Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
9-107546599-T-C p.Val2261Val synonymous ABCA1 2 83188 2.40419E-5 41594 0 1.59215E-4
9-107546599-T-A p.Val2261Val synonymous ABCA1 2 83188 2.40419E-5 41594 0 1.15404E-4
9-107546609-T-G p.Glu2258Ala missense ABCA1 1 83176 1.20227E-5 41588 0 3.97947E-6
9-107546614-C-T p.Val2256Val synonymous ABCA1 3 83168 3.60716E-5 41584 0 6.25E-4
9-107546616-C-T p.Val2256Met missense ABCA1 2 83174 2.4046E-5 41587 0 NA
9-107546623-A-G p.Asp2253Asp synonymous ABCA1 1 83158 1.20253E-5 41579 0 NA
9-107546632-A-G p.Phe2250Phe synonymous ABCA1 1 83150 1.20265E-5 41575 0 NA
9-107546635-A-G p.Ser2249Ser synonymous ABCA1 2 83158 2.40506E-5 41579 0 3.18431E-5
9-107546638-T-C p.Thr2248Thr synonymous ABCA1 1 83166 1.20241E-5 41583 0 1.27389E-4
9-107546639-G-T p.Thr2248Lys missense ABCA1 2 83170 2.40471E-5 41585 0 8.23859E-6
9-107546640-T-A p.Thr2248Ser missense ABCA1 3 83170 3.60707E-5 41585 0 NA
9-107546641-G-A p.Leu2247Leu synonymous ABCA1 2 83174 2.4046E-5 41587 0 NA
9-107546651-A-G p.Val2244Ala missense ABCA1 2 83164 2.40489E-5 41582 0 3.18492E-5
9-107546651-A-T p.Val2244Asp missense ABCA1 2 83164 2.40489E-5 41582 0 NA
9-107546652-C-T p.Val2244Ile missense ABCA1 36 83158 4.32911E-4 41579 0 0.0025
9-107546653-G-T p.Asp2243Glu missense ABCA1 189 83160 0.00227273 41580 0 0.00586174
9-107546661-C-T p.Val2241Ile missense ABCA1 1 83168 1.20239E-5 41584 0 8.239E-6
9-107546681-G-A p.Ser2234Leu missense ABCA1 2 83138 2.40564E-5 41569 0 6.5925E-5
9-107546683-G-A p.Leu2233Leu synonymous ABCA1 1 83122 1.20305E-5 41561 0 NA
9-107546687-T-C p.Asp2232Gly missense ABCA1 1 83128 1.20296E-5 41564 0 6.37267E-5
9-107546691-T-G p.Lys2231Gln missense ABCA1 1 83114 1.20317E-5 41557 0 3.98026E-6
9-107546695-G-C p.His2229Gln missense ABCA1 2 83094 2.40691E-5 41547 0 1.6484E-5
9-107546706-C-G p.Asp2226His missense ABCA1 1 83060 1.20395E-5 41530 0 3.98096E-6
9-107546714-T-TCCTTGGCAAAGTTCACAAATACCTGTTAAAAGATTAAGATGGACCTTTATAAATACCACTCA p.Asp2223fs frameshift ABCA1 1 83024 1.20447E-5 41512 0 3.98124E-6
9-107546728-C-G p.Val2218Val synonymous ABCA1 1 82910 1.20613E-5 41455 0 5.03525E-4
9-107546736-C-CTTGGTCAAGTGTTGTCTGAGAAACAGAGTAGTCTTCTATGTGGAGTCG c.6646-1_6646insCGACTCCACATAGAAGACTACTCTGTTTCTCAGACAACACTTGACCAA splice_acceptor ABCA1 4 82832 4.82905E-5 41416 2 NA
9-107546736-C-CTTGGT c.6646-1_6646insACCAA splice_acceptor ABCA1 2 82832 2.41453E-5 41416 0 NA
9-107546736-C-CTTGGTCAAGTGTTGT c.6646-1_6646insACAACACTTGACCAA splice_acceptor ABCA1 1 82832 1.20726E-5 41416 0 NA
9-107546738-T-A c.6646-2A>T splice_acceptor ABCA1 2 82804 2.41534E-5 41402 0 3.18471E-5
9-107547713-T-G p.Ile2203Ile synonymous ABCA1 2 82796 2.41558E-5 41398 0 8.24674E-6
9-107547723-C-T p.Arg2200Gln missense ABCA1 14 82808 1.69066E-4 41404 0 8.36547E-5
9-107547731-G-A p.Ser2197Ser synonymous ABCA1 1 82812 1.20755E-5 41406 0 NA
9-107547734-C-G p.Gln2196His missense ABCA1 15 82822 1.81111E-4 41411 0 2.55918E-4
9-107547745-T-G p.Ile2193Leu missense ABCA1 1 82794 1.20782E-5 41397 0 4.12242E-5
9-107547753-A-G p.Ile2190Thr missense ABCA1 2 82766 2.41645E-5 41383 0 NA
9-107547757-T-C p.Arg2189Gly missense ABCA1 1 82756 1.20837E-5 41378 0 8.24443E-6
9-107547758-G-A p.Ala2188Ala synonymous ABCA1 3 82754 3.6252E-5 41377 0 9.55353E-5
9-107547767-A-C p.Ser2185Ser synonymous ABCA1 39 82782 4.71117E-4 41391 0 0.00127364
9-107547768-G-A p.Ser2185Phe missense ABCA1 1 82790 1.20788E-5 41395 0 3.9833E-6
9-107547770-T-C p.Leu2184Leu synonymous ABCA1 1 82798 1.20776E-5 41399 0 4.12167E-5
9-107547777-G-A p.Ser2182Phe missense ABCA1 7 82780 8.45615E-5 41390 0 1.59215E-4
9-107547788-G-A p.Tyr2178Tyr synonymous ABCA1 1 82804 1.20767E-5 41402 0 8.2428E-6
9-107547791-T-C p.Gln2177Gln synonymous ABCA1 1 82832 1.20726E-5 41416 0 NA
9-107547804-C-T p.Arg2173Gln missense ABCA1 1 82846 1.20706E-5 41423 0 8.2447E-6
9-107547805-G-A p.Arg2173Trp missense ABCA1 4 82840 4.82859E-5 41420 0 3.29783E-5
9-107547805-G-T p.Arg2173Arg synonymous ABCA1 2 82840 2.41429E-5 41420 0 NA
9-107547807-T-C p.His2172Arg missense ABCA1 2 82862 2.41365E-5 41431 0 NA
9-107547818-T-C p.Leu2168Leu synonymous ABCA1 4 82882 4.82614E-5 41441 0 3.18512E-5
9-107547821-A-T p.Val2167Val synonymous ABCA1 1 82874 1.20665E-5 41437 0 NA
9-107547832-G-A p.Pro2164Ser missense ABCA1 1 82896 1.20633E-5 41448 0 1.64987E-5
9-107547836-T-C p.Ala2162Ala synonymous ABCA1 2 82910 2.41225E-5 41455 0 7.96331E-6
9-107547839-A-C p.Leu2161Leu synonymous ABCA1 2 82892 2.41278E-5 41446 0 NA
9-107547872-C-T p.Pro2150Pro synonymous ABCA1 404 82760 0.00488159 41380 8 0.0106369
9-107547873-G-A p.Pro2150Leu missense ABCA1 5 82754 6.042E-5 41377 0 6.25E-4
9-107547895-C-T p.Val2143Ile missense ABCA1 1 82520 1.21183E-5 41260 0 NA
9-107547895-C-A p.Val2143Leu missense ABCA1 1 82520 1.21183E-5 41260 0 NA
9-107547898-C-A p.Val2142Phe missense ABCA1 1 82472 1.21253E-5 41236 0 NA
9-107547899-T-A p.Ile2141Ile synonymous ABCA1 1 82448 1.21289E-5 41224 0 NA
9-107547923-G-A c.6402-3C>T splice_region ABCA1 1 81758 1.22312E-5 40879 0 NA
9-107548581-A-G p.Asn2133Asn splice_region+synonymous ABCA1 1 82974 1.2052E-5 41487 0 8.25219E-6
9-107548581-AT-A p.Asn2133fs frameshift ABCA1 1 82974 1.2052E-5 41487 0 NA
9-107548589-G-A p.Leu2131Leu synonymous ABCA1 2 83022 2.409E-5 41511 0 NA
9-107548605-A-C p.Leu2125Leu synonymous ABCA1 3 83070 3.61141E-5 41535 0 NA
9-107548624-T-A p.Asn2119Ile missense ABCA1 2 83096 2.40685E-5 41548 0 NA
9-107548626-G-A p.Val2118Val synonymous ABCA1 3 83088 3.61063E-5 41544 0 NA
9-107548629-C-T p.Met2117Ile missense ABCA1 1 83086 1.20357E-5 41543 0 NA
9-107548644-AG-A p.Thr2112fs frameshift ABCA1 1 83022 1.2045E-5 41511 0 3.98051E-6
9-107548664-C-T p.Glu2106Lys missense ABCA1 1 82934 1.20578E-5 41467 0 8.23995E-6
9-107548673-T-TATGAGATGTAAGCACTACTGATCTCCCCTCCTTGACAACACTTA c.6309-3_6309-2insTAAGTGTTGTCAAGGAGGGGAGATCAGTAGTGCTTACATCTCAT splice_region ABCA1 4 82796 4.83115E-5 41398 1 NA
9-107548675-C-T c.6309-4G>A splice_region ABCA1 18 82758 2.17502E-4 41379 0 5.85248E-4
9-107548676-G-A c.6309-5C>T splice_region ABCA1 1 82744 1.20855E-5 41372 0 2.47304E-5
9-107548677-G-A c.6309-6C>T splice_region ABCA1 4 82744 4.83419E-5 41372 0 6.3678E-5
9-107549146-C-T c.6308+8G>A splice_region ABCA1 1 83092 1.20349E-5 41546 0 NA
9-107549164-T-A p.Thr2100Ser missense ABCA1 1 83124 1.20302E-5 41562 0 NA
9-107549168-C-T p.Val2098Val synonymous ABCA1 9 83116 1.08282E-4 41558 0 3.97953E-5
9-107549194-C-T p.Val2090Ile missense ABCA1 1 83156 1.20256E-5 41578 0 NA
9-107549220-C-T p.Arg2081Gln missense ABCA1 1 83132 1.20291E-5 41566 0 1.19403E-5
9-107549221-G-A p.Arg2081Trp missense ABCA1 1 83130 1.20294E-5 41565 0 NA
9-107549246-G-T p.Thr2072Thr synonymous ABCA1 1 83112 1.2032E-5 41556 0 8.24892E-6
9-107550194-T-C c.6204+7A>G splice_region ABCA1 6 83178 7.21345E-5 41589 0 0.001875
9-107550197-T-G c.6204+4A>C splice_region ABCA1 1 83184 1.20215E-5 41592 0 3.18431E-5
9-107550201-C-G p.Leu2068Leu splice_region+synonymous ABCA1 4 83238 4.8055E-5 41619 0 6.36983E-5
9-107550212-C-T p.Val2065Met missense ABCA1 1 83288 1.20065E-5 41644 0 3.18512E-5
9-107550218-G-A p.Pro2063Ser missense ABCA1 1 83296 1.20054E-5 41648 0 3.97915E-6
9-107550222-G-A p.Gly2061Gly synonymous ABCA1 4242 83302 0.0509231 41651 269 0.0822402
9-107550224-C-T p.Gly2061Ser missense ABCA1 2 83368 2.399E-5 41684 0 7.9545E-6
9-107550225-G-A p.Ile2060Ile synonymous ABCA1 4 83368 4.798E-5 41684 0 3.29511E-5
9-107550228-C-T p.Leu2059Leu synonymous ABCA1 1 83372 1.19944E-5 41686 0 NA
9-107550274-T-C p.Asn2044Ser missense ABCA1 1 83392 1.19916E-5 41696 0 3.97706E-6
9-107550285-T-G p.Lys2040Asn missense ABCA1 1 83386 1.19924E-5 41693 0 NA
9-107550287-T-C p.Lys2040Glu missense ABCA1 19 83378 2.27878E-4 41689 0 4.37508E-5
9-107550303-G-A p.Leu2034Leu synonymous ABCA1 14 83364 1.67938E-4 41682 0 2.22873E-4
9-107550316-C-T p.Arg2030Gln missense ABCA1 3 83348 3.59937E-5 41674 0 0.00100806
9-107550321-C-T p.Ala2028Ala synonymous ABCA1 1 83328 1.20008E-5 41664 0 8.23737E-6
9-107550322-G-A p.Ala2028Val missense ABCA1 24 83316 2.8806E-4 41658 0 5.04032E-4
9-107550337-T-TTGCCAACTTCTTTCTCTGGGACTCCTCTCAAAAGGGC c.6070-3_6070-2insGCCCTTTTGAGAGGAGTCCCAGAGAAAGAAGTTGGCA splice_region ABCA1 1 83276 1.20083E-5 41638 0 NA
9-107550337-T-TTGCCA c.6070-3_6070-2insTGGCA splice_region ABCA1 2 83276 2.40165E-5 41638 1 NA
9-107550337-T-TTGCCAACTTCTTTCTCTGGGACTCCTCTCA c.6070-3_6070-2insTGAGAGGAGTCCCAGAGAAAGAAGTTGGCA splice_region ABCA1 1 83276 1.20083E-5 41638 0 NA
9-107550337-T-TTGCCAACTTCTTTCTCTGGGACTCCTCTCAAAAGGGCAA c.6070-3_6070-2insTTGCCCTTTTGAGAGGAGTCCCAGAGAAAGAAGTTGGCA splice_region ABCA1 1 83276 1.20083E-5 41638 0 NA
9-107550728-G-A p.Val2016Val synonymous ABCA1 1 82852 1.20697E-5 41426 0 6.36699E-5
9-107550741-A-C p.Leu2012Arg missense ABCA1 1 82818 1.20747E-5 41409 0 3.98232E-6
9-107550758-G-A p.His2006His synonymous ABCA1 28 82766 3.38303E-4 41383 0 1.99144E-4
9-107550766-T-C p.Arg2004Gly missense ABCA1 2 82730 2.4175E-5 41365 0 3.98327E-6
9-107550767-C-T p.Gly2003Gly synonymous ABCA1 1 82722 1.20887E-5 41361 0 2.47304E-5
9-107550770-A-C p.Thr2002Thr synonymous ABCA1 4 82716 4.83582E-5 41358 0 5.03525E-4
9-107550784-T-A p.Thr1998Ser missense ABCA1 1 82656 1.20983E-5 41328 0 NA
9-107550814-T-G p.Met1988Leu missense ABCA1 5 82562 6.05605E-5 41281 0 8.25137E-6
9-107550815-G-T p.Asn1987Lys missense ABCA1 1 82538 1.21156E-5 41269 0 NA
9-107550822-T-G p.His1985Pro missense ABCA1 1 82508 1.212E-5 41254 0 1.65079E-5
9-107550823-G-A p.His1985Tyr missense ABCA1 6 82500 7.27273E-5 41250 0 4.95303E-5
9-107550832-G-C p.His1982Asp missense ABCA1 1 82490 1.21227E-5 41245 0 NA
9-107550837-T-C p.Asn1980Ser missense ABCA1 2 82470 2.42512E-5 41235 0 NA
9-107550838-T-C p.Asn1980Asp missense ABCA1 1 82456 1.21277E-5 41228 0 NA
9-107550848-A-G p.Ser1976Ser splice_region+synonymous ABCA1 1 82430 1.21315E-5 41215 0 NA
9-107553206-T-A p.Asn1975Ile missense ABCA1 1 82976 1.20517E-5 41488 0 2.78733E-5
9-107553225-C-G p.Asp1969His missense ABCA1 1 83078 1.20369E-5 41539 0 NA
9-107553235-A-T p.Val1965Val synonymous ABCA1 4 83112 4.81278E-5 41556 0 8.24008E-6
9-107553252-T-C p.Thr1960Ala missense ABCA1 1 83142 1.20276E-5 41571 0 3.18388E-5
9-107553259-C-T p.Lys1957Lys synonymous ABCA1 1 83128 1.20296E-5 41564 0 1.59222E-5
9-107553285-C-CCCTATGTACATGTACCT p.Gly1949fs frameshift ABCA1 1 83106 1.20328E-5 41553 0 NA
9-107553301-C-T p.Gly1943Gly synonymous ABCA1 1 83056 1.20401E-5 41528 0 NA
9-107553311-T-TCACCAG c.5821-3_5821-2insCTGGTG splice_region ABCA1 1 82974 1.2052E-5 41487 0 NA
9-107553311-T-TCACCAGGAG c.5821-3_5821-2insCTCCTGGTG splice_region ABCA1 2 82974 2.41039E-5 41487 1 NA
9-107553317-G-C c.5821-8C>G splice_region ABCA1 1 82860 1.20685E-5 41430 0 NA
9-107554224-G-A p.Pro1938Leu missense ABCA1 2 82966 2.41063E-5 41483 0 0.00151057
9-107554225-G-A p.Pro1938Ser missense ABCA1 1 82960 1.2054E-5 41480 0 NA
9-107554226-A-G p.Pro1937Pro synonymous ABCA1 1 82958 1.20543E-5 41479 0 8.77809E-6
9-107554237-C-T p.Val1934Met missense ABCA1 2 82982 2.41016E-5 41491 0 1.39244E-4
9-107554238-G-A p.Cys1933Cys synonymous ABCA1 3 82978 3.61542E-5 41489 0 3.18471E-5
9-107554257-G-A p.Pro1927Leu missense ABCA1 1 82938 1.20572E-5 41469 0 NA
9-107554263-C-T p.Arg1925Gln missense ABCA1 140 82898 0.00168882 41449 0 0.00414013
9-107554264-G-A p.Arg1925Trp missense ABCA1 1 82888 1.20645E-5 41444 0 6.36943E-5
9-107554264-G-C p.Arg1925Gly missense ABCA1 1 82888 1.20645E-5 41444 0 6.25E-4
9-107554270-T-C p.Arg1923Gly missense ABCA1 1 82892 1.20639E-5 41446 0 1.20187E-5
9-107554274-A-G p.Tyr1921Tyr synonymous ABCA1 1305 82868 0.0157479 41434 62 0.0325242
9-107554274-ATA-GTT p.Tyr1921Asn missense ABCA1 1 82880 1.20656E-5 41440 0 NA
9-107554275-T-C p.Tyr1921Cys missense ABCA1 2 82870 2.41342E-5 41435 0 NA
9-107554276-A-G p.Tyr1921His missense ABCA1 1 82866 1.20677E-5 41433 0 6.25E-4
9-107554278-A-G p.Ile1920Thr missense+splice_region ABCA1 1 82852 1.20697E-5 41426 0 NA
9-107554281-T-TTC c.5758-3_5758-2insGA splice_region ABCA1 1 82820 1.20744E-5 41410 0 NA
9-107554282-G-T c.5758-3C>A splice_region ABCA1 1 82802 1.2077E-5 41401 0 9.23515E-6
9-107555057-ACT-A c.5757+8_5757+9delAG splice_region ABCA1 6 82604 7.26357E-5 41302 0 3.29554E-5
9-107555061-T-G c.5757+6A>C splice_region ABCA1 3 82680 3.62845E-5 41340 0 6.3678E-5
9-107555070-C-T p.Thr1918Thr synonymous ABCA1 2 82796 2.41558E-5 41398 0 4.11936E-5
9-107555071-G-A p.Thr1918Met missense ABCA1 2 82810 2.41517E-5 41405 0 4.38055E-5
9-107555077-T-G p.Glu1916Ala missense ABCA1 49 82886 5.91173E-4 41443 0 0.00159266
9-107555088-T-C p.Leu1912Leu synonymous ABCA1 1 82972 1.20523E-5 41486 0 NA
9-107555112-A-G p.Asp1904Asp synonymous ABCA1 2 83132 2.40581E-5 41566 0 NA
9-107555115-A-G p.Leu1903Leu synonymous ABCA1 1 83130 1.20294E-5 41565 0 NA
9-107555134-C-T p.Arg1897Gln missense ABCA1 2 83204 2.40373E-5 41602 0 6.3678E-5
9-107555135-G-A p.Arg1897Trp missense ABCA1 1 83200 1.20192E-5 41600 0 6.37024E-5
9-107555150-C-T p.Asp1892Asn missense ABCA1 1 83218 1.20166E-5 41609 0 3.97921E-6
9-107555167-G-A p.Ser1886Phe missense ABCA1 4 83218 4.80665E-5 41609 0 2.47276E-5
9-107555168-A-G p.Ser1886Pro missense ABCA1 2 83228 2.40304E-5 41614 0 NA
9-107555169-T-C p.Leu1885Leu synonymous ABCA1 9 83230 1.08134E-4 41615 0 9.55171E-5
9-107555175-T-C p.Ala1883Ala synonymous ABCA1 8 83220 9.61307E-5 41610 0 9.55353E-5
9-107555178-A-G p.Asn1882Asn synonymous ABCA1 1 83222 1.20161E-5 41611 0 NA
9-107555188-CT-C c.5637-2delA splice_acceptor ABCA1 2 83206 2.40367E-5 41603 1 NA
9-107555189-T-TGGGCCTGATGAAGAATCTGTAC c.5637-3_5637-2insGTACAGATTCTTCATCAGGCCC splice_region ABCA1 2 83202 2.40379E-5 41601 0 NA
9-107555190-TG-T c.5637-4delC splice_region ABCA1 56 83182 6.73223E-4 41591 2 4.45828E-4
9-107555192-G-A c.5637-5C>T splice_region ABCA1 1 83174 1.2023E-5 41587 0 3.98527E-6
9-107555194-G-A c.5637-7C>T splice_region ABCA1 1 83178 1.20224E-5 41589 0 NA
9-107555460-G-A p.Ile1876Ile synonymous ABCA1 1 82960 1.2054E-5 41480 0 8.2375E-6
9-107555463-G-C p.Phe1875Leu missense ABCA1 1 82962 1.20537E-5 41481 0 3.98156E-6
9-107555467-A-C p.Phe1874Cys missense ABCA1 1 82978 1.20514E-5 41489 0 1.6475E-5
9-107555477-G-A p.Gln1871* stop_gained ABCA1 1 83000 1.20482E-5 41500 0 NA
9-107555478-G-A p.Ile1870Ile synonymous ABCA1 1 82994 1.20491E-5 41497 0 7.96235E-6
9-107555493-G-A p.Leu1865Leu synonymous ABCA1 1 83022 1.2045E-5 41511 0 NA
9-107555501-A-C p.Phe1863Val missense ABCA1 2 83032 2.40871E-5 41516 0 NA
9-107555516-C-T p.Val1858Met missense ABCA1 1 83052 1.20406E-5 41526 0 3.18471E-5
9-107555517-G-A p.Ala1857Ala synonymous ABCA1 4 83056 4.81603E-5 41528 0 1.64791E-5
9-107555523-G-A p.Ala1855Ala synonymous ABCA1 7 83046 8.42906E-5 41523 0 NA
9-107555526-G-A p.Phe1854Phe synonymous ABCA1 1 83046 1.20415E-5 41523 0 1.64799E-5
9-107555548-T-C p.Asp1847Gly missense ABCA1 1 83022 1.2045E-5 41511 0 NA
9-107555568-A-G p.Phe1840Phe synonymous ABCA1 2 83008 2.40941E-5 41504 0 NA
9-107555570-A-G p.Phe1840Leu missense ABCA1 2 83010 2.40935E-5 41505 0 3.18593E-5
9-107555572-C-T p.Arg1839His missense ABCA1 2 83000 2.40964E-5 41500 0 9.55779E-5
9-107555573-G-A p.Arg1839Cys missense ABCA1 1 82998 1.20485E-5 41499 0 1.649E-5
9-107555574-A-G p.Asn1838Asn synonymous ABCA1 3 83004 3.61428E-5 41502 0 NA
9-107555577-C-T p.Glu1837Glu synonymous ABCA1 1 83002 1.20479E-5 41501 0 5.03525E-4
9-107555583-T-G c.5507-2A>C splice_acceptor ABCA1 1 82968 1.20528E-5 41484 0 NA
9-107555589-A-G c.5507-8T>C splice_region ABCA1 1 82932 1.20581E-5 41466 0 NA
9-107556672-C-A p.Arg1834Ser missense ABCA1 4 83114 4.81267E-5 41557 0 2.78467E-5
9-107556681-G-C p.Ala1831Ala synonymous ABCA1 2 83194 2.40402E-5 41597 0 8.2375E-6
9-107556682-G-A p.Ala1831Val missense ABCA1 4 83192 4.80815E-5 41596 0 2.23342E-4
9-107556710-T-G p.Met1822Leu missense ABCA1 1 83260 1.20106E-5 41630 0 NA
9-107556714-G-A p.Ile1820Ile synonymous ABCA1 1 83248 1.20123E-5 41624 0 1.64785E-5
9-107556717-G-A p.Leu1819Leu synonymous ABCA1 3 83258 3.60326E-5 41629 0 7.95646E-6
9-107556725-G-A p.Arg1817* stop_gained ABCA1 1 83234 1.20143E-5 41617 0 8.24076E-6
9-107556758-C-T p.Val1806Met missense ABCA1 1 82982 1.20508E-5 41491 0 2.47733E-5
9-107556759-G-A p.Ser1805Ser synonymous ABCA1 2 82958 2.41086E-5 41479 0 5.03525E-4
9-107556765-C-T p.Leu1803Leu synonymous ABCA1 6 82822 7.24445E-5 41411 0 1.21272E-5
9-107556768-G-A p.Ile1802Ile synonymous ABCA1 14 82672 1.69344E-4 41336 0 2.57353E-4
9-107556768-G-T p.Ile1802Ile synonymous ABCA1 12 82672 1.45152E-4 41336 0 4.04412E-4
9-107556774-A-G p.Asn1800Asn synonymous ABCA1 1 82394 1.21368E-5 41197 0 NA
9-107556776-T-G p.Asn1800His missense ABCA1 36 82266 4.37605E-4 41133 0 6.7598E-4
9-107556788-GCTTCT-G p.Lys1795_Leu1796del splice_acceptor ABCA1 1 80598 1.24073E-5 40299 0 NA
9-107556790-TTC-T p.Lys1795fs frameshift ABCA1 9 79988 1.12517E-4 39994 0 8.59254E-5
9-107556791-T-TATTGTCGGTGAACAGCTCCAGCACAAAGGTGGCCACGCTGC c.5383-1_5383insGCAGCGTGGCCACCTTTGTGCTGGAGCTGTTCACCGACAAT splice_acceptor ABCA1 3 79530 3.77216E-5 39765 1 NA
9-107556791-T-TATTGTCGGTGAACAG c.5383-1_5383insCTGTTCACCGACAAT splice_acceptor ABCA1 1 79530 1.25739E-5 39765 0 NA
9-107556792-C-CAAA c.5383-2_5383-1insTTT splice_acceptor ABCA1 2 79024 2.53088E-5 39512 0 2.4215E-4
9-107556792-C-CAA c.5383-2_5383-1insTT splice_acceptor ABCA1 4 79028 5.0615E-5 39514 0 1.15048E-4
9-107556792-C-CA c.5383-2_5383-1insT splice_acceptor ABCA1 1 79026 1.26541E-5 39513 0 NA
9-107556792-C-A c.5383-1G>T splice_acceptor ABCA1 2 79012 2.53126E-5 39506 0 1.21075E-4
9-107556793-T-TAA c.5383-3_5383-2insTT splice_region ABCA1 3481 77882 0.0446958 38941 1185 0.153307
9-107556793-T-TAAA c.5383-3_5383-2insTTT splice_region ABCA1 14222 75186 0.189158 37593 4896 0.554213
9-107556793-T-TAAAA c.5383-3_5383-2insTTTT splice_region ABCA1 2255 78222 0.0288282 39111 778 0.123872
9-107556793-T-TAAAAA c.5383-3_5383-2insTTTTT splice_region ABCA1 501 78626 0.00637194 39313 153 0.0267066
9-107556793-TA-T c.5383-3delT splice_region ABCA1 1822 78120 0.0233231 39060 19 0.136572
9-107556793-TAA-T c.5383-4_5383-3delTT splice_region ABCA1 68 78574 8.65426E-4 39287 0 NA
9-107556793-T-TAAAAAA c.5383-3_5383-2insTTTTTT splice_region ABCA1 150 78684 0.00190636 39342 41 NA
9-107556793-TAAA-T c.5383-5_5383-3delTTT splice_region ABCA1 2 78686 2.54175E-5 39343 0 NA
9-107556793-T-A c.5383-2A>T splice_acceptor ABCA1 7 78646 8.90064E-5 39323 1 NA
9-107556793-T-TAAAAAAA c.5383-3_5383-2insTTTTTTT splice_region ABCA1 40 78692 5.08311E-4 39346 13 NA
9-107556793-T-TAAAAAAAA c.5383-4_5383-3insTTTTTTTT splice_region ABCA1 9 78700 1.14358E-4 39350 2 NA
9-107556793-T-TAAAAAAAAA c.5383-3_5383-2insTTTTTTTTT splice_region ABCA1 1 78704 1.27058E-5 39352 0 NA
9-107556793-TAAAA-T c.5383-6_5383-3delTTTT splice_region ABCA1 1 78704 1.27058E-5 39352 0 NA
9-107556793-T-TAAAAAAAAAAAAA c.5383-3_5383-2insTTTTTTTTTTTTT splice_region ABCA1 2 78704 2.54117E-5 39352 0 NA
9-107556793-T-TTAA c.5383-3_5383-2insTTA splice_region ABCA1 1 78704 1.27058E-5 39352 0 NA
9-107558334-A-G p.Asn1794Asn splice_region+synonymous ABCA1 1 82174 1.21693E-5 41087 0 NA
9-107558339-C-T p.Asp1793Asn missense ABCA1 3 82238 3.64795E-5 41119 0 2.3903E-5
9-107558340-G-A p.Thr1792Thr synonymous ABCA1 231 82252 0.00280844 41126 1 0.00705645
9-107558354-G-A p.Leu1788Leu synonymous ABCA1 1 82504 1.21206E-5 41252 0 3.29511E-5
9-107558370-G-A p.Ser1782Ser synonymous ABCA1 2 82696 2.4185E-5 41348 0 3.18451E-5
9-107558387-T-C p.Ile1777Val missense ABCA1 3 82898 3.61891E-5 41449 0 8.23778E-6
9-107558399-C-T p.Val1773Met missense ABCA1 2 82988 2.40999E-5 41494 0 2.3884E-5
9-107558400-G-A p.Ser1772Ser synonymous ABCA1 1 82974 1.2052E-5 41487 0 1.6475E-5
9-107558406-G-A p.Leu1770Leu synonymous ABCA1 2 83040 2.40848E-5 41520 0 NA
9-107558415-A-G p.Tyr1767Tyr synonymous ABCA1 74 83102 8.90472E-4 41551 0 0.00151057
9-107558415-A-AC p.Tyr1767fs frameshift ABCA1 1 83104 1.20331E-5 41552 0 NA
9-107558416-T-C p.Tyr1767Cys missense ABCA1 1 83114 1.20317E-5 41557 0 9.94969E-5
9-107558417-AGGCTGT-A p.Thr1765_Ala1766del conservative_inframe_deletion ABCA1 1 83120 1.20308E-5 41560 0 NA
9-107558429-GG-AT p.IlePro1762IleSer missense ABCA1 1 83144 1.20273E-5 41572 0 NA
9-107558430-G-T p.Ile1762Ile synonymous ABCA1 1 83152 1.20262E-5 41576 0 8.23764E-6
9-107558433-C-A p.Lys1761Asn missense ABCA1 1 83160 1.2025E-5 41580 0 NA
9-107558450-C-T p.Ala1756Thr missense ABCA1 3 83168 3.60716E-5 41584 0 8.23832E-6
9-107558459-TGA-T p.Leu1752fs frameshift ABCA1 1 83160 1.2025E-5 41580 0 NA
9-107558471-T-C p.Ile1749Val missense ABCA1 4 83160 4.81E-5 41580 0 9.8912E-5
9-107558476-CACCTGTTGAGACACAAAAAGATAAGTGTCTACTGAGAGTCCCTGCCCTCCTTCTGACACTGGGCACCAAATGCCTTATCCACTGTGCAGCTCCCTCACTCAGAGGTGACTT-C p.Trp1747fs frameshift ABCA1 4 83146 4.81081E-5 41573 0 NA
9-107558612-C-T p.Ala1739Thr missense ABCA1 1 82560 1.21124E-5 41280 0 3.18329E-5
9-107558635-G-C p.Ser1731Cys missense ABCA1 1 82468 1.21259E-5 41234 0 2.79049E-5
9-107558670-G-A p.Ile1719Ile synonymous ABCA1 1 82160 1.21714E-5 41080 0 NA
9-107558696-C-T p.Val1711Ile missense ABCA1 3 81622 3.67548E-5 40811 0 6.25E-4
9-107558697-G-A p.Tyr1710Tyr synonymous ABCA1 1 81556 1.22615E-5 40778 0 5.33608E-5
9-107558706-C-CA c.5122-2_5122-1insT splice_acceptor ABCA1 1 81214 1.23131E-5 40607 0 NA
9-107560695-T-C c.5121+7A>G splice_region ABCA1 1 82776 1.20808E-5 41388 0 NA
9-107560726-C-A p.Trp1699Cys missense ABCA1 3 83058 3.61193E-5 41529 0 1.64747E-5
9-107560727-C-T p.Trp1699* stop_gained ABCA1 1 83082 1.20363E-5 41541 0 NA
9-107560729-G-A p.Tyr1698Tyr synonymous ABCA1 12 83084 1.44432E-4 41542 0 3.82068E-4
9-107560734-T-C p.Ile1697Val missense ABCA1 1 83118 1.20311E-5 41559 0 8.2371E-6
9-107560754-A-C p.Ile1690Ser missense ABCA1 1 83192 1.20204E-5 41596 0 NA
9-107560755-T-C p.Ile1690Val missense ABCA1 4 83202 4.80758E-5 41601 0 8.23696E-6
9-107560762-C-T p.Leu1687Leu synonymous ABCA1 1 83226 1.20155E-5 41613 0 8.23723E-6
9-107560784-C-T p.Arg1680Gln missense ABCA1 39 83266 4.68378E-4 41633 0 3.70694E-4
9-107560785-G-C p.Arg1680Gly missense ABCA1 1 83264 1.201E-5 41632 0 NA
9-107560785-G-A p.Arg1680Trp missense ABCA1 1 83264 1.201E-5 41632 0 7.95779E-6
9-107560789-C-T p.Gln1678Gln synonymous ABCA1 10 83264 1.201E-4 41632 0 5.45091E-4
9-107560792-G-A p.Ile1677Ile synonymous ABCA1 1 83268 1.20094E-5 41634 0 NA
9-107560803-C-T p.Val1674Ile missense ABCA1 29 83274 3.48248E-4 41637 0 0.001875
9-107560804-G-A p.Val1673Val synonymous ABCA1 6 83274 7.20513E-5 41637 0 1.31822E-4
9-107560810-G-T p.Ser1671Arg missense ABCA1 1 83272 1.20088E-5 41636 0 NA
9-107560821-C-T p.Val1668Ile missense ABCA1 2 83292 2.40119E-5 41646 0 4.3764E-5
9-107560848-T-C p.Ile1659Val missense ABCA1 2 83248 2.40246E-5 41624 0 NA
9-107560864-C-T p.Val1653Val synonymous ABCA1 1 83104 1.20331E-5 41552 0 NA
9-107560879-C-CAGAGCCACCT c.4944-1_4944insAGGTGGCTCT splice_acceptor ABCA1 2 82842 2.41423E-5 41421 1 NA
9-107560879-C-CAGAGCCACCTCTGAGAGCTGCTGCTTGGTGAGATT c.4944-1_4944insAATCTCACCAAGCAGCAGCTCTCAGAGGTGGCTCT splice_acceptor ABCA1 1 82842 1.20712E-5 41421 0 NA
9-107562093-C-T c.4943+7G>A splice_region ABCA1 1 83324 1.20013E-5 41662 0 NA
9-107562145-T-C p.Asn1633Ser missense ABCA1 2 83348 2.39958E-5 41674 0 1.64731E-5
9-107562151-G-A p.Ala1631Val missense ABCA1 3 83344 3.59954E-5 41672 0 5.76568E-5
9-107562152-C-A p.Ala1631Ser missense ABCA1 1 83346 1.19982E-5 41673 0 NA
9-107562164-A-G p.Tyr1627His missense ABCA1 1 83356 1.19967E-5 41678 0 3.97697E-6
9-107562175-T-C p.Asn1623Ser missense ABCA1 1 83346 1.19982E-5 41673 0 NA
9-107562186-T-C p.Gln1619Gln synonymous ABCA1 1 83334 1.19999E-5 41667 0 NA
9-107562199-C-T p.Arg1615Gln missense ABCA1 4 83328 4.80031E-5 41664 0 3.97757E-6
9-107562200-G-A p.Arg1615Trp missense ABCA1 3 83328 3.60023E-5 41664 0 3.18552E-5
9-107562204-A-G p.Ile1613Ile synonymous ABCA1 2 83312 2.40061E-5 41656 0 1.91131E-4
9-107562234-G-A p.Ser1603Ser synonymous ABCA1 1 83210 1.20178E-5 41605 0 1.64739E-5
9-107562259-T-C p.Asn1595Ser missense ABCA1 1 83072 1.20378E-5 41536 0 NA
9-107562269-C-A p.Val1592Leu missense+splice_region ABCA1 1 83010 1.20467E-5 41505 0 7.96134E-6
9-107562785-G-A c.4773+6C>T splice_region ABCA1 1 83118 1.20311E-5 41559 0 1.59246E-4
9-107562800-A-G p.Asn1588Asn synonymous ABCA1 2 83184 2.40431E-5 41592 0 5.03525E-4
9-107562804-T-C p.Lys1587Arg missense ABCA1 55563 82772 0.671278 41386 19771 0.707479
9-107562805-T-G p.Lys1587Gln missense ABCA1 2 83190 2.40414E-5 41595 0 1.64737E-5
9-107562849-C-T p.Arg1572Gln missense ABCA1 2 83178 2.40448E-5 41589 0 8.23696E-6
9-107562854-T-C p.Ala1570Ala synonymous ABCA1 1 83162 1.20247E-5 41581 0 8.23696E-6
9-107562861-C-A p.Ser1568Ile missense ABCA1 1 83136 1.20285E-5 41568 0 NA
9-107564328-A-G c.4698+7T>C splice_region ABCA1 43 83206 5.1679E-4 41603 0 0.00144005
9-107564335-C-G p.Lys1566Asn missense+splice_region ABCA1 3 83240 3.60404E-5 41620 0 1.64832E-5
9-107564358-T-G p.Lys1559Gln missense ABCA1 1 83268 1.20094E-5 41634 0 5.03525E-4
9-107564392-C-T p.Pro1547Pro synonymous ABCA1 1 83290 1.20062E-5 41645 0 8.2375E-6
9-107564393-G-A p.Pro1547Leu missense ABCA1 1 83284 1.20071E-5 41642 0 4.11875E-5
9-107564402-G-A p.Ala1544Val missense ABCA1 1 83280 1.20077E-5 41640 0 NA
9-107564416-G-A p.Val1539Val synonymous ABCA1 1 83258 1.20109E-5 41629 0 1.98916E-5
9-107564426-G-A p.Ser1536Phe missense ABCA1 1 83200 1.20192E-5 41600 0 0.0100705
9-107564434-G-A p.Gly1533Gly synonymous ABCA1 2 83220 2.40327E-5 41610 0 6.37105E-5
9-107564443-A-C c.4593-3T>G splice_region ABCA1 1 83202 1.20189E-5 41601 0 3.97905E-6
9-107564447-G-T c.4593-7C>A splice_region ABCA1 1 83158 1.20253E-5 41579 0 4.12596E-5
9-107565588-G-A p.Asn1523Asn synonymous ABCA1 1 83324 1.20013E-5 41662 0 NA
9-107565592-T-C p.Lys1522Arg missense ABCA1 1 83304 1.20042E-5 41652 0 NA
9-107566902-G-T c.4559+5C>A splice_region ABCA1 2 83116 2.40628E-5 41558 0 6.25E-4
9-107566930-C-A p.Thr1512Thr synonymous ABCA1 1179 83186 0.0141731 41593 9 0.0140095
9-107566930-C-T p.Thr1512Thr synonymous ABCA1 9 83204 1.08168E-4 41602 1 6.28141E-4
9-107566931-G-A p.Thr1512Met missense ABCA1 2 83198 2.4039E-5 41599 0 6.25E-4
9-107566941-G-T p.Leu1509Met missense ABCA1 3 83212 3.60525E-5 41606 0 3.18451E-5
9-107566948-C-T p.Ser1506Ser synonymous ABCA1 4 83196 4.80792E-5 41598 0 9.55292E-5
9-107566963-T-C p.Thr1501Thr synonymous ABCA1 1 83172 1.20233E-5 41586 0 NA
9-107566982-T-G p.Asp1495Ala missense ABCA1 2 83086 2.40714E-5 41543 0 NA
9-107566985-G-A p.Ala1494Val missense ABCA1 1 83056 1.20401E-5 41528 0 NA
9-107566985-G-T p.Ala1494Glu missense ABCA1 1 83056 1.20401E-5 41528 0 NA
9-107566986-C-A p.Ala1494Ser missense ABCA1 1 83062 1.20392E-5 41531 0 8.23696E-6
9-107567001-T-TTTGTGGAGGAGGCAGCCCCC c.4465-1_4465insGGGGGCTGCCTCCTCCACAA splice_acceptor ABCA1 1 82922 1.20595E-5 41461 0 NA
9-107567002-C-G c.4465-1G>C splice_acceptor ABCA1 1 82908 1.20616E-5 41454 0 3.98038E-6
9-107568515-G-A c.4464+7C>T splice_region ABCA1 1 82536 1.21159E-5 41268 0 8.28281E-6
9-107568519-C-G c.4464+3G>C splice_region ABCA1 2 82656 2.41967E-5 41328 0 4.38153E-5
9-107568525-T-C p.Pro1487Pro synonymous ABCA1 2 82790 2.41575E-5 41395 0 3.98086E-6
9-107568529-G-A p.Pro1486Leu missense ABCA1 1 82896 1.20633E-5 41448 0 NA
9-107568536-G-GC p.Leu1484fs frameshift ABCA1 1 83070 1.2038E-5 41535 0 NA
9-107568537-C-T p.Gly1483Gly synonymous ABCA1 1 83076 1.20372E-5 41538 0 6.26566E-4
9-107568546-C-A p.Gly1480Gly synonymous ABCA1 866 83188 0.0104102 41594 28 0.0218569
9-107568547-C-G p.Gly1480Ala missense ABCA1 1 83196 1.20198E-5 41598 0 1.19343E-5
9-107568550-G-A p.Pro1479Leu missense ABCA1 1 83242 1.20132E-5 41621 0 NA
9-107568556-C-A p.Cys1477Phe missense ABCA1 1 83248 1.20123E-5 41624 0 NA
9-107568582-G-T p.Asp1468Glu missense ABCA1 1 83280 1.20077E-5 41640 0 5.03525E-4
9-107568582-G-A p.Asp1468Asp synonymous ABCA1 1 83280 1.20077E-5 41640 0 8.24063E-6
9-107568595-T-C p.Gln1464Arg missense ABCA1 3 83276 3.60248E-5 41638 0 8.24144E-6
9-107568609-AG-A p.Pro1459fs frameshift ABCA1 1 83258 1.20109E-5 41629 0 NA
9-107568613-T-C p.Asn1458Ser missense ABCA1 1 83240 1.20135E-5 41620 0 NA
9-107568668-G-A p.Pro1440Ser missense ABCA1 1 83186 1.20213E-5 41593 0 3.97921E-6
9-107568689-C-T p.Glu1433Lys missense ABCA1 3 83152 3.60785E-5 41576 0 7.95931E-6
9-107568691-C-T p.Gly1432Glu missense ABCA1 1 83152 1.20262E-5 41576 0 NA
9-107568696-C-T p.Gln1430Gln synonymous ABCA1 3 83136 3.60855E-5 41568 0 1.27389E-4
9-107568699-G-A p.Cys1429Cys synonymous ABCA1 3 83116 3.60941E-5 41558 0 8.27116E-6
9-107568704-G-T p.Pro1428Thr missense ABCA1 1 83104 1.20331E-5 41552 0 NA
9-107568705-C-T p.Thr1427Thr synonymous ABCA1 8086 82828 0.097624 41414 479 0.114368
9-107568706-G-A p.Thr1427Met missense ABCA1 2 83098 2.4068E-5 41549 0 1.07807E-4
9-107568710-C-T p.Asp1426Asn missense+splice_region ABCA1 1 83072 1.20378E-5 41536 0 NA
9-107571741-A-T c.4274+6T>A splice_region ABCA1 1 83162 1.20247E-5 41581 0 8.28226E-6
9-107571747-G-A p.Pro1425Leu missense+splice_region ABCA1 1 83198 1.20195E-5 41599 0 1.59136E-5
9-107571771-C-T p.Arg1417His missense ABCA1 16 83268 1.92151E-4 41634 0 6.37105E-4
9-107571772-G-A p.Arg1417Cys missense ABCA1 5 83272 6.00442E-5 41636 0 3.30109E-5
9-107571779-G-A p.Phe1414Phe synonymous ABCA1 2 83282 2.40148E-5 41641 0 8.24987E-6
9-107571786-G-C p.Pro1412Arg missense ABCA1 1 83288 1.20065E-5 41644 0 NA
9-107571788-G-A p.Asp1411Asp synonymous ABCA1 4 83286 4.80273E-5 41643 0 NA
9-107571799-G-A p.Leu1408Phe missense ABCA1 3 83284 3.60213E-5 41642 0 4.25613E-4
9-107571802-C-T p.Ala1407Thr missense ABCA1 3 83278 3.60239E-5 41639 0 5.03525E-4
9-107571803-G-A p.Asn1406Asn synonymous ABCA1 1 83290 1.20062E-5 41645 0 1.65038E-5
9-107571803-G-C p.Asn1406Lys missense ABCA1 1 83288 1.20065E-5 41644 0 0.00100705
9-107571819-G-A p.Thr1401Ile missense ABCA1 3 83284 3.60213E-5 41642 0 1.27364E-4
9-107571824-C-T p.Thr1399Thr synonymous ABCA1 13 83286 1.56089E-4 41643 0 1.91071E-4
9-107571825-G-A p.Thr1399Met missense ABCA1 4 83286 4.80273E-5 41643 0 2.48008E-5
9-107571826-T-A p.Thr1399Ser missense ABCA1 7 83286 8.40477E-5 41643 1 6.25E-4
9-107571827-G-A p.Asp1398Asp synonymous ABCA1 2 83284 2.40142E-5 41642 0 8.26829E-6
9-107571845-G-A p.Ser1392Ser splice_region+synonymous ABCA1 3 83252 3.60352E-5 41626 0 1.66069E-5
9-107571848-G-GACAAATGTGTACTGTTCGTTGTACATCCAGGGC c.4176-4_4176-3insGCCCTGGATGTACAACGAACAGTACACATTTGT splice_region ABCA1 1 83246 1.20126E-5 41623 0 NA
9-107571850-G-A c.4176-5C>T splice_region ABCA1 2 83216 2.40338E-5 41608 0 NA
9-107573077-A-T c.4175+4T>A splice_region ABCA1 2 83378 2.39871E-5 41689 0 3.9764E-6
9-107573078-T-C c.4175+3A>G splice_region ABCA1 2 83378 2.39871E-5 41689 0 NA
9-107573078-T-TA c.4175+2_4175+3insT splice_donor ABCA1 2 83378 2.39871E-5 41689 0 NA
9-107573080-C-A c.4175+1G>T splice_donor ABCA1 6 83382 7.1958E-5 41691 0 3.97643E-5
9-107573095-C-T p.Gln1387Gln synonymous ABCA1 5 83400 5.9952E-5 41700 0 2.47093E-5
9-107573100-C-T p.Glu1386Lys missense ABCA1 1 83394 1.19913E-5 41697 0 1.19293E-5
9-107573101-G-A p.Asn1385Asn synonymous ABCA1 10 83392 1.19916E-4 41696 0 1.27356E-4
9-107573130-T-C p.Ser1376Gly missense ABCA1 11 83386 1.31917E-4 41693 0 3.50318E-4
9-107573135-T-G p.Tyr1374Ser missense ABCA1 1 83388 1.19921E-5 41694 0 NA
9-107573146-G-A p.Pro1370Pro synonymous ABCA1 1 83386 1.19924E-5 41693 0 NA
9-107573154-C-T p.Val1368Met missense ABCA1 1 83388 1.19921E-5 41694 0 2.38595E-5
9-107573161-G-T p.Ser1365Arg missense ABCA1 1 83386 1.19924E-5 41693 0 NA
9-107573173-G-T p.Ala1361Ala synonymous ABCA1 2 83384 2.39854E-5 41692 0 NA
9-107573173-G-A p.Ala1361Ala synonymous ABCA1 9 83384 1.07934E-4 41692 0 3.29462E-5
9-107573176-A-G p.Ile1360Ile synonymous ABCA1 1 83384 1.19927E-5 41692 0 6.25E-4
9-107573193-C-A p.Ala1355Ser missense ABCA1 1 83374 1.19941E-5 41687 0 1.64758E-5
9-107573199-A-T p.Leu1353Met missense ABCA1 1 83356 1.19967E-5 41678 0 8.23818E-6
9-107573201-A-G p.Val1352Ala missense ABCA1 1 83352 1.19973E-5 41676 0 7.95399E-6
9-107573207-T-TGAGCAAAAAATCCTTTCCGACTCCGTCTGGCAATTAGCAGTCTC c.4051-3_4051-2insGAGACTGCTAATTGCCAGACGGAGTCGGAAAGGATTTTTTGCTC splice_region ABCA1 1 83338 1.19993E-5 41669 0 NA
9-107573207-T-TGAGCAAAAAATCCTTTCCGACTCCGTCTGGCAA c.4051-3_4051-2insTTGCCAGACGGAGTCGGAAAGGATTTTTTGCTC splice_region ABCA1 1 83338 1.19993E-5 41669 0 NA
9-107574847-C-T c.4050+8G>A splice_region ABCA1 15 83298 1.80076E-4 41649 0 1.19336E-5
9-107574848-G-A c.4050+7C>T splice_region ABCA1 2 83310 2.40067E-5 41655 0 6.37227E-5
9-107574868-C-T p.Gly1346Glu missense ABCA1 23 83360 2.75912E-4 41680 0 1.15324E-4
9-107574874-C-T p.Arg1344Gln missense ABCA1 1 83372 1.19944E-5 41686 0 3.97652E-6
9-107574875-G-A p.Arg1344Trp missense ABCA1 10 83368 1.1995E-4 41684 0 3.57881E-5
9-107574881-G-A p.Arg1342Trp missense ABCA1 1 83380 1.19933E-5 41690 0 1.64756E-5
9-107574883-C-G p.Arg1341Thr missense ABCA1 31 83384 3.71774E-4 41692 0 5.73139E-4
9-107574906-C-T p.Leu1333Leu synonymous ABCA1 17 83392 2.03856E-4 41696 0 1.91071E-4
9-107574930-T-C p.Thr1325Thr synonymous ABCA1 4 83406 4.79582E-5 41703 0 1.98815E-5
9-107574931-G-A p.Thr1325Ile missense ABCA1 2 83404 2.39797E-5 41702 0 8.23655E-6
9-107574943-C-G p.Gly1321Ala missense ABCA1 1 83400 1.19904E-5 41700 0 1.64728E-5
9-107574960-C-T p.Gly1315Gly synonymous ABCA1 883 83394 0.0105883 41697 32 0.0235017
9-107574961-C-T p.Gly1315Glu missense ABCA1 1 83392 1.19916E-5 41696 0 8.23655E-6
9-107574967-C-T p.Gly1313Asp missense ABCA1 1 83386 1.19924E-5 41693 0 NA
9-107574989-C-G p.Asp1306His missense ABCA1 3 83374 3.59824E-5 41687 0 NA
9-107574994-T-C p.Glu1304Gly missense ABCA1 1 83366 1.19953E-5 41683 0 NA
9-107574998-T-C p.Arg1303Gly missense ABCA1 4 83364 4.79823E-5 41682 0 6.36699E-5
9-107575006-G-GGGTCTATGTCAGAATCATTTGGATCAGCAGCAT c.3902-4_3902-3insATGCTGCTGATCCAAATGATTCTGACATAGACC splice_region ABCA1 1 83358 1.19964E-5 41679 0 NA
9-107576391-T-A c.3901+8A>T splice_region ABCA1 6 83034 7.22596E-5 41517 0 3.1841E-5
9-107576395-A-C c.3901+4T>G splice_region ABCA1 2 83076 2.40743E-5 41538 0 2.48455E-5
9-107576403-G-A p.Asp1299Asp synonymous ABCA1 3 83150 3.60794E-5 41575 0 8.35615E-5
9-107576408-T-A p.Ile1298Leu missense ABCA1 2 83188 2.40419E-5 41594 0 3.3077E-5
9-107576411-C-T p.Asp1297Asn missense ABCA1 1 83204 1.20187E-5 41602 0 NA
9-107576420-T-C p.Asn1294Asp missense ABCA1 1 83232 1.20146E-5 41616 0 2.47778E-5
9-107576425-T-TCAG p.Ala1291dup conservative_inframe_insertion ABCA1 2 83238 2.40275E-5 41619 0 NA
9-107576426-C-T p.Asp1292Asn missense ABCA1 1 83238 1.20137E-5 41619 0 8.25614E-6
9-107576432-C-A p.Ala1290Ser missense ABCA1 1 83246 1.20126E-5 41623 0 NA
9-107576444-T-A p.Thr1286Ser missense ABCA1 2 83250 2.4024E-5 41625 0 NA
9-107576448-C-T p.Pro1284Pro synonymous ABCA1 1 83246 1.20126E-5 41623 0 4.37473E-5
9-107576449-G-A p.Pro1284Leu missense ABCA1 4 83252 4.80469E-5 41626 0 2.475E-5
9-107576453-G-A p.Arg1283Cys missense ABCA1 7 83246 8.40881E-5 41623 0 4.12514E-5
9-107576469-G-A p.Asp1277Asp synonymous ABCA1 2 83222 2.40321E-5 41611 0 2.38618E-4
9-107576474-C-T p.Gly1276Arg missense ABCA1 5 83232 6.0073E-5 41616 0 3.97722E-5
9-107576475-G-A p.Phe1275Phe synonymous ABCA1 5 83230 6.00745E-5 41615 0 3.18309E-5
9-107576482-C-T p.Arg1273Gln missense ABCA1 5 83260 6.00528E-5 41630 0 6.3678E-5
9-107576482-C-A p.Arg1273Leu missense ABCA1 2 83260 2.40211E-5 41630 0 8.25096E-6
9-107576483-G-A p.Arg1273Trp missense ABCA1 2 83252 2.40234E-5 41626 0 3.1839E-5
9-107576493-T-C p.Arg1269Arg synonymous ABCA1 1 83216 1.20169E-5 41608 0 3.97744E-6
9-107576703-G-T c.3787+5C>A splice_region ABCA1 1 83284 1.20071E-5 41642 0 3.1839E-5
9-107576720-C-T p.Ala1259Thr missense ABCA1 1 83314 1.20028E-5 41657 0 NA
9-107576724-C-T p.Val1257Val synonymous ABCA1 1 83326 1.20011E-5 41663 0 NA
9-107576726-C-T p.Val1257Met missense ABCA1 2 83326 2.40021E-5 41663 0 NA
9-107576727-C-T p.Gly1256Gly synonymous ABCA1 9 83324 1.08012E-4 41662 0 1.73059E-4
9-107576732-T-G p.Ser1255Arg missense ABCA1 32 83322 3.84052E-4 41661 0 0.00101924
9-107576738-C-T p.Glu1253Lys missense ABCA1 4 83314 4.80111E-5 41657 0 6.36699E-5
9-107576739-G-C p.Ala1252Ala synonymous ABCA1 2 83308 2.40073E-5 41654 0 1.19313E-5
9-107576739-G-A p.Ala1252Ala synonymous ABCA1 10 83308 1.20036E-4 41654 0 3.97709E-5
9-107576742-C-T p.Val1251Val synonymous ABCA1 1 83312 1.20031E-5 41656 0 NA
9-107576746-T-C p.Lys1250Arg missense ABCA1 1 83312 1.20031E-5 41656 0 6.3678E-5
9-107576750-G-A p.Leu1249Phe missense ABCA1 1 83308 1.20036E-5 41654 0 NA
9-107578417-A-C c.3738+7T>G splice_region ABCA1 1 83290 1.20062E-5 41645 0 NA
9-107578436-C-T p.Thr1242Thr synonymous ABCA1 2 83338 2.39987E-5 41669 0 0.00100705
9-107578447-T-C p.Ile1239Val missense ABCA1 1 83348 1.19979E-5 41674 0 2.78337E-5
9-107578464-C-T p.Gly1233Asp missense ABCA1 2 83366 2.39906E-5 41683 0 3.18573E-5
9-107578468-G-A p.Leu1232Leu synonymous ABCA1 1 83368 1.1995E-5 41684 0 3.97624E-6
9-107578478-C-T p.Arg1228Arg synonymous ABCA1 2083 83346 0.0249922 41673 147 0.0525544
9-107578479-C-T p.Arg1228Gln missense ABCA1 1 83374 1.19941E-5 41687 0 6.25E-4
9-107578483-C-T p.Asp1227Asn missense ABCA1 1 83376 1.19939E-5 41688 0 NA
9-107578495-G-C p.His1223Asp missense ABCA1 2 83384 2.39854E-5 41692 0 8.23642E-6
9-107578500-A-C p.Leu1221Arg missense ABCA1 1 83380 1.19933E-5 41690 0 3.97621E-6
9-107578504-C-T p.Glu1220Lys missense ABCA1 1 83376 1.19939E-5 41688 0 3.97621E-6
9-107578512-G-T p.Ala1217Asp missense ABCA1 3 83380 3.59799E-5 41690 0 NA
9-107578513-C-T p.Ala1217Thr missense ABCA1 2 83384 2.39854E-5 41692 0 NA
9-107578515-C-A p.Gly1216Val missense ABCA1 2 83386 2.39848E-5 41693 0 5.76559E-5
9-107578527-G-C p.Ala1212Gly missense ABCA1 1 83376 1.19939E-5 41688 0 NA
9-107578529-T-C p.Glu1211Glu synonymous ABCA1 2088 83356 0.0250492 41678 75 0.0579053
9-107578535-T-C p.Pro1209Pro synonymous ABCA1 4 83378 4.79743E-5 41689 0 3.9763E-6
9-107578555-C-G p.Glu1203Gln missense ABCA1 2 83372 2.39889E-5 41686 0 NA
9-107578559-C-T p.Gly1201Gly synonymous ABCA1 1 83368 1.1995E-5 41684 0 1.64734E-5
9-107578564-T-TG p.Ile1200fs frameshift ABCA1 1 83352 1.19973E-5 41676 0 NA
9-107578576-G-A p.Leu1196Leu synonymous ABCA1 1 83342 1.19988E-5 41671 0 3.18817E-5
9-107578577-C-G p.Arg1195Arg synonymous ABCA1 2 83344 2.39969E-5 41672 0 8.23696E-6
9-107578578-C-T p.Arg1195Gln missense ABCA1 27 83342 3.23966E-4 41671 3 5.03525E-4
9-107578579-G-A p.Arg1195Trp missense ABCA1 1 83336 1.19996E-5 41668 0 1.98818E-5
9-107578595-C-T p.Lys1189Lys synonymous ABCA1 5 83278 6.00399E-5 41639 0 1.91229E-4
9-107578607-G-T p.Asn1185Lys missense ABCA1 3 83186 3.60638E-5 41593 0 6.37633E-5
9-107578608-T-C p.Asn1185Ser missense ABCA1 21 83172 2.52489E-4 41586 0 1.27616E-4
9-107578615-T-C p.Ile1183Val missense ABCA1 1 83080 1.20366E-5 41540 0 NA
9-107578618-C-T p.Ala1182Thr missense ABCA1 43 83002 5.1806E-4 41501 0 0.00100705
9-107578620-G-A p.Ser1181Phe missense ABCA1 72 82962 8.67867E-4 41481 0 0.00137179
9-107578622-G-C p.Val1180Val synonymous ABCA1 1 82926 1.20589E-5 41463 0 NA
9-107578626-T-C p.Asp1179Gly missense+splice_region ABCA1 1 82820 1.20744E-5 41410 0 NA
9-107578630-C-T c.3536-4G>A splice_region ABCA1 1 82632 1.21018E-5 41316 0 3.9788E-6
9-107578632-G-A c.3536-6C>T splice_region ABCA1 2 82548 2.42283E-5 41274 0 9.56816E-5
9-107579614-G-A p.Ile1178Ile splice_region+synonymous ABCA1 1 83242 1.20132E-5 41621 0 6.25E-4
9-107579622-G-C p.Leu1176Val missense ABCA1 1 83262 1.20103E-5 41631 0 5.96488E-5
9-107579623-C-T p.Thr1175Thr synonymous ABCA1 1 83260 1.20106E-5 41630 0 4.11977E-5
9-107579624-G-A p.Thr1175Met missense ABCA1 5 83262 6.00514E-5 41631 0 1.91119E-4
9-107579632-C-G p.Glu1172Asp missense ABCA1 4094 83168 0.0492257 41584 196 0.0881168
9-107579633-T-C p.Glu1172Gly missense ABCA1 18 83266 2.16175E-4 41633 0 0.005
9-107579641-G-A p.Ser1169Ser synonymous ABCA1 2 83250 2.4024E-5 41625 0 1.19306E-5
9-107579647-C-A p.Leu1167Leu synonymous ABCA1 3 83240 3.60404E-5 41620 0 NA
9-107579649-G-A p.Leu1167Leu synonymous ABCA1 2 83232 2.40292E-5 41616 0 3.97703E-6
9-107579654-G-A p.Ala1165Val missense ABCA1 1 83222 1.20161E-5 41611 0 NA
9-107579666-C-T p.Ser1161Asn missense ABCA1 2 83152 2.40523E-5 41576 0 3.97719E-6
9-107579676-C-T p.Val1158Ile missense ABCA1 1 83104 1.20331E-5 41552 0 1.64929E-5
9-107579678-C-T p.Ser1157Asn missense ABCA1 7 83088 8.4248E-5 41544 0 1.074E-4
9-107579679-T-C p.Ser1157Gly missense ABCA1 1 83080 1.20366E-5 41540 0 8.24783E-6
9-107579690-T-C c.3463-5A>G splice_region ABCA1 3 83014 3.61385E-5 41507 0 NA
9-107580936-C-CA c.3462+7_3462+8insT splice_region ABCA1 1 83030 1.20438E-5 41515 0 8.23791E-6
9-107580961-C-T p.Val1149Met missense ABCA1 2 83212 2.4035E-5 41606 0 NA
9-107580963-G-A p.Thr1148Ile missense ABCA1 2 83230 2.40298E-5 41615 0 8.23655E-6
9-107580970-T-C p.Ser1146Gly missense ABCA1 2 83270 2.40183E-5 41635 0 NA
9-107580974-G-A p.Asn1144Asn synonymous ABCA1 3 83282 3.60222E-5 41641 0 1.27429E-4
9-107580984-G-T p.Ser1141Tyr missense ABCA1 2 83294 2.40113E-5 41647 0 3.97643E-6
9-107580991-G-GGGA p.Ser1138dup conservative_inframe_insertion ABCA1 2 83308 2.40073E-5 41654 0 6.36983E-5
9-107580993-G-A p.Ser1138Phe missense ABCA1 2 83306 2.40079E-5 41653 0 NA
9-107580998-T-G p.Glu1136Asp missense ABCA1 2 83314 2.40056E-5 41657 0 8.23642E-6
9-107581007-T-G p.Lys1133Asn missense ABCA1 1 83312 1.20031E-5 41656 0 NA
9-107581034-T-G p.Thr1124Thr synonymous ABCA1 1 83322 1.20016E-5 41661 0 NA
9-107581042-G-A p.Leu1122Leu synonymous ABCA1 1517 83292 0.018213 41646 84 0.0410374
9-107581055-A-C p.Phe1117Leu missense ABCA1 1 83332 1.20002E-5 41666 0 3.9764E-6
9-107581077-C-G p.Cys1110Ser missense ABCA1 1 83316 1.20025E-5 41658 0 NA
9-107581089-T-C p.His1106Arg missense ABCA1 1 83296 1.20054E-5 41648 0 NA
9-107581090-G-A p.His1106Tyr missense ABCA1 2 83296 2.40108E-5 41648 0 NA
9-107581096-T-A p.Ile1104Phe missense ABCA1 1 83282 1.20074E-5 41641 0 NA
9-107581100-G-A p.Ala1102Ala synonymous ABCA1 1 83280 1.20077E-5 41640 0 NA
9-107581104-A-G p.Ile1101Thr missense ABCA1 1 83278 1.2008E-5 41639 0 NA
9-107581110-T-TC p.Asp1099fs frameshift ABCA1 1 83250 1.2012E-5 41625 0 NA
9-107581111-C-A p.Asp1099Tyr missense ABCA1 1 83254 1.20114E-5 41627 0 NA
9-107581118-G-T p.Val1096Val synonymous ABCA1 1 83238 1.20137E-5 41619 0 8.35967E-6
9-107581120-C-T p.Val1096Ile missense ABCA1 4 83230 4.80596E-5 41615 0 1.75974E-4
9-107581121-G-T p.Asp1095Glu missense ABCA1 2 83218 2.40333E-5 41609 0 NA
9-107581121-G-A p.Asp1095Asp synonymous ABCA1 2 83216 2.40338E-5 41608 0 1.19381E-5
9-107581127-T-C p.Glu1093Glu synonymous ABCA1 1 83182 1.20218E-5 41591 0 NA
9-107581136-G-A p.His1090His synonymous ABCA1 1 83116 1.20314E-5 41558 0 1.51379E-4
9-107581149-A-G p.Leu1086Pro missense ABCA1 1 82986 1.20502E-5 41493 0 7.98257E-6
9-107581153-T-C p.Ile1085Val missense ABCA1 5 82954 6.02744E-5 41477 0 6.37024E-5
9-107581161-C-T p.Arg1082His missense ABCA1 1 82686 1.20939E-5 41343 0 3.18573E-5
9-107581162-G-A p.Arg1082Cys missense+splice_region ABCA1 1 82662 1.20975E-5 41331 0 4.2179E-5
9-107581165-C-CT c.3242-2_3242-1insA splice_acceptor ABCA1 2 82610 2.42101E-5 41305 1 NA
9-107581166-T-TTGTCGGTATTTCA c.3242-3_3242-2insTGAAATACCGACA splice_region ABCA1 1 82570 1.21109E-5 41285 0 NA
9-107581166-T-TTGTCGGTATTTCAGCAGCAGCTCCCATATTCCCCTGCGGGAGTAAGG c.3242-3_3242-2insCCTTACTCCCGCAGGGGAATATGGGAGCTGCTGCTGAAATACCGACA splice_region ABCA1 1 82570 1.21109E-5 41285 0 NA
9-107581859-T-A c.3241+8A>T splice_region ABCA1 1 83082 1.20363E-5 41541 0 NA
9-107581868-T-C p.Gln1080Gln splice_region+synonymous ABCA1 1 83210 1.20178E-5 41605 0 3.97836E-6
9-107581873-G-A p.Arg1079* stop_gained ABCA1 3 83254 3.60343E-5 41627 0 NA
9-107581874-G-A p.Tyr1078Tyr synonymous ABCA1 1 83266 1.20097E-5 41633 0 3.97807E-6
9-107581892-C-T p.Trp1072* stop_gained ABCA1 1 83358 1.19964E-5 41679 0 3.97671E-6
9-107581899-C-G p.Gly1070Ala missense ABCA1 1 83372 1.19944E-5 41686 0 3.97659E-6
9-107581904-G-A p.Arg1068Arg synonymous ABCA1 93 83364 0.00111559 41682 1 0.00503525
9-107581906-G-A p.Arg1068Cys missense ABCA1 1 83366 1.19953E-5 41683 0 6.37186E-5
9-107581915-G-T p.Pro1065Thr missense ABCA1 1 83370 1.19947E-5 41685 0 NA
9-107581916-G-A p.Asp1064Asp synonymous ABCA1 1 83374 1.19941E-5 41687 0 8.23642E-6
9-107581933-G-T p.Pro1059Thr missense ABCA1 1 83340 1.1999E-5 41670 0 NA
9-107581949-A-C p.Val1053Val synonymous ABCA1 616 83318 0.00739336 41659 2 0.00828289
9-107581959-C-A p.Gly1050Val missense ABCA1 1 83288 1.20065E-5 41644 0 NA
9-107581959-C-T p.Gly1050Glu missense ABCA1 1 83288 1.20065E-5 41644 0 NA
9-107581960-C-T p.Gly1050Arg missense ABCA1 1 83278 1.2008E-5 41639 0 3.97716E-6
9-107581963-C-T p.Gly1049Arg missense ABCA1 1 83254 1.20114E-5 41627 0 6.25E-4
9-107581964-G-A p.Val1048Val synonymous ABCA1 9 83262 1.08093E-4 41631 0 0.00125
9-107581977-G-A p.Ala1044Val missense ABCA1 1 83182 1.20218E-5 41591 0 NA
9-107581987-G-C p.Leu1041Val missense ABCA1 3 83120 3.60924E-5 41560 0 4.9425E-5
9-107581989-T-C p.Lys1040Arg missense ABCA1 1 83096 1.20343E-5 41548 0 7.95741E-6
9-107581997-C-T p.Met1037Ile missense ABCA1 1 82976 1.20517E-5 41488 0 NA
9-107582000-T-C p.Gly1036Gly synonymous ABCA1 1 82922 1.20595E-5 41461 0 NA
9-107582003-A-G p.Gly1035Gly splice_region+synonymous ABCA1 1 82886 1.20648E-5 41443 0 NA
9-107582008-C-CA c.3104-5_3104-4insT splice_region ABCA1 3 82800 3.62319E-5 41400 0 1.19476E-5
9-107582012-A-G c.3104-8T>C splice_region ABCA1 1 82718 1.20893E-5 41359 0 NA
9-107582202-C-A c.3103+6G>T splice_region ABCA1 1 83356 1.19967E-5 41678 0 NA
9-107582203-C-T c.3103+5G>A splice_region ABCA1 1 83356 1.19967E-5 41678 0 2.47737E-5
9-107582205-C-T c.3103+3G>A splice_region ABCA1 1 83360 1.19962E-5 41680 0 2.79544E-5
9-107582212-C-G p.Leu1033Leu synonymous ABCA1 79 83370 9.47583E-4 41685 0 5.1053E-4
9-107582217-G-T p.Gln1032Lys missense ABCA1 1 83376 1.19939E-5 41688 0 NA
9-107582245-T-C p.Pro1022Pro synonymous ABCA1 2 83388 2.39843E-5 41694 0 2.47394E-5
9-107582247-G-A p.Pro1022Ser missense ABCA1 1 83386 1.19924E-5 41693 0 NA
9-107582255-A-G p.Val1019Ala missense ABCA1 1 83388 1.19921E-5 41694 0 3.97719E-6
9-107582256-C-T p.Val1019Ile missense ABCA1 1 83388 1.19921E-5 41694 0 8.24389E-6
9-107582257-A-G p.Asp1018Asp synonymous ABCA1 9 83390 1.07927E-4 41695 0 7.95425E-5
9-107582258-T-C p.Asp1018Gly missense ABCA1 101 83390 0.00121118 41695 0 0.0020141
9-107582266-C-A p.Met1015Ile missense ABCA1 1 83396 1.1991E-5 41698 0 NA
9-107582275-C-T p.Met1012Ile missense ABCA1 1 83378 1.19936E-5 41689 0 1.31865E-4
9-107582281-C-T p.Ala1010Ala synonymous ABCA1 1 83380 1.19933E-5 41690 0 1.59066E-5
9-107582282-G-A p.Ala1010Val missense ABCA1 2 83376 2.39877E-5 41688 0 3.18654E-5
9-107582289-C-T p.Val1008Met missense ABCA1 2 83366 2.39906E-5 41683 0 2.47219E-5
9-107582309-T-C p.Lys1001Arg missense ABCA1 2 83346 2.39964E-5 41673 0 8.24035E-6
9-107582316-G-A p.Arg999Cys missense ABCA1 5 83338 5.99966E-5 41669 0 4.37463E-5
9-107582335-T-G p.Glu992Asp missense ABCA1 1 83302 1.20045E-5 41651 0 NA
9-107582340-C-T p.Glu991Lys missense ABCA1 1 83244 1.20129E-5 41622 0 1.19351E-5
9-107582341-G-A p.Val990Val synonymous ABCA1 11 83234 1.32158E-4 41617 0 4.94527E-5
9-107582350-C-CATGTCAAACAGCACGTTATG c.2961-1_2961insCATAACGTGCTGTTTGACAT splice_acceptor ABCA1 1 83154 1.20259E-5 41577 0 NA
9-107583658-G-T p.Asp986Glu missense+splice_region ABCA1 1 83142 1.20276E-5 41571 0 3.97848E-6
9-107583669-C-T p.Val983Met missense ABCA1 1 83192 1.20204E-5 41596 0 3.97826E-6
9-107583673-A-T p.His981Gln missense ABCA1 1 83204 1.20187E-5 41602 0 NA
9-107583679-G-C p.Pro979Pro synonymous ABCA1 1 83212 1.20175E-5 41606 0 NA
9-107583681-GA-G p.Gln980fs frameshift ABCA1 1 83202 1.20189E-5 41601 0 3.97814E-6
9-107583702-G-A p.Arg972Trp missense ABCA1 1 83256 1.20111E-5 41628 0 6.36983E-5
9-107583706-G-A p.Thr970Thr synonymous ABCA1 24 83252 2.88281E-4 41626 0 8.25137E-5
9-107583713-A-G p.Met968Thr missense ABCA1 9 83268 1.08085E-4 41634 0 6.37349E-5
9-107583723-G-A p.Arg965Cys missense ABCA1 1 83280 1.20077E-5 41640 0 6.25E-4
9-107583723-G-T p.Arg965Ser missense ABCA1 1 83280 1.20077E-5 41640 0 NA
9-107583739-G-A p.Ile959Ile synonymous ABCA1 2 83280 2.40154E-5 41640 0 1.19326E-5
9-107583748-G-A p.Thr956Thr synonymous ABCA1 405 83218 0.00486674 41609 4 0.00984453
9-107583751-G-A p.Gly955Gly synonymous ABCA1 3 83232 3.60438E-5 41616 0 3.18512E-5
9-107583754-C-T p.Ser954Ser synonymous ABCA1 1 83236 1.2014E-5 41618 0 9.54813E-5
9-107583755-G-A p.Ser954Leu missense ABCA1 1 83242 1.20132E-5 41621 0 6.37146E-5
9-107583760-C-T p.Pro952Pro synonymous ABCA1 4 83232 4.80584E-5 41616 0 1.6539E-5
9-107583764-G-A p.Pro951Leu missense ABCA1 2 83220 2.40327E-5 41610 0 NA
9-107583766-G-A p.Phe950Phe synonymous ABCA1 1 83202 1.20189E-5 41601 0 3.18492E-5
9-107583774-C-T p.Gly948Arg missense ABCA1 3 83158 3.60759E-5 41579 0 3.97962E-6
9-107584791-C-T p.Gly938Gly synonymous ABCA1 166 83220 0.00199471 41610 1 0.00445945
9-107584794-C-T p.Ala937Ala synonymous ABCA1 17 83220 2.04278E-4 41610 0 7.15865E-5
9-107584795-G-A p.Ala937Val missense ABCA1 1 83230 1.20149E-5 41615 0 2.47097E-5
9-107584797-T-G p.Gly936Gly synonymous ABCA1 2 83260 2.40211E-5 41630 0 3.97668E-6
9-107584798-C-T p.Gly936Glu missense ABCA1 2 83268 2.40188E-5 41634 0 NA
9-107584801-T-A p.Asn935Ile missense ABCA1 1 83292 1.2006E-5 41646 0 NA
9-107584806-G-A p.Gly933Gly synonymous ABCA1 4 83290 4.8025E-5 41645 0 1.27429E-4
9-107584823-T-C p.Ile928Val missense ABCA1 2 83320 2.40038E-5 41660 0 NA
9-107584846-G-A p.Ala920Val missense ABCA1 1 83362 1.19959E-5 41681 0 NA
9-107584854-A-G p.Asp917Asp synonymous ABCA1 1 83352 1.19973E-5 41676 0 NA
9-107584857-G-A p.Val916Val synonymous ABCA1 10 83354 1.1997E-4 41677 0 1.59327E-4
9-107584875-A-G p.Asp910Asp synonymous ABCA1 48 83352 5.75871E-4 41676 0 0.00115045
9-107584879-C-T p.Arg909Gln missense ABCA1 3 83354 3.59911E-5 41677 0 1.64734E-4
9-107584880-G-A p.Arg909* stop_gained ABCA1 2 83354 2.3994E-5 41677 0 7.95267E-6
9-107584898-T-G p.Asn903His missense ABCA1 2 83356 2.39935E-5 41678 0 NA
9-107584926-G-A p.Thr893Thr synonymous ABCA1 2 83310 2.40067E-5 41655 0 3.97674E-6
9-107584927-G-A p.Thr893Ile missense ABCA1 1 83314 1.20028E-5 41657 0 1.59065E-4
9-107584936-T-G p.Glu890Ala missense ABCA1 2 83270 2.40183E-5 41635 0 NA
9-107584942-A-C p.Met888Arg missense ABCA1 1 83270 1.20091E-5 41635 0 3.97697E-6
9-107584945-C-A p.Cys887Phe missense ABCA1 16 83260 1.92169E-4 41630 0 6.68705E-4
9-107586740-A-G c.2656+6T>C splice_region ABCA1 1 82880 1.20656E-5 41440 0 8.25805E-6
9-107586753-T-C p.Ile883Met missense ABCA1 16481 82764 0.199132 41382 2256 0.250064
9-107586755-T-C p.Ile883Val missense ABCA1 1 83128 1.20296E-5 41564 0 3.97741E-6
9-107586763-T-C p.Gln880Arg missense ABCA1 1 83188 1.2021E-5 41594 0 3.97706E-6
9-107586792-A-G p.Ser870Ser synonymous ABCA1 1 83276 1.20083E-5 41638 0 NA
9-107586795-T-A p.Glu869Asp missense ABCA1 3 83278 3.60239E-5 41639 0 3.18492E-5
9-107586798-C-T p.Glu868Glu synonymous ABCA1 2 83284 2.40142E-5 41642 0 3.97678E-6
9-107586800-C-T p.Glu868Lys missense ABCA1 180 83272 0.00216159 41636 1 0.00500032
9-107586801-G-A p.Gly867Gly synonymous ABCA1 11 83280 1.32085E-4 41640 0 5.03525E-4
9-107586822-G-C p.Cys860Trp missense ABCA1 1 83290 1.20062E-5 41645 0 NA
9-107586852-G-A p.Tyr850Tyr synonymous ABCA1 3 83082 3.61089E-5 41541 0 6.36943E-5
9-107586862-G-A c.2543-3C>T splice_region ABCA1 52 82876 6.27443E-4 41438 0 0.0018797
9-107587873-A-G n.806T>C splice_region ABCA1 2 81332 2.45906E-5 40666 0 NA
9-107587979-C-T p.Glu843Lys missense ABCA1 1 83326 1.20011E-5 41663 0 NA
9-107587982-T-C p.Ile842Val missense ABCA1 2 83326 2.40021E-5 41663 0 3.97681E-6
9-107587982-T-G p.Ile842Leu missense ABCA1 1 83326 1.20011E-5 41663 0 3.97681E-6
9-107588000-C-T p.Gly836Arg missense ABCA1 1 83346 1.19982E-5 41673 0 3.97652E-6
9-107588007-G-A p.Phe833Phe synonymous ABCA1 1 83354 1.1997E-5 41677 0 NA
9-107588010-G-A p.Thr832Thr synonymous ABCA1 2 83360 2.39923E-5 41680 0 NA
9-107588033-C-T p.Val825Ile missense ABCA1 4954 83282 0.0594846 41641 248 0.0820833
9-107588033-CCG-TCA p.SerVal824LeuIle missense ABCA1 7 83352 8.39812E-5 41676 0 NA
9-107588034-C-T p.Ser824Ser synonymous ABCA1 13 83352 1.55965E-4 41676 0 9.2254E-4
9-107588035-G-A p.Ser824Leu missense ABCA1 3 83362 3.59876E-5 41681 0 2.78368E-5
9-107588047-T-C p.Asn820Ser missense ABCA1 4 83362 4.79835E-5 41681 0 0.00100705
9-107588061-C-T p.Glu815Glu synonymous ABCA1 1 83362 1.19959E-5 41681 0 NA
9-107588062-T-C p.Glu815Gly missense ABCA1 8 83360 9.59693E-5 41680 0 4.45973E-4
9-107588075-C-T p.Glu811Lys missense ABCA1 1 83360 1.19962E-5 41680 0 NA
9-107588087-C-T p.Asp807Asn missense ABCA1 3 83344 3.59954E-5 41672 0 6.37105E-5
9-107588097-T-G p.Gly803Gly synonymous ABCA1 2 83342 2.39975E-5 41671 0 NA
9-107588124-A-G p.Phe794Phe synonymous ABCA1 4 83328 4.80031E-5 41664 0 6.76046E-5
9-107588134-C-G p.Cys791Ser missense ABCA1 1 83322 1.20016E-5 41661 0 3.97684E-6
9-107588142-C-T p.Gly788Gly synonymous ABCA1 1 83286 1.20068E-5 41643 0 3.97693E-6
9-107588150-C-G p.Ala786Pro missense ABCA1 1 83258 1.20109E-5 41629 0 NA
9-107588151-C-A p.Val785Val synonymous ABCA1 1 83254 1.20114E-5 41627 0 NA
9-107588156-G-C p.Pro784Ala missense ABCA1 1 83222 1.20161E-5 41611 0 3.97814E-6
9-107588157-A-G p.Ser783Ser synonymous ABCA1 1 83216 1.20169E-5 41608 0 NA
9-107588166-G-C p.Ser780Arg missense+splice_region ABCA1 5 83086 6.01786E-5 41543 0 NA
9-107588169-CTG-C c.2338-3_2338-2delCA splice_acceptor ABCA1 1 83030 1.20438E-5 41515 0 4.77623E-5
9-107589231-C-T p.Ala779Thr missense+splice_region ABCA1 8 82254 9.72597E-5 41127 0 4.39887E-5
9-107589232-G-A p.Phe778Phe synonymous ABCA1 1 82364 1.21412E-5 41182 0 0.0010101
9-107589238-C-G p.Lys776Asn missense ABCA1 232 82604 0.00280858 41302 3 0.00750939
9-107589243-G-A p.Leu775Phe missense ABCA1 3 82744 3.62564E-5 41372 0 1.64948E-5
9-107589246-T-G p.Thr774Pro missense ABCA1 255 82780 0.00308045 41390 0 0.00209834
9-107589251-C-G p.Gly772Ala missense ABCA1 2 82914 2.41214E-5 41457 0 NA
9-107589255-C-T p.Val771Met missense ABCA1 4635 82846 0.0559472 41423 188 0.063125
9-107589255-C-G p.Val771Leu missense ABCA1 64 83002 7.71066E-4 41501 0 0.00159357
9-107589265-C-A p.Trp767Cys missense ABCA1 2 83114 2.40633E-5 41557 0 1.7919E-4
9-107589270-C-T p.Ala766Thr missense ABCA1 1 83142 1.20276E-5 41571 0 NA
9-107589283-G-A p.Tyr761Tyr synonymous ABCA1 25 83214 3.0043E-4 41607 0 0.00125
9-107589296-A-G p.Leu757Pro missense ABCA1 1 83278 1.2008E-5 41639 0 4.11882E-5
9-107589308-A-T p.Ile753Asn missense ABCA1 1 83294 1.20057E-5 41647 0 NA
9-107589322-G-C p.Ala748Ala synonymous ABCA1 2 83316 2.4005E-5 41658 0 3.97697E-6
9-107589331-C-A p.Leu745Leu synonymous ABCA1 28 83318 3.36062E-4 41659 0 2.54745E-4
9-107589343-G-A p.Ser741Ser synonymous ABCA1 2 83324 2.40027E-5 41662 0 3.5793E-5
9-107589360-TC-AT p.LeuIle735LeuPhe missense ABCA1 1 83340 1.1999E-5 41670 0 NA
9-107589367-G-T p.Cys733* stop_gained ABCA1 2 83340 2.39981E-5 41670 0 NA
9-107589370-C-T p.Gln732Gln synonymous ABCA1 2 83338 2.39987E-5 41669 0 6.59087E-5
9-107589378-T-C p.Ile730Val missense ABCA1 2 83334 2.39998E-5 41667 0 4.94332E-5
9-107589389-G-A p.Ala726Val missense ABCA1 1 83332 1.20002E-5 41666 0 NA
9-107589390-C-A p.Ala726Ser missense ABCA1 1 83328 1.20008E-5 41664 0 1.19309E-5
9-107589396-C-T p.Val724Met missense ABCA1 4 83336 4.79985E-5 41668 0 6.3678E-5
9-107589397-G-A p.Ser723Ser synonymous ABCA1 10 83340 1.1999E-4 41670 0 0.00130565
9-107589417-C-T p.Val717Met missense ABCA1 10 83294 1.20057E-4 41647 0 3.18492E-5
9-107589440-A-T p.Leu709Gln missense ABCA1 2 83176 2.40454E-5 41588 0 1.67721E-5
9-107591207-A-G p.Val702Ala missense ABCA1 1 83126 1.20299E-5 41563 0 8.2971E-6
9-107591222-G-A p.Ala697Val missense ABCA1 1 83212 1.20175E-5 41606 0 8.25955E-6
9-107591223-C-T p.Ala697Thr missense ABCA1 70 83210 8.41245E-4 41605 0 0.00165658
9-107591224-G-A p.Ser696Ser synonymous ABCA1 12 83218 1.442E-4 41609 0 2.23072E-4
9-107591230-A-G p.Leu694Leu synonymous ABCA1 1 83248 1.20123E-5 41624 0 1.1933E-5
9-107591242-G-A p.Leu690Leu synonymous ABCA1 1 83274 1.20085E-5 41637 0 NA
9-107591245-G-A p.Ser689Ser synonymous ABCA1 1 83256 1.20111E-5 41628 0 3.97735E-6
9-107591251-A-G p.Ile687Ile synonymous ABCA1 1 83270 1.20091E-5 41635 0 NA
9-107591259-A-T p.Trp685Arg missense ABCA1 5 83286 6.00341E-5 41643 0 NA
9-107591269-G-C p.Leu681Leu synonymous ABCA1 2 83296 2.40108E-5 41648 0 NA
9-107591272-G-T p.Ile680Ile synonymous ABCA1 15456 83094 0.186006 41547 1988 0.232601
9-107591292-T-G p.Met674Leu missense ABCA1 1 83294 1.20057E-5 41647 0 1.40042E-4
9-107591297-C-T p.Arg672Gln missense ABCA1 3 83294 3.6017E-5 41647 0 3.18573E-5
9-107591298-G-A p.Arg672Trp missense ABCA1 3 83286 3.60205E-5 41643 0 3.9775E-5
9-107591302-G-A p.Thr670Thr synonymous ABCA1 1 83292 1.2006E-5 41646 0 NA
9-107591307-C-G p.Glu669Gln missense ABCA1 1 83298 1.20051E-5 41649 0 3.97703E-6
9-107591311-C-A p.Leu667Leu synonymous ABCA1 1 83300 1.20048E-5 41650 0 NA
9-107591315-C-T p.Arg666Gln missense ABCA1 5 83300 6.0024E-5 41650 0 9.55049E-5
9-107591316-G-A p.Arg666Trp missense ABCA1 4 83298 4.80204E-5 41649 0 6.25E-4
9-107591320-C-T p.Glu664Glu synonymous ABCA1 6 83304 7.20254E-5 41652 0 1.91046E-4
9-107591325-T-C p.Lys663Glu missense ABCA1 1 83302 1.20045E-5 41651 0 3.97693E-6
9-107591334-C-A p.Val660Leu missense ABCA1 1 83292 1.2006E-5 41646 0 1.64772E-5
9-107591335-G-A p.Ile659Ile synonymous ABCA1 147 83278 0.00176517 41639 1 0.0041396
9-107591339-C-A p.Gly658Val missense ABCA1 2 83266 2.40194E-5 41633 0 6.3674E-5
9-107591339-C-G p.Gly658Ala missense ABCA1 10 83266 1.20097E-4 41633 0 1.64764E-5
9-107591340-C-T p.Gly658Ser missense ABCA1 1 83272 1.20088E-5 41636 0 NA
9-107591344-G-A p.Ile656Ile synonymous ABCA1 1 83270 1.20091E-5 41635 0 NA
9-107591347-G-C p.Ile655Met missense ABCA1 1 83272 1.20088E-5 41636 0 NA
9-107591350-C-T p.Val654Val synonymous ABCA1 1 83262 1.20103E-5 41631 0 NA
9-107591352-C-T p.Val654Met missense ABCA1 1 83260 1.20106E-5 41630 0 NA
9-107591359-T-C p.Ser651Ser synonymous ABCA1 5 83272 6.00442E-5 41636 0 1.59205E-4
9-107591378-G-A p.Thr645Met missense ABCA1 3 83218 3.60499E-5 41609 0 8.24131E-6
9-107591382-T-C p.Met644Val missense ABCA1 1 83216 1.20169E-5 41608 0 NA
9-107591389-G-C p.Pro641Pro synonymous ABCA1 2 83186 2.40425E-5 41593 0 NA
9-107591399-C-T p.Arg638Gln missense ABCA1 15 83062 1.80588E-4 41531 0 0.00375
9-107591400-G-A p.Arg638Trp missense ABCA1 3 83048 3.61237E-5 41524 0 2.4768E-5
9-107591419-G-GATGTCATCAACGTAACAGGGATAGGGCATCTGTTGCATATAGACACCAGTTTT c.1893-1_1893insAAAACTGGTGTCTATATGCAACAGATGCCCTATCCCTGTTACGTTGATGACAT splice_acceptor ABCA1 1 82858 1.20688E-5 41429 0 NA
9-107591423-G-C c.1893-4C>G splice_region ABCA1 6 82804 7.24603E-5 41402 0 1.17024E-4
9-107593215-A-G p.Val628Ala missense ABCA1 2 83334 2.39998E-5 41667 0 1.64728E-5
9-107593216-C-T p.Val628Ile missense ABCA1 1 83334 1.19999E-5 41667 0 3.20965E-5
9-107593217-G-A p.Tyr627Tyr synonymous ABCA1 8 83344 9.59877E-5 41672 0 2.63565E-4
9-107593242-A-T p.Met619Lys missense ABCA1 2 83362 2.39917E-5 41681 0 NA
9-107593251-C-T p.Gly616Asp missense ABCA1 1 83358 1.19964E-5 41679 0 NA
9-107593264-C-T p.Glu612Lys missense ABCA1 2 83362 2.39917E-5 41681 0 3.21399E-5
9-107593271-C-T p.Thr609Thr synonymous ABCA1 6 83350 7.19856E-5 41675 0 3.97662E-6
9-107593272-G-A p.Thr609Met missense ABCA1 4 83356 4.79869E-5 41678 0 3.57904E-5
9-107593277-C-G p.Val607Val synonymous ABCA1 1 83348 1.19979E-5 41674 0 8.23655E-6
9-107593304-A-G p.Asp598Asp synonymous ABCA1 1 83344 1.19985E-5 41672 0 8.23683E-6
9-107593310-C-A p.Leu596Phe missense ABCA1 1 83334 1.19999E-5 41667 0 NA
9-107593318-C-T p.Ala594Thr missense ABCA1 10 83310 1.20034E-4 41655 0 2.24965E-4
9-107593322-G-GC p.Phe593fs frameshift ABCA1 5 83282 6.0037E-5 41641 0 1.73116E-4
9-107593324-C-A p.Gly592Cys missense ABCA1 1 83312 1.20031E-5 41656 0 3.97725E-6
9-107593329-C-A p.Trp590Leu missense ABCA1 9 83324 1.08012E-4 41662 0 1.28518E-4
9-107593329-C-G p.Trp590Ser missense ABCA1 2 83326 2.40021E-5 41663 0 6.42591E-5
9-107593333-C-T p.Val589Ile missense ABCA1 12 83326 1.44013E-4 41663 0 1.40049E-4
9-107593334-G-A p.Tyr588Tyr synonymous ABCA1 6 83320 7.20115E-5 41660 0 1.98847E-5
9-107593338-C-T p.Arg587Gln missense ABCA1 1 83322 1.20016E-5 41661 0 NA
9-107593339-G-A p.Arg587Trp missense ABCA1 1 83308 1.20036E-5 41654 0 3.29587E-5
9-107593343-G-A p.Asp585Asp synonymous ABCA1 1 83300 1.20048E-5 41650 0 3.97716E-6
9-107593382-C-T p.Gly572Gly splice_region+synonymous ABCA1 18 82880 2.17181E-4 41440 0 0.00151362
9-107593383-C-CCATCCTTGATTT c.1716-2_1716-1insAAATCAAGGATG splice_acceptor ABCA1 1 82880 1.20656E-5 41440 0 NA
9-107593383-C-CCATCCTTGAT c.1716-2_1716-1insATCAAGGATG splice_acceptor ABCA1 1 82880 1.20656E-5 41440 0 NA
9-107593390-C-A c.1716-8G>T splice_region ABCA1 2 82616 2.42084E-5 41308 0 NA
9-107593900-T-C c.1715+3A>G splice_region ABCA1 2 82942 2.41132E-5 41471 0 NA
9-107593908-C-T p.Lys570Lys synonymous ABCA1 1 83054 1.20404E-5 41527 0 8.43441E-6
9-107593910-T-G p.Lys570Gln missense ABCA1 1 83074 1.20375E-5 41537 0 NA
9-107593933-T-C p.Asn562Ser missense ABCA1 1 83222 1.20161E-5 41611 0 1.59128E-5
9-107593939-A-G p.Ile560Thr missense ABCA1 1 83250 1.2012E-5 41625 0 4.95278E-5
9-107593940-T-C p.Ile560Val missense ABCA1 1 83254 1.20114E-5 41627 0 3.1841E-5
9-107593943-C-G p.Asp559His missense ABCA1 1 83260 1.20106E-5 41630 0 NA
9-107593949-G-A p.Arg557* stop_gained ABCA1 1 83280 1.20077E-5 41640 0 3.97788E-6
9-107593971-G-A p.Pro549Pro synonymous ABCA1 1 83304 1.20042E-5 41652 0 8.23954E-6
9-107593982-T-C p.Ile546Val missense ABCA1 2 83342 2.39975E-5 41671 0 8.23818E-5
9-107593983-G-A p.Ser545Ser synonymous ABCA1 343 83338 0.00411577 41669 7 0.00776872
9-107594026-T-G p.Lys531Thr missense ABCA1 1 83330 1.20005E-5 41665 0 NA
9-107594037-C-T p.Leu527Leu synonymous ABCA1 2 83316 2.4005E-5 41658 0 NA
9-107594075-T-C p.Thr515Ala missense ABCA1 1 83200 1.20192E-5 41600 0 8.23683E-6
9-107594078-C-T p.Ala514Thr missense ABCA1 1 83180 1.20221E-5 41590 0 NA
9-107594088-T-C p.Leu510Leu synonymous ABCA1 117 83110 0.00140777 41555 0 0.00385326
9-107594094-G-A p.Asn508Asn synonymous ABCA1 54 83028 6.50383E-4 41514 0 0.00143285
9-107594109-C-A c.1510-1G>T splice_acceptor ABCA1 1 82856 1.20691E-5 41428 0 NA
9-107594110-T-TCCATGAAGCGA c.1510-3_1510-2insTCGCTTCATGG splice_region ABCA1 2 82850 2.414E-5 41425 0 NA
9-107594113-TAGA-T c.1510-8_1510-6delTCT splice_region ABCA1 1 82782 1.20799E-5 41391 0 8.2394E-6
9-107594850-T-G c.1509+5A>C splice_region ABCA1 1 83334 1.19999E-5 41667 0 NA
9-107594855-C-T p.Glu503Glu splice_region+synonymous ABCA1 1 83360 1.19962E-5 41680 0 NA
9-107594860-T-C p.Met502Val missense ABCA1 4 83362 4.79835E-5 41681 1 NA
9-107594863-A-G p.Phe501Leu missense ABCA1 1 83368 1.1995E-5 41684 0 NA
9-107594865-C-T p.Arg500His missense ABCA1 7 83368 8.39651E-5 41684 0 3.29516E-5
9-107594866-G-A p.Arg500Cys missense ABCA1 2 83370 2.39894E-5 41685 0 3.1841E-5
9-107594872-T-C p.Ile498Val missense ABCA1 1 83388 1.19921E-5 41694 0 NA
9-107594877-C-T p.Arg496Gln missense ABCA1 2 83394 2.39825E-5 41697 0 8.23696E-6
9-107594878-G-A p.Arg496Trp missense ABCA1 67 83396 8.03396E-4 41698 0 0.00100705
9-107594897-G-A p.Asn489Asn synonymous ABCA1 2 83400 2.39808E-5 41700 0 5.03525E-4
9-107594910-C-T p.Arg485Lys missense ABCA1 1 83408 1.19893E-5 41704 0 8.23669E-6
9-107594918-G-A p.Tyr482Tyr synonymous ABCA1 1 83404 1.19898E-5 41702 0 8.23669E-6
9-107594929-C-G p.Gly479Arg missense ABCA1 2 83396 2.3982E-5 41698 0 3.18573E-5
9-107594938-A-G p.Ser476Pro missense ABCA1 1 83396 1.1991E-5 41698 0 3.97636E-6
9-107594944-C-A p.Val474Phe missense ABCA1 1 83398 1.19907E-5 41699 0 NA
9-107594952-GGGT-G p.His470del disruptive_inframe_deletion ABCA1 2 83390 2.39837E-5 41695 0 NA
9-107594961-G-T p.Ala468Asp missense ABCA1 1 83392 1.19916E-5 41696 0 NA
9-107594969-C-T p.Ala465Ala synonymous ABCA1 2 83386 2.39848E-5 41693 0 6.25E-4
9-107594972-C-A p.Val464Val synonymous ABCA1 2 83386 2.39848E-5 41693 0 NA
9-107594974-C-T p.Val464Met missense ABCA1 21 83388 2.51835E-4 41694 0 0.00100705
9-107594975-G-A p.Ile463Ile synonymous ABCA1 5 83388 5.99607E-5 41694 0 0.00151057
9-107594979-T-C p.Asp462Gly missense ABCA1 4 83384 4.79708E-5 41692 0 3.18431E-5
9-107594983-G-A p.Gln461* stop_gained ABCA1 1 83390 1.19918E-5 41695 0 NA
9-107594987-T-G p.Thr459Thr synonymous ABCA1 15 83396 1.79865E-4 41698 0 6.68662E-4
9-107594990-C-A p.Trp458Cys missense ABCA1 1 83390 1.19918E-5 41695 0 NA
9-107594993-A-T p.Asp457Glu missense ABCA1 1 83392 1.19916E-5 41696 0 8.23655E-6
9-107595011-C-T p.Gln451Gln synonymous ABCA1 6 83396 7.19459E-5 41698 0 6.36821E-5
9-107595020-A-G p.Phe448Phe synonymous ABCA1 1 83374 1.19941E-5 41687 0 1.64734E-5
9-107595026-G-C p.Asp446Glu missense ABCA1 54 83358 6.47808E-4 41679 0 0.00151057
9-107595029-A-G p.Asn445Asn synonymous ABCA1 2 83364 2.39912E-5 41682 0 NA
9-107595036-C-T p.Arg443Lys missense ABCA1 1 83350 1.19976E-5 41675 0 3.97728E-6
9-107595038-G-C p.Ser442Arg missense ABCA1 1 83346 1.19982E-5