Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
7-48211089-T-C p.His3His synonymous ABCA13 16 78444 2.03967E-4 39222 0 7.6438E-4
7-48211090-G-A p.Ala4Thr missense ABCA13 24 78452 3.0592E-4 39226 0 2.5481E-4
7-48211091-C-T p.Ala4Val missense ABCA13 1 78448 1.27473E-5 39224 0 NA
7-48211092-C-T p.Ala4Ala synonymous ABCA13 2 78486 2.54823E-5 39243 0 2.11652E-5
7-48211092-CG-C p.Cys6fs frameshift ABCA13 1 78486 1.27411E-5 39243 0 NA
7-48211097-G-A p.Cys6Tyr missense ABCA13 5 78576 6.36327E-5 39288 0 5.80114E-5
7-48211097-GC-G p.Gln7fs frameshift ABCA13 1 78576 1.27265E-5 39288 0 NA
7-48211098-C-A p.Cys6* stop_gained ABCA13 7 78582 8.90789E-5 39291 0 1.27462E-4
7-48211099-CAGT-C p.Gln7_Phe8delinsLeu disruptive_inframe_deletion ABCA13 2 78592 2.54479E-5 39296 0 1.15996E-4
7-48211101-G-C p.Gln7His missense ABCA13 2 78612 2.54414E-5 39306 0 7.05099E-6
7-48211110-C-T p.Ala10Ala synonymous ABCA13 1 78688 1.27084E-5 39344 0 3.18552E-5
7-48211148-C-T p.Pro23Leu missense+splice_region ABCA13 1 78568 1.27278E-5 39284 0 5.81531E-5
7-48211149-G-A p.Pro23Pro splice_region+synonymous ABCA13 3 78542 3.81961E-5 39271 0 2.23029E-4
7-48211156-G-A c.69+7G>A splice_region ABCA13 1 78448 1.27473E-5 39224 0 NA
7-48232552-C-T c.70-4C>T splice_region ABCA13 2 77434 2.58284E-5 38717 0 6.99689E-4
7-48232559-C-G p.Leu25Val missense ABCA13 1 77962 1.28268E-5 38981 0 3.39732E-5
7-48232580-T-C p.Trp32Arg missense ABCA13 155 78338 0.00197861 39169 2 0.00452166
7-48232596-T-C p.Phe37Ser missense ABCA13 1 78498 1.27392E-5 39249 0 6.37796E-5
7-48232616-C-T p.Arg44Cys missense ABCA13 3 78478 3.82273E-5 39239 0 6.52533E-5
7-48232617-G-A p.Arg44His missense ABCA13 6 78458 7.6474E-5 39229 0 7.94591E-5
7-48232617-G-C p.Arg44Pro missense ABCA13 1 78458 1.27457E-5 39229 0 2.62502E-4
7-48232626-A-C p.Glu47Ala missense ABCA13 1 78424 1.27512E-5 39212 0 NA
7-48232645-C-T p.Asp53Asp synonymous ABCA13 3 78280 3.8324E-5 39140 0 3.19081E-5
7-48232656-T-G c.163+7T>G splice_region ABCA13 13 78034 1.66594E-4 39017 0 6.28931E-4
7-48237825-TA-T c.164-8delA splice_region ABCA13 2 80242 2.49246E-5 40121 0 0.00134138
7-48237829-TCTAGG-T p.Cys55fs frameshift ABCA13 2 80280 2.49128E-5 40140 0 0.00147634
7-48237838-T-A p.Tyr56* stop_gained ABCA13 2 80288 2.49103E-5 40144 0 0.00244347
7-48237839-T-TGA p.Leu57fs frameshift ABCA13 2 80304 2.49054E-5 40152 0 0.00258978
7-48237840-T-C p.Leu57Ser missense ABCA13 13 80346 1.618E-4 40173 0 1.98539E-4
7-48237840-T-TACG p.Leu57_Gln58insArg disruptive_inframe_insertion ABCA13 2 80320 2.49004E-5 40160 0 0.00246188
7-48237842-C-A p.Gln58Lys missense ABCA13 2 80320 2.49004E-5 40160 0 NA
7-48237842-C-CG p.Gln58fs frameshift ABCA13 1 80292 1.24545E-5 40146 0 0.00265344
7-48237844-G-C p.Gln58His missense ABCA13 1 80302 1.2453E-5 40151 0 0.00339464
7-48237846-C-A p.Pro59His missense ABCA13 1 80334 1.2448E-5 40167 0 0.00366123
7-48237848-C-T p.Arg60* stop_gained ABCA13 3 80390 3.73181E-5 40195 0 5.1254E-5
7-48237853-T-G p.Asp61Glu missense ABCA13 4 80400 4.97512E-5 40200 0 6.37146E-5
7-48237857-C-T p.Pro63Ser missense ABCA13 1 80422 1.24344E-5 40211 0 8.04887E-6
7-48237866-G-A p.Gly66Ser missense ABCA13 1 80438 1.24319E-5 40219 0 NA
7-48237867-G-A p.Gly66Asp missense ABCA13 1 80438 1.24319E-5 40219 0 0.00125
7-48237870-T-G p.Val67Gly missense ABCA13 1 80438 1.24319E-5 40219 0 8.47903E-6
7-48237878-T-C p.Phe70Leu missense ABCA13 2 80438 2.48639E-5 40219 0 1.69374E-5
7-48237904-T-C p.Thr78Thr synonymous ABCA13 1 80426 1.24338E-5 40213 0 6.36862E-5
7-48237905-G-T p.Gly79* stop_gained ABCA13 1 80426 1.24338E-5 40213 0 4.21443E-5
7-48237906-G-C p.Gly79Ala missense ABCA13 12 80410 1.49235E-4 40205 0 2.54793E-4
7-48237919-G-A p.Arg83Arg synonymous ABCA13 34 80396 4.22907E-4 40198 0 8.68041E-4
7-48237951-A-G p.His94Arg missense ABCA13 8 80336 9.95818E-5 40168 0 5.03525E-4
7-48237957-G-A p.Arg96His missense+splice_region ABCA13 1 80322 1.24499E-5 40161 0 6.37064E-5
7-48258950-G-C c.288-1G>C splice_acceptor ABCA13 8 80130 9.98378E-5 40065 0 2.22973E-4
7-48258979-C-T p.Pro106Ser missense ABCA13 1 80302 1.2453E-5 40151 0 8.32584E-6
7-48258990-C-T p.Val109Val synonymous ABCA13 1 80336 1.24477E-5 40168 0 2.42041E-5
7-48259001-C-A p.Ala113Asp missense ABCA13 2 80344 2.4893E-5 40172 0 NA
7-48259002-C-T p.Ala113Ala synonymous ABCA13 2 80348 2.48917E-5 40174 0 NA
7-48259002-C-G p.Ala113Ala synonymous ABCA13 2 80348 2.48917E-5 40174 0 NA
7-48259014-G-A p.Glu117Glu synonymous ABCA13 5 80342 6.2234E-5 40171 0 1.40964E-4
7-48259040-A-G p.His126Arg missense ABCA13 3 80274 3.7372E-5 40137 0 2.48591E-5
7-48259051-G-A p.Asp130Asn missense ABCA13 3 80238 3.73888E-5 40119 0 3.18756E-5
7-48259056-G-A p.Lys131Lys synonymous ABCA13 1 80236 1.24632E-5 40118 0 NA
7-48259057-G-A p.Ala132Thr missense ABCA13 9 80218 1.12194E-4 40109 0 2.8997E-4
7-48259058-C-G p.Ala132Gly missense ABCA13 1 80208 1.24676E-5 40104 0 3.19061E-5
7-48259067-T-G p.Leu135* stop_gained ABCA13 1 80178 1.24722E-5 40089 0 NA
7-48259072-AGACTTTGGGTAG-A p.Arg137_Glu141delinsLys disruptive_inframe_deletion ABCA13 11 80162 1.37222E-4 40081 0 1.24267E-4
7-48259073-G-T p.Arg137Ile missense ABCA13 6 80164 7.48466E-5 40082 0 1.69242E-4
7-48259082-T-C p.Val140Ala missense ABCA13 1 80124 1.24807E-5 40062 0 8.28583E-6
7-48259086-A-G p.Glu141Glu synonymous ABCA13 2 80106 2.49669E-5 40053 0 3.18552E-5
7-48259087-C-T p.Arg142* stop_gained ABCA13 4 80082 4.99488E-5 40041 0 7.45712E-5
7-48259088-G-A p.Arg142Gln missense ABCA13 7 80062 8.74322E-5 40031 0 0.00352467
7-48259102-G-A p.Asp147Asn missense+splice_region ABCA13 1 80018 1.24972E-5 40009 0 NA
7-48259106-A-G c.439+4A>G splice_region ABCA13 1 79996 1.25006E-5 39998 0 NA
7-48260884-C-T p.Ser149Phe missense ABCA13 1 75822 1.31888E-5 37911 0 1.4246E-5
7-48260894-C-T p.Ser152Ser synonymous ABCA13 31 75808 4.08928E-4 37904 0 8.28184E-4
7-48260896-G-GT p.Thr156fs frameshift ABCA13 1 75762 1.31992E-5 37881 0 3.18654E-5
7-48260906-A-G p.Thr156Thr splice_region+synonymous ABCA13 1 75760 1.31996E-5 37880 0 1.43287E-5
7-48266869-A-G p.Asn160Ser missense ABCA13 34 79974 4.25138E-4 39987 0 6.69643E-4
7-48266873-G-A p.Lys161Lys synonymous ABCA13 23 80010 2.87464E-4 40005 0 0.0025
7-48266876-C-A p.Thr162Thr synonymous ABCA13 997 79994 0.0124634 39997 9 0.0594159
7-48266876-C-T p.Thr162Thr synonymous ABCA13 2 80018 2.49944E-5 40009 0 5.79691E-5
7-48266877-G-A p.Glu163Lys missense ABCA13 5 80050 6.2461E-5 40025 0 2.87301E-4
7-48266881-A-C p.Glu164Ala missense ABCA13 2 80086 2.49732E-5 40043 0 6.37959E-5
7-48266883-G-A p.Val165Ile missense ABCA13 1 80098 1.24847E-5 40049 0 8.28144E-6
7-48266889-T-C p.Leu167Leu synonymous ABCA13 1 80140 1.24782E-5 40070 0 8.28157E-6
7-48266910-C-T p.Gln174* stop_gained ABCA13 2 80202 2.4937E-5 40101 0 NA
7-48266937-C-A p.Leu183Ile missense ABCA13 1 80060 1.24906E-5 40030 0 9.2329E-4
7-48266939-T-G p.Leu183Leu synonymous ABCA13 1 80060 1.24906E-5 40030 0 8.53116E-4
7-48266940-T-A p.Leu184Ile missense ABCA13 1 80060 1.24906E-5 40030 0 8.59912E-4
7-48266944-T-G p.Leu185Arg missense ABCA13 1 80042 1.24934E-5 40021 0 9.67867E-4
7-48266945-G-GCGACCA p.Leu185_Pro186insArgPro disruptive_inframe_insertion ABCA13 1 80046 1.24928E-5 40023 0 0.00106635
7-48266947-C-T p.Pro186Leu missense ABCA13 1 80150 1.24766E-5 40075 0 2.4853E-5
7-48266948-G-A p.Pro186Pro synonymous ABCA13 7 80150 8.73362E-5 40075 0 1.16487E-4
7-48266951-A-AT p.Leu188fs frameshift ABCA13 1 80036 1.24944E-5 40018 0 0.00136936
7-48266968-A-G p.Asp193Gly missense ABCA13 1 80178 1.24722E-5 40089 0 8.28803E-6
7-48266974-T-G p.Val195Gly missense ABCA13 1 80176 1.24726E-5 40088 0 NA
7-48266974-T-A p.Val195Glu missense ABCA13 2 80176 2.49451E-5 40088 0 NA
7-48266976-G-A p.Glu196Lys missense ABCA13 18 80176 2.24506E-4 40088 1 0.003125
7-48266977-A-C p.Glu196Ala missense ABCA13 1 80178 1.24722E-5 40089 0 NA
7-48266990-T-A p.Asp200Glu missense ABCA13 3 80132 3.74382E-5 40066 1 8.03258E-6
7-48267010-A-G p.Gln207Arg missense ABCA13 1 79998 1.25003E-5 39999 0 3.1837E-5
7-48269416-T-G c.633-6T>G splice_region ABCA13 1 80242 1.24623E-5 40121 0 NA
7-48269418-C-G c.633-4C>G splice_region ABCA13 1 80252 1.24607E-5 40126 0 NA
7-48269432-TC-T p.Leu216fs frameshift ABCA13 1 80328 1.2449E-5 40164 0 NA
7-48269433-C-T p.Ser215Phe missense ABCA13 1 80332 1.24483E-5 40166 0 NA
7-48269438-G-A p.Glu217Lys missense ABCA13 6 80334 7.46882E-5 40167 1 7.45527E-5
7-48269440-A-T p.Glu217Asp missense ABCA13 2 80318 2.4901E-5 40159 0 NA
7-48269456-C-A p.Pro223Thr missense ABCA13 1 80362 1.24437E-5 40181 0 NA
7-48269463-A-G p.Asn225Ser missense ABCA13 41 80398 5.09963E-4 40199 0 5.03525E-4
7-48269468-AC-A p.Thr227fs frameshift ABCA13 1 80410 1.24363E-5 40205 0 NA
7-48269482-T-A p.Val231Val synonymous ABCA13 19 80424 2.36248E-4 40212 0 2.22902E-4
7-48269496-T-C p.Leu236Pro missense ABCA13 1 80444 1.2431E-5 40222 0 NA
7-48269501-G-C p.Val238Leu missense ABCA13 1 80452 1.24298E-5 40226 0 NA
7-48269511-C-T p.Ser241Leu missense ABCA13 6 80430 7.4599E-5 40215 0 1.59226E-4
7-48269517-T-C p.Leu243Pro missense ABCA13 1 80438 1.24319E-5 40219 0 3.1841E-5
7-48269519-A-G p.Thr244Ala missense ABCA13 2 80432 2.48657E-5 40216 0 2.40807E-5
7-48269523-T-A p.Phe245Tyr missense ABCA13 2 80418 2.48701E-5 40209 0 8.28185E-6
7-48269538-G-T p.Gly250Val missense ABCA13 1 80396 1.24384E-5 40198 0 NA
7-48269548-C-A p.Val253Val synonymous ABCA13 1 80380 1.24409E-5 40190 0 8.29201E-6
7-48269551-C-T p.Thr254Thr splice_region+synonymous ABCA13 1 80358 1.24443E-5 40179 0 6.43439E-5
7-48269552-G-A p.Glu255Lys missense+splice_region ABCA13 3 80358 3.73329E-5 40179 0 1.60918E-5
7-48273616-G-C p.Glu255Asp missense+splice_region ABCA13 2 80388 2.48793E-5 40194 0 NA
7-48273622-T-G p.Val257Val synonymous ABCA13 85 80400 0.00105721 40200 1 0.00553877
7-48273630-T-C p.Leu260Pro missense ABCA13 1 80422 1.24344E-5 40211 0 4.01407E-6
7-48273631-G-T p.Leu260Leu synonymous ABCA13 1 80424 1.24341E-5 40212 0 4.01361E-6
7-48273638-C-A p.Gln263Lys missense ABCA13 2 80420 2.48694E-5 40210 0 3.18451E-5
7-48273651-GGGA-G p.Trp267_Asp268delinsCys disruptive_inframe_deletion ABCA13 6 80432 7.45972E-5 40216 0 4.98331E-5
7-48273652-G-C p.Trp267Cys missense ABCA13 1 80426 1.24338E-5 40213 0 NA
7-48273662-A-G p.Lys271Glu missense ABCA13 1 80438 1.24319E-5 40219 0 4.01204E-6
7-48273664-A-C p.Lys271Asn missense ABCA13 2 80440 2.48633E-5 40220 0 9.55353E-5
7-48273682-A-C p.Lys277Asn missense ABCA13 1 80446 1.24307E-5 40223 0 NA
7-48273685-C-A p.Ser278Ser synonymous ABCA13 5 80436 6.21612E-5 40218 0 5.79816E-5
7-48273685-C-T p.Ser278Ser synonymous ABCA13 1 80436 1.24322E-5 40218 0 1.65662E-5
7-48273690-T-A p.Phe280Tyr missense ABCA13 1 80444 1.2431E-5 40222 0 NA
7-48273697-T-A p.Phe282Leu missense ABCA13 1 80452 1.24298E-5 40226 0 8.02375E-6
7-48273705-T-C p.Leu285Pro missense ABCA13 1 80436 1.24322E-5 40218 0 NA
7-48273711-C-T p.Thr287Met missense ABCA13 8 80424 9.94728E-5 40212 0 1.20373E-5
7-48273712-G-A p.Thr287Thr synonymous ABCA13 5 80424 6.21705E-5 40212 0 0.00100705
7-48273726-A-G p.Asn292Ser missense ABCA13 1 80386 1.244E-5 40193 0 6.37389E-5
7-48273735-C-T p.Ala295Val missense ABCA13 1 80336 1.24477E-5 40168 0 NA
7-48273747-A-T p.Glu299Val missense+splice_region ABCA13 1 80268 1.24583E-5 40134 0 5.03525E-4
7-48273749-G-T c.897+1G>T splice_donor ABCA13 2 80260 2.4919E-5 40130 0 4.01381E-6
7-48273753-A-G p.His301Arg missense ABCA13 1 80216 1.24663E-5 40108 0 NA
7-48273772-A-G p.Ser307Ser synonymous ABCA13 810 79966 0.0101293 39983 15 0.0222668
7-48273776-C-T p.Arg309Cys missense ABCA13 2 79910 2.50282E-5 39955 0 4.96985E-5
7-48273777-G-A p.Arg309His missense ABCA13 9 79862 1.12694E-4 39931 0 4.97034E-5
7-48273799-G-C p.Trp316Cys missense ABCA13 1 79464 1.25843E-5 39732 0 3.18451E-5
7-48273823-G-A c.*18G>A splice_region ABCA13 20 78784 2.53859E-4 39392 0 2.22859E-4
7-48273830-C-T c.*19+6C>T splice_region ABCA13 23 78340 2.93592E-4 39170 0 7.32484E-4
7-48273831-G-A c.*19+7G>A splice_region ABCA13 2 78312 2.55389E-5 39156 0 1.22389E-5
7-48278835-C-T c.*20-3C>T splice_region ABCA13 1 80176 1.24726E-5 40088 0 NA
7-48278853-TC-T p.Leu306fs frameshift ABCA13 2 80244 2.4924E-5 40122 0 6.37146E-5
7-48278867-G-T p.Met309Ile missense ABCA13 69 80274 8.59556E-4 40137 0 7.0086E-4
7-48278890-C-T p.Thr317Ile missense ABCA13 7 80328 8.71427E-5 40164 0 6.36821E-5
7-48278891-A-C p.Thr317Thr synonymous ABCA13 3 80326 3.73478E-5 40163 0 4.01294E-6
7-48278897-G-T p.Glu319Asp missense ABCA13 4 80334 4.97921E-5 40167 0 NA
7-48278913-T-C p.Trp325Arg missense ABCA13 2 80342 2.48936E-5 40171 0 8.29848E-6
7-48278916-G-A p.Gly326Ser missense ABCA13 26 80354 3.23568E-4 40177 0 0.001875
7-48278917-G-GCAGC p.His327fs frameshift ABCA13 1 80350 1.24456E-5 40175 0 NA
7-48278919-C-T p.His327Tyr missense ABCA13 2 80348 2.48917E-5 40174 0 2.49041E-5
7-48278921-C-T p.His327His synonymous ABCA13 3 80338 3.73422E-5 40169 0 6.64231E-5
7-48278922-G-A p.Val328Ile missense ABCA13 3 80340 3.73413E-5 40170 0 2.22859E-4
7-48278954-C-T p.Ala338Ala synonymous ABCA13 1 80408 1.24366E-5 40204 0 6.37511E-5
7-48278988-C-T p.Arg350* stop_gained ABCA13 2 80412 2.48719E-5 40206 0 9.5584E-5
7-48278997-C-CGGTA p.Gln353fs frameshift ABCA13 26 80420 3.23303E-4 40210 0 2.32686E-4
7-48278999-A-G p.Gln353Gln synonymous ABCA13 1 80424 1.24341E-5 40212 0 NA
7-48279000-C-A p.Gln354Lys missense+splice_region ABCA13 1 80414 1.24356E-5 40207 0 1.7304E-5
7-48280464-G-T p.Val355Leu missense+splice_region ABCA13 6 78184 7.6742E-5 39092 0 2.22902E-4
7-48280473-C-T p.Gln358* stop_gained ABCA13 3 78532 3.8201E-5 39266 0 3.82958E-5
7-48280508-C-T p.Leu369Leu synonymous ABCA13 85 80158 0.00106041 40079 1 0.00210164
7-48280512-G-T p.Gly371Cys missense ABCA13 1 80254 1.24604E-5 40127 0 NA
7-48280522-A-G p.His374Arg missense ABCA13 1 80264 1.24589E-5 40132 0 NA
7-48280533-G-C p.Ala378Pro missense ABCA13 17 80252 2.11833E-4 40126 0 5.03525E-4
7-48280543-A-G p.Asn381Ser missense ABCA13 3 80244 3.7386E-5 40122 0 8.29655E-6
7-48280547-G-T p.Gln382His missense ABCA13 4 80220 4.98629E-5 40110 0 6.36618E-5
7-48280549-T-C p.Phe383Ser missense ABCA13 2 80214 2.49333E-5 40107 0 8.04085E-6
7-48280551-G-A p.Glu384Lys missense ABCA13 16 80224 1.99442E-4 40112 0 5.09489E-4
7-48280556-A-G p.Glu385Glu synonymous ABCA13 1 80228 1.24645E-5 40114 0 1.20608E-5
7-48280558-A-C p.Glu386Ala missense ABCA13 34 80234 4.23761E-4 40117 0 0.00105075
7-48280559-G-C p.Glu386Asp missense ABCA13 2 80234 2.49271E-5 40117 0 8.2861E-6
7-48280560-A-G p.Ser387Gly missense ABCA13 1 80228 1.24645E-5 40114 0 NA
7-48280564-A-G p.Lys388Arg missense ABCA13 1 80214 1.24667E-5 40107 0 NA
7-48280593-A-C p.Thr398Pro missense ABCA13 1 80240 1.24626E-5 40120 0 3.1839E-5
7-48280598-A-C p.Ala399Ala synonymous ABCA13 2 80244 2.4924E-5 40122 0 3.1841E-5
7-48280633-G-A p.Gly411Asp missense ABCA13 1 80220 1.24657E-5 40110 0 NA
7-48280649-T-C p.His416His synonymous ABCA13 1 80190 1.24704E-5 40095 0 1.65659E-5
7-48280652-A-G p.Thr417Thr synonymous ABCA13 4 80178 4.9889E-5 40089 0 NA
7-48280659-A-G p.Lys420Glu missense ABCA13 1 80132 1.24794E-5 40066 0 NA
7-48280670-C-T c.*384+7C>T splice_region ABCA13 203 79992 0.00253775 39996 1 0.010625
7-48280671-G-A c.*384+8G>A splice_region ABCA13 1 79994 1.25009E-5 39997 0 8.28789E-6
7-48284168-C-G c.*482-5C>G splice_region ABCA13 691 79500 0.00869182 39750 3 0.00752415
7-48284171-A-G c.*482-2A>G splice_acceptor ABCA13 1 79578 1.25663E-5 39789 0 4.05091E-6
7-48284173-A-AT p.Leu422fs frameshift ABCA13 2 79586 2.513E-5 39793 0 3.18552E-5
7-48284179-G-A p.Gln423Gln synonymous ABCA13 28 79668 3.51459E-4 39834 0 0.0020141
7-48284184-T-A p.Leu425Gln missense ABCA13 791 79668 0.0099287 39834 21 0.0217156
7-48284185-G-T p.Leu425Leu synonymous ABCA13 3 79692 3.76449E-5 39846 0 8.55915E-6
7-48284199-G-A p.Ser430Asn missense ABCA13 1 79788 1.25332E-5 39894 0 4.02706E-6
7-48284204-C-T p.Leu432Leu synonymous ABCA13 5 79804 6.26535E-5 39902 0 3.1841E-5
7-48284212-C-A p.Asn434Lys missense ABCA13 10 79856 1.25225E-4 39928 0 0.00100705
7-48284213-C-T p.Leu435Leu synonymous ABCA13 1 79850 1.25235E-5 39925 0 NA
7-48284219-C-G p.Gln437Glu missense ABCA13 1 79890 1.25172E-5 39945 0 4.02327E-6
7-48284222-T-A p.Trp438Arg missense ABCA13 3 79910 3.75422E-5 39955 0 3.1841E-5
7-48284226-C-T p.Pro439Leu missense ABCA13 1 79936 1.251E-5 39968 0 5.83042E-5
7-48284227-G-A p.Pro439Pro synonymous ABCA13 1 79934 1.25103E-5 39967 0 1.66531E-5
7-48284229-C-T p.Ala440Val missense ABCA13 1 79948 1.25081E-5 39974 0 NA
7-48284233-G-GA p.Arg443fs frameshift ABCA13 1 79960 1.25063E-5 39980 0 4.02317E-6
7-48284238-G-T p.Arg443Ile missense ABCA13 1 79992 1.25013E-5 39996 0 8.05082E-6
7-48284247-A-G p.Gln446Arg missense ABCA13 1 80016 1.24975E-5 40008 0 NA
7-48284250-T-C p.Leu447Pro missense ABCA13 1 80026 1.24959E-5 40013 0 NA
7-48284254-T-C p.Asp448Asp synonymous ABCA13 133 80032 0.00166184 40016 0 0.00305655
7-48284271-C-T p.Ala454Val missense ABCA13 1 80064 1.249E-5 40032 0 NA
7-48284272-G-C p.Ala454Ala synonymous ABCA13 1 80068 1.24894E-5 40034 0 4.06802E-6
7-48284273-A-G p.Ile455Val missense ABCA13 1 80070 1.24891E-5 40035 0 3.18552E-5
7-48284275-A-G p.Ile455Met missense ABCA13 4 80072 4.9955E-5 40036 0 NA
7-48284297-C-G p.Gln463Glu missense ABCA13 1 80142 1.24779E-5 40071 0 NA
7-48285071-ACCTTAGGTGAATAATAATCAATTTGTCTACTTTG-A c.*610-37_*610-4delCCTTAGGTGAATAATAATCAATTTGTCTACTTTG splice_region ABCA13 1 78580 1.27259E-5 39290 0 NA
7-48285114-C-T p.Leu466Phe missense ABCA13 1 79600 1.25628E-5 39800 0 NA
7-48285123-C-T p.Leu469Leu synonymous ABCA13 2 79728 2.50853E-5 39864 0 0.00125
7-48285153-T-C p.Phe479Leu missense ABCA13 31 79890 3.88034E-4 39945 0 1.91107E-4
7-48285167-A-G p.Gln483Gln synonymous ABCA13 1026 79912 0.0128391 39956 10 0.0594159
7-48285168-T-C p.Leu484Leu synonymous ABCA13 2 79924 2.50238E-5 39962 0 0.00151057
7-48285182-G-A p.Lys488Lys synonymous ABCA13 1 79936 1.251E-5 39968 0 NA
7-48285188-G-A p.Val490Val synonymous ABCA13 3 79928 3.75338E-5 39964 0 8.10747E-6
7-48285208-A-G p.Gln497Arg missense+splice_region ABCA13 2 79802 2.5062E-5 39901 0 NA
7-48285215-G-A c.*710+6G>A splice_region ABCA13 1 79710 1.25455E-5 39855 0 NA
7-48285467-C-T p.Ala500Val missense ABCA13 25 80026 3.12398E-4 40013 0 9.55901E-4
7-48285468-G-A p.Ala500Ala synonymous ABCA13 14 80040 1.74913E-4 40020 0 9.5584E-5
7-48285473-A-G p.Asn502Ser missense ABCA13 1 80062 1.24903E-5 40031 0 1.70891E-5
7-48285485-C-T p.Pro506Leu missense ABCA13 31566 79872 0.395207 39936 6372 0.448958
7-48285489-T-C p.Asn507Asn synonymous ABCA13 1 80106 1.24835E-5 40053 0 2.50217E-5
7-48285493-C-A p.Arg509Ser missense ABCA13 2 80120 2.49626E-5 40060 0 NA
7-48285507-G-T p.Lys513Asn missense ABCA13 1 80134 1.24791E-5 40067 0 3.18512E-5
7-48285509-A-G p.Glu514Gly missense ABCA13 4 80136 4.99151E-5 40068 0 NA
7-48285513-C-G p.Val515Val synonymous ABCA13 2 80148 2.49538E-5 40074 0 NA
7-48285519-G-A p.Leu517Leu synonymous ABCA13 1 80124 1.24807E-5 40062 0 3.19366E-5
7-48285522-G-A p.Pro518Pro synonymous ABCA13 3 80116 3.74457E-5 40058 0 0.00125
7-48285522-G-T p.Pro518Pro synonymous ABCA13 1 80116 1.24819E-5 40058 0 4.02269E-6
7-48285532-T-G p.Ser522Ala missense ABCA13 1 80144 1.24775E-5 40072 0 NA
7-48285550-C-T p.Leu528Phe missense ABCA13 1 80104 1.24838E-5 40052 0 NA
7-48285555-G-A p.Gln529Gln synonymous ABCA13 1 80092 1.24856E-5 40046 0 4.01748E-6
7-48285558-A-G p.Gly530Gly synonymous ABCA13 45 80068 5.62022E-4 40034 0 0.00101969
7-48285560-T-G p.Leu531Arg missense ABCA13 1 80072 1.24888E-5 40036 0 1.674E-5
7-48285583-GA-TT p.Glu539Leu missense ABCA13 2 80016 2.4995E-5 40008 0 NA
7-48285584-A-C p.Glu539Ala missense ABCA13 2 80014 2.49956E-5 40007 0 NA
7-48285585-G-A p.Glu539Glu synonymous ABCA13 2 80000 2.5E-5 40000 0 4.01845E-6
7-48285587-C-T p.Thr540Met missense ABCA13 2 79970 2.50094E-5 39985 0 3.18674E-5
7-48285591-T-G p.Ser541Arg missense ABCA13 1 79980 1.25031E-5 39990 0 4.01936E-6
7-48285604-C-A p.Leu546Ile missense ABCA13 1 79958 1.25066E-5 39979 0 8.54E-6
7-48285606-A-G p.Leu546Leu synonymous ABCA13 2 79950 2.50156E-5 39975 0 4.42414E-5
7-48285627-T-C p.Ala553Ala splice_region+synonymous ABCA13 2 79830 2.50532E-5 39915 0 NA
7-48285628-G-C c.*878+1G>C splice_donor ABCA13 1 79816 1.25288E-5 39908 0 8.85269E-6
7-48287831-T-C c.*879-5T>C splice_region ABCA13 2 79538 2.51452E-5 39769 0 9.41957E-6
7-48287839-C-T p.Arg555Cys missense ABCA13 1 79622 1.25593E-5 39811 0 NA
7-48287840-G-A p.Arg555His missense ABCA13 10758 78924 0.136308 39462 725 0.17582
7-48287849-A-G p.Gln558Arg missense ABCA13 1 79706 1.25461E-5 39853 0 4.0282E-6
7-48287853-G-A p.Glu559Glu synonymous ABCA13 2 79736 2.50828E-5 39868 0 NA
7-48287857-A-G p.Ile561Val missense ABCA13 14 79756 1.75535E-4 39878 0 6.46635E-4
7-48287861-C-T p.Thr562Ile missense ABCA13 1 79760 1.25376E-5 39880 0 NA
7-48287872-AAT-A p.Met567fs frameshift ABCA13 1 79830 1.25266E-5 39915 0 NA
7-48287897-A-T p.Glu574Val missense ABCA13 2 79906 2.50294E-5 39953 0 4.01732E-6
7-48287902-T-C p.Leu576Leu synonymous ABCA13 1 79930 1.25109E-5 39965 0 5.03525E-4
7-48287911-C-T p.Gln579* stop_gained ABCA13 1 79924 1.25119E-5 39962 0 NA
7-48287914-G-A p.Glu580Lys missense ABCA13 2 79898 2.50319E-5 39949 0 3.3184E-5
7-48287939-C-A p.Ala588Glu missense ABCA13 1 79884 1.25182E-5 39942 0 1.60715E-5
7-48287956-C-T p.Arg594Trp missense ABCA13 14 79910 1.75197E-4 39955 0 9.64343E-5
7-48287969-T-A p.Leu598Gln missense ABCA13 1 79914 1.25135E-5 39957 0 NA
7-48287970-G-A p.Leu598Leu synonymous ABCA13 4 79914 5.00538E-5 39957 0 3.31912E-5
7-48287973-G-A p.Leu599Leu synonymous ABCA13 1 79904 1.2515E-5 39952 0 NA
7-48287988-TC-T p.Pro605fs frameshift ABCA13 2 79832 2.50526E-5 39916 0 NA
7-48287991-T-G p.Pro605Pro synonymous ABCA13 1 79792 1.25326E-5 39896 0 NA
7-48288001-G-A p.Val609Ile missense ABCA13 2 79678 2.5101E-5 39839 0 NA
7-48288002-TC-T p.Ser611fs frameshift ABCA13 1 79672 1.25515E-5 39836 0 NA
7-48288028-C-G p.Leu618Val missense ABCA13 2 79248 2.52372E-5 39624 0 5.04032E-4
7-48288802-A-T c.*1085-7A>T splice_region ABCA13 2 79612 2.51218E-5 39806 0 1.68112E-5
7-48288807-A-G c.*1085-2A>G splice_acceptor ABCA13 1 79730 1.25423E-5 39865 0 NA
7-48288817-A-G p.His625Arg missense ABCA13 1 79868 1.25207E-5 39934 0 2.01732E-5
7-48288820-C-T p.Thr626Ile missense ABCA13 1 79876 1.25194E-5 39938 0 9.5645E-5
7-48288829-A-G p.Lys629Arg missense ABCA13 1 79992 1.25013E-5 39996 0 NA
7-48288831-A-G p.Thr630Ala missense ABCA13 2 80004 2.49987E-5 40002 0 8.06452E-6
7-48288868-C-T p.Ala642Val missense ABCA13 2 80134 2.49582E-5 40067 0 1.66014E-5
7-48288882-A-G p.Ile647Val missense ABCA13 1 80192 1.24701E-5 40096 0 2.48868E-5
7-48288897-G-A p.Glu652Lys missense ABCA13 414 80196 0.00516235 40098 7 0.0101625
7-48288900-G-A p.Val653Met missense ABCA13 1 80218 1.2466E-5 40109 0 1.65815E-5
7-48288904-C-T p.Ala654Val missense ABCA13 1 80204 1.24682E-5 40102 0 6.37186E-5
7-48288912-G-A p.Val657Ile missense ABCA13 1 80208 1.24676E-5 40104 0 1.6061E-5
7-48288920-G-T p.Met659Ile missense ABCA13 17 80174 2.12039E-4 40087 0 1.16057E-4
7-48288926-G-C p.Glu661Asp missense ABCA13 1 80168 1.24738E-5 40084 0 4.1447E-5
7-48288928-G-A p.Ser662Asn missense ABCA13 1 80154 1.2476E-5 40077 0 NA
7-48288946-T-C p.Leu668Ser missense+splice_region ABCA13 1 80078 1.24878E-5 40039 0 3.21611E-5
7-48308587-G-A p.Glu672Glu synonymous ABCA13 2 76612 2.61056E-5 38306 0 1.24437E-5
7-48308588-G-A p.Glu673Lys missense ABCA13 28 76722 3.64954E-4 38361 0 1.60318E-4
7-48308592-C-T p.Ser674Phe missense ABCA13 11 76956 1.42939E-4 38478 0 1.27885E-4
7-48308598-G-GT p.Glu678fs frameshift ABCA13 1 77216 1.29507E-5 38608 0 NA
7-48308607-A-C p.Glu679Ala missense ABCA13 1 77568 1.28919E-5 38784 0 9.57365E-5
7-48308612-A-G p.Met681Val missense ABCA13 1 77750 1.28617E-5 38875 0 6.3804E-5
7-48308659-C-T p.Asn696Asn synonymous ABCA13 1 77358 1.29269E-5 38679 0 5.26793E-5
7-48308659-C-G p.Asn696Lys missense ABCA13 1 77358 1.29269E-5 38679 0 NA
7-48311383-G-A c.*1340-1G>A splice_acceptor ABCA13 2 75260 2.65745E-5 37630 0 NA
7-48311384-G-A p.Arg707Arg splice_region+synonymous ABCA13 1 75290 1.3282E-5 37645 0 7.13674E-5
7-48311386-C-T p.Ala708Val missense+splice_region ABCA13 1 76134 1.31347E-5 38067 0 7.92833E-6
7-48311390-A-C p.Leu709Phe missense ABCA13 2 76530 2.61335E-5 38265 0 7.77532E-6
7-48311405-C-A p.His714Gln missense ABCA13 1 78674 1.27107E-5 39337 0 NA
7-48311412-A-C p.Met717Leu missense ABCA13 1 79120 1.2639E-5 39560 0 6.21157E-6
7-48311415-A-G p.Met718Val missense ABCA13 1 79242 1.26196E-5 39621 0 NA
7-48311417-G-A p.Met718Ile missense ABCA13 1 79288 1.26122E-5 39644 0 3.19366E-5
7-48311432-C-T p.His723His synonymous ABCA13 1 79758 1.25379E-5 39879 0 5.3408E-6
7-48311434-C-T p.Thr724Ile missense ABCA13 2 79866 2.50419E-5 39933 0 NA
7-48311434-C-A p.Thr724Asn missense ABCA13 1 79866 1.2521E-5 39933 0 NA
7-48311436-C-T p.Leu725Phe missense ABCA13 1 79892 1.25169E-5 39946 0 NA
7-48311441-G-A p.Glu726Glu synonymous ABCA13 1 79956 1.25069E-5 39978 0 3.05008E-5
7-48311450-A-G p.Gln729Gln synonymous ABCA13 1 80012 1.24981E-5 40006 0 4.60126E-6
7-48311450-A-T p.Gln729His missense ABCA13 1 80012 1.24981E-5 40006 0 NA
7-48311454-A-C p.Asn731His missense ABCA13 1 80040 1.24938E-5 40020 0 6.97512E-5
7-48311477-A-AT p.Glu741fs frameshift ABCA13 1 80096 1.2485E-5 40048 0 NA
7-48311478-T-G p.Phe739Val missense ABCA13 2 80106 2.49669E-5 40053 0 NA
7-48311481-T-C p.Phe740Leu missense ABCA13 7 80112 8.73777E-5 40056 0 0.00100705
7-48311485-A-C p.Glu741Ala missense ABCA13 139 80110 0.00173511 40055 4 0.00669736
7-48311495-G-A p.Leu744Leu synonymous ABCA13 4 80136 4.99151E-5 40068 0 9.50137E-6
7-48311531-T-C p.Ser756Ser synonymous ABCA13 3 80170 3.74205E-5 40085 0 NA
7-48311533-T-G p.Phe757Cys missense ABCA13 10 80166 1.24741E-4 40083 0 2.4908E-4
7-48311535-C-T p.His758Tyr missense ABCA13 1 80164 1.24744E-5 40082 0 NA
7-48311550-C-A p.Leu763Ile missense ABCA13 1 80142 1.24779E-5 40071 0 NA
7-48311550-C-G p.Leu763Val missense ABCA13 2 80142 2.49557E-5 40071 0 NA
7-48311552-C-T p.Leu763Leu synonymous ABCA13 2 80134 2.49582E-5 40067 0 NA
7-48311563-T-G p.Ile767Ser missense ABCA13 12291 79916 0.153799 39958 956 0.17406
7-48311572-T-C p.Ile770Thr missense ABCA13 13 80144 1.62208E-4 40072 0 1.42252E-4
7-48311584-G-C p.Trp774Ser missense ABCA13 3 80128 3.74401E-5 40064 0 6.37552E-5
7-48311584-G-A p.Trp774* stop_gained ABCA13 1 80128 1.248E-5 40064 0 NA
7-48311585-G-A p.Trp774* stop_gained ABCA13 3 80106 3.74504E-5 40053 0 0.00125
7-48311587-C-A p.Thr775Lys missense ABCA13 2 80114 2.49644E-5 40057 0 NA
7-48311598-A-C p.Lys779Gln missense ABCA13 12 80092 1.49828E-4 40046 0 0.00302115
7-48311601-A-C p.Ser780Arg missense ABCA13 1 80096 1.2485E-5 40048 0 NA
7-48311602-G-A p.Ser780Asn missense ABCA13 1037 80084 0.0129489 40042 10 0.0579053
7-48311611-G-C p.Arg783Thr missense ABCA13 1 80094 1.24853E-5 40047 0 3.18756E-5
7-48311632-C-T p.Ala790Val missense ABCA13 1 80100 1.24844E-5 40050 0 4.02013E-6
7-48311641-T-G p.Leu793Arg missense ABCA13 10 80130 1.24797E-4 40065 0 5.86921E-4
7-48311641-T-C p.Leu793Pro missense ABCA13 1 80130 1.24797E-5 40065 0 NA
7-48311653-G-A p.Gly797Asp missense ABCA13 2 80150 2.49532E-5 40075 0 2.09055E-4
7-48311657-C-T p.Asn798Asn synonymous ABCA13 1 80150 1.24766E-5 40075 0 4.18186E-5
7-48311658-G-A p.Glu799Lys missense ABCA13 3057 80116 0.0381572 40058 65 0.0475
7-48311658-G-C p.Glu799Gln missense ABCA13 2 80150 2.49532E-5 40075 0 2.50954E-5
7-48311666-T-C p.Ile801Ile synonymous ABCA13 2 80156 2.49513E-5 40078 0 2.01055E-5
7-48311669-GA-G p.Met804fs frameshift ABCA13 1 80152 1.24763E-5 40076 0 8.04272E-6
7-48311670-A-C p.Lys803Gln missense ABCA13 4 80160 4.99002E-5 40080 0 NA
7-48311681-T-G p.Thr806Thr synonymous ABCA13 1 80176 1.24726E-5 40088 0 8.38462E-6
7-48311684-C-T p.Leu807Leu synonymous ABCA13 27 80150 3.36868E-4 40075 0 0.00274165
7-48311685-G-A p.Gly808Arg missense ABCA13 4 80144 4.99102E-5 40072 0 3.18756E-5
7-48311701-G-A p.Arg813Lys missense ABCA13 1 80158 1.24754E-5 40079 0 8.42119E-6
7-48311707-A-G p.Glu815Gly missense ABCA13 2 80152 2.49526E-5 40076 0 3.18471E-5
7-48311710-C-A p.Pro816Gln missense ABCA13 1 80150 1.24766E-5 40075 0 NA
7-48311715-A-C p.Asn818His missense ABCA13 1 80150 1.24766E-5 40075 0 3.18512E-5
7-48311777-G-A p.Trp838* stop_gained ABCA13 1 79984 1.25025E-5 39992 0 8.56384E-6
7-48311790-T-A p.Ser843Thr missense ABCA13 1 79942 1.25091E-5 39971 0 4.06997E-6
7-48311797-G-GA p.Arg847fs frameshift ABCA13 1 79934 1.25103E-5 39967 0 NA
7-48311803-G-T p.Arg847Ile missense ABCA13 73 79914 9.13482E-4 39957 3 0.00193402
7-48311833-T-A p.Leu857* stop_gained ABCA13 14 79812 1.75412E-4 39906 0 0.00125
7-48311836-A-T p.Asn858Ile missense ABCA13 1 79788 1.25332E-5 39894 0 NA
7-48311844-G-A p.Val861Ile missense ABCA13 2 79760 2.50752E-5 39880 0 NA
7-48311858-G-A p.Glu865Glu synonymous ABCA13 1 79760 1.25376E-5 39880 0 NA
7-48311868-A-G p.Thr869Ala missense ABCA13 1 79744 1.25401E-5 39872 0 3.1837E-5
7-48311872-G-A p.Ser870Asn missense ABCA13 2 79734 2.50834E-5 39867 0 9.55597E-5
7-48311883-T-C p.Ser874Pro missense ABCA13 1 79666 1.25524E-5 39833 0 NA
7-48311884-C-T p.Ser874Phe missense ABCA13 107 79660 0.00134321 39830 1 0.00235759
7-48311885-C-G p.Ser874Ser synonymous ABCA13 2 79668 2.51042E-5 39834 0 NA
7-48311897-T-C p.His878His synonymous ABCA13 5 79608 6.28078E-5 39804 0 9.12439E-5
7-48311903-T-A p.Asp880Glu missense ABCA13 7 79548 8.79972E-5 39774 0 3.1835E-4
7-48311907-C-T p.Pro882Ser missense ABCA13 14 79502 1.76096E-4 39751 0 9.65111E-5
7-48311915-A-G p.Ser884Ser synonymous ABCA13 16 79484 2.01298E-4 39742 0 3.61981E-4
7-48311916-C-T p.Pro885Ser missense ABCA13 1 79468 1.25837E-5 39734 0 4.02191E-6
7-48311930-A-G p.Ile889Met missense ABCA13 1 79410 1.25929E-5 39705 0 8.28912E-6
7-48311937-G-A p.Val892Ile missense ABCA13 1 79352 1.26021E-5 39676 0 4.02363E-6
7-48311940-C-T p.Arg893Cys missense ABCA13 4 79342 5.04147E-5 39671 0 6.37105E-5
7-48311941-G-A p.Arg893His missense ABCA13 34 79326 4.28611E-4 39663 0 8.28765E-4
7-48311953-C-T p.Ala897Val missense ABCA13 1 79356 1.26014E-5 39678 0 4.02405E-6
7-48311955-A-G p.Ile898Val missense ABCA13 2 79350 2.52048E-5 39675 0 8.29036E-6
7-48311958-A-G p.Ile899Val missense ABCA13 1 79394 1.25954E-5 39697 0 3.18552E-5
7-48311969-C-G p.Leu902Leu synonymous ABCA13 5 79400 6.29723E-5 39700 0 1.27445E-4
7-48312006-G-A p.Glu915Lys missense ABCA13 1 79688 1.25489E-5 39844 0 8.29559E-6
7-48312023-C-G p.Val920Val synonymous ABCA13 1 79776 1.25351E-5 39888 0 NA
7-48312026-C-T p.Tyr921Tyr synonymous ABCA13 1 79794 1.25323E-5 39897 0 6.25E-4
7-48312027-G-A p.Ala922Thr missense ABCA13 1162 79772 0.0145665 39886 41 0.0316843
7-48312027-G-T p.Ala922Ser missense ABCA13 1 79790 1.25329E-5 39895 0 NA
7-48312028-C-T p.Ala922Val missense ABCA13 1 79802 1.2531E-5 39901 0 NA
7-48312030-A-C p.Ile923Leu missense ABCA13 1 79804 1.25307E-5 39902 0 8.04233E-6
7-48312039-G-A p.Ala926Thr missense ABCA13 2 79790 2.50658E-5 39895 0 NA
7-48312052-T-C p.Phe930Ser missense ABCA13 1 79774 1.25354E-5 39887 0 1.60884E-5
7-48312056-A-C p.Ser931Ser synonymous ABCA13 8 79764 1.00296E-4 39882 0 0.0020141
7-48312066-G-A p.Glu935Lys missense ABCA13 1 79708 1.25458E-5 39854 0 NA
7-48312084-G-C p.Val941Leu missense ABCA13 4377 79610 0.0549805 39805 139 0.07
7-48312096-T-C p.Leu945Leu synonymous ABCA13 14 79644 1.75782E-4 39822 0 3.18492E-5
7-48312101-T-A p.Thr946Thr synonymous ABCA13 1 79626 1.25587E-5 39813 0 8.3051E-6
7-48312104-C-T p.His947His synonymous ABCA13 1 79644 1.25559E-5 39822 0 2.41392E-5
7-48312105-A-G p.Ile948Val missense ABCA13 2 79634 2.51149E-5 39817 0 8.3062E-6
7-48312109-A-G p.His949Arg missense ABCA13 1 79632 1.25578E-5 39816 0 NA
7-48312111-C-G p.Leu950Val missense ABCA13 1 79598 1.25631E-5 39799 0 NA
7-48312164-A-G p.Ser967Ser synonymous ABCA13 1 79418 1.25916E-5 39709 0 1.59317E-4
7-48312171-C-T p.Arg970* stop_gained ABCA13 2 79388 2.51927E-5 39694 0 2.50505E-5
7-48312172-G-A p.Arg970Gln missense ABCA13 3 79390 3.77881E-5 39695 0 5.01245E-5
7-48312196-T-G p.Ile978Ser missense ABCA13 1 79258 1.2617E-5 39629 0 8.06712E-6
7-48312200-G-C p.Gln979His missense ABCA13 221 79236 0.00278914 39618 1 0.0119048
7-48312207-G-GGCTCTT p.Ser983_Ser984insCysSer disruptive_inframe_insertion ABCA13 6 79178 7.57786E-5 39589 0 6.36862E-5
7-48312214-C-T p.Ser984Leu missense ABCA13 1 79152 1.26339E-5 39576 0 8.57736E-6
7-48312215-G-A p.Ser984Ser synonymous ABCA13 405 79138 0.00511764 39569 0 0.00956697
7-48312222-T-C p.Phe987Leu missense ABCA13 1 79132 1.26371E-5 39566 0 NA
7-48312230-A-G p.Thr989Thr synonymous ABCA13 1 79086 1.26445E-5 39543 0 NA
7-48312245-C-A p.His994Gln missense ABCA13 2 79010 2.53133E-5 39505 0 3.18471E-5
7-48312246-A-G p.Ile995Val missense ABCA13 5 79014 6.32799E-5 39507 0 NA
7-48312246-A-T p.Ile995Phe missense ABCA13 1 79014 1.2656E-5 39507 0 NA
7-48312252-G-T p.Asp997Tyr missense ABCA13 2 79002 2.53158E-5 39501 0 NA
7-48312252-G-C p.Asp997His missense ABCA13 4 79002 5.06316E-5 39501 0 8.99345E-5
7-48312259-T-C p.Ile999Thr missense ABCA13 1 79118 1.26393E-5 39559 0 2.84722E-5
7-48312260-A-G p.Ile999Met missense ABCA13 18 79126 2.27485E-4 39563 0 1.91071E-4
7-48312262-A-T p.Lys1000Ile missense ABCA13 11 79146 1.38984E-4 39573 0 0.00125
7-48312264-C-T p.Gln1001* stop_gained ABCA13 1 79140 1.26358E-5 39570 0 NA
7-48312268-T-A p.Phe1002Tyr missense ABCA13 1 79184 1.26288E-5 39592 0 3.1841E-5
7-48312291-G-A p.Ala1010Thr missense ABCA13 1 79424 1.25907E-5 39712 0 3.18613E-5
7-48312297-G-A p.Ala1012Thr missense ABCA13 7 79476 8.80769E-5 39738 0 9.69161E-5
7-48312298-C-A p.Ala1012Glu missense ABCA13 3 79486 3.77425E-5 39743 0 3.18634E-5
7-48312302-T-C p.Phe1013Phe synonymous ABCA13 1 79534 1.25732E-5 39767 0 3.90839E-5
7-48312321-G-C p.Val1020Leu missense ABCA13 2 79746 2.50796E-5 39873 0 NA
7-48312326-TG-T p.Gly1023fs frameshift ABCA13 2 79782 2.50683E-5 39891 0 NA
7-48312354-C-G p.Gln1031Glu missense ABCA13 3 79914 3.75404E-5 39957 0 6.37064E-5
7-48312360-T-C p.Leu1033Leu synonymous ABCA13 1 79930 1.25109E-5 39965 0 NA
7-48312369-A-G p.Ile1036Val missense ABCA13 3 79930 3.75328E-5 39965 0 1.10884E-5
7-48312392-G-A p.Gln1043Gln synonymous ABCA13 1 79936 1.251E-5 39968 0 1.13368E-5
7-48312404-CAT-C p.Met1048fs frameshift ABCA13 1 79890 1.25172E-5 39945 0 3.18451E-5
7-48312412-C-T p.Thr1050Ile missense ABCA13 1 79868 1.25207E-5 39934 0 3.39328E-5
7-48312432-G-A p.Val1057Met missense ABCA13 1 79856 1.25225E-5 39928 0 3.1839E-5
7-48312432-G-T p.Val1057Leu missense ABCA13 34 79856 4.25766E-4 39928 1 0.00117122
7-48312445-C-T p.Thr1061Ile missense ABCA13 1 79852 1.25232E-5 39926 0 5.03525E-4
7-48312453-GGCCTCAAACAGCT-G p.Leu1065fs frameshift ABCA13 2 79870 2.50407E-5 39935 0 NA
7-48312454-G-A p.Gly1064Asp missense ABCA13 1 79860 1.25219E-5 39930 0 NA
7-48312456-C-T p.Leu1065Phe missense ABCA13 1 79866 1.2521E-5 39933 0 NA
7-48312461-A-G p.Lys1066Lys synonymous ABCA13 1 79862 1.25216E-5 39931 0 NA
7-48312485-T-C p.Asp1074Asp synonymous ABCA13 3 79878 3.75573E-5 39939 0 NA
7-48312489-C-T p.Arg1076Cys missense ABCA13 1 79894 1.25166E-5 39947 0 2.11439E-5
7-48312490-G-A p.Arg1076His missense ABCA13 1038 79864 0.0129971 39932 10 0.0589124
7-48312498-T-G p.Leu1079Val missense ABCA13 3 79900 3.75469E-5 39950 0 NA
7-48312503-T-C p.Phe1080Phe synonymous ABCA13 2 79918 2.50257E-5 39959 0 2.01203E-5
7-48312504-C-A p.Gln1081Lys missense ABCA13 2 79916 2.50263E-5 39958 0 NA
7-48312514-G-A p.Ser1084Asn missense ABCA13 1 79936 1.251E-5 39968 0 NA
7-48312517-A-C p.Gln1085Pro missense ABCA13 2 79956 2.50138E-5 39978 0 9.5124E-6
7-48312518-ATTC-A p.Phe1087del conservative_inframe_deletion ABCA13 1 79952 1.25075E-5 39976 0 NA
7-48312534-G-T p.Val1091Leu missense ABCA13 1 79962 1.25059E-5 39981 0 NA
7-48312543-C-T p.Leu1094Leu synonymous ABCA13 1 79946 1.25084E-5 39973 0 NA
7-48312555-A-G p.Lys1098Glu missense ABCA13 1 79932 1.25106E-5 39966 0 4.03242E-6
7-48312559-G-A p.Cys1099Tyr missense ABCA13 1 79914 1.25135E-5 39957 0 NA
7-48312585-T-C p.Ser1108Pro missense ABCA13 1 79848 1.25238E-5 39924 0 3.40588E-5
7-48312588-TC-T p.Val1110fs frameshift ABCA13 1 79840 1.2525E-5 39920 0 3.18593E-5
7-48312590-C-T c.*2546C>T splice_region ABCA13 36 79824 4.50992E-4 39912 0 4.83438E-4
7-48312591-G-A p.Val1110Ile missense ABCA13 18 79812 2.2553E-4 39906 0 0.00251762
7-48312598-A-G p.Tyr1112Cys missense ABCA13 1 79802 1.2531E-5 39901 0 8.43298E-6
7-48312603-A-G p.Thr1114Ala missense ABCA13 3 79754 3.76157E-5 39877 0 9.55475E-5
7-48312603-A-T p.Thr1114Ser missense ABCA13 1 79754 1.25386E-5 39877 0 NA
7-48312606-AG-A p.Ser1115fs frameshift ABCA13 1 79720 1.25439E-5 39860 0 1.20801E-5
7-48312607-G-C p.Ser1115Thr missense ABCA13 1 79708 1.25458E-5 39854 0 4.02693E-6
7-48312630-C-G p.Pro1123Ala missense ABCA13 1 79566 1.25682E-5 39783 0 3.18573E-5
7-48312637-C-A p.Ala1125Glu missense ABCA13 3 79554 3.77102E-5 39777 0 2.54891E-4
7-48312649-C-T p.Ser1129Leu missense ABCA13 2 79600 2.51256E-5 39800 0 2.23571E-4
7-48312651-A-G p.Asn1130Asp missense ABCA13 2 79602 2.5125E-5 39801 0 NA
7-48312656-C-T p.Leu1131Leu synonymous ABCA13 2 79648 2.51105E-5 39824 0 6.25E-4
7-48312657-T-TCAG p.Ala1133dup conservative_inframe_insertion ABCA13 1 79646 1.25556E-5 39823 0 NA
7-48312660-G-A p.Ala1133Thr missense ABCA13 1 79648 1.25552E-5 39824 0 NA
7-48312674-G-A p.Val1137Val synonymous ABCA13 39823 79450 0.501233 39725 9927 0.538335
7-48312679-A-G p.Asn1139Ser missense ABCA13 1 79772 1.25357E-5 39886 0 4.02198E-6
7-48312679-A-C p.Asn1139Thr missense ABCA13 1 79772 1.25357E-5 39886 0 NA
7-48312703-C-T p.Thr1147Ile missense ABCA13 2 79888 2.5035E-5 39944 0 4.01978E-6
7-48312704-C-T p.Thr1147Thr synonymous ABCA13 1 79884 1.25182E-5 39942 0 6.64033E-5
7-48312705-G-A p.Val1148Ile missense ABCA13 1 79888 1.25175E-5 39944 0 5.03525E-4
7-48312708-T-C p.Ser1149Pro missense ABCA13 2 79888 2.5035E-5 39944 0 4.01936E-6
7-48312711-T-C p.Trp1150Arg missense ABCA13 1 79906 1.25147E-5 39953 0 4.01913E-6
7-48312723-T-G p.Trp1154Gly missense ABCA13 122 79900 0.00152691 39950 0 0.00215825
7-48312735-T-C p.Trp1158Arg missense ABCA13 2 79868 2.50413E-5 39934 0 NA
7-48312743-C-G p.Thr1160Thr synonymous ABCA13 2 79858 2.50445E-5 39929 0 NA
7-48312752-A-G p.Gln1163Gln synonymous ABCA13 14 79858 1.75311E-4 39929 0 2.22987E-4
7-48312770-GA-G p.Asn1170fs frameshift ABCA13 2 79816 2.50576E-5 39908 0 2.49256E-5
7-48312771-A-T p.Asn1170Tyr missense ABCA13 3 79802 3.7593E-5 39901 0 3.18492E-5
7-48312774-G-A p.Val1171Ile missense ABCA13 2 79790 2.50658E-5 39895 0 NA
7-48312783-T-G p.Ser1174Ala missense ABCA13 1 79810 1.25298E-5 39905 0 NA
7-48312819-T-C p.Leu1186Leu synonymous ABCA13 3 79868 3.7562E-5 39934 0 5.04032E-4
7-48312819-T-A p.Leu1186Met missense ABCA13 1 79868 1.25207E-5 39934 0 4.02126E-6
7-48312820-T-A p.Leu1186* stop_gained ABCA13 3 79868 3.7562E-5 39934 0 1.60871E-5
7-48312823-A-C p.Glu1187Ala missense ABCA13 1 79842 1.25247E-5 39921 0 2.01081E-5
7-48312837-G-A p.Val1192Ile missense ABCA13 7 79846 8.76688E-5 39923 0 1.27405E-4
7-48312851-C-T p.Cys1196Cys synonymous ABCA13 1 79730 1.25423E-5 39865 0 NA
7-48312855-G-T p.Gly1198Cys missense ABCA13 1 79692 1.25483E-5 39846 0 NA
7-48312860-A-G p.Ile1199Met missense ABCA13 2 79668 2.51042E-5 39834 0 1.66867E-5
7-48312871-A-G p.His1203Arg missense ABCA13 1 79574 1.25669E-5 39787 0 8.3492E-6
7-48312888-A-G p.Ile1209Val missense ABCA13 5 79386 6.29834E-5 39693 0 6.85523E-5
7-48312907-A-G p.Asn1215Ser missense ABCA13 1 79334 1.26049E-5 39667 0 NA
7-48312911-A-G p.Val1216Val synonymous ABCA13 1 79308 1.26091E-5 39654 0 4.0333E-6
7-48312915-C-G p.Gln1218Glu missense ABCA13 2 79308 2.52181E-5 39654 0 8.08636E-6
7-48312915-C-A p.Gln1218Lys missense ABCA13 1 79310 1.26088E-5 39655 0 5.04032E-4
7-48312918-G-A p.Ala1219Thr missense ABCA13 1 79352 1.26021E-5 39676 0 NA
7-48312922-A-G p.Asn1220Ser missense ABCA13 2 79396 2.51902E-5 39698 0 8.38068E-6
7-48312923-TG-T p.Asp1221fs frameshift ABCA13 24 79406 3.02244E-4 39703 0 5.09619E-4
7-48312937-G-A p.Trp1225* stop_gained ABCA13 1 79434 1.25891E-5 39717 0 NA
7-48312939-G-A p.Glu1226Lys missense ABCA13 2 79450 2.51731E-5 39725 0 8.05575E-6
7-48312969-G-A p.Val1236Ile missense ABCA13 9 79392 1.13362E-4 39696 0 1.27584E-4
7-48312983-T-C p.Asn1240Asn synonymous ABCA13 1 79346 1.2603E-5 39673 0 8.06413E-6
7-48312986-A-T p.Ala1241Ala synonymous ABCA13 1 79318 1.26075E-5 39659 0 NA
7-48312990-G-A p.Val1243Ile missense ABCA13 3 79264 3.78482E-5 39632 0 9.55657E-5
7-48312997-T-TA p.Leu1248fs frameshift ABCA13 1 79190 1.26279E-5 39595 0 NA
7-48312999-A-G p.Lys1246Glu missense ABCA13 3 79160 3.78979E-5 39580 0 1.74605E-5
7-48313000-A-G p.Lys1246Arg missense ABCA13 37 79156 4.67431E-4 39578 0 4.68452E-4
7-48313003-A-T p.Lys1247Ile missense ABCA13 25 79130 3.15936E-4 39565 0 5.73504E-4
7-48313005-C-G p.Leu1248Val missense ABCA13 1 79114 1.264E-5 39557 0 3.18674E-5
7-48313020-G-A p.Val1253Met missense ABCA13 2 78872 2.53575E-5 39436 0 3.63418E-5
7-48313022-G-C p.Val1253Val synonymous ABCA13 1 78822 1.26868E-5 39411 0 4.05337E-6
7-48313025-G-C p.Glu1254Asp missense ABCA13 1 78752 1.26981E-5 39376 0 NA
7-48313033-T-A p.Leu1257His missense ABCA13 3 78660 3.81388E-5 39330 0 3.18756E-5
7-48313053-C-A p.Leu1264Met missense ABCA13 1 78542 1.2732E-5 39271 0 NA
7-48313070-A-G p.Thr1269Thr synonymous ABCA13 3 78668 3.81349E-5 39334 0 NA
7-48313084-A-G p.Glu1274Gly missense ABCA13 4 78804 5.07588E-5 39402 0 7.30873E-4
7-48313084-A-C p.Glu1274Ala missense ABCA13 3 78804 3.80691E-5 39402 0 1.30629E-5
7-48313091-A-C p.Thr1276Thr synonymous ABCA13 1739 78902 0.02204 39451 73 0.0422378
7-48313098-G-T p.Glu1279* stop_gained ABCA13 1 79004 1.26576E-5 39502 0 NA
7-48313105-T-A p.Leu1281* stop_gained ABCA13 6 79116 7.5838E-5 39558 0 1.81932E-4
7-48313119-G-A p.Glu1286Lys missense ABCA13 1 79292 1.26116E-5 39646 0 1.95626E-5
7-48313126-T-C p.Phe1288Ser missense ABCA13 1 79356 1.26014E-5 39678 0 3.75629E-5
7-48313129-T-C p.Ile1289Thr missense ABCA13 2 79398 2.51896E-5 39699 0 3.18573E-5
7-48313138-G-A p.Ser1292Asn missense ABCA13 1 79448 1.25868E-5 39724 0 NA
7-48313139-C-T p.Ser1292Ser synonymous ABCA13 1 79446 1.25872E-5 39723 0 5.03875E-6
7-48313144-C-T p.Thr1294Ile missense ABCA13 1 79464 1.25843E-5 39732 0 9.56145E-5
7-48313155-A-G p.Ile1298Val missense ABCA13 1749 79500 0.022 39750 72 0.0422616
7-48313156-T-C p.Ile1298Thr missense ABCA13 2 79528 2.51484E-5 39764 0 5.06088E-6
7-48313157-A-G p.Ile1298Met missense ABCA13 2 79522 2.51503E-5 39761 0 1.51243E-5
7-48313167-C-T p.Leu1302Leu synonymous ABCA13 12 79514 1.50917E-4 39757 0 5.04541E-4
7-48313180-A-G p.Asn1306Ser missense ABCA13 1 79460 1.25849E-5 39730 0 NA
7-48313193-AAAT-A p.Asn1312del conservative_inframe_deletion ABCA13 1 79374 1.25986E-5 39687 0 3.18552E-5
7-48313213-G-A p.Gly1317Glu missense ABCA13 2 79136 2.52729E-5 39568 0 NA
7-48313231-T-A p.Ile1323Asn missense ABCA13 1 78896 1.26749E-5 39448 0 NA
7-48313244-A-G p.Leu1327Leu synonymous ABCA13 5 78788 6.34614E-5 39394 0 3.18512E-5
7-48313256-A-G p.Ile1331Met missense ABCA13 1029 78766 0.013064 39383 10 0.0589124
7-48313274-A-G p.Val1337Val synonymous ABCA13 15 78896 1.90124E-4 39448 0 0.00100705
7-48313279-A-T p.His1339Leu missense ABCA13 1 78924 1.26704E-5 39462 0 3.18451E-5
7-48313284-C-T p.Arg1341* stop_gained ABCA13 2 78936 2.5337E-5 39468 0 6.30549E-5
7-48313285-G-A p.Arg1341Gln missense ABCA13 1 78964 1.2664E-5 39482 0 1.22609E-5
7-48313302-G-C p.Ala1347Pro missense ABCA13 1 79276 1.26142E-5 39638 0 3.18593E-5
7-48313303-CTGA-C p.Asp1348del conservative_inframe_deletion ABCA13 1 79292 1.26116E-5 39646 0 NA
7-48313320-G-C p.Val1353Leu missense ABCA13 1 79570 1.25676E-5 39785 0 NA
7-48313330-G-A p.Cys1356Tyr missense ABCA13 33 79690 4.14105E-4 39845 0 4.55818E-4
7-48313341-G-A p.Asp1360Asn missense ABCA13 118 79842 0.00147792 39921 0 0.00152973
7-48313342-A-T p.Asp1360Val missense ABCA13 1 79864 1.25213E-5 39932 0 4.10769E-6
7-48313362-A-G p.Thr1367Ala missense ABCA13 1 80034 1.24947E-5 40017 0 NA
7-48313362-A-T p.Thr1367Ser missense ABCA13 1 80034 1.24947E-5 40017 0 NA
7-48313374-A-C p.Met1371Leu missense ABCA13 1 80088 1.24863E-5 40044 0 3.18532E-5
7-48313379-A-T p.Leu1372Phe missense ABCA13 3 80106 3.74504E-5 40053 0 9.91552E-5
7-48313380-C-T p.Arg1373Cys missense ABCA13 3 80106 3.74504E-5 40053 0 3.18634E-5
7-48313381-G-T p.Arg1373Leu missense ABCA13 5 80118 6.24079E-5 40059 0 4.14092E-4
7-48313381-G-A p.Arg1373His missense ABCA13 9 80118 1.12334E-4 40059 0 1.59266E-4
7-48313390-A-G p.Asp1376Gly missense ABCA13 1 80112 1.24825E-5 40056 0 NA
7-48313393-C-T p.Thr1377Met missense ABCA13 12 80122 1.49772E-4 40061 0 8.16073E-5
7-48313407-T-C p.Phe1382Leu missense ABCA13 1 80126 1.24803E-5 40063 0 4.06808E-6
7-48313418-G-A p.Glu1385Glu synonymous ABCA13 2 80148 2.49538E-5 40074 0 4.06342E-6
7-48313427-TAGC-T p.Ser1390del disruptive_inframe_deletion ABCA13 12 80144 1.4973E-4 40072 0 2.54826E-4
7-48313429-G-A p.Ser1389Asn missense ABCA13 2 80132 2.49588E-5 40066 0 NA
7-48313451-A-G p.Val1396Val synonymous ABCA13 1 80148 1.24769E-5 40074 0 NA
7-48313481-G-C p.Leu1406Phe missense ABCA13 2 80132 2.49588E-5 40066 0 4.04217E-6
7-48313484-G-A p.Leu1407Leu synonymous ABCA13 1 80116 1.24819E-5 40058 0 2.42546E-5
7-48313504-A-C p.Gln1414Pro missense ABCA13 1 80110 1.24828E-5 40055 0 NA
7-48313509-C-T p.His1416Tyr missense ABCA13 10 80110 1.24828E-4 40055 0 6.25E-4
7-48313510-A-G p.His1416Arg missense ABCA13 25117 79894 0.314379 39947 4124 0.353831
7-48313516-A-C p.Gln1418Pro missense ABCA13 1 80132 1.24794E-5 40066 0 NA
7-48313534-T-C p.Phe1424Ser missense ABCA13 1 80126 1.24803E-5 40063 0 NA
7-48313548-A-G p.Asn1429Asp missense ABCA13 3 80124 3.7442E-5 40062 0 NA
7-48313563-A-G p.Ile1434Val missense ABCA13 1035 80096 0.012922 40048 10 0.0579637
7-48313575-G-GT p.Thr1439fs frameshift ABCA13 1 80078 1.24878E-5 40039 0 NA
7-48313578-A-G p.Thr1439Ala missense ABCA13 2 80084 2.49738E-5 40042 0 8.11939E-6
7-48313594-TA-T p.Lys1446fs frameshift ABCA13 3 80060 3.74719E-5 40030 0 3.1904E-5
7-48313599-A-AGCCATCTTCT p.Lys1446fs frameshift ABCA13 1 80064 1.249E-5 40032 0 NA
7-48313600-A-T p.Lys1446Ile missense ABCA13 4 80056 4.9965E-5 40028 0 4.06474E-6
7-48313601-A-C p.Lys1446Asn missense ABCA13 1 80052 1.24919E-5 40026 0 8.52079E-6
7-48313605-CTT-C p.Cys1449fs frameshift ABCA13 2 80052 2.49838E-5 40026 0 4.06431E-6
7-48313617-A-G p.Asn1452Asp missense ABCA13 4 80018 4.99888E-5 40009 0 1.62153E-5
7-48313635-T-A p.Cys1458Ser missense ABCA13 1 79984 1.25025E-5 39992 0 8.61237E-6
7-48313638-G-T p.Val1459Phe missense ABCA13 1 79978 1.25034E-5 39989 0 NA
7-48313650-T-C p.Leu1463Leu synonymous ABCA13 2 79926 2.50231E-5 39963 0 1.74929E-5
7-48313652-G-C p.Leu1463Phe missense ABCA13 1 79928 1.25113E-5 39964 0 1.75193E-5
7-48313682-A-G p.Val1473Val synonymous ABCA13 1 79848 1.25238E-5 39924 0 4.10324E-6
7-48313689-A-G p.Thr1476Ala missense ABCA13 6 79844 7.51465E-5 39922 0 9.11195E-6
7-48313692-G-A p.Val1477Ile missense ABCA13 2 79834 2.5052E-5 39917 0 3.18776E-5
7-48313698-G-A p.Glu1479Lys missense ABCA13 2 79808 2.50601E-5 39904 0 NA
7-48313757-G-A p.Lys1498Lys synonymous ABCA13 5875 79784 0.0736363 39892 229 0.102823
7-48313758-C-T p.Gln1499* stop_gained ABCA13 1 79868 1.25207E-5 39934 0 9.2785E-6
7-48313768-T-A p.Met1502Lys missense ABCA13 7 79868 8.76446E-5 39934 0 2.94475E-4
7-48313771-G-A p.Ser1503Asn missense ABCA13 1 79870 1.25203E-5 39935 0 3.18634E-5
7-48313775-C-G p.Ile1504Met missense ABCA13 3 79876 3.75582E-5 39938 0 3.18674E-5
7-48313778-C-T p.Asn1505Asn synonymous ABCA13 13 79900 1.62703E-4 39950 0 2.23044E-4
7-48313779-A-C p.Asn1506His missense ABCA13 2 79904 2.503E-5 39952 0 NA
7-48313786-C-A p.Thr1508Lys missense ABCA13 6 79928 7.50676E-5 39964 0 1.27486E-4
7-48313788-A-G p.Thr1509Ala missense ABCA13 1 79922 1.25122E-5 39961 0 4.0627E-6
7-48313789-C-A p.Thr1509Lys missense ABCA13 1 79914 1.25135E-5 39957 0 3.18654E-5
7-48313804-C-T p.Ala1514Val missense ABCA13 4 79898 5.00638E-5 39949 0 7.25401E-4
7-48313809-C-G p.Gln1516Glu missense ABCA13 1 79914 1.25135E-5 39957 0 NA
7-48313814-C-T p.Ser1517Ser synonymous ABCA13 1 79914 1.25135E-5 39957 0 NA
7-48313816-A-G p.Asn1518Ser missense ABCA13 1 79918 1.25128E-5 39959 0 8.78009E-6
7-48313825-AT-A p.Phe1522fs frameshift ABCA13 1 79902 1.25153E-5 39951 0 NA
7-48313833-G-A p.Glu1524Lys missense ABCA13 2 79924 2.50238E-5 39962 0 NA
7-48313846-G-C p.Arg1528Thr missense ABCA13 2 79914 2.50269E-5 39957 0 NA
7-48313848-C-G p.Pro1529Ala missense ABCA13 1 79930 1.25109E-5 39965 0 2.5572E-5
7-48313852-T-A p.Ile1530Lys missense ABCA13 1 79934 1.25103E-5 39967 0 NA
7-48313854-G-A p.Glu1531Lys missense ABCA13 121 79928 0.00151386 39964 0 0.00121035
7-48313859-G-A p.Met1532Ile missense ABCA13 4 79948 5.00325E-5 39974 0 3.18613E-5
7-48313881-T-C p.Phe1540Leu missense ABCA13 5940 79916 0.074328 39958 235 0.10423
7-48313885-A-G p.Gln1541Arg missense ABCA13 1 79992 1.25013E-5 39996 0 NA
7-48313893-T-C p.Trp1544Arg missense ABCA13 1 80028 1.24956E-5 40014 0 8.05873E-5
7-48313895-G-A p.Trp1544* stop_gained ABCA13 1 80026 1.24959E-5 40013 0 3.34661E-5
7-48313898-T-C p.Leu1545Leu synonymous ABCA13 2 80036 2.49888E-5 40018 0 3.18492E-5
7-48313901-T-C p.His1546His synonymous ABCA13 2 80060 2.49813E-5 40030 0 3.1841E-5
7-48313909-C-T p.Thr1549Ile missense ABCA13 1 80080 1.24875E-5 40040 0 NA
7-48313919-G-T p.Lys1552Asn missense ABCA13 1 80114 1.24822E-5 40057 0 1.61151E-5
7-48313927-A-G p.Gln1555Arg missense ABCA13 7 80116 8.73733E-5 40058 0 3.1839E-4
7-48313942-G-T p.Gly1560Val missense ABCA13 2 80120 2.49626E-5 40060 0 8.0588E-6
7-48313949-C-T p.Tyr1562Tyr synonymous ABCA13 8704 79962 0.108852 39981 510 0.128689
7-48313950-T-G p.Phe1563Val missense ABCA13 4 80128 4.99201E-5 40064 0 NA
7-48313993-T-A p.Leu1577* stop_gained ABCA13 1 80050 1.24922E-5 40025 0 NA
7-48313997-A-T p.Leu1578Phe missense ABCA13 1 80038 1.24941E-5 40019 0 NA
7-48313998-A-G p.Asn1579Asp missense ABCA13 1 80038 1.24941E-5 40019 0 6.66433E-5
7-48314003-AT-A p.Phe1581fs frameshift ABCA13 1 80006 1.24991E-5 40003 0 NA
7-48314008-C-T p.Ala1582Val missense ABCA13 1 80014 1.24978E-5 40007 0 NA
7-48314014-G-C p.Ser1584Thr missense ABCA13 1 79996 1.25006E-5 39998 0 6.3678E-5
7-48314027-G-A p.Lys1588Lys synonymous ABCA13 1 79978 1.25034E-5 39989 0 0.00100705
7-48314030-T-G p.Asp1589Glu missense ABCA13 1 79944 1.25088E-5 39972 0 8.312E-6
7-48314037-A-G p.Ser1592Gly missense ABCA13 2 79890 2.50344E-5 39945 0 NA
7-48314041-T-C p.Val1593Ala missense ABCA13 1 79858 1.25222E-5 39929 0 8.30579E-6
7-48314050-C-T p.Ser1596Phe missense ABCA13 2 79784 2.50677E-5 39892 0 8.30634E-6
7-48314050-C-G p.Ser1596Cys missense ABCA13 1 79784 1.25338E-5 39892 0 3.18492E-5
7-48314053-T-TCTGACATTTCTA p.Ile1597_Tyr1598insTerHisPheTyr stop_gained ABCA13 1 79750 1.25392E-5 39875 0 NA
7-48314065-C-A p.Ala1601Asp missense ABCA13 1 79562 1.25688E-5 39781 0 8.30551E-6
7-48314078-C-T p.Ala1605Ala synonymous ABCA13 1 79382 1.25973E-5 39691 0 4.02453E-6
7-48314089-C-G p.Ser1609Cys missense ABCA13 2 79082 2.52902E-5 39541 0 NA
7-48314096-C-A p.Asp1611Glu missense ABCA13 1 78600 1.27226E-5 39300 0 2.0133E-5
7-48314109-C-T p.Pro1616Ser missense ABCA13 13 77468 1.67811E-4 38734 0 3.65491E-4
7-48314114-A-T p.Lys1617Asn missense ABCA13 3 77082 3.89196E-5 38541 0 8.30537E-6
7-48314133-A-T p.Ile1624Leu missense ABCA13 1 76712 1.30358E-5 38356 0 6.63967E-5
7-48314143-C-T p.Ala1627Val missense ABCA13 1 76696 1.30385E-5 38348 0 0.00125
7-48314151-C-G p.Leu1630Val missense ABCA13 475 76686 0.00619409 38343 1 0.006875
7-48314158-T-G p.Ile1632Ser missense ABCA13 1 76784 1.30235E-5 38392 0 NA
7-48314160-C-A p.Gln1633Lys missense ABCA13 1 76782 1.30239E-5 38391 0 2.01522E-5
7-48314170-G-A p.Arg1636Lys missense ABCA13 1 77210 1.29517E-5 38605 0 6.37064E-5
7-48314171-G-A p.Arg1636Arg synonymous ABCA13 3 77232 3.8844E-5 38616 0 8.05685E-6
7-48314200-T-C p.Val1646Ala missense ABCA13 2 79098 2.52851E-5 39549 0 NA
7-48314209-C-G p.Thr1649Ser missense ABCA13 1 79306 1.26094E-5 39653 0 NA
7-48314212-G-T p.Ser1650Ile missense ABCA13 2 79358 2.52022E-5 39679 0 NA
7-48314227-G-C p.Gly1655Ala missense ABCA13 1 79614 1.25606E-5 39807 0 1.65653E-5
7-48314227-G-A p.Gly1655Asp missense ABCA13 1 79614 1.25606E-5 39807 0 4.01916E-6
7-48314232-A-G p.Met1657Val missense ABCA13 2 79698 2.50947E-5 39849 0 4.018E-6
7-48314248-A-C p.Lys1662Thr missense ABCA13 1 79884 1.25182E-5 39942 0 NA
7-48314266-G-A p.Arg1668His missense ABCA13 4 80054 4.99663E-5 40027 0 9.93772E-5
7-48314279-G-A p.Lys1672Lys synonymous ABCA13 12266 79926 0.153467 39963 951 0.173789
7-48314284-A-G p.Asp1674Gly missense ABCA13 1 80152 1.24763E-5 40076 0 NA
7-48314286-A-G p.Ile1675Val missense ABCA13 1 80156 1.24757E-5 40078 0 8.28116E-6
7-48314287-T-C p.Ile1675Thr missense ABCA13 1 80156 1.24757E-5 40078 0 8.02781E-6
7-48314291-C-T p.Asp1676Asp synonymous ABCA13 1 80160 1.2475E-5 40080 0 NA
7-48314298-G-A p.Val1679Met missense ABCA13 12 80200 1.49626E-4 40100 0 9.93838E-5
7-48314302-A-G p.Asp1680Gly missense ABCA13 2 80204 2.49364E-5 40102 0 1.20403E-5
7-48314303-T-C p.Asp1680Asp synonymous ABCA13 1 80208 1.24676E-5 40104 0 8.28226E-6
7-48314309-T-C p.Leu1682Leu synonymous ABCA13 1 80228 1.24645E-5 40114 0 NA
7-48314318-T-C p.Val1685Val synonymous ABCA13 1 80258 1.24598E-5 40129 0 1.20383E-5
7-48314330-A-G p.Leu1689Leu synonymous ABCA13 1042 80302 0.012976 40151 10 0.0599194
7-48314347-A-G p.Asn1695Ser missense ABCA13 4 80336 4.97909E-5 40168 0 3.1835E-5
7-48314355-A-T p.Ser1698Cys missense ABCA13 3 80360 3.7332E-5 40180 0 9.55231E-5
7-48314356-G-C p.Ser1698Thr missense ABCA13 3 80372 3.73264E-5 40186 0 8.42649E-5
7-48314359-T-C p.Val1699Ala missense ABCA13 1 80362 1.24437E-5 40181 0 8.28391E-6
7-48314389-T-C p.Leu1709Pro missense ABCA13 140 80424 0.00174077 40212 0 0.00353571
7-48314403-G-T p.Glu1714* stop_gained ABCA13 1 80428 1.24335E-5 40214 0 8.02542E-6
7-48314412-GCAGACAGCTCA-G p.Asp1718fs frameshift ABCA13 1 80414 1.24356E-5 40207 0 NA
7-48314436-G-A p.Val1725Ile missense ABCA13 1 80388 1.24397E-5 40194 0 8.28459E-6
7-48314460-C-T p.Arg1733Cys missense ABCA13 9 80322 1.12049E-4 40161 0 9.94266E-5
7-48314462-C-T p.Arg1733Arg synonymous ABCA13 2 80318 2.4901E-5 40159 0 2.48562E-5
7-48314466-T-C p.Phe1735Leu missense ABCA13 1 80304 1.24527E-5 40152 0 8.02555E-6
7-48314476-ATGT-A p.Val1740del disruptive_inframe_deletion ABCA13 1 80274 1.24573E-5 40137 0 NA
7-48314482-T-C p.Val1740Ala missense ABCA13 1 80264 1.24589E-5 40132 0 NA
7-48314529-C-CTCCT p.Gln1758fs frameshift ABCA13 1 80302 1.2453E-5 40151 0 NA
7-48314532-C-T p.Leu1757Leu synonymous ABCA13 8 80286 9.96438E-5 40143 0 9.55475E-5
7-48314534-G-T p.Leu1757Leu synonymous ABCA13 1 80292 1.24545E-5 40146 0 NA
7-48314549-T-C p.Gly1762Gly synonymous ABCA13 1 80294 1.24542E-5 40147 0 NA
7-48314561-T-C p.Thr1766Thr synonymous ABCA13 1 80312 1.24514E-5 40156 0 8.29119E-6
7-48314578-TCTACAGCTTCACA-T p.Tyr1773fs frameshift ABCA13 1 80304 1.24527E-5 40152 0 3.21177E-5
7-48314582-C-T p.Tyr1773Tyr synonymous ABCA13 1 80300 1.24533E-5 40150 0 4.01487E-6
7-48314584-G-C p.Ser1774Thr missense ABCA13 1 80312 1.24514E-5 40156 0 NA
7-48314591-A-C p.Thr1776Thr synonymous ABCA13 2 80308 2.49041E-5 40154 0 2.49087E-5
7-48314592-C-T p.Leu1777Phe missense ABCA13 10 80312 1.24514E-4 40156 0 5.03525E-4
7-48314593-T-G p.Leu1777Arg missense ABCA13 1 80308 1.24521E-5 40154 0 NA
7-48314604-A-T p.Ile1781Leu missense ABCA13 1 80276 1.2457E-5 40138 0 8.32113E-6
7-48314612-T-C p.Ile1783Ile synonymous ABCA13 1 80260 1.24595E-5 40130 0 1.66856E-5
7-48314621-C-T p.Ile1786Ile synonymous ABCA13 1 80186 1.2471E-5 40093 0 8.37802E-6
7-48314636-C-A p.Phe1791Leu missense ABCA13 1 80134 1.24791E-5 40067 0 3.38501E-5
7-48314636-C-T p.Phe1791Phe synonymous ABCA13 1 80134 1.24791E-5 40067 0 4.23126E-5
7-48314637-G-A p.Ala1792Thr missense ABCA13 1 80106 1.24835E-5 40053 0 6.37064E-5
7-48314658-T-C p.Leu1799Leu synonymous ABCA13 1 79986 1.25022E-5 39993 0 1.61803E-5
7-48314659-TG-T p.Asp1800fs frameshift ABCA13 1 79984 1.25025E-5 39992 0 NA
7-48314667-A-G p.Ile1802Val missense ABCA13 4 79952 5.003E-5 39976 0 8.54993E-6
7-48314670-G-A p.Glu1803Lys missense ABCA13 3 79942 3.75272E-5 39971 0 8.55945E-6
7-48314676-G-A p.Val1805Ile missense ABCA13 1 79942 1.25091E-5 39971 0 1.21635E-5
7-48314678-A-G p.Val1805Val synonymous ABCA13 1 79942 1.25091E-5 39971 0 6.3674E-5
7-48314679-T-A p.Ser1806Thr missense ABCA13 2 79928 2.50225E-5 39964 0 3.42747E-5
7-48314687-G-A p.Lys1808Lys synonymous ABCA13 1 79882 1.25185E-5 39941 0 3.43247E-5
7-48314694-A-G p.Ile1811Val missense ABCA13 1 79954 1.25072E-5 39977 0 8.10038E-6
7-48314702-A-T p.Ser1813Ser synonymous ABCA13 10 79998 1.25003E-4 39999 0 7.71182E-5
7-48314707-C-T p.Ala1815Val missense ABCA13 1 79990 1.25016E-5 39995 0 NA
7-48314708-T-A p.Ala1815Ala synonymous ABCA13 1 80002 1.24997E-5 40001 0 8.55769E-6
7-48314718-TTTCCTGTG-T p.Phe1819fs frameshift ABCA13 1 80066 1.24897E-5 40033 0 4.02937E-6
7-48314732-G-T p.Trp1823Cys missense ABCA13 4 80112 4.99301E-5 40056 1 NA
7-48314733-T-C p.Cys1824Arg missense ABCA13 1 80120 1.24813E-5 40060 0 8.44181E-6
7-48314736-T-C p.Trp1825Arg missense ABCA13 1 80128 1.248E-5 40064 0 4.01936E-6
7-48314760-C-T p.Arg1833Trp missense ABCA13 12 80186 1.49652E-4 40093 0 5.03525E-4
7-48314761-G-A p.Arg1833Gln missense ABCA13 6 80180 7.48316E-5 40090 0 4.16889E-5
7-48314775-A-G p.Ile1838Val missense ABCA13 7 80204 8.72774E-5 40102 0 1.49708E-4
7-48314798-G-T p.Gly1845Gly synonymous ABCA13 26201 79854 0.328111 39927 4400 0.341875
7-48314809-C-A p.Ser1849Tyr missense ABCA13 1 80074 1.24884E-5 40037 0 8.03284E-6
7-48314819-T-G p.Tyr1852* stop_gained ABCA13 1 80028 1.24956E-5 40014 0 8.29655E-6
7-48314834-T-C p.Ser1857Ser synonymous ABCA13 1 79940 1.25094E-5 39970 0 8.29449E-6
7-48314834-T-G p.Ser1857Arg missense ABCA13 1 79940 1.25094E-5 39970 0 NA
7-48314844-C-T p.His1861Tyr missense ABCA13 1 79894 1.25166E-5 39947 0 3.18532E-5
7-48314876-A-C p.Ser1871Ser synonymous ABCA13 795 79802 0.00996216 39901 23 0.0212183
7-48314880-T-A p.Cys1873Ser missense ABCA13 1 79810 1.25298E-5 39905 0 NA
7-48314896-C-T p.Ser1878Phe missense ABCA13 101 79862 0.00126468 39931 0 0.00185883
7-48314898-C-T p.Arg1879* stop_gained ABCA13 2 79878 2.50382E-5 39939 0 4.82377E-5
7-48314899-G-A p.Arg1879Gln missense ABCA13 1 79878 1.25191E-5 39939 0 3.21626E-5
7-48314907-A-T p.Ile1882Leu missense ABCA13 1 79956 1.25069E-5 39978 0 8.29807E-6
7-48314911-C-T p.Thr1883Ile missense ABCA13 4 79956 5.00275E-5 39978 0 4.019E-6
7-48314924-C-T p.Val1887Val synonymous ABCA13 1 80034 1.24947E-5 40017 0 5.03525E-4
7-48314926-G-T p.Cys1888Phe missense ABCA13 1 80050 1.24922E-5 40025 0 NA
7-48314929-T-A p.Ile1889Lys missense ABCA13 1042 80064 0.0130146 40032 10 0.0589124
7-48314934-C-A p.His1891Asn missense ABCA13 1 80084 1.24869E-5 40042 0 1.20518E-5
7-48314949-T-G p.Trp1896Gly missense ABCA13 1 80146 1.24772E-5 40073 0 NA
7-48314958-A-G p.Ile1899Val missense ABCA13 1 80158 1.24754E-5 40079 0 3.1841E-5
7-48314967-G-C p.Glu1902Gln missense ABCA13 3 80160 3.74252E-5 40080 0 2.00781E-5
7-48314972-C-T p.Leu1903Leu synonymous ABCA13 15 80174 1.87093E-4 40087 0 2.2293E-4
7-48314999-T-A p.Ser1912Ser synonymous ABCA13 3 80104 3.74513E-5 40052 0 9.64157E-5
7-48315003-G-A p.Val1914Met missense ABCA13 3 80078 3.74635E-5 40039 0 1.60729E-4
7-48315007-A-G p.Lys1915Arg missense ABCA13 1 80042 1.24934E-5 40021 0 NA
7-48315015-C-G p.Gln1918Glu missense ABCA13 1 80018 1.24972E-5 40009 0 NA
7-48315028-A-G p.His1922Arg missense ABCA13 2 80000 2.5E-5 40000 0 8.03878E-6
7-48315034-T-G p.Ile1924Arg missense ABCA13 3 79974 3.75122E-5 39987 0 1.66439E-5
7-48315040-C-T p.Pro1926Leu missense ABCA13 2 79964 2.50113E-5 39982 0 9.55414E-5
7-48315040-C-A p.Pro1926Gln missense ABCA13 1 79964 1.25056E-5 39982 0 NA
7-48315041-G-A p.Pro1926Pro synonymous ABCA13 219 79942 0.00273949 39971 0 0.00251762
7-48315047-C-T p.Val1928Val synonymous ABCA13 1 79940 1.25094E-5 39970 0 NA
7-48315048-C-T p.Pro1929Ser missense ABCA13 1 79946 1.25084E-5 39973 0 8.3221E-6
7-48315054-T-C p.Ser1931Pro missense ABCA13 3 79968 3.7515E-5 39984 0 8.04253E-6
7-48315061-A-G p.Asn1933Ser missense ABCA13 2 79934 2.50206E-5 39967 0 8.32348E-6
7-48315105-A-G p.Ile1948Val missense ABCA13 3 79720 3.76317E-5 39860 0 2.49767E-5
7-48315110-G-A p.Lys1949Lys synonymous ABCA13 1 79688 1.25489E-5 39844 0 NA
7-48315115-T-C p.Val1951Ala missense ABCA13 1 79648 1.25552E-5 39824 0 NA
7-48315117-G-A p.Ala1952Thr missense ABCA13 1 79616 1.25603E-5 39808 0 4.02421E-6
7-48315130-T-C p.Ile1956Thr missense ABCA13 1 79606 1.25619E-5 39803 0 NA
7-48315131-A-G p.Ile1956Met missense ABCA13 1 79594 1.25638E-5 39797 0 NA
7-48315142-A-G p.Lys1960Arg missense ABCA13 3 79552 3.77112E-5 39776 0 5.04549E-5
7-48315167-A-G p.Thr1968Thr synonymous ABCA13 2 79482 2.51629E-5 39741 0 NA
7-48315184-T-G p.Leu1974Arg missense ABCA13 1 79448 1.25868E-5 39724 0 NA
7-48315197-T-C p.Ser1978Ser synonymous ABCA13 1 79438 1.25884E-5 39719 0 1.01053E-5
7-48315202-T-C p.Leu1980Ser missense ABCA13 18 79438 2.26592E-4 39719 0 4.77616E-4
7-48315205-A-G p.Asn1981Ser missense ABCA13 1 79476 1.25824E-5 39738 0 NA
7-48315212-C-A p.Ile1983Ile synonymous ABCA13 4 79438 5.03537E-5 39719 0 1.68077E-5
7-48315212-C-T p.Ile1983Ile synonymous ABCA13 1 79438 1.25884E-5 39719 0 1.68077E-5
7-48315219-A-G p.Ile1986Val missense ABCA13 1 79440 1.25881E-5 39720 0 0.00125
7-48315229-A-G p.Asp1989Gly missense ABCA13 7 79420 8.8139E-5 39710 0 3.44053E-5
7-48315250-ATAT-A p.Ile1998del conservative_inframe_deletion ABCA13 3 79418 3.77748E-5 39709 0 NA
7-48315253-T-C p.Ile1997Thr missense ABCA13 1 79442 1.25878E-5 39721 0 4.43668E-6
7-48315264-A-C p.Asn2001His missense ABCA13 1 79446 1.25872E-5 39723 0 1.25335E-5
7-48315274-G-A p.Arg2004Lys missense ABCA13 2 79504 2.5156E-5 39752 0 8.93519E-6
7-48315277-C-T p.Thr2005Ile missense ABCA13 2 79532 2.51471E-5 39766 0 NA
7-48315286-T-C p.Leu2008Ser missense ABCA13 2 79598 2.51263E-5 39799 0 NA
7-48315291-T-C p.Ser2010Pro missense ABCA13 1 79630 1.25581E-5 39815 0 4.49301E-6
7-48315295-AAGAC-A p.Glu2011fs frameshift ABCA13 1 79630 1.25581E-5 39815 0 NA
7-48315309-G-A p.Glu2016Lys missense ABCA13 3 79716 3.76336E-5 39858 0 9.57304E-5
7-48315319-C-T p.Thr2019Met missense ABCA13 4 79758 5.01517E-5 39879 0 1.13105E-4
7-48315320-G-A p.Thr2019Thr synonymous ABCA13 4 79740 5.0163E-5 39870 0 7.5077E-5
7-48315323-T-C p.His2020His synonymous ABCA13 2 79780 2.50689E-5 39890 0 4.29934E-6
7-48315332-CT-C p.Ser2024fs frameshift ABCA13 10 79868 1.25207E-4 39934 0 8.9172E-4
7-48315334-C-G p.Ser2024Cys missense ABCA13 1 79898 1.2516E-5 39949 0 2.39843E-5
7-48315334-CT-C p.Leu2025fs frameshift ABCA13 1 79898 1.2516E-5 39949 0 NA
7-48315341-C-T p.Phe2026Phe synonymous ABCA13 2 79950 2.50156E-5 39975 0 1.17528E-5
7-48315348-C-G p.Leu2029Val missense ABCA13 1 79950 1.25078E-5 39975 0 1.14695E-5
7-48315360-A-G p.Asn2033Asp missense ABCA13 2736 79976 0.0342103 39988 72 0.0441117
7-48315363-G-A p.Val2034Ile missense ABCA13 1 80020 1.24969E-5 40010 0 NA
7-48315400-T-C p.Ile2046Thr missense ABCA13 1 80016 1.24975E-5 40008 0 5.84044E-5
7-48315425-C-T p.Asn2054Asn synonymous ABCA13