-48314096-C-A p.Asp1611Glu missense ABCA13 1 80910 1.23594E-5 40455 0 2.0133E-5
7-48314109-C-T p.Pro1616Ser missense ABCA13 14 79822 1.7539E-4 39911 0 3.65491E-4
7-48314114-A-T p.Lys1617Asn missense ABCA13 3 79454 3.77577E-5 39727 0 8.30537E-6
7-48314133-A-T p.Ile1624Leu missense ABCA13 4 79112 5.05612E-5 39556 0 6.63967E-5
7-48314143-C-T p.Ala1627Val missense ABCA13 1 79114 1.264E-5 39557 0 0.00125
7-48314151-C-G p.Leu1630Val missense ABCA13 490 79106 0.00619422 39553 1 0.006875
7-48314158-T-G p.Ile1632Ser missense ABCA13 1 79208 1.2625E-5 39604 0 NA
7-48314160-C-A p.Gln1633Lys missense ABCA13 1 79214 1.2624E-5 39607 0 2.01522E-5
7-48314170-G-A p.Arg1636Lys missense ABCA13 1 79602 1.25625E-5 39801 0 6.37064E-5
7-48314171-G-A p.Arg1636Arg synonymous ABCA13 3 79620 3.7679E-5 39810 0 8.05685E-6
7-48314200-T-C p.Val1646Ala missense ABCA13 2 81410 2.4567E-5 40705 0 NA
7-48314209-C-G p.Thr1649Ser missense ABCA13 1 81610 1.22534E-5 40805 0 NA
7-48314212-G-T p.Ser1650Ile missense ABCA13 2 81664 2.44906E-5 40832 0 NA
7-48314227-G-C p.Gly1655Ala missense ABCA13 2 81916 2.44153E-5 40958 0 1.65653E-5
7-48314227-G-A p.Gly1655Asp missense ABCA13 1 81916 1.22076E-5 40958 0 4.01916E-6
7-48314232-A-G p.Met1657Val missense ABCA13 2 82000 2.43902E-5 41000 0 4.018E-6
7-48314248-A-C p.Lys1662Thr missense ABCA13 1 82190 1.21669E-5 41095 0 NA
7-48314258-T-A p.Ser1665Ser synonymous ABCA13 1 82300 1.21507E-5 41150 0 NA
7-48314266-G-A p.Arg1668His missense ABCA13 4 82354 4.85708E-5 41177 0 9.93772E-5
7-48314279-G-A p.Lys1672Lys synonymous ABCA13 12651 82214 0.153879 41107 987 0.173789
7-48314284-A-G p.Asp1674Gly missense ABCA13 1 82452 1.21283E-5 41226 0 NA
7-48314286-A-G p.Ile1675Val missense ABCA13 1 82456 1.21277E-5 41228 0 8.28116E-6
7-48314287-T-C p.Ile1675Thr missense ABCA13 1 82454 1.2128E-5 41227 0 8.02781E-6
7-48314291-C-T p.Asp1676Asp synonymous ABCA13 1 82458 1.21274E-5 41229 0 NA
7-48314298-G-A p.Val1679Met missense ABCA13 12 82498 1.45458E-4 41249 0 9.93838E-5
7-48314301-G-A p.Asp1680Asn missense ABCA13 1 82500 1.21212E-5 41250 0 NA
7-48314302-A-G p.Asp1680Gly missense ABCA13 3 82504 3.63619E-5 41252 0 1.20403E-5
7-48314303-T-C p.Asp1680Asp synonymous ABCA13 1 82506 1.21203E-5 41253 0 8.28226E-6
7-48314309-T-C p.Leu1682Leu synonymous ABCA13 1 82528 1.21171E-5 41264 0 NA
7-48314318-T-C p.Val1685Val synonymous ABCA13 1 82558 1.21127E-5 41279 0 1.20383E-5
7-48314330-A-G p.Leu1689Leu synonymous ABCA13 1117 82596 0.0135237 41298 13 0.0599194
7-48314347-A-G p.Asn1695Ser missense ABCA13 4 82630 4.84086E-5 41315 0 3.1835E-5
7-48314355-A-T p.Ser1698Cys missense ABCA13 5 82656 6.04917E-5 41328 0 9.55231E-5
7-48314356-G-C p.Ser1698Thr missense ABCA13 2 82670 2.41926E-5 41335 0 8.42649E-5
7-48314359-T-C p.Val1699Ala missense ABCA13 1 82660 1.20978E-5 41330 0 8.28391E-6
7-48314383-A-G p.Asn1707Ser missense ABCA13 1 82710 1.20904E-5 41355 0 2.40738E-5
7-48314389-T-C p.Leu1709Pro missense ABCA13 141 82724 0.00170446 41362 0 0.00353571
7-48314403-G-T p.Glu1714* stop_gained ABCA13 1 82728 1.20878E-5 41364 0 8.02542E-6
7-48314412-GCAGACAGCTCA-G p.Asp1718fs frameshift ABCA13 1 82714 1.20899E-5 41357 0 NA
7-48314436-G-A p.Val1725Ile missense ABCA13 1 82674 1.20957E-5 41337 0 8.28459E-6
7-48314460-C-T p.Arg1733Cys missense ABCA13 9 82612 1.08943E-4 41306 0 9.94266E-5
7-48314462-C-T p.Arg1733Arg synonymous ABCA13 2 82604 2.42119E-5 41302 0 2.48562E-5
7-48314466-T-C p.Phe1735Leu missense ABCA13 1 82588 1.21083E-5 41294 0 8.02555E-6
7-48314476-ATGT-A p.Val1740del disruptive_inframe_deletion ABCA13 1 82554 1.21133E-5 41277 0 NA
7-48314482-T-C p.Val1740Ala missense ABCA13 1 82552 1.21136E-5 41276 0 NA
7-48314529-C-CTCCT p.Gln1758fs frameshift ABCA13 1 82600 1.21065E-5 41300 0 NA
7-48314532-C-T p.Leu1757Leu synonymous ABCA13 8 82586 9.68687E-5 41293 0 9.55475E-5
7-48314534-G-T p.Leu1757Leu synonymous ABCA13 1 82592 1.21077E-5 41296 0 NA
7-48314549-T-C p.Gly1762Gly synonymous ABCA13 1 82594 1.21074E-5 41297 0 NA
7-48314550-A-G p.Lys1763Glu missense ABCA13 1 82596 1.21071E-5 41298 0 8.29022E-6
7-48314561-T-C p.Thr1766Thr synonymous ABCA13 1 82612 1.21048E-5 41306 0 8.29119E-6
7-48314578-TCTACAGCTTCACA-T p.Tyr1773fs frameshift ABCA13 1 82606 1.21057E-5 41303 0 3.21177E-5
7-48314582-C-T p.Tyr1773Tyr synonymous ABCA13 1 82606 1.21057E-5 41303 0 4.01487E-6
7-48314584-G-C p.Ser1774Thr missense ABCA13 1 82618 1.21039E-5 41309 0 NA
7-48314591-A-C p.Thr1776Thr synonymous ABCA13 2 82610 2.42101E-5 41305 0 2.49087E-5
7-48314592-C-T p.Leu1777Phe missense ABCA13 10 82616 1.21042E-4 41308 0 5.03525E-4
7-48314593-T-G p.Leu1777Arg missense ABCA13 1 82614 1.21045E-5 41307 0 NA
7-48314604-A-T p.Ile1781Leu missense ABCA13 2 82578 2.42195E-5 41289 0 8.32113E-6
7-48314612-T-C p.Ile1783Ile synonymous ABCA13 1 82556 1.2113E-5 41278 0 1.66856E-5
7-48314621-C-T p.Ile1786Ile synonymous ABCA13 1 82482 1.21239E-5 41241 0 8.37802E-6
7-48314636-C-A p.Phe1791Leu missense ABCA13 1 82442 1.21297E-5 41221 0 3.38501E-5
7-48314636-C-T p.Phe1791Phe synonymous ABCA13 1 82442 1.21297E-5 41221 0 4.23126E-5
7-48314637-G-A p.Ala1792Thr missense ABCA13 1 82414 1.21339E-5 41207 0 6.37064E-5
7-48314658-T-C p.Leu1799Leu synonymous ABCA13 1 82294 1.21516E-5 41147 0 1.61803E-5
7-48314659-TG-T p.Asp1800fs frameshift ABCA13 1 82292 1.21518E-5 41146 0 NA
7-48314667-A-G p.Ile1802Val missense ABCA13 4 82260 4.86263E-5 41130 0 8.54993E-6
7-48314670-G-A p.Glu1803Lys missense ABCA13 3 82256 3.64715E-5 41128 0 8.55945E-6
7-48314672-A-G p.Glu1803Glu synonymous ABCA13 1 82252 1.21578E-5 41126 0 NA
7-48314676-G-A p.Val1805Ile missense ABCA13 1 82254 1.21575E-5 41127 0 1.21635E-5
7-48314678-A-G p.Val1805Val synonymous ABCA13 1 82256 1.21572E-5 41128 0 6.3674E-5
7-48314679-T-A p.Ser1806Thr missense ABCA13 2 82242 2.43185E-5 41121 0 3.42747E-5
7-48314687-G-A p.Lys1808Lys synonymous ABCA13 1 82194 1.21663E-5 41097 0 3.43247E-5
7-48314694-A-G p.Ile1811Val missense ABCA13 1 82268 1.21554E-5 41134 0 8.10038E-6
7-48314702-A-T p.Ser1813Ser synonymous ABCA13 10 82308 1.21495E-4 41154 0 7.71182E-5
7-48314707-C-T p.Ala1815Val missense ABCA13 1 82296 1.21513E-5 41148 0 NA
7-48314708-T-A p.Ala1815Ala synonymous ABCA13 1 82308 1.21495E-5 41154 0 8.55769E-6
7-48314718-TTTCCTGTG-T p.Phe1819fs frameshift ABCA13 1 82370 1.21403E-5 41185 0 4.02937E-6
7-48314732-G-T p.Trp1823Cys missense ABCA13 4 82418 4.85331E-5 41209 1 NA
7-48314733-T-C p.Cys1824Arg missense ABCA13 1 82426 1.21321E-5 41213 0 8.44181E-6
7-48314736-T-C p.Trp1825Arg missense ABCA13 1 82434 1.21309E-5 41217 0 4.01936E-6
7-48314760-C-T p.Arg1833Trp missense ABCA13 15 82492 1.81836E-4 41246 0 5.03525E-4
7-48314761-G-A p.Arg1833Gln missense ABCA13 6 82486 7.27396E-5 41243 0 4.16889E-5
7-48314775-A-G p.Ile1838Val missense ABCA13 7 82508 8.48403E-5 41254 0 1.49708E-4
7-48314798-G-T p.Gly1845Gly synonymous ABCA13 26914 82156 0.327596 41078 4513 0.341875
7-48314809-C-A p.Ser1849Tyr missense ABCA13 1 82376 1.21395E-5 41188 0 8.03284E-6
7-48314819-T-G p.Tyr1852* stop_gained ABCA13 1 82326 1.21468E-5 41163 0 8.29655E-6
7-48314834-T-C p.Ser1857Ser synonymous ABCA13 1 82230 1.2161E-5 41115 0 8.29449E-6
7-48314834-T-G p.Ser1857Arg missense ABCA13 1 82230 1.2161E-5 41115 0 NA
7-48314844-C-T p.His1861Tyr missense ABCA13 1 82184 1.21678E-5 41092 0 3.18532E-5
7-48314876-A-C p.Ser1871Ser synonymous ABCA13 802 82096 0.00976905 41048 23 0.0212183
7-48314879-A-G p.Pro1872Pro synonymous ABCA13 1 82112 1.21785E-5 41056 0 5.03525E-4
7-48314880-T-A p.Cys1873Ser missense ABCA13 1 82104 1.21797E-5 41052 0 NA
7-48314896-C-T p.Ser1878Phe missense ABCA13 100 82156 0.0012172 41078 0 0.00185883
7-48314898-C-T p.Arg1879* stop_gained ABCA13 2 82170 2.43398E-5 41085 0 4.82377E-5
7-48314899-G-A p.Arg1879Gln missense ABCA13 1 82170 1.21699E-5 41085 0 3.21626E-5
7-48314907-A-T p.Ile1882Leu missense ABCA13 1 82252 1.21578E-5 41126 0 8.29807E-6
7-48314911-C-T p.Thr1883Ile missense ABCA13 2 82250 2.43161E-5 41125 0 4.019E-6
7-48314924-C-T p.Val1887Val synonymous ABCA13 1 82330 1.21462E-5 41165 0 5.03525E-4
7-48314926-G-T p.Cys1888Phe missense ABCA13 1 82348 1.21436E-5 41174 0 NA
7-48314929-T-A p.Ile1889Lys missense ABCA13 1116 82360 0.0135503 41180 13 0.0589124
7-48314934-C-A p.His1891Asn missense ABCA13 1 82380 1.21389E-5 41190 0 1.20518E-5
7-48314949-T-G p.Trp1896Gly missense ABCA13 2 82442 2.42595E-5 41221 0 NA
7-48314958-A-G p.Ile1899Val missense ABCA13 1 82452 1.21283E-5 41226 0 3.1841E-5
7-48314967-G-C p.Glu1902Gln missense ABCA13 3 82450 3.63857E-5 41225 0 2.00781E-5
7-48314972-C-T p.Leu1903Leu synonymous ABCA13 15 82468 1.81889E-4 41234 0 2.2293E-4
7-48314999-T-A p.Ser1912Ser synonymous ABCA13 3 82366 3.64228E-5 41183 0 9.64157E-5
7-48315003-G-A p.Val1914Met missense ABCA13 3 82340 3.64343E-5 41170 0 1.60729E-4
7-48315007-A-G p.Lys1915Arg missense ABCA13 1 82302 1.21504E-5 41151 0 NA
7-48315015-C-G p.Gln1918Glu missense ABCA13 1 82276 1.21542E-5 41138 0 NA
7-48315028-A-G p.His1922Arg missense ABCA13 2 82256 2.43143E-5 41128 0 8.03878E-6
7-48315034-T-G p.Ile1924Arg missense ABCA13 3 82230 3.6483E-5 41115 0 1.66439E-5
7-48315040-C-T p.Pro1926Leu missense ABCA13 2 82214 2.43268E-5 41107 0 9.55414E-5
7-48315040-C-A p.Pro1926Gln missense ABCA13 1 82214 1.21634E-5 41107 0 NA
7-48315041-G-A p.Pro1926Pro synonymous ABCA13 221 82198 0.00268863 41099 0 0.00251762
7-48315047-C-T p.Val1928Val synonymous ABCA13 1 82196 1.2166E-5 41098 0 NA
7-48315048-C-T p.Pro1929Ser missense ABCA13 1 82204 1.21649E-5 41102 0 8.3221E-6
7-48315054-T-C p.Ser1931Pro missense ABCA13 3 82226 3.64848E-5 41113 0 8.04253E-6
7-48315061-A-G p.Asn1933Ser missense ABCA13 2 82198 2.43315E-5 41099 0 8.32348E-6
7-48315105-A-G p.Ile1948Val missense ABCA13 3 82010 3.65809E-5 41005 0 2.49767E-5
7-48315110-G-A p.Lys1949Lys synonymous ABCA13 1 81974 1.2199E-5 40987 0 NA
7-48315115-T-C p.Val1951Ala missense ABCA13 1 81936 1.22046E-5 40968 0 NA
7-48315117-G-A p.Ala1952Thr missense ABCA13 1 81900 1.221E-5 40950 0 4.02421E-6
7-48315130-T-C p.Ile1956Thr missense ABCA13 1 81904 1.22094E-5 40952 0 NA
7-48315131-A-G p.Ile1956Met missense ABCA13 1 81888 1.22118E-5 40944 0 NA
7-48315142-A-G p.Lys1960Arg missense ABCA13 3 81846 3.66542E-5 40923 0 5.04549E-5
7-48315167-A-G p.Thr1968Thr synonymous ABCA13 2 81772 2.44582E-5 40886 0 NA
7-48315184-T-G p.Leu1974Arg missense ABCA13 1 81738 1.22342E-5 40869 0 NA
7-48315197-T-C p.Ser1978Ser synonymous ABCA13 1 81730 1.22354E-5 40865 0 1.01053E-5
7-48315202-T-C p.Leu1980Ser missense ABCA13 18