Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
17-79092126-C-G n.432-4G>C splice_region AATK 1 80696 1.23922E-5 40348 0 NA
17-79092128-C-T n.432-6G>A splice_region AATK 2 80754 2.47666E-5 40377 0 3.18634E-5
17-79092129-G-A n.432-7C>T splice_region AATK 3 80792 3.71324E-5 40396 0 3.18552E-5
17-79092203-C-T p.Ter1375Ter stop_retained AATK 5 81330 6.14779E-5 40665 0 6.37349E-5
17-79092207-C-A p.Ala1374Ser missense AATK 4 81350 4.91703E-5 40675 0 4.18711E-6
17-79092211-T-A p.Lys1372Asn missense AATK 2 81290 2.46033E-5 40645 0 NA
17-79092216-T-C p.Ser1371Gly missense AATK 4 81136 4.92999E-5 40568 0 1.15759E-4
17-79092216-T-A p.Ser1371Cys missense AATK 3 81136 3.6975E-5 40568 0 3.85862E-5
17-79092217-C-G p.Glu1370Asp missense AATK 1 81118 1.23277E-5 40559 0 3.18776E-5
17-79092225-C-T p.Gly1368Arg missense AATK 7 81006 8.64134E-5 40503 0 0.00125
17-79092226-G-A p.Ala1367Ala synonymous AATK 122 80970 0.00150673 40485 1 0.00203666
17-79092232-A-C p.Ala1365Ala synonymous AATK 1 80980 1.23487E-5 40490 0 NA
17-79092237-C-T p.Glu1364Lys missense AATK 1 80876 1.23646E-5 40438 0 NA
17-79092240-G-A p.Pro1363Ser missense+splice_region AATK 1 80832 1.23713E-5 40416 0 5.10204E-4
17-79092245-G-A c.4085-3C>T splice_region AATK 8 80730 9.90957E-5 40365 0 3.18817E-5
17-79093174-C-T c.4084+6G>A splice_region AATK 61 54516 0.00111894 27258 1 0.00750939
17-79093179-C-T c.4084+1G>A splice_donor AATK 1 54916 1.82096E-5 27458 0 NA
17-79093184-C-T p.Lys1360Lys synonymous AATK 1 55052 1.81646E-5 27526 0 NA
17-79093192-C-T p.Glu1358Lys missense AATK 3 54760 5.47845E-5 27380 0 2.93555E-5
17-79093193-G-A p.Ala1357Ala synonymous AATK 1 54540 1.83352E-5 27270 0 5.9145E-6
17-79093194-G-T p.Ala1357Asp missense AATK 1 54628 1.83056E-5 27314 0 NA
17-79093195-C-T p.Ala1357Thr missense AATK 4 54460 7.34484E-5 27230 0 6.40779E-5
17-79093198-C-A p.Asp1356Tyr missense AATK 13 54822 2.37131E-4 27411 0 1.46561E-4
17-79093206-G-C p.Ser1353Cys missense AATK 4 54558 7.33165E-5 27279 0 NA
17-79093211-G-A p.His1351His synonymous AATK 46 54144 8.49586E-4 27072 0 0.00136012
17-79093220-G-A p.Ser1348Ser synonymous AATK 4 54066 7.39836E-5 27033 0 6.69714E-4
17-79093228-G-GGGACGT p.Ser1345_Arg1346insThrSer conservative_inframe_insertion AATK 5 53214 9.39602E-5 26607 0 2.12481E-5
17-79093228-G-GGGACGTGGGCGCGGGCGACACCGTGAAGCGCGAGAAGGGAGC p.Ser1345_Arg1346insAlaProPheSerArgPheThrValSerProAlaProThrSer conservative_inframe_insertion AATK 1 53214 1.8792E-5 26607 0 NA
17-79093233-G-A p.Thr1344Met missense AATK 1 52874 1.89129E-5 26437 0 0.00101215
17-79093234-TGGGCGC-T p.Ala1342_Pro1343del conservative_inframe_deletion AATK 1 52730 1.89645E-5 26365 0 1.06847E-5
17-79093244-C-T p.Ser1340Ser synonymous AATK 1 51966 1.92434E-5 25983 0 1.18036E-4
17-79093253-G-A p.Phe1337Phe synonymous AATK 1 52060 1.92086E-5 26030 0 NA
17-79093258-G-A p.Arg1336Cys missense AATK 1 51660 1.93573E-5 25830 0 2.21175E-5
17-79093261-A-C p.Ser1335Ala missense AATK 1 51542 1.94017E-5 25771 0 NA
17-79093264-A-AGGGAGC p.Pro1333_Phe1334insAlaPro conservative_inframe_insertion AATK 1 51570 1.93911E-5 25785 0 2.3559E-4
17-79093265-G-A p.Pro1333Pro synonymous AATK 1 51694 1.93446E-5 25847 0 3.21254E-5
17-79093267-G-A p.Pro1333Ser missense AATK 16 51648 3.09789E-4 25824 0 0.00128449
17-79093268-A-AGTGG p.Pro1333fs frameshift AATK 6 51412 1.16704E-4 25706 0 9.07544E-5
17-79093268-A-AGCGGGC p.Ala1332_Pro1333insProAla disruptive_inframe_insertion AATK 1 51412 1.94507E-5 25706 0 3.40329E-5
17-79093268-A-AGCGGGCGTGGGCGTGGGC p.Ala1332_Pro1333insProThrProThrProAla disruptive_inframe_insertion AATK 1 51412 1.94507E-5 25706 0 NA
17-79093270-C-T p.Ala1332Thr missense AATK 679 51150 0.0132747 25575 13 0.0258359
17-79093270-C-CGGGCGT p.Pro1331_Ala1332insThrPro conservative_inframe_insertion AATK 2191 51212 0.0427829 25606 68 0.0452937
17-79093270-C-CGGGCGTGGGCGCGGGCGT p.Pro1331_Ala1332insThrProAlaProThrPro conservative_inframe_insertion AATK 2 51274 3.90061E-5 25637 0 NA
17-79093270-C-CGT p.Ala1332fs frameshift AATK 6 51276 1.17014E-4 25638 0 4.36732E-5
17-79093270-C-CGGGCGTGGGCGTGGGCGT p.Pro1331_Ala1332insThrProThrProThrPro conservative_inframe_insertion AATK 2 51274 3.90061E-5 25637 0 1.93013E-4
17-79093270-C-CGGGCGTGGGCGT p.Pro1331_Ala1332insThrProThrPro conservative_inframe_insertion AATK 19 51274 3.70558E-4 25637 0 7.39883E-4
17-79093270-C-CGGGCAT p.Pro1331_Ala1332insMetPro conservative_inframe_insertion AATK 4 51276 7.80092E-5 25638 0 2.89519E-4
17-79093270-CGGGCGT-C p.Thr1330_Pro1331del conservative_inframe_deletion AATK 3 51276 5.85069E-5 25638 0 1.70029E-4
17-79093271-G-A p.Pro1331Pro synonymous AATK 7 51486 1.35959E-4 25743 0 2.40702E-4
17-79093274-C-CAT p.Pro1331fs frameshift AATK 5 51054 9.79355E-5 25527 0 3.20883E-5
17-79093275-G-A p.Thr1330Met missense AATK 2456 51242 0.0479294 25621 115 0.064816
17-79093275-G-GGGCA p.Thr1330fs frameshift AATK 6 51416 1.16695E-4 25708 0 3.20554E-5
17-79093276-T-TGGGCGTGGGCGCAGCCG p.Thr1330fs frameshift AATK 2 51366 3.89363E-5 25683 0 NA
17-79093278-G-A p.Pro1329Leu missense AATK 2 51518 3.88214E-5 25759 0 3.19816E-5
17-79093282-T-TGGGCGCAGCCGGGGC p.Pro1327_Thr1328insAlaProAlaAlaPro conservative_inframe_insertion AATK 1 51460 1.94326E-5 25730 0 3.23164E-5
17-79093282-T-TGGGCGC p.Pro1327_Thr1328insAlaPro conservative_inframe_insertion AATK 1 51460 1.94326E-5 25730 0 3.49081E-5
17-79093297-C-T p.Ala1323Thr missense AATK 1 50900 1.96464E-5 25450 0 6.41643E-5
17-79093298-G-A p.Pro1322Pro synonymous AATK 240 51170 0.00469025 25585 4 0.00972463
17-79093310-GT-G p.Asp1318fs frameshift AATK 1 51494 1.94197E-5 25747 0 NA
17-79093312-C-T p.Asp1318Asn missense AATK 12 51358 2.33654E-4 25679 0 2.23514E-4
17-79093312-C-G p.Asp1318His missense AATK 1 51358 1.94712E-5 25679 0 NA
17-79093316-G-T p.Ala1316Ala synonymous AATK 75 51644 0.00145225 25822 0 0.00124784
17-79093324-C-T p.Ala1314Thr missense AATK 293 50886 0.00575797 25443 14 0.0175049
17-79093326-A-G p.Phe1313Ser missense AATK 2 51070 3.91619E-5 25535 0 1.05895E-5
17-79093337-G-A p.Ala1309Ala synonymous AATK 6 50832 1.18036E-4 25416 0 8.3949E-5
17-79093344-A-G p.Met1307Thr missense AATK 1 50536 1.97879E-5 25268 0 3.64737E-5
17-79093349-C-T p.Pro1305Pro synonymous AATK 2 50056 3.99553E-5 25028 0 5.24422E-6
17-79093354-AGTC-A p.Asp1303del conservative_inframe_deletion AATK 2 49678 4.02593E-5 24839 0 6.39918E-5
17-79093354-A-AGTC p.Asp1303dup conservative_inframe_insertion AATK 1 49678 2.01296E-5 24839 0 NA
17-79093362-T-G p.Asp1301Ala missense AATK 1 48710 2.05297E-5 24355 0 2.31278E-5
17-79093367-C-G p.Ala1299Ala synonymous AATK 2 48448 4.12814E-5 24224 0 3.56089E-4
17-79093369-C-G p.Ala1299Pro missense AATK 1 47932 2.08629E-5 23966 0 NA
17-79093369-C-T p.Ala1299Thr missense AATK 1 47932 2.08629E-5 23966 0 5.83621E-6
17-79093370-G-A p.Phe1298Phe synonymous AATK 6 47878 1.25319E-4 23939 0 0.00375469
17-79093384-C-T c.3884-4G>A splice_region AATK 1 46726 2.14014E-5 23363 0 NA
17-79093733-C-T c.3883+3G>A splice_region AATK 3 60108 4.99102E-5 30054 0 NA
17-79093736-C-T p.Gly1295Ser missense+splice_region AATK 1 60132 1.66301E-5 30066 0 NA
17-79093743-C-A p.Ala1292Ala synonymous AATK 1 59862 1.67051E-5 29931 0 NA
17-79093743-C-T p.Ala1292Ala synonymous AATK 3 59862 5.01153E-5 29931 0 NA
17-79093744-G-T p.Ala1292Glu missense AATK 2 59490 3.36191E-5 29745 0 1.60834E-5
17-79093746-T-C p.Thr1291Thr synonymous AATK 1 59796 1.67235E-5 29898 0 6.25234E-5
17-79093749-G-A p.Ser1290Ser synonymous AATK 2 59852 3.34158E-5 29926 0 2.0475E-4
17-79093751-A-G p.Ser1290Pro missense AATK 1 59638 1.67678E-5 29819 0 1.57783E-5
17-79093757-T-C p.Asn1288Asp missense AATK 2 59458 3.36372E-5 29729 0 3.20041E-5
17-79093757-T-TTGGGGAGCCATC p.Pro1287_Asn1288insAspGlySerPro conservative_inframe_insertion AATK 1 59458 1.68186E-5 29729 0 1.50417E-5
17-79093761-G-A p.Ser1286Ser synonymous AATK 1 59272 1.68714E-5 29636 0 NA
17-79093770-A-G p.Ala1283Ala synonymous AATK 1 58790 1.70097E-5 29395 0 NA
17-79093773-C-T p.Gln1282Gln synonymous AATK 11 58578 1.87784E-4 29289 0 0.00507328
17-79093779-C-T p.Pro1280Pro synonymous AATK 8 57948 1.38055E-4 28974 0 0.00285063
17-79093784-G-A p.Arg1279Trp missense AATK 2 57646 3.46945E-5 28823 0 4.49035E-5
17-79093791-G-C p.Ala1276Ala synonymous AATK 2 57706 3.46584E-5 28853 0 NA
17-79093792-G-A p.Ala1276Val missense AATK 2 57584 3.47319E-5 28792 0 NA
17-79093803-G-A p.Gly1272Gly synonymous AATK 1 57080 1.75193E-5 28540 0 NA
17-79093804-C-A p.Gly1272Val missense AATK 1 56942 1.75617E-5 28471 0 NA
17-79093806-G-A p.Pro1271Pro synonymous AATK 1 56952 1.75586E-5 28476 0 NA
17-79093809-G-A p.Ser1270Ser synonymous AATK 1 57182 1.7488E-5 28591 0 6.16314E-5
17-79093810-C-G p.Ser1270Thr missense AATK 1 57338 1.74404E-5 28669 0 NA
17-79093819-A-T p.Leu1267His missense AATK 1 58432 1.71139E-5 29216 0 NA
17-79093821-G-A p.Phe1266Phe synonymous AATK 1 58456 1.71069E-5 29228 0 NA
17-79093822-A-G p.Phe1266Ser missense AATK 21958 57294 0.383251 28647 4474 0.488967
17-79093824-C-T p.Thr1265Thr synonymous AATK 1 58316 1.7148E-5 29158 0 1.38248E-5
17-79093841-T-C p.Lys1260Glu missense AATK 1 60910 1.64177E-5 30455 0 NA
17-79093845-G-T p.Gly1258Gly synonymous AATK 1 60648 1.64886E-5 30324 0 NA
17-79093845-G-A p.Gly1258Gly synonymous AATK 1 60648 1.64886E-5 30324 0 NA
17-79093848-C-T p.Pro1257Pro synonymous AATK 2 61224 3.26669E-5 30612 0 3.80633E-5
17-79093849-G-A p.Pro1257Leu missense AATK 3 61804 4.85405E-5 30902 0 3.89864E-4
17-79093851-G-T p.Phe1256Leu missense AATK 2 62126 3.21926E-5 31063 0 NA
17-79093863-G-A p.Leu1252Leu synonymous AATK 1 63436 1.57639E-5 31718 0 NA
17-79093865-G-A p.Leu1252Phe missense AATK 2 63822 3.13372E-5 31911 0 NA
17-79093875-G-A p.Pro1248Pro synonymous AATK 1 64790 1.54345E-5 32395 0 NA
17-79093882-TCCTGGAGGAATCAGAGAGCACCAGGTAGCTCGGCCGCCAGGAGCCGCGGCCGCTCCCACCCCTTCCTGCGGGAGCGCGACCCCCAGCCCCGGGCAGACCCCGGGTGGCGGCGGCCCA-T p.Glu1246fs frameshift AATK 2 64826 3.08518E-5 32413 1 NA
17-79093889-G-A c.3736-6C>T splice_region AATK 1 64692 1.54579E-5 32346 0 1.1815E-5
17-79094019-G-A p.Thr1239Thr synonymous AATK 2 50872 3.93144E-5 25436 0 8.96516E-4
17-79094034-G-A p.Phe1234Phe synonymous AATK 9 51418 1.75036E-4 25709 1 0.0010144
17-79094045-CCTT-C p.Lys1230del conservative_inframe_deletion AATK 2 51252 3.90229E-5 25626 0 8.89316E-6
17-79094055-G-A p.Arg1227Arg synonymous AATK 1 51600 1.93798E-5 25800 0 NA
17-79094068-T-G p.Glu1223Ala missense AATK 1 51550 1.93986E-5 25775 0 NA
17-79094070-G-A p.Cys1222Cys synonymous AATK 1 51484 1.94235E-5 25742 0 NA
17-79094072-A-G p.Cys1222Arg missense AATK 1 51544 1.94009E-5 25772 0 4.1625E-6
17-79094075-A-C p.Phe1221Val missense AATK 2 51632 3.87357E-5 25816 0 1.75165E-5
17-79094078-T-A p.Thr1220Ser missense AATK 2 51454 3.88697E-5 25727 0 NA
17-79094080-TC-T p.Glu1219fs frameshift AATK 1 51448 1.94371E-5 25724 0 NA
17-79094082-G-A p.Ser1218Ser synonymous AATK 1 51384 1.94613E-5 25692 0 2.62711E-5
17-79094082-G-C p.Ser1218Ser synonymous AATK 1 51384 1.94613E-5 25692 0 NA
17-79094085-C-G p.Leu1217Leu synonymous AATK 4 51504 7.76639E-5 25752 0 4.37744E-5
17-79094086-A-G p.Leu1217Pro missense AATK 2 51494 3.88395E-5 25747 0 8.75473E-6
17-79094096-G-A p.Pro1214Ser missense AATK 1 51154 1.95488E-5 25577 0 1.24799E-5
17-79094104-A-AGCAGGCTGC p.Arg1208_Leu1210dup conservative_inframe_insertion AATK 1 50904 1.96448E-5 25452 0 NA
17-79094108-G-C p.Leu1210Val missense AATK 1 50918 1.96394E-5 25459 0 NA
17-79094112-G-A p.Arg1208Arg synonymous AATK 2 50506 3.95993E-5 25253 0 3.19366E-5
17-79094117-G-C p.Leu1207Val missense AATK 1 50288 1.98855E-5 25144 0 NA
17-79094122-C-T p.Arg1205His missense AATK 5 49592 1.00823E-4 24796 0 5.04541E-4
17-79094125-G-A p.Ala1204Val missense AATK 1 49224 2.03153E-5 24612 0 1.67413E-5
17-79094148-C-T p.Val1196Val synonymous AATK 1 48272 2.07159E-5 24136 0 NA
17-79094149-A-T p.Val1196Glu missense AATK 1 48100 2.079E-5 24050 0 NA
17-79094151-G-A p.Pro1195Pro synonymous AATK 1 47988 2.08385E-5 23994 0 3.19081E-5
17-79094151-G-C p.Pro1195Pro synonymous AATK 1 47988 2.08385E-5 23994 0 NA
17-79094154-C-T p.Val1194Val synonymous AATK 1 47842 2.09021E-5 23921 0 NA
17-79094162-G-A p.Pro1192Ser missense AATK 543 47408 0.0114538 23704 3 0.0107271
17-79094163-C-T p.Ala1191Ala synonymous AATK 130 47360 0.00274493 23680 1 0.00395762
17-79094169-C-G p.Glu1189Asp missense AATK 3 47336 6.33767E-5 23668 0 3.7966E-5
17-79094182-T-A p.Glu1185Val missense AATK 1 46702 2.14124E-5 23351 0 1.0211E-5
17-79094184-G-A p.Ser1184Ser synonymous AATK 2 46466 4.30422E-5 23233 0 1.0272E-4
17-79094191-T-C p.Glu1182Gly missense AATK 1 46312 2.15927E-5 23156 0 NA
17-79094198-C-T p.Val1180Ile missense AATK 1 46002 2.17382E-5 23001 0 3.18979E-5
17-79094199-G-C p.Ser1179Arg missense AATK 1 45930 2.17723E-5 22965 0 4.37909E-6
17-79094216-C-T p.Glu1174Lys missense AATK 1 45156 2.21455E-5 22578 0 1.33326E-5
17-79094219-C-T p.Glu1173Lys missense AATK 1 45014 2.22153E-5 22507 0 4.62423E-6
17-79094220-G-C p.Asp1172Glu missense AATK 1 44918 2.22628E-5 22459 0 4.61732E-5
17-79094220-G-A p.Asp1172Asp synonymous AATK 1 44918 2.22628E-5 22459 0 1.46765E-5
17-79094224-G-T p.Ser1171Tyr missense AATK 5 44924 1.11299E-4 22462 0 4.19325E-4
17-79094229-G-A p.Asp1169Asp synonymous AATK 16 44828 3.5692E-4 22414 0 0.00130212
17-79094244-GTCC-G p.Glu1163del disruptive_inframe_deletion AATK 3 44608 6.72525E-5 22304 0 0.138384
17-79094244-G-A p.Asp1164Asp synonymous AATK 26 44796 5.80409E-4 22398 0 0.0021097
17-79094244-GTCCTCC-G p.Glu1162_Glu1163del disruptive_inframe_deletion AATK 6 44800 1.33929E-4 22400 0 2.49493E-4
17-79094244-G-GTCC p.Glu1163dup disruptive_inframe_insertion AATK 2 44800 4.46429E-5 22400 0 6.5853E-5
17-79094267-G-A p.Arg1157Trp missense AATK 1 44822 2.23105E-5 22411 0 3.91665E-5
17-79094269-CCCT-C p.Glu1155del disruptive_inframe_deletion AATK 2 44892 4.45514E-5 22446 1 6.65009E-6
17-79094279-C-G p.Ala1153Pro missense AATK 1 45214 2.2117E-5 22607 0 NA
17-79094280-C-T p.Ala1152Ala synonymous AATK 38 45226 8.40225E-4 22613 0 5.17745E-4
17-79094281-G-A p.Ala1152Val missense AATK 1 45186 2.21307E-5 22593 0 NA
17-79094289-G-A p.Gly1149Gly synonymous AATK 2 45340 4.41112E-5 22670 0 1.20904E-4
17-79094290-C-T p.Gly1149Asp missense AATK 197 45352 0.0043438 22676 3 0.0101761
17-79094294-G-A p.Pro1148Ser missense AATK 43 45434 9.46428E-4 22717 0 0.00709939
17-79094300-C-T p.Ala1146Thr missense AATK 1 45600 2.19298E-5 22800 0 NA
17-79094306-G-A p.Arg1144Cys missense AATK 1 45708 2.1878E-5 22854 0 4.01043E-4
17-79094313-G-A p.Ala1141Ala synonymous AATK 1 45854 2.18083E-5 22927 0 NA
17-79094323-G-T p.Thr1138Asn missense AATK 1 46166 2.1661E-5 23083 0 NA
17-79094341-C-T p.Arg1132Gln missense AATK 7 47122 1.48551E-4 23561 0 1.35575E-4
17-79094342-G-A p.Arg1132Trp missense AATK 1 47148 2.12098E-5 23574 0 1.3598E-4
17-79094343-C-T p.Lys1131Lys synonymous AATK 3 47296 6.34303E-5 23648 0 NA
17-79094352-G-A p.Ala1128Ala synonymous AATK 3 47916 6.26096E-5 23958 0 3.19142E-5
17-79094376-G-C p.Pro1120Pro synonymous AATK 1 49960 2.0016E-5 24980 0 NA
17-79094379-C-A p.Gly1119Gly synonymous AATK 1 50084 1.99665E-5 25042 0 NA
17-79094384-G-A p.Gln1118* stop_gained AATK 1 50902 1.96456E-5 25451 0 8.14996E-5
17-79094385-G-A p.Phe1117Phe synonymous AATK 1 51022 1.95994E-5 25511 0 7.98085E-5
17-79094390-C-CA p.Glu1116fs frameshift AATK 1 51926 1.92582E-5 25963 0 NA
17-79094401-C-T p.Gly1112Asp missense AATK 3 53174 5.64186E-5 26587 0 6.60327E-5
17-79094438-A-C p.Phe1100Val missense AATK 27 57320 4.7104E-4 28660 1 0.00560081
17-79094438-ACTGGGAGCAG-A p.Cys1097fs frameshift AATK 3 57320 5.23378E-5 28660 0 NA
17-79094440-T-C p.Gln1099Arg missense AATK 2 57498 3.47838E-5 28749 0 NA
17-79094451-G-A p.Pro1095Pro synonymous AATK 6 58322 1.02877E-4 29161 0 1.2747E-4
17-79094454-GCT-CCC p.Ser1094Gly missense AATK 2 58230 3.43466E-5 29115 0 NA
17-79094465-G-A p.Pro1091Ser missense AATK 1 58786 1.70109E-5 29393 0 6.31313E-4
17-79094467-C-G p.Arg1090Pro missense AATK 5 58956 8.4809E-5 29478 0 7.5959E-6
17-79094467-C-T p.Arg1090Gln missense AATK 1 58956 1.69618E-5 29478 0 3.18796E-5
17-79094468-G-C p.Arg1090Gly missense AATK 3 58930 5.09079E-5 29465 0 1.51632E-5
17-79094468-G-A p.Arg1090Trp missense AATK 2 58930 3.39386E-5 29465 0 1.1202E-4
17-79094471-C-A p.Val1089Leu missense AATK 1 59614 1.67746E-5 29807 0 1.08578E-4
17-79094479-G-A p.Pro1086Leu missense AATK 1 60064 1.66489E-5 30032 0 5.58098E-5
17-79094484-T-G p.Gln1084His missense AATK 1 59824 1.67157E-5 29912 0 7.48391E-6
17-79094485-T-G p.Gln1084Pro missense AATK 6 59834 1.00277E-4 29917 0 2.8721E-4
17-79094491-T-G p.Glu1082Ala missense AATK 1 59500 1.68067E-5 29750 0 NA
17-79094493-C-T p.Pro1081Pro synonymous AATK 3 59514 5.04083E-5 29757 0 1.11495E-4
17-79094494-G-A p.Pro1081Leu missense AATK 1 60004 1.66656E-5 30002 0 0.00102041
17-79094494-G-T p.Pro1081Gln missense AATK 1 60006 1.6665E-5 30003 0 2.21343E-5
17-79094495-G-A p.Pro1081Ser missense AATK 5 60230 8.30151E-5 30115 0 0.00125122
17-79094498-G-A p.Pro1080Ser missense AATK 1 60446 1.65437E-5 30223 0 6.37714E-5
17-79094503-G-A p.Pro1078Leu missense AATK 1 61092 1.63688E-5 30546 0 5.16422E-5
17-79094542-G-A p.Ser1065Phe missense AATK 2 66916 2.98882E-5 33458 0 NA
17-79094555-G-A p.Gln1061* stop_gained AATK 5 69738 7.16969E-5 34869 0 NA
17-79094555-G-T p.Gln1061Lys missense AATK 1 69738 1.43394E-5 34869 0 4.15076E-5
17-79094564-G-C p.Pro1058Ala missense AATK 2 71130 2.81175E-5 35565 0 NA
17-79094573-C-T p.Val1055Met missense AATK 4 72132 5.54539E-5 36066 0 5.07099E-4
17-79094576-C-T p.Glu1054Lys missense AATK 1 72502 1.37927E-5 36251 0 4.59179E-5
17-79094579-C-G p.Gly1053Arg missense AATK 2 72834 2.74597E-5 36417 0 1.85753E-4
17-79094579-C-T p.Gly1053Arg missense AATK 2 72834 2.74597E-5 36417 0 3.19183E-5
17-79094580-G-A p.Pro1052Pro synonymous AATK 1 72892 1.37189E-5 36446 0 1.17777E-5
17-79094582-G-A p.Pro1052Ser missense AATK 3 73284 4.09366E-5 36642 0 NA
17-79094587-G-A p.Ser1050Phe missense AATK 1 74118 1.3492E-5 37059 0 NA
17-79094592-T-C p.Gln1048Gln synonymous AATK 2 74798 2.67387E-5 37399 0 NA
17-79094603-C-T p.Gly1045Arg missense AATK 1 75780 1.31961E-5 37890 0 0.0010142
17-79094614-G-A p.Pro1041Leu missense AATK 1 77010 1.29853E-5 38505 0 0.00151976
17-79094625-G-C c.*97+3C>G splice_region AATK 2 77730 2.57301E-5 38865 0 3.19E-5
17-79094637-C-T p.Pro1033Pro synonymous AATK 5 78032 6.40763E-5 39016 0 1.91307E-4
17-79094638-G-A p.Pro1033Leu missense AATK 5 78032 6.40763E-5 39016 0 1.594E-5
17-79094648-T-A p.Thr1030Ser missense AATK 4 78306 5.10817E-5 39153 0 2.18739E-4
17-79094649-G-A p.Ser1029Ser synonymous AATK 1 78340 1.27649E-5 39170 0 NA
17-79094652-C-T p.Pro1028Pro synonymous AATK 145 78334 0.00185105 39167 0 0.0050813
17-79094653-G-A p.Pro1028Leu missense AATK 1 78356 1.27623E-5 39178 0 5.07614E-4
17-79094659-C-T p.Gly1026Asp missense AATK 2 78454 2.54926E-5 39227 0 NA
17-79094672-C-T p.Gly1022Arg missense AATK 118 78458 0.00150399 39229 0 0.00159847
17-79094673-G-A p.Pro1021Pro synonymous AATK 13 78566 1.65466E-4 39283 0 6.27353E-4
17-79094680-C-T p.Arg1019Gln missense AATK 2 78524 2.54699E-5 39262 0 1.08016E-5
17-79094681-G-C p.Arg1019Gly missense AATK 1 78580 1.27259E-5 39290 0 3.22206E-5
17-79094681-G-T p.Arg1019Arg synonymous AATK 1 78580 1.27259E-5 39290 0 NA
17-79094688-G-A p.Gly1016Gly synonymous AATK 1 78930 1.26695E-5 39465 0 2.9146E-5
17-79094688-G-C p.Gly1016Gly synonymous AATK 1 78930 1.26695E-5 39465 0 NA
17-79094691-G-A p.Cys1015Cys synonymous AATK 8 79162 1.01059E-4 39581 0 9.5645E-5
17-79094693-ACTT-A p.Lys1014del conservative_inframe_deletion AATK 12 79264 1.51393E-4 39632 0 5.0813E-4
17-79094697-C-T p.Lys1013Lys synonymous AATK 1 79564 1.25685E-5 39782 0 6.25782E-4
17-79094703-T-C p.Pro1011Pro synonymous AATK 1 79688 1.25489E-5 39844 0 NA
17-79094714-T-TGGCCTC p.Ala1007_Thr1008insGluAla conservative_inframe_insertion AATK 3 79654 3.76629E-5 39827 0 2.20255E-5
17-79094720-C-T p.Glu1006Lys missense AATK 6 79726 7.52578E-5 39863 0 8.21895E-5
17-79094720-C-G p.Glu1006Gln missense AATK 2 79726 2.50859E-5 39863 0 NA
17-79094721-G-A p.Ala1005Ala synonymous AATK 4 79804 5.01228E-5 39902 0 6.02434E-5
17-79094721-G-GGCCTCA p.Ala1005_Glu1006insGluAla disruptive_inframe_insertion AATK 3 79802 3.7593E-5 39901 0 2.00811E-5
17-79094726-C-T p.Glu1004Lys missense AATK 1 79934 1.25103E-5 39967 0 9.37418E-5
17-79094730-C-T p.Gly879Ser missense AATK 1 79968 1.2505E-5 39984 0 7.06764E-5
17-79094746-T-C p.Tyr997Cys missense AATK 1 80436 1.24322E-5 40218 0 NA
17-79094756-C-T p.Asp994Asn missense AATK 2 80610 2.48108E-5 40305 0 3.57143E-4
17-79094759-G-C p.Arg993Gly missense AATK 3 80624 3.72098E-5 40312 0 3.76128E-5
17-79094761-T-G p.Tyr992Ser missense AATK 2 80656 2.47967E-5 40328 0 NA
17-79094775-G-A p.Arg864* stop_gained AATK 1 80824 1.23726E-5 40412 0 NA
17-79094782-C-A p.Trp861Cys missense+splice_region AATK 1 80890 1.23625E-5 40445 0 NA
17-79094783-C-T p.Trp861* stop_gained AATK 1 80964 1.23512E-5 40482 0 4.13955E-6
17-79094784-A-G p.Trp861Arg missense+splice_region AATK 9 80940 1.11193E-4 40470 0 5.4275E-4
17-79094797-G-A p.Ser980Phe missense AATK 1 81016 1.23432E-5 40508 0 3.19E-5
17-79094799-G-A p.Leu979Leu synonymous AATK 2 81032 2.46816E-5 40516 0 2.16455E-5
17-79094799-G-C p.Leu979Leu synonymous AATK 1 81030 1.23411E-5 40515 0 6.37836E-5
17-79094803-C-T p.Arg978Gln missense AATK 6 80996 7.40777E-5 40498 0 6.25E-4
17-79094810-C-T p.Glu976Lys missense AATK 6 81090 7.39919E-5 40545 0 6.37471E-5
17-79094811-G-C p.Pro975Pro synonymous AATK 1 81064 1.23359E-5 40532 0 9.72027E-5
17-79094816-C-T p.Gly974Arg missense AATK 3 81042 3.70178E-5 40521 0 6.4415E-5
17-79094817-G-A p.Pro973Pro synonymous AATK 4 81024 4.93681E-5 40512 0 0.00201613
17-79094821-C-A p.Gly972Val missense AATK 8 81018 9.87435E-5 40509 0 8.50557E-5
17-79094828-C-G p.Gly970Arg missense AATK 6 81122 7.39627E-5 40561 0 NA
17-79094832-T-C p.Ser968Ser synonymous AATK 1 81154 1.23223E-5 40577 0 NA
17-79094836-G-A p.Ala967Val missense AATK 4 81138 4.92987E-5 40569 0 6.25E-4
17-79094837-C-T p.Ala967Thr missense AATK 1 81110 1.23289E-5 40555 0 4.16445E-6
17-79094844-C-T p.Ala964Ala synonymous AATK 1 81110 1.23289E-5 40555 0 0.00125
17-79094845-G-A p.Ala964Val missense AATK 5 81086 6.16629E-5 40543 0 1.59418E-4
17-79094852-C-T p.Ala962Thr missense AATK 1 81088 1.23323E-5 40544 0 NA
17-79094858-G-A p.Pro960Ser missense AATK 1 80962 1.23515E-5 40481 0 1.03432E-5
17-79094866-C-G p.Gly957Ala missense AATK 3 80994 3.70398E-5 40497 0 9.56084E-5
17-79094867-C-T p.Gly957Arg missense AATK 2 81004 2.46901E-5 40502 0 1.66121E-5
17-79094874-C-T p.Ala954Ala synonymous AATK 1 80834 1.2371E-5 40417 0 6.37389E-5
17-79094875-G-A p.Ala954Val missense AATK 18 80844 2.22651E-4 40422 0 2.3311E-4
17-79094885-G-A p.Leu951Phe missense AATK 1 80768 1.23811E-5 40384 0 3.18695E-5
17-79094888-C-T p.Val950Met missense AATK 1 80734 1.23864E-5 40367 0 2.05516E-5
17-79094894-CA-TG p.ProGlu947ProLys missense AATK 3 80688 3.71802E-5 40344 0 NA
17-79094895-A-G p.Pro947Pro synonymous AATK 284 80678 0.00352017 40339 0 0.00807265
17-79094912-C-T p.Glu942Lys missense AATK 3 80526 3.7255E-5 40263 0 3.18715E-5
17-79094913-G-A p.Thr941Thr synonymous AATK 1 80526 1.24183E-5 40263 0 1.26437E-5
17-79094916-G-A p.Asp940Asp synonymous AATK 4 80524 4.96746E-5 40262 0 6.37349E-5
17-79094929-T-G p.Asp936Ala missense AATK 1 80464 1.24279E-5 40232 0 4.24301E-6
17-79094934-C-T p.Ala934Ala synonymous AATK 6 80370 7.46547E-5 40185 0 5.61975E-5
17-79094935-G-A p.Ala934Val missense AATK 1 80348 1.24459E-5 40174 0 1.27584E-4
17-79094939-G-A p.Arg933* stop_gained AATK 1 80294 1.24542E-5 40147 0 NA
17-79094940-C-T p.Pro932Pro synonymous AATK 1 80308 1.24521E-5 40154 0 1.61711E-4
17-79094947-C-G p.Gly930Ala missense AATK 4 80306 4.98095E-5 40153 0 4.69693E-5
17-79094957-G-A p.Pro927Ser missense AATK 2 80176 2.49451E-5 40088 0 2.42371E-5
17-79094967-C-T p.Ser923Ser synonymous AATK 2 80088 2.49725E-5 40044 0 6.37267E-5
17-79094968-G-A p.Ser923Leu missense AATK 3 80046 3.74785E-5 40023 0 5.34974E-5
17-79094970-C-T p.Pro922Pro synonymous AATK 9 80036 1.12449E-4 40018 0 1.87491E-4
17-79094971-G-A p.Pro922Leu missense AATK 5 80024 6.24813E-5 40012 0 4.9995E-5
17-79094984-C-T p.Glu918Lys missense AATK 1 80120 1.24813E-5 40060 0 1.2467E-5
17-79094988-G-C p.Gly916Gly synonymous AATK 2 80108 2.49663E-5 40054 0 9.55353E-5
17-79095001-G-A p.Ala912Val missense AATK 3 80120 3.74438E-5 40060 0 1.23286E-5
17-79095004-G-A p.Ser911Leu missense AATK 1 80190 1.24704E-5 40095 0 NA
17-79095007-G-A p.Ser910Phe missense AATK 1 80212 1.2467E-5 40106 0 0.004375
17-79095009-C-T p.Pro909Pro synonymous AATK 216 80266 0.00269105 40133 2 0.0056391
17-79095010-G-A p.Pro909Leu missense AATK 1 80270 1.2458E-5 40135 0 3.18573E-5
17-79095014-T-TGTCCAGGGA p.Asp907_Ile908insSerLeuAsp conservative_inframe_insertion AATK 42 80372 5.2257E-4 40186 0 3.23971E-4
17-79095014-TGTCCAGGGA-T p.Ser905_Asp907del conservative_inframe_deletion AATK 5 80376 6.22076E-5 40188 0 1.08727E-4
17-79095024-G-A p.Asp904Asp synonymous AATK 1 80588 1.24088E-5 40294 0 2.38783E-5
17-79095025-T-G p.Asp904Ala missense AATK 1 80574 1.2411E-5 40287 0 NA
17-79095030-G-A p.Ser902Ser synonymous AATK 1 80776 1.23799E-5 40388 0 1.17542E-5
17-79095031-G-C p.Ser902Cys missense AATK 1 80786 1.23784E-5 40393 0 3.18593E-5
17-79095031-G-A p.Ser902Phe missense AATK 3 80786 3.71351E-5 40393 0 NA
17-79095035-C-T p.Asp901Asn missense AATK 5 80818 6.18674E-5 40409 0 8.19499E-5
17-79095036-G-A p.Pro900Pro synonymous AATK 7 80860 8.65694E-5 40430 0 0.00151515
17-79095038-G-A p.Pro900Ser missense AATK 1 80922 1.23576E-5 40461 0 1.14419E-5
17-79095040-G-T p.Thr899Asn missense AATK 3 80964 3.70535E-5 40482 0 1.9345E-4
17-79095057-C-T p.Leu893Leu synonymous AATK 1 81224 1.23116E-5 40612 0 3.18573E-5
17-79095061-G-A p.Ser892Phe missense AATK 2 81294 2.46021E-5 40647 0 3.18512E-5
17-79095064-C-T p.Arg891His missense AATK 13 81268 1.59965E-4 40634 0 2.23229E-4
17-79095065-G-A p.Arg891Cys missense AATK 48 81320 5.90261E-4 40660 0 0.005
17-79095067-A-G p.Phe890Ser missense AATK 1 81310 1.22986E-5 40655 0 NA
17-79095075-C-T p.Val887Val synonymous AATK 3 81308 3.68967E-5 40654 0 NA
17-79095084-C-T p.Pro884Pro synonymous AATK 3 81338 3.68831E-5 40669 0 7.68743E-5
17-79095085-G-A p.Pro884Leu missense AATK 513 81342 0.00630671 40671 7 0.0132427
17-79095085-G-T p.Pro884Gln missense AATK 1 81360 1.22911E-5 40680 0 NA
17-79095088-C-A p.Arg883Met missense AATK 2 81390 2.4573E-5 40695 0 3.19E-5
17-79095095-C-A p.Ala881Ser missense AATK 1 81346 1.22932E-5 40673 0 1.22442E-5
17-79095104-C-T p.Gly878Ser missense AATK 1 81270 1.23047E-5 40635 0 2.03897E-5
17-79095105-G-A p.Asp877Asp synonymous AATK 2 81252 2.46148E-5 40626 0 5.47745E-5
17-79095107-C-T p.Asp877Asn missense AATK 1 81248 1.2308E-5 40624 0 4.54694E-5
17-79095108-G-A p.Ser876Ser synonymous AATK 9 81236 1.10788E-4 40618 0 1.17903E-4
17-79095109-C-T p.Ser876Asn missense AATK 1 81256 1.23068E-5 40628 0 3.19163E-5
17-79095114-C-T p.Thr874Thr synonymous AATK 1 81212 1.23135E-5 40606 0 3.19E-5
17-79095115-G-A p.Thr874Met missense AATK 2 81188 2.46342E-5 40594 0 1.79575E-5
17-79095119-C-T p.Asp873Asn missense AATK 5 81126 6.16325E-5 40563 0 6.38407E-5
17-79095120-G-A p.Thr872Thr synonymous AATK 29 81126 3.57469E-4 40563 0 0.001875
17-79095136-G-A p.Thr867Ile missense AATK 2 80714 2.47788E-5 40357 0 1.22132E-5
17-79095138-G-GGCCTCGGCCGTGTCCTCATCCTCACTGCTGGGT p.Ala866_Thr867insProSerSerGluAspGluAspThrAlaGluAla disruptive_inframe_insertion AATK 28 80574 3.47507E-4 40287 0 8.59982E-4
17-79095144-G-A p.Ala864Ala synonymous AATK 52721 65038 0.810618 32519 21385 0.878024
17-79095148-G-T p.Thr863Lys missense AATK 3 80074 3.74653E-5 40037 0 NA
17-79095148-G-A p.Thr863Met missense AATK 2 80074 2.49769E-5 40037 0 6.37146E-5
17-79095164-T-C p.Ser858Gly missense AATK 1 79204 1.26256E-5 39602 0 NA
17-79095165-G-A p.Ser857Ser synonymous AATK 1 79144 1.26352E-5 39572 0 NA
17-79095167-T-C p.Ser857Gly missense AATK 3 79018 3.7966E-5 39509 0 3.18654E-5
17-79095168-G-A p.Pro856Pro synonymous AATK 7 78910 8.87087E-5 39455 0 3.69455E-5
17-79095173-C-T p.Ala855Thr missense AATK 1 78374 1.27593E-5 39187 0 NA
17-79095174-C-T p.Glu854Glu synonymous AATK 1 78390 1.27567E-5 39195 0 4.11916E-6
17-79095179-C-T p.Val853Met missense AATK 1 78008 1.28192E-5 39004 0 NA
17-79095183-G-A p.Pro851Pro synonymous AATK 2 77482 2.58124E-5 38741 0 0.00252781
17-79095197-T-C p.Ser847Gly missense AATK 1 75720 1.32066E-5 37860 0 4.19738E-6
17-79095204-C-T p.Leu844Leu synonymous AATK 62 74870 8.28102E-4 37435 0 0.00245567
17-79095206-G-T p.Leu844Met missense AATK 1 74490 1.34246E-5 37245 0 8.46977E-6
17-79095207-G-A p.Ala843Ala synonymous AATK 1 74350 1.34499E-5 37175 0 8.48011E-6
17-79095211-G-A p.Ser842Phe missense AATK 5 73596 6.79385E-5 36798 0 5.99564E-4
17-79095225-G-A p.Ala837Ala synonymous AATK 1 70590 1.41663E-5 35295 0 1.29443E-5
17-79095226-G-A p.Ala837Val missense AATK 2 70268 2.84625E-5 35134 0 5.05051E-4
17-79095231-C-T p.Val835Val synonymous AATK 1 69208 1.44492E-5 34604 0 NA
17-79095236-C-T p.Glu834Lys missense AATK 1 67448 1.48262E-5 33724 0 2.80143E-5
17-79095237-G-A p.Gly833Gly synonymous AATK 5 66818 7.48301E-5 33409 0 9.56084E-5
17-79095237-G-C p.Gly833Gly synonymous AATK 2 66818 2.99321E-5 33409 0 1.81912E-5
17-79095239-C-A p.Gly833Cys missense AATK 1 66558 1.50245E-5 33279 0 2.85404E-5
17-79095247-G-A p.Ala830Val missense AATK 1 64952 1.5396E-5 32476 0 1.4958E-5
17-79095251-G-A p.Pro829Ser missense AATK 2 63520 3.14861E-5 31760 0 NA
17-79095252-C-A p.Thr828Thr synonymous AATK 21 62942 3.3364E-4 31471 0 2.15969E-4
17-79095252-C-T p.Thr828Thr synonymous AATK 217 62916 0.00344904 31458 4 0.00921615
17-79095253-G-C p.Thr828Arg missense AATK 3 62886 4.77054E-5 31443 0 NA
17-79095253-G-A p.Thr828Met missense AATK 2 62886 3.18036E-5 31443 0 1.88175E-5
17-79095271-G-T p.Ala822Asp missense AATK 1 58956 1.69618E-5 29478 0 NA
17-79095280-G-C p.Ala819Gly missense AATK 25 56928 4.39151E-4 28464 0 0.00264827
17-79095281-C-T p.Ala819Thr missense AATK 13 56376 2.30595E-4 28188 0 0.00253293
17-79095282-G-A p.Asp818Asp synonymous AATK 1 56408 1.7728E-5 28204 0 0.00101317
17-79095284-C-T p.Asp818Asn missense AATK 1 55886 1.78936E-5 27943 0 7.347E-5
17-79095284-CGGG-C p.Pro817del conservative_inframe_deletion AATK 1 55886 1.78936E-5 27943 0 1.10205E-4
17-79095287-G-T p.Pro817Thr missense AATK 1 55770 1.79308E-5 27885 0 1.83164E-5
17-79095294-G-A p.Ala814Ala synonymous AATK 1 54990 1.81851E-5 27495 0 NA
17-79095296-C-T p.Ala814Thr missense AATK 1 54818 1.82422E-5 27409 0 NA
17-79095303-C-T p.Ser811Ser synonymous AATK 15 54346 2.76009E-4 27173 0 0.00125
17-79095304-G-A p.Ser811Leu missense AATK 7 54622 1.28153E-4 27311 0 1.31854E-4
17-79095320-C-T p.Gly806Arg missense AATK 1 53970 1.85288E-5 26985 0 NA
17-79095331-G-T p.Pro802Gln missense AATK 2 53904 3.7103E-5 26952 0 NA
17-79095331-G-A p.Pro802Leu missense AATK 2 53904 3.7103E-5 26952 0 0.00101215
17-79095341-C-T p.Val799Ile missense AATK 10 53004 1.88665E-4 26502 0 0.00101626
17-79095342-G-A p.Ser798Ser synonymous AATK 1 53336 1.87491E-5 26668 0 0.0015213
17-79095345-A-G p.Pro797Pro synonymous AATK 1 53402 1.87259E-5 26701 0 1.8875E-5
17-79095353-G-A p.Pro795Ser missense AATK 3 53168 5.64249E-5 26584 0 1.60979E-4
17-79095358-C-T p.Arg793His missense AATK 15 52800 2.84091E-4 26400 0 0.001875
17-79095359-G-T p.Arg793Ser missense AATK 283 53190 0.00532055 26595 4 0.011989
17-79095359-G-A p.Arg793Cys missense AATK 15 53206 2.81923E-4 26603 0 4.464E-4
17-79095365-C-T p.Gly791Arg missense AATK 6 52796 1.13645E-4 26398 0 0.00125
17-79095366-G-A p.Thr790Thr synonymous AATK 24 52792 4.54614E-4 26396 0 0.00203666
17-79095370-G-A p.Thr789Ile missense AATK 2 52894 3.78115E-5 26447 0 NA
17-79095375-C-T p.Glu787Glu synonymous AATK 1 52916 1.88979E-5 26458 0 1.36116E-5
17-79095408-C-T p.Pro776Pro synonymous AATK 4 51530 7.76247E-5 25765 0 0.0030581
17-79095409-G-A p.Pro776Leu missense AATK 1 51596 1.93813E-5 25798 0 8.15381E-6
17-79095418-C-T p.Gly773Asp missense AATK 1 51140 1.95542E-5 25570 0 NA
17-79095448-G-A p.Pro763Leu missense AATK 1 49604 2.01597E-5 24802 0 5.61987E-5
17-79095451-G-A p.Thr762Ile missense AATK 1 49404 2.02413E-5 24702 0 NA
17-79095457-A-G p.Leu760Pro missense AATK 2 49188 4.06603E-5 24594 0 NA
17-79095458-G-A p.Leu760Leu synonymous AATK 4 49142 8.13968E-5 24571 0 3.18756E-5
17-79095459-G-C p.Cys759Trp missense AATK 2 48970 4.08413E-5 24485 0 9.56145E-5
17-79095471-T-G p.Ala755Ala synonymous AATK 2 48132 4.15524E-5 24066 0 NA
17-79095478-C-A p.Gly753Val missense AATK 1 47840 2.0903E-5 23920 0 3.82824E-4
17-79095483-G-A p.Ala751Ala synonymous AATK 1 47650 2.09864E-5 23825 0 NA
17-79095491-A-G p.Cys749Arg missense AATK 1 47248 2.11649E-5 23624 0 NA
17-79095503-G-T p.Leu745Ile missense AATK 5 46826 1.06778E-4 23413 0 3.51056E-4
17-79095506-C-T p.Gly744Ser missense AATK 7 46548 1.50382E-4 23274 0 5.00701E-4
17-79095507-G-A p.Pro743Pro synonymous AATK 4 46648 8.57486E-5 23324 0 9.92457E-4
17-79095509-G-A p.Pro743Ser missense AATK 10 46576 2.14703E-4 23288 0 9.85028E-4
17-79095520-G-A p.Pro739Leu missense AATK 10 46692 2.14169E-4 23346 0 0.00377358
17-79095522-C-T p.Glu738Glu synonymous AATK 1 46692 2.14169E-5 23346 0 NA
17-79095534-G-A p.Ala734Ala synonymous AATK 2 46908 4.26366E-5 23454 0 NA
17-79095554-G-A p.Leu728Leu synonymous AATK 1 47328 2.11291E-5 23664 0 7.23966E-6
17-79095558-C-A p.Glu726Asp missense AATK 1 47266 2.11569E-5 23633 0 7.06294E-6
17-79095562-C-T p.Gly725Glu missense AATK 3 47332 6.33821E-5 23666 0 6.36375E-5
17-79095570-C-T p.Gly722Gly synonymous AATK 2 47456 4.21443E-5 23728 0 3.18959E-5
17-79095571-C-T p.Gly722Glu missense AATK 1 47500 2.10526E-5 23750 0 1.87266E-5
17-79095574-G-A p.Pro721Leu missense AATK 1 47484 2.10597E-5 23742 0 4.78515E-5
17-79095579-G-A p.Pro719Pro synonymous AATK 2 47576 4.2038E-5 23788 0 6.30199E-4
17-79095583-G-A p.Ser718Phe missense AATK 1 47870 2.08899E-5 23935 0 3.18898E-5
17-79095588-C-T p.Arg716Arg synonymous AATK 4 47958 8.34063E-5 23979 0 6.36132E-4
17-79095589-C-T p.Arg716Gln missense AATK 25 47988 5.20964E-4 23994 0 0.00204082
17-79095590-G-A p.Arg716Trp missense AATK 1 48100 2.079E-5 24050 0 NA
17-79095595-G-T p.Thr714Asn missense AATK 1 48510 2.06143E-5 24255 0 NA
17-79095602-T-G p.Lys712Gln missense AATK 1 48702 2.0533E-5 24351 0 9.95154E-6
17-79095608-T-G p.Ser710Arg missense AATK 1 48878 2.04591E-5 24439 0 3.18898E-5
17-79095615-G-A p.Gly707Gly synonymous AATK 3 48832 6.14351E-5 24416 0 6.47361E-5
17-79095617-C-T p.Gly707Ser missense AATK 5 48864 1.02325E-4 24432 0 1.87907E-4
17-79095624-G-A p.His704His synonymous AATK 4 48872 8.18465E-5 24436 0 3.18735E-5
17-79095629-C-A p.Gly703Cys missense AATK 25294 48332 0.523339 24166 6698 0.602121
17-79095629-C-G p.Gly703Arg missense AATK 2 48906 4.08948E-5 24453 0 2.55456E-4
17-79095630-G-T p.Gly702Gly synonymous AATK 1 48866 2.04641E-5 24433 0 3.18857E-5
17-79095630-G-A p.Gly702Gly synonymous AATK 2 48866 4.09283E-5 24433 0 4.76535E-6
17-79095633-C-T p.Ala701Ala synonymous AATK 6 48946 1.22584E-4 24473 1 3.59747E-5
17-79095634-G-A p.Ala701Val missense AATK 1 48924 2.04399E-5 24462 0 3.18837E-5
17-79095636-A-G p.Ser700Ser synonymous AATK 1 49050 2.03874E-5 24525 0 4.73889E-5
17-79095641-C-T p.Val699Ile missense AATK 1 49034 2.0394E-5 24517 0 4.65199E-6
17-79095642-G-A p.Pro698Pro synonymous AATK 5 49112 1.01808E-4 24556 0 6.28931E-4
17-79095642-G-T p.Pro698Pro synonymous AATK 1 49112 2.03616E-5 24556 0 3.18837E-5
17-79095647-C-T p.Asp697Asn missense AATK 5 49238 1.01548E-4 24619 0 1.27535E-4
17-79095652-G-C p.Ser695Cys missense AATK 2 49508 4.03975E-5 24754 0 1.14406E-5
17-79095663-G-A p.Arg691Arg synonymous AATK 1 49684 2.01272E-5 24842 0 NA
17-79095665-G-A p.Arg691Cys missense AATK 1 49622 2.01524E-5 24811 0 4.58463E-5
17-79095671-C-T p.Gly689Ser missense AATK 14 49756 2.81373E-4 24878 0 8.28976E-4
17-79095673-CTGT-C p.Asn687del disruptive_inframe_deletion AATK 8 49930 1.60224E-4 24965 0 2.68777E-4
17-79095678-G-A p.Asn686Asn synonymous AATK 4 50462 7.92676E-5 25231 0 6.28931E-4
17-79095684-GGCT-G p.Ala684del disruptive_inframe_deletion AATK 1 50554 1.97808E-5 25277 0 NA
17-79095690-C-G p.Val682Val synonymous AATK 1 50468 1.98145E-5 25234 0 1.10053E-4
17-79095692-C-G p.Val682Leu missense AATK 1 50494 1.98043E-5 25247 0 1.77085E-5
17-79095693-G-C p.Asn681Lys missense AATK 1 50472 1.9813E-5 25236 0 NA
17-79095695-T-C p.Asn681Asp missense AATK 2 50538 3.95742E-5 25269 0 9.78953E-6
17-79095696-G-A p.Ser680Ser synonymous AATK 3 50522 5.93801E-5 25261 0 NA
17-79095697-G-C p.Ser680Cys missense AATK 7 50396 1.389E-4 25198 0 3.89727E-5
17-79095701-G-A p.Arg679Cys missense AATK 2 50184 3.98533E-5 25092 0 6.27353E-4
17-79095707-G-A p.His677Tyr missense AATK 174 50392 0.00345293 25196 3 0.00749028
17-79095710-C-G p.Gly676Arg missense AATK 1 50518 1.97949E-5 25259 0 9.56297E-6
17-79095712-C-T p.Arg675His missense AATK 2 50506 3.95993E-5 25253 0 7.63228E-5
17-79095717-G-A p.Ala673Ala synonymous AATK 1 50640 1.97472E-5 25320 0 NA
17-79095718-G-C p.Ala673Gly missense AATK 2 50526 3.95836E-5 25263 0 2.64231E-5
17-79095720-G-A p.Ala672Ala synonymous AATK 3 50616 5.92698E-5 25308 0 4.39908E-5
17-79095721-G-T p.Ala672Asp missense AATK 3 50642 5.92394E-5 25321 0 3.52141E-5
17-79095727-C-A p.Arg670Leu missense AATK 1 50940 1.96309E-5 25470 0 3.18715E-5
17-79095728-G-A p.Arg670Trp missense AATK 1 50726 1.97138E-5 25363 0 9.56145E-5
17-79095738-C-T p.Glu666Glu synonymous AATK 1 52238 1.91432E-5 26119 0 4.36826E-6
17-79095748-T-C p.Glu663Gly missense AATK 1 53262 1.87751E-5 26631 0 9.31602E-6
17-79095756-G-A p.Gly660Gly synonymous AATK 16 53776 2.9753E-4 26888 0 3.9186E-5
17-79095758-C-T p.Gly660Ser missense AATK 1 54142 1.84699E-5 27071 0 9.37805E-6
17-79095761-TCAGCGG-T p.Pro657_Leu658del conservative_inframe_deletion AATK 2 54266 3.68555E-5 27133 0 3.18735E-5
17-79095765-C-T p.Pro657Pro synonymous AATK 1 54870 1.82249E-5 27435 0 NA
17-79095765-C-G p.Pro657Pro synonymous AATK 2 54870 3.64498E-5 27435 0 NA
17-79095768-C-A p.Leu656Leu synonymous AATK 2 55246 3.62017E-5 27623 0 4.35597E-6
17-79095772-G-A p.Pro655Leu missense AATK 1 55810 1.79179E-5 27905 0 3.18695E-5
17-79095773-G-A p.Pro655Ser missense AATK 1 56002 1.78565E-5 28001 0 5.66166E-5
17-79095776-G-A p.Pro654Ser missense AATK 2 56132 3.56303E-5 28066 0 9.46217E-6
17-79095777-C-T p.Ala653Ala synonymous AATK 2 56058 3.56773E-5 28029 0 0.00151822
17-79095780-C-T p.Gly652Gly synonymous AATK 3 56864 5.27575E-5 28432 0 3.05035E-4
17-79095791-C-T p.Gly649Arg missense AATK 1 58512 1.70905E-5 29256 0 NA
17-79095795-A-G p.Pro647Pro synonymous AATK 1 59032 1.694E-5 29516 0 9.56328E-5
17-79095805-C-T p.Gly644Asp missense AATK 1 59802 1.67218E-5 29901 0 NA
17-79095816-C-A p.Glu640Asp missense AATK 1 60168 1.66201E-5 30084 0 NA
17-79095819-G-A p.Phe639Phe synonymous AATK 1 60152 1.66246E-5 30076 0 1.30852E-5
17-79095823-AA-GC p.Phe638Ala missense AATK 3 60268 4.97777E-5 30134 0 NA
17-79095825-G-A p.Ala637Ala synonymous AATK 2 60344 3.31433E-5 30172 0 6.37389E-5
17-79095840-G-A p.Ala632Ala synonymous AATK 2 58334 3.42853E-5 29167 0 6.27353E-4
17-79095841-G-T p.Ala632Asp missense AATK 81 57990 0.00139679 28995 0 0.00202224
17-79095841-G-A p.Ala632Val missense AATK 7 57992 1.20706E-4 28996 0 2.24321E-5
17-79095844-A-G p.Val631Ala missense AATK 5 57822 8.64723E-5 28911 0 5.05561E-4
17-79095845-C-T p.Val631Met missense AATK 2 57716 3.46524E-5 28858 0 3.44812E-5
17-79095846-G-A p.Gly630Gly synonymous AATK 3 57212 5.24366E-5 28606 0 2.3347E-5
17-79095867-T-C p.Gly623Gly synonymous AATK 1 52846 1.89229E-5 26423 0 0.00608519
17-79095885-CAG-C p.Leu617fs frameshift AATK 1 51022 1.95994E-5 25511 0 NA
17-79095889-G-C p.Pro616Arg missense AATK 1 51250 1.95122E-5 25625 0 NA
17-79095895-G-A p.Ala614Val missense AATK 3 50498 5.94083E-5 25249 0 1.2751E-4
17-79095900-G-C p.Pro612Pro synonymous AATK 1 50096 1.99617E-5 25048 0 2.43629E-5
17-79095901-G-A p.Pro612Leu missense AATK 1 50008 1.99968E-5 25004 0 NA
17-79095903-C-T p.Ser611Ser synonymous AATK 1 49268 2.02971E-5 24634 0 1.35693E-4
17-79095904-G-A p.Ser611Leu missense AATK 2 49192 4.0657E-5 24596 0 6.37146E-5
17-79095912-G-A p.Arg608Arg synonymous AATK 1 47834 2.09056E-5 23917 0 0.00376412
17-79095912-G-C p.Arg608Arg synonymous AATK 1 47834 2.09056E-5 23917 0 5.72856E-6
17-79095913-C-T p.Arg608His missense AATK 3 47476 6.31898E-5 23738 0 1.59347E-4
17-79095920-G-A p.Pro606Ser missense AATK 2 46562 4.29535E-5 23281 0 6.26566E-4
17-79095922-C-T p.Cys605Tyr missense AATK 1 46232 2.163E-5 23116 0 3.86429E-5
17-79095934-C-T p.Arg601Gln missense AATK 1 44932 2.22559E-5 22466 0 6.69774E-6
17-79095937-G-A p.Ala600Val missense AATK 1 44470 2.24871E-5 22235 0 5.45256E-5
17-79095949-C-T p.Arg596His missense AATK 1 43572 2.29505E-5 21786 0 1.34898E-4
17-79095960-G-A p.Asp592Asp synonymous AATK 3 42940 6.98649E-5 21470 0 2.54972E-4
17-79095962-C-T p.Asp592Asn missense AATK 3 42708 7.02445E-5 21354 0 NA
17-79095962-C-G p.Asp592His missense AATK 2 42708 4.68296E-5 21354 0 NA
17-79095963-G-A p.Gly591Gly synonymous AATK 2 42504 4.70544E-5 21252 0 1.83891E-4
17-79095972-C-T p.Trp588* stop_gained AATK 1 42202 2.36956E-5 21101 0 NA
17-79095978-G-C p.Val586Val synonymous AATK 11 42082 2.61394E-4 21041 0 0.00104167
17-79095980-C-T p.Val586Ile missense AATK 1 41984 2.38186E-5 20992 0 NA
17-79095983-C-T p.Asp585Asn missense AATK 1 41846 2.38971E-5 20923 0 NA
17-79095984-G-A p.Val584Val synonymous AATK 25 41802 5.98058E-4 20901 0 7.33231E-4
17-79095985-A-T p.Val584Asp missense AATK 2 41804 4.78423E-5 20902 0 NA
17-79095996-G-A p.His580His synonymous AATK 2 41700 4.79616E-5 20850 0 2.23229E-4
17-79096004-G-T p.Leu578Met missense AATK 1 41670 2.39981E-5 20835 0 NA
17-79096007-G-A p.Leu577Leu synonymous AATK 1 41650 2.40096E-5 20825 0 NA
17-79096009-G-A p.Pro576Leu missense AATK 5 41630 1.20106E-4 20815 0 0.00106838
17-79096011-C-A p.Glu575Asp missense AATK 1 41694 2.39843E-5 20847 0 1.27608E-4
17-79096028-C-T p.Ala570Thr missense AATK 2 41596 4.80815E-5 20798 0 3.94906E-5
17-79096029-G-A p.Ala569Ala synonymous AATK 2 41628 4.80446E-5 20814 0 3.27011E-4
17-79096031-C-T p.Ala569Thr missense AATK 1 41574 2.40535E-5 20787 0 3.19366E-5
17-79096032-G-A p.Thr568Thr synonymous AATK 1 41632 2.402E-5 20816 0 6.88082E-5
17-79096040-C-A p.Gly566Cys missense AATK 1 41836 2.39029E-5 20918 0 NA
17-79096040-C-T p.Gly566Ser missense AATK 1 41836 2.39029E-5 20918 0 1.97656E-5
17-79096052-C-T p.Asp562Asn missense AATK 1 42072 2.37688E-5 21036 0 NA
17-79096053-G-A p.Asp561Asp synonymous AATK 1 42102 2.37518E-5 21051 0 3.27332E-4
17-79096062-C-G p.Ala558Ala synonymous AATK 6 42292 1.41871E-4 21146 0 8.07233E-4
17-79096065-G-T p.Thr557Thr synonymous AATK 1 42366 2.36038E-5 21183 0 NA
17-79096065-G-C p.Thr557Thr synonymous AATK 2 42366 4.72077E-5 21183 0 NA
17-79096080-G-A p.Pro552Pro synonymous AATK 2 43048 4.64598E-5 21524 0 5.74218E-4
17-79096082-G-A p.Pro552Ser missense AATK 1 43058 2.32245E-5 21529 0 0.00312589
17-79096091-C-T p.Gly549Ser missense AATK 1 43352 2.3067E-5 21676 0 1.92215E-5
17-79096092-G-A p.Ala548Ala synonymous AATK 3 43356 6.91946E-5 21678 0 9.59288E-6
17-79096100-C-G p.Asp546His missense AATK 179 43652 0.00410061 21826 0 0.00440631
17-79096103-G-C p.Pro545Ala missense AATK 1 43792 2.28352E-5 21896 0 NA
17-79096107-G-C p.His543Gln missense AATK 1 43772 2.28457E-5 21886 0 NA
17-79096113-G-A p.Ala541Ala synonymous AATK 1 43966 2.27448E-5 21983 0 3.21378E-5
17-79096113-GGC-AGT p.Ala541Thr missense AATK 1 43966 2.27448E-5 21983 0 NA
17-79096115-C-T p.Ala541Thr missense AATK 6493 43742 0.148439 21871 527 0.212779
17-79096119-G-T p.Pro539Pro synonymous AATK 4 44386 9.01185E-5 22193 0 3.06212E-4
17-79096123-G-T p.Ala538Glu missense AATK 1 44618 2.24125E-5 22309 0 NA
17-79096125-G-A p.Ala537Ala synonymous AATK 1 44650 2.23964E-5 22325 0 3.22414E-5
17-79096129-T-C p.Glu536Gly missense AATK 2 45276 4.41735E-5 22638 0 1.73202E-5
17-79096149-C-T p.Glu529Glu synonymous AATK 1 47054 2.12522E-5 23527 0 8.54263E-6
17-79096151-C-T p.Glu529Lys missense AATK 2 47108 4.24556E-5 23554 0 2.57052E-5
17-79096152-G-A p.Ser528Ser synonymous AATK 2 47086 4.24755E-5 23543 0 8.5681E-6
17-79096160-G-A p.Leu526Leu synonymous AATK 3 47980 6.25261E-5 23990 0 8.61594E-6
17-79096164-C-G p.Pro524Pro synonymous AATK 1 48596 2.05778E-5 24298 0 NA
17-79096165-G-A p.Pro524Leu missense AATK 1 48628 2.05643E-5 24314 0 NA
17-79096174-G-A p.Ala521Val missense AATK 3 49576 6.05131E-5 24788 0 4.80307E-4
17-79096174-GCGCTGAGCA-G p.Val518_Ser520del disruptive_inframe_deletion AATK 1 49576 2.0171E-5 24788 0 NA
17-79096176-G-A p.Ser520Ser synonymous AATK 1 49922 2.00312E-5 24961 0 NA
17-79096194-G-A p.Gly514Gly synonymous AATK 3 52032 5.76568E-5 26016 0 3.18776E-5
17-79096196-C-G p.Gly514Arg missense AATK 4 52686 7.59215E-5 26343 0 2.12459E-5
17-79096206-G-A p.Gly510Gly synonymous AATK 3 54192 5.53587E-5 27096 0 5.78075E-5
17-79096208-C-T p.Gly510Ser missense AATK 1 54788 1.82522E-5 27394 0 6.25782E-4
17-79096209-G-A p.Asp509Asp synonymous AATK 2 55100 3.62976E-5 27550 0 6.6454E-5
17-79096212-G-A p.Pro508Pro synonymous AATK 1 55676 1.79611E-5 27838 0 NA
17-79096215-G-A p.Ala507Ala synonymous AATK 2 56490 3.54045E-5 28245 0 1.1529E-5
17-79096216-GC-TT p.Ala507Asn missense AATK 1 56676 1.76442E-5 28338 0 NA
17-79096220-A-G p.Cys506Arg missense AATK 1 57582 1.73665E-5 28791 0 NA
17-79096227-C-T c.1402-1G>A splice_acceptor AATK 1 58928 1.69699E-5 29464 0 2.34819E-5
17-79096228-T-G c.1402-2A>C splice_acceptor AATK 1 59040 1.69377E-5 29520 0 NA
17-79096239-G-A p.Thr499Thr synonymous AATK 5 60248 8.29903E-5 30124 0 1.17811E-5
17-79096239-G-T p.Thr499Thr synonymous AATK 1 60248 1.65981E-5 30124 0 NA
17-79096240-G-A p.Thr499Ile missense AATK 13 60562 2.14656E-4 30281 0 1.37246E-4
17-79096246-C-G p.Gly497Ala missense AATK 6 61426 9.76785E-5 30713 0 4.35673E-5
17-79096248-A-G p.Pro496Pro synonymous AATK 3 61756 4.85783E-5 30878 0 NA
17-79096251-G-A p.Ser495Ser synonymous AATK 1 62238 1.60674E-5 31119 0 NA
17-79096263-C-T p.Pro491Pro synonymous AATK 1 63130 1.58403E-5 31565 0 3.4053E-5
17-79096272-C-A p.Glu488Asp missense AATK 87 64530 0.00134821 32265 0 0.00249846
17-79096274-C-G p.Glu488Gln missense AATK 2 64844 3.08433E-5 32422 0 6.84697E-5
17-79096276-G-A p.Ala487Val missense AATK 6 64960 9.23645E-5 32480 0 9.9108E-5
17-79096278-G-A p.Gly486Gly synonymous AATK 1 65218 1.53332E-5 32609 0 NA
17-79096280-C-T p.Gly486Ser missense AATK 2 65420 3.05717E-5 32710 0 9.77135E-5
17-79096281-GC-TT p.Arg485Gln missense AATK 1 65408 1.52886E-5 32704 0 NA
17-79096282-C-T p.Arg485His missense AATK 2 65624 3.04767E-5 32812 0 6.50195E-4
17-79096285-C-A p.Gly484Val missense AATK 1 66230 1.50989E-5 33115 0 1.00681E-5
17-79096288-G-A p.Ala483Val missense AATK 1 66568 1.50222E-5 33284 0 NA
17-79096308-A-C p.Asn476Lys missense AATK 1 68830 1.45285E-5 34415 0 NA
17-79096318-C-T p.Arg473Gln missense AATK 1 68948 1.45037E-5 34474 0 NA
17-79096323-G-A p.Thr471Thr synonymous AATK 1 69012 1.44902E-5 34506 0 9.13075E-5
17-79096329-G-C c.1401+6C>G splice_region AATK 1 68898 1.45142E-5 34449 0 NA
17-79096330-G-A p.Thr469Ile missense AATK 1 69076 1.44768E-5 34538 0 8.80003E-6
17-79096344-G-A p.Asp464Asp synonymous AATK 93 68948 0.00134884 34474 1 0.00114155
17-79096347-G-A p.Asp463Asp synonymous AATK 1 68944 1.45045E-5 34472 0 NA
17-79096357-G-C p.Ala460Gly missense AATK 3 69082 4.34267E-5 34541 0 6.83574E-5
17-79096364-A-C p.Phe458Val missense AATK 1 69068 1.44785E-5 34534 0 NA
17-79096368-G-A p.Asp456Asp synonymous AATK 1 68818 1.45311E-5 34409 0 3.42395E-5
17-79096375-G-A p.Ala454Val missense AATK 1 68792 1.45366E-5 34396 0 NA
17-79096392-C-T p.Pro448Pro synonymous AATK 1 68232 1.46559E-5 34116 0 NA
17-79096399-G-A p.Ser446Phe missense AATK 27 68014 3.96977E-4 34007 0 1.51841E-4
17-79096411-G-A p.Ala442Val missense AATK 17 67808 2.50708E-4 33904 0 6.25E-4
17-79096413-G-A p.Leu441Leu synonymous AATK 1 67720 1.47667E-5 33860 0 3.41437E-5
17-79096425-G-A p.Gly437Gly synonymous AATK 3 68172 4.40063E-5 34086 0 0.005
17-79096427-C-T p.Gly437Ser missense AATK 4 68376 5.85001E-5 34188 0 6.78472E-5
17-79096436-T-C p.Met434Val missense AATK 1 69352 1.44192E-5 34676 0 NA
17-79096436-T-A p.Met434Leu missense AATK 4 69352 5.76768E-5 34676 0 NA
17-79096444-G-GCCGCACCGGGCCCGGGCCCCA p.Val424_Ala430dup conservative_inframe_insertion AATK 1 70268 1.42312E-5 35134 0 NA
17-79096447-G-A p.Ala430Val missense AATK 1 70484 1.41876E-5 35242 0 NA
17-79096447-G-T p.Ala430Glu missense AATK 2 70484 2.83752E-5 35242 0 1.07875E-5
17-79096449-A-ACCGGGC p.Gly429_Ala430insProGly disruptive_inframe_insertion AATK 11 70654 1.55688E-4 35327 0 1.34363E-4
17-79096449-ACCGGGC-A p.Pro428_Gly429del disruptive_inframe_deletion AATK 3 70654 4.24604E-5 35327 0 NA
17-79096451-C-T p.Gly429Ser missense AATK 1 70732 1.41379E-5 35366 0 3.34829E-5
17-79096451-CG-C p.Gly429fs frameshift AATK 3 70734 4.24124E-5 35367 0 NA
17-79096455-CCCGGGCCCCACGCCGCCCCCG-C p.Gly421_Gly427del disruptive_inframe_deletion AATK 1 71128 1.40592E-5 35564 0 NA
17-79096458-G-C p.Pro426Pro synonymous AATK 1 71460 1.39938E-5 35730 0 4.37568E-5
17-79096458-G-A p.Pro426Pro synonymous AATK 1 71460 1.39938E-5 35730 0 NA
17-79096459-G-C p.Pro426Arg missense AATK 1 71542 1.39778E-5 35771 0 NA
17-79096464-C-T p.Val424Val synonymous AATK 1 72072 1.3875E-5 36036 0 NA
17-79096465-A-ACGCCGCCCC p.Gly421_Gly423dup conservative_inframe_insertion AATK 1 72134 1.38631E-5 36067 0 9.97208E-5
17-79096466-C-T p.Val424Met missense AATK 1 72228 1.3845E-5 36114 0 NA
17-79096476-G-A p.Gly420Gly synonymous AATK 2 73514 2.72057E-5 36757 0 7.5325E-6
17-79096492-C-T p.Arg415His missense AATK 1 74926 1.33465E-5 37463 0 2.13675E-4
17-79096501-C-T p.Arg412Gln missense AATK 1 75488 1.32471E-5 37744 0 NA
17-79096502-G-A p.Arg412Trp missense AATK 2 75568 2.64662E-5 37784 0 0.0026178
17-79096502-G-T p.Arg412Arg synonymous AATK 1 75568 1.32331E-5 37784 0 NA
17-79096517-C-G p.Glu407Gln missense AATK 15 75950 1.97498E-4 37975 0 2.0759E-4
17-79096529-C-A p.Ala403Ser missense AATK 1 76096 1.31413E-5 38048 0 0.00104384
17-79096530-G-A n.360C>T splice_region AATK 1 76116 1.31378E-5 38058 0 1.15982E-4
17-79096536-G-A n.358-4C>T splice_region AATK 1 76250 1.31148E-5 38125 0 NA
17-79096542-CAGGT-C p.Tyr397fs frameshift AATK 1 76368 1.30945E-5 38184 0 NA
17-79096545-G-A p.Tyr397Tyr synonymous AATK 3 76370 3.92824E-5 38185 0 4.70588E-5
17-79096553-G-A p.Leu395Leu synonymous AATK 3 76416 3.92588E-5 38208 0 9.03546E-5
17-79096553-GC-TT p.LeuLeu394LeuMet missense AATK 2 76416 2.61725E-5 38208 0 NA
17-79096558-A-T p.Leu393Gln missense AATK 1 76400 1.3089E-5 38200 0 NA
17-79096578-G-A p.Pro386Pro synonymous AATK 2 76300 2.62123E-5 38150 0 NA
17-79096590-G-A p.Pro382Pro synonymous AATK 1 76100 1.31406E-5 38050 0 2.59754E-5
17-79096590-G-C p.Pro382Pro synonymous AATK 4 76100 5.25624E-5 38050 0 5.04449E-6
17-79096598-G-A p.Leu380Leu synonymous AATK 1 76074 1.31451E-5 38037 0 NA
17-79096607-A-G p.Phe377Leu missense AATK 1 75886 1.31777E-5 37943 0 NA
17-79096621-T-C p.Tyr372Cys missense+splice_region AATK 1 75398 1.3263E-5 37699 0 NA
17-79096627-CGAG-C c.1113-7_1113-5delCTC splice_region AATK 3 74966 4.00181E-5 37483 0 NA
17-79096627-C-T c.1113-4G>A splice_region AATK 5 74964 6.66987E-5 37482 0 9.98295E-5
17-79096628-G-C c.1113-5C>G splice_region AATK 1 74946 1.33429E-5 37473 0 5.2776E-5
17-79096628-G-A c.1113-5C>T splice_region AATK 1 74946 1.33429E-5 37473 0 NA
17-79096629-A-G c.1113-6T>C splice_region AATK 2 74904 2.67008E-5 37452 0 7.6799E-6
17-79096998-G-A p.Arg370Cys missense AATK 6 53006 1.13195E-4 26503 0 1.1685E-4
17-79096999-G-A p.Asp369Asp synonymous AATK 1 53306 1.87596E-5 26653 0 3.1904E-5
17-79097003-G-A p.Ser368Leu missense AATK 3 53844 5.57165E-5 26922 0 5.67537E-4
17-79097029-G-C p.Pro359Pro synonymous AATK 1 55450 1.80343E-5 27725 0 NA
17-79097034-G-A p.Leu358Leu synonymous AATK 1 55614 1.79811E-5 27807 0 0.001875
17-79097035-C-T p.Lys357Lys synonymous AATK 2 55522 3.60218E-5 27761 0 6.25E-4
17-79097045-T-C p.Gln354Arg missense AATK 3 56168 5.34112E-5 28084 0 1.91327E-4
17-79097052-G-A p.Arg352Trp missense AATK 2 56220 3.55745E-5 28110 0 2.27511E-5
17-79097056-C-T p.Thr350Thr synonymous AATK 4 56250 7.11111E-5 28125 0 3.18837E-5
17-79097056-C-G p.Thr350Thr synonymous AATK 2 56250 3.55556E-5 28125 0 NA
17-79097057-G-A p.Thr350Met missense AATK 4 56564 7.07164E-5 28282 0 6.25E-4
17-79097062-C-T p.Ala348Ala synonymous AATK 4 56664 7.05916E-5 28332 0 3.18898E-5
17-79097063-G-A p.Ala348Val missense AATK 2 56500 3.53982E-5 28250 0 1.58831E-4
17-79097065-C-T p.Leu347Leu synonymous AATK 1 56890 1.75778E-5 28445 0 6.25E-4
17-79097073-G-C p.Gln345Glu missense AATK 1 57390 1.74246E-5 28695 0 NA
17-79097088-G-A p.Gln340* stop_gained AATK 1 58086 1.72159E-5 29043 0 NA
17-79097090-G-T p.Pro339His missense AATK 3 58230 5.15198E-5 29115 0 NA
17-79097101-C-T p.Thr335Thr synonymous AATK 3 57292 5.23633E-5 28646 0 1.70707E-4
17-79097102-G-T p.Thr335Lys missense AATK 2 57614 3.47138E-5 28807 0 NA
17-79097104-G-A p.Gly334Gly synonymous AATK 1 57658 1.73436E-5 28829 0 NA
17-79097128-G-A p.Thr326Thr synonymous AATK 1 56056 1.78393E-5 28028 0 NA
17-79097134-G-A p.Gly324Gly synonymous AATK 1 54660 1.82949E-5 27330 0 2.23015E-4
17-79097140-G-A p.Ser322Ser synonymous AATK 10 54230 1.844E-4 27115 0 6.37918E-5
17-79098519-G-A c.962+8C>T splice_region AATK 155 81170 0.00190957 40585 0 0.00391944
17-79098520-C-T c.962+7G>A splice_region AATK 1 81234 1.23101E-5 40617 0 NA
17-79098531-C-T p.Val320Met missense AATK 1 81460 1.2276E-5 40730 0 NA
17-79098538-G-A p.Ser317Ser synonymous AATK 4 81522 4.90665E-5 40761 0 9.55597E-5
17-79098541-C-T p.Lys316Lys synonymous AATK 2 81594 2.45116E-5 40797 0 4.4372E-5
17-79098544-G-A p.Thr315Thr synonymous AATK 444 81572 0.00544304 40786 8 0.0117227
17-79098550-G-A p.Asp313Asp synonymous AATK 2 81566 2.452E-5 40783 0 NA
17-79098556-G-A p.Val311Val synonymous AATK 6 81518 7.36034E-5 40759 0 3.38289E-5
17-79098558-C-T p.Val311Ile missense AATK 1 81508 1.22687E-5 40754 0 3.18593E-5
17-79098570-T-C p.Ser307Gly missense AATK 4 81498 4.9081E-5 40749 0 2.55445E-5
17-79098571-A-G p.His306His synonymous AATK 1 81486 1.2272E-5 40743 0 1.70439E-5
17-79098580-G-A p.Asp303Asp synonymous AATK 2 81384 2.45749E-5 40692 0 1.91168E-4
17-79098595-C-T p.Ala298Ala synonymous AATK 1 81286 1.23022E-5 40643 0 0.00251762
17-79098598-G-A p.Ile297Ile synonymous AATK 34 81228 4.18575E-4 40614 0 3.18593E-4
17-79098604-G-A p.Arg295Arg synonymous AATK 1 81184 1.23177E-5 40592 0 NA
17-79098615-C-T p.Val292Met missense AATK 1 81034 1.23405E-5 40517 0 NA
17-79098616-C-T p.Trp291* stop_gained AATK 2 81042 2.46786E-5 40521 0 4.066E-6
17-79098627-C-T p.Asp288Asn missense AATK 2 80854 2.47359E-5 40427 0 NA
17-79098628-G-A p.Ala287Ala synonymous AATK 3 80826 3.71168E-5 40413 0 6.25E-4
17-79098637-G-A p.Phe284Phe synonymous AATK 6 80744 7.43089E-5 40372 0 2.26819E-5
17-79098646-C-T p.Glu281Glu splice_region+synonymous AATK 1 80648 1.23996E-5 40324 0 1.69591E-5
17-79098647-TCCTGTTGGCACAGGGACGGGTCACCCCTGCCGGCGCAGGCCCTGCCCCTCATGCCCAGCCCAGCCCACCCCACCCCACTCA-T p.Glu281fs frameshift AATK 14 80572 1.73758E-4 40286 7 NA
17-79098649-C-A c.841-1G>T splice_acceptor AATK 1 80626 1.24029E-5 40313 0 NA
17-79098727-C-T c.840+3G>A splice_region AATK 1 79846 1.25241E-5 39923 0 NA
17-79098760-A-G p.Gly270Gly synonymous AATK 2 80056 2.49825E-5 40028 0 6.40451E-5
17-79098772-C-T p.Thr266Thr synonymous AATK 2 79900 2.50313E-5 39950 0 0.0015213
17-79098773-G-A p.Thr266Met missense AATK 1 79888 1.25175E-5 39944 0 6.38447E-5
17-79098774-T-A p.Thr266Ser missense AATK 1 79858 1.25222E-5 39929 0 4.96835E-6
17-79098775-C-G p.Leu265Leu synonymous AATK 1 79878 1.25191E-5 39939 0 3.19E-5
17-79098787-G-C p.Leu261Leu synonymous AATK 2 79538 2.51452E-5 39769 0 5.25017E-5
17-79098801-G-A p.Arg257Trp missense AATK 2 78688 2.54168E-5 39344 0 2.69193E-5
17-79098801-G-T p.Arg257Arg synonymous AATK 4 78688 5.08337E-5 39344 0 1.34597E-4
17-79098811-G-A p.Asp253Asp synonymous AATK 1 77658 1.2877E-5 38829 0 2.96454E-5
17-79098814-G-A p.Ser252Ser splice_region+synonymous AATK 3 76858 3.9033E-5 38429 0 1.6819E-4
17-79098818-C-T c.756-4G>A splice_region AATK 3 76426 3.92537E-5 38213 0 2.07148E-5
17-79098819-A-AGGCAGG c.756-6_756-5insCCTGCC splice_region AATK 30 76324 3.93061E-4 38162 1 1.78228E-4
17-79098819-AGGCAGG-A c.756-11_756-6delCCTGCC splice_region AATK 7 76334 9.17023E-5 38167 0 6.78472E-5
17-79100219-G-A c.755+8C>T splice_region AATK 2 79780 2.50689E-5 39890 0 1.91939E-4
17-79100234-C-T p.Val250Met missense AATK 1 80356 1.24446E-5 40178 0 NA
17-79100234-C-A p.Val250Leu missense AATK 2 80356 2.48892E-5 40178 0 NA
17-79100245-C-T p.Arg246His missense AATK 1 80482 1.24251E-5 40241 0 5.65547E-5
17-79100246-G-A p.Arg246Cys missense AATK 1 80508 1.24211E-5 40254 0 0.00257467
17-79100253-G-A p.His243His synonymous AATK 1 80584 1.24094E-5 40292 0 5.90807E-6
17-79100261-C-T p.Val241Ile missense AATK 1 80564 1.24125E-5 40282 0 1.13366E-4
17-79100262-G-A p.Gly240Gly synonymous AATK 94 80550 0.00116698 40275 0 0.00205128
17-79100268-G-T p.Ala238Ala synonymous AATK 207 80546 0.00256996 40273 4 0.00548469
17-79100295-G-T p.Thr229Thr synonymous AATK 31 80232 3.8638E-4 40116 0 8.60805E-4
17-79100299-C-T p.Arg228Gln missense AATK 6 80078 7.49269E-5 40039 0 6.38733E-5
17-79100303-G-C p.Pro227Ala missense AATK 2 79994 2.50019E-5 39997 0 8.52795E-5
17-79100306-C-T p.Asp226Asn missense AATK 14 79838 1.75355E-4 39919 0 0.0018797
17-79100307-G-A p.Pro225Pro synonymous AATK 3 79828 3.75808E-5 39914 0 1.93598E-4
17-79100322-C-T p.Ala220Ala synonymous AATK 2 79108 2.52819E-5 39554 0 5.33049E-4
17-79100323-G-A p.Ala220Val missense AATK 7 78952 8.86615E-5 39476 0 3.99718E-5
17-79100327-C-T p.Val219Met missense AATK 1 78792 1.26916E-5 39396 0 NA
17-79100329-C-T p.Arg218Gln missense AATK 4 78644 5.08621E-5 39322 0 6.6745E-6
17-79100330-G-A p.Arg218Trp missense AATK 1 78656 1.27136E-5 39328 0 6.67708E-5
17-79100338-C-T p.Arg215Gln missense AATK 3 78166 3.83799E-5 39083 0 NA
17-79100340-C-T p.Leu214Leu synonymous AATK 880 77846 0.0113044 38923 6 0.0125364
17-79100346-G-A p.Gly212Gly synonymous AATK 4 77232 5.1792E-5 38616 0 9.56389E-5
17-79100358-C-G p.Gly208Gly splice_region+synonymous AATK 2 75362 2.65386E-5 37681 0 9.56511E-5
17-79100619-T-A n.664-2A>T splice_acceptor AATK 1 27898 3.58449E-5 13949 0 NA
17-79100621-T-TGGGCAGAACTCCATCACCAGCA n.664-5_664-4insTGCTGGTGATGGAGTTCTGCCC splice_region AATK 1 27952 3.57756E-5 13976 0 NA
17-79100623-G-A n.664-6C>T splice_region AATK 1 27944 3.57859E-5 13972 0 3.19183E-5
17-79101389-G-A p.Cys205Cys synonymous AATK 4 81074 4.93376E-5 40537 0 6.69434E-5
17-79101412-A-G p.Tyr198His missense AATK 1 81114 1.23283E-5 40557 0 6.38203E-5
17-79101413-G-A p.Pro197Pro synonymous AATK 4 81118 4.93109E-5 40559 0 0.00101317
17-79101416-C-T p.Thr196Thr synonymous AATK 2 81092 2.46633E-5 40546 0 9.78359E-5
17-79101417-G-A p.Thr196Met missense AATK 2 81076 2.46682E-5 40538 0 9.57549E-5
17-79101425-G-A p.Ala193Ala synonymous AATK 5 81078 6.1669E-5 40539 0 1.60077E-4
17-79101427-C-T p.Ala193Thr missense AATK 1 81084 1.23329E-5 40542 0 2.002E-5
17-79101428-G-A p.Cys192Cys synonymous AATK 3 81092 3.6995E-5 40546 0 1.19885E-4
17-79101449-C-A p.Leu185Leu synonymous AATK 1 81090 1.2332E-5 40545 0 2.23514E-5
17-79101455-G-C p.Ser183Arg missense AATK 2 81086 2.46652E-5 40543 0 3.19101E-5
17-79101456-C-T p.Ser183Asn missense AATK 3 81092 3.6995E-5 40546 1 4.68099E-5
17-79101467-G-A p.Ala179Ala synonymous AATK 2 81022 2.46847E-5 40511 0 NA
17-79101469-CCCTGCGGGAGTGGACAGGCGGCCCCTGACTTGGGAGGAGGTGGGGAGGGGGAGTCGGGCCGAGCAGGGGAGGGAGAGGAGGGGGCCGCACAGCACAGGCCTTTGTGCCCGGTGGCCTCCCA-C p.Ala179fs frameshift AATK 3 81008 3.70334E-5 40504 0 NA
17-79101474-C-T c.534-4G>A splice_region AATK 6 80954 7.41162E-5 40477 0 3.20061E-5
17-79101475-G-A c.534-5C>T splice_region AATK 3 80986 3.70434E-5 40493 0 1.11458E-4
17-79101584-C-T c.533+8G>A splice_region AATK 1 80308 1.24521E-5 40154 0 NA
17-79101588-C-T c.533+4G>A splice_region AATK 4 80424 4.97364E-5 40212 0 6.47668E-6
17-79101597-G-A p.Pro176Pro synonymous AATK 56 80548 6.95238E-4 40274 0 0.00121429
17-79101604-A-G p.Val174Ala missense AATK 1 80556 1.24137E-5 40278 0 6.45886E-6
17-79101622-A-C p.Met168Arg missense AATK 1 80728 1.23873E-5 40364 0 6.42665E-6
17-79101635-C-T p.Val164Met missense AATK 5 80724 6.19394E-5 40362 0 3.20385E-5
17-79101650-G-T p.Gln159Lys missense AATK 1 80844 1.23695E-5 40422 0 NA
17-79101695-C-T p.Val144Met missense AATK 3 80552 3.7243E-5 40276 0 4.93974E-5
17-79101697-T-A p.Glu143Val missense AATK 44 80494 5.46625E-4 40247 0 6.42864E-4
17-79101699-C-T p.Gly142Gly synonymous AATK 1 80522 1.2419E-5 40261 0 NA
17-79101705-G-A p.Phe140Phe synonymous AATK 89 80342 0.00110776 40171 2 0.00306945
17-79102266-G-C c.414+4C>G splice_region AATK 6 80862 7.42005E-5 40431 0 3.24115E-5
17-79102266-G-A c.414+4C>T splice_region AATK 3 80862 3.71002E-5 40431 0 1.00563E-4
17-79102270-C-T p.Lys138Lys splice_region+synonymous AATK 1 80958 1.23521E-5 40479 0 3.18959E-5
17-79102273-C-T p.Gly137Gly synonymous AATK 1 80992 1.23469E-5 40496 0 NA
17-79102286-C-T p.Arg133His missense AATK 6 81078 7.40028E-5 40539 0 5.18007E-5
17-79102287-G-A p.Arg133Cys missense AATK 2 81078 2.46676E-5 40539 0 0.00131579
17-79102293-T-C p.Ile131Val missense AATK 1 81116 1.2328E-5 40558 0 NA
17-79102306-C-G p.Leu126Leu synonymous AATK 1 81126 1.23265E-5 40563 0 6.47383E-5
17-79102319-C-T p.Arg122Gln missense AATK 2 81128 2.46524E-5 40564 0 NA
17-79102326-C-T p.Val120Met missense AATK 1 81114 1.23283E-5 40557 0 6.47585E-6
17-79102327-G-A p.Asp119Asp synonymous AATK 602 81096 0.0074233 40548 1 0.00794005
17-79102330-T-C p.Thr118Thr synonymous AATK 6067 81046 0.0748587 40523 256 0.0956448
17-79102339-G-A p.Leu115Leu synonymous AATK 6 81112 7.39718E-5 40556 0 1.0015E-4
17-79102344-G-C p.Leu114Val missense AATK 1 81094 1.23314E-5 40547 0 NA
17-79102346-T-G p.Gln113Pro missense AATK 3 81090 3.69959E-5 40545 0 6.4787E-6
17-79102349-A-G p.Val112Ala missense+splice_region AATK 1 81074 1.23344E-5 40537 0 7.12786E-5
17-79102480-C-T n.205+4G>A splice_region AATK 3 74174 4.04454E-5 37087 0 NA
17-79102483-C-A n.205+1G>T splice_donor AATK 5 73944 6.76187E-5 36972 0 NA
17-79104866-C-T p.Arg110His missense AATK 7 80570 8.6881E-5 40285 0 5.68505E-5
17-79104866-C-G p.Arg110Pro missense AATK 1 80570 1.24116E-5 40285 0 NA
17-79104867-G-A p.Arg110Cys missense AATK 30 80574 3.72329E-4 40287 0 9.2445E-4
17-79104871-A-G p.Pro108Pro synonymous AATK 1 80708 1.23903E-5 40354 0 NA
17-79104874-C-G p.Gln107His missense AATK 1 80744 1.23848E-5 40372 0 NA
17-79104885-T-C p.Met1? start_lost AATK 1 80880 1.2364E-5 40440 0 NA
17-79104897-C-A p.Val100Phe missense AATK 1 80994 1.23466E-5 40497 0 NA
17-79104897-C-T p.Val100Ile missense AATK 2 80994 2.46932E-5 40497 0 1.22227E-5
17-79104901-C-T p.Thr98Thr synonymous AATK 13 81018 1.60458E-4 40509 0 0.00206825
17-79104902-G-A p.Thr98Met missense AATK 4 81032 4.93632E-5 40516 0 0.00103199
17-79104906-G-A p.Leu97Phe missense AATK 4 81058 4.93474E-5 40529 0 NA
17-79104909-G-A p.Pro96Ser missense AATK 1 81064 1.23359E-5 40532 0 NA
17-79104916-G-A c.-31C>T 5_prime_UTR_premature_start_codon_gain AATK 6 80982 7.40905E-5 40491 0 0.0010352
17-79104922-G-A c.-37C>T 5_prime_UTR_premature_start_codon_gain AATK 132 80952 0.0016306 40476 0 0.00225312
17-79104924-C-T p.Asp91Asn missense AATK 4 80964 4.94047E-5 40482 0 6.63885E-4
17-79104930-C-T p.Gly89Arg missense AATK 2 80994 2.46932E-5 40497 0 0.00205761
17-79104931-G-A c.-46C>T 5_prime_UTR_premature_start_codon_gain AATK 2 80966 2.47017E-5 40483 0 4.50288E-5
17-79104943-C-T p.Thr84Thr synonymous AATK 271 81026 0.00334461 40513 8