Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
6-44268287-G-C p.Leu985Leu synonymous AARS2 1 82622 1.21033E-5 41311 0 NA
6-44268290-C-G p.Gln984His missense AARS2 7 82666 8.46781E-5 41333 1 0.00375
6-44268305-G-C p.Thr979Thr synonymous AARS2 1 82868 1.20674E-5 41434 0 1.59205E-4
6-44268308-T-G p.Gln978His missense AARS2 1 82884 1.20651E-5 41442 0 NA
6-44268322-G-A p.Leu974Phe missense AARS2 1 82964 1.20534E-5 41482 0 3.18451E-5
6-44268337-C-A p.Asp969Tyr missense AARS2 35 82944 4.21971E-4 41472 0 9.55657E-4
6-44268349-C-T p.Gly965Arg missense AARS2 2 82890 2.41284E-5 41445 0 6.25E-4
6-44268349-C-CG p.Gly965fs frameshift AARS2 2 82890 2.41284E-5 41445 0 NA
6-44268350-G-A p.Thr964Thr synonymous AARS2 6 82862 7.24096E-5 41431 0 5.03525E-4
6-44268367-C-A p.Val959Leu missense AARS2 1 82812 1.20755E-5 41406 0 NA
6-44268369-C-T p.Arg958Gln missense AARS2 2 82802 2.4154E-5 41401 0 3.29815E-5
6-44268370-G-A p.Arg958* stop_gained AARS2 1 82774 1.20811E-5 41387 0 6.25E-4
6-44268371-T-C p.Ser957Ser synonymous AARS2 75830 82426 0.919977 41213 35217 0.948502
6-44268372-G-A p.Ser957Leu missense AARS2 3 82762 3.62485E-5 41381 0 1.98984E-5
6-44268381-G-A p.Ala954Val missense AARS2 4 82654 4.83945E-5 41327 0 1.71157E-4
6-44268386-GCCC-G p.Gly952del disruptive_inframe_deletion AARS2 1 82656 1.20983E-5 41328 0 7.96331E-6
6-44268388-C-T p.Gly952Ser missense AARS2 1 82684 1.20942E-5 41342 0 NA
6-44268391-C-G p.Gly951Arg missense AARS2 1 82674 1.20957E-5 41337 0 NA
6-44268403-A-G p.Cys947Arg missense AARS2 1 82644 1.21001E-5 41322 0 NA
6-44268408-G-C p.Ala945Gly missense AARS2 2 82586 2.42172E-5 41293 0 8.30096E-6
6-44268430-T-G p.Thr938Pro missense AARS2 1 82410 1.21345E-5 41205 0 3.33439E-5
6-44268433-A-C p.Phe937Val missense AARS2 1 82420 1.2133E-5 41210 0 NA
6-44268448-C-T p.Gly932Ser missense+splice_region AARS2 2 82162 2.43422E-5 41081 0 NA
6-44268915-A-G p.Leu924Pro missense AARS2 1 82760 1.20831E-5 41380 0 8.34488E-6
6-44268930-GGCTGGGGGCTGAGTAGGAGCACAGACGT-G p.Thr910fs frameshift AARS2 14 82708 1.6927E-4 41354 0 6.37714E-5
6-44268956-C-T p.Thr910Thr synonymous AARS2 2 82812 2.41511E-5 41406 0 6.37471E-5
6-44268957-G-C p.Thr910Arg missense AARS2 22 82796 2.65713E-4 41398 0 2.54988E-4
6-44268957-G-A p.Thr910Met missense AARS2 1 82798 1.20776E-5 41399 0 3.58669E-5
6-44268964-G-A p.Pro908Ser missense AARS2 6 82854 7.24165E-5 41427 0 9.11728E-5
6-44268966-G-A p.Ala907Val missense AARS2 1 82824 1.20738E-5 41412 0 NA
6-44268968-C-G p.Gln906His missense AARS2 1 82882 1.20653E-5 41441 0 4.14271E-5
6-44268977-C-T p.Leu903Leu synonymous AARS2 1 82926 1.20589E-5 41463 0 6.25E-4
6-44268977-C-G p.Leu903Leu synonymous AARS2 1 82926 1.20589E-5 41463 0 NA
6-44268984-C-T p.Arg901Gln missense AARS2 1 82952 1.20552E-5 41476 0 0.0025
6-44268985-G-A p.Arg901Trp missense AARS2 7 82966 8.43719E-5 41483 0 1.91339E-4
6-44268985-G-C p.Arg901Gly missense AARS2 3 82966 3.61594E-5 41483 0 1.19441E-5
6-44268986-T-C p.Val900Val synonymous AARS2 2 82970 2.41051E-5 41485 0 NA
6-44269000-GCACCTGGACCACGAAAGACAGATGGTGAGCCCATCGCTTCCCAGACCCCTAGCTGTCTCCTGGTCAGGACTTTGCCCTCCCCAGACCCTGGGGCAGCCCGGCTTGGCTAGCACT-G p.Val895_Leu896del splice_acceptor AARS2 5 83032 6.02177E-5 41516 0 NA
6-44269003-C-T p.Val895Met missense+splice_region AARS2 1 83050 1.20409E-5 41525 0 1.65284E-5
6-44269110-G-A c.2682+8C>T splice_region AARS2 1 83186 1.20213E-5 41593 0 NA
6-44269113-C-A c.2682+5G>T splice_region AARS2 1 83206 1.20184E-5 41603 0 NA
6-44269121-G-A p.Leu893Leu synonymous AARS2 24 83226 2.88371E-4 41613 0 3.18403E-4
6-44269122-A-C p.Leu893Arg missense AARS2 1 83208 1.20181E-5 41604 0 NA
6-44269122-A-G p.Leu893Pro missense AARS2 3 83208 3.60542E-5 41604 0 1.9898E-5
6-44269123-G-C p.Leu893Val missense AARS2 2 83216 2.40338E-5 41608 0 NA
6-44269149-A-C p.Ile884Ser missense AARS2 1 83220 1.20163E-5 41610 0 NA
6-44269150-T-TCAGAGGCCCC p.Ile884fs frameshift AARS2 1 83224 1.20158E-5 41612 0 NA
6-44269159-C-T p.Gly881Arg missense AARS2 6 83246 7.20755E-5 41623 0 NA
6-44269161-T-G p.Lys880Thr missense AARS2 1 83246 1.20126E-5 41623 0 3.19E-5
6-44269164-G-A p.Ser879Leu missense AARS2 1 83228 1.20152E-5 41614 0 3.18796E-5
6-44269170-C-T p.Arg877Gln missense AARS2 11 83228 1.32167E-4 41614 0 4.78286E-4
6-44269171-G-A p.Arg877Trp missense AARS2 262 83210 0.00314866 41605 3 0.00663138
6-44269174-C-G p.Glu876Gln missense AARS2 1 83234 1.20143E-5 41617 0 3.18695E-5
6-44269186-G-A p.Gln872* stop_gained AARS2 1 83214 1.20172E-5 41607 0 NA
6-44269186-G-C p.Gln872Glu missense AARS2 1 83214 1.20172E-5 41607 0 1.59439E-5
6-44269187-A-C p.Thr871Thr synonymous AARS2 1 83214 1.20172E-5 41607 0 NA
6-44269188-G-GT p.Thr871fs frameshift AARS2 1 83196 1.20198E-5 41598 0 4.12875E-5
6-44269190-T-C p.Lys870Lys synonymous AARS2 1 83200 1.20192E-5 41600 0 NA
6-44269193-C-T p.Lys869Lys synonymous AARS2 57732 81206 0.710933 40603 20809 0.735849
6-44269200-G-A p.Ala867Val missense+splice_region AARS2 4 83156 4.81024E-5 41578 0 9.59877E-5
6-44269796-C-A c.2598+1G>T splice_donor AARS2 1 82788 1.2079E-5 41394 0 1.59678E-5
6-44269816-C-T p.Arg860His missense AARS2 4 82828 4.82928E-5 41414 0 3.19081E-5
6-44269817-G-A p.Arg860Cys missense AARS2 6 82820 7.24463E-5 41410 0 3.19015E-5
6-44269818-G-A p.Ile859Ile synonymous AARS2 3 82822 3.62223E-5 41411 0 4.20734E-5
6-44269826-T-C p.Thr857Ala missense AARS2 1 82770 1.20817E-5 41385 0 3.18654E-5
6-44269834-C-T p.Arg854His missense AARS2 8 82692 9.67445E-5 41346 0 6.37267E-5
6-44269835-G-A p.Arg854Cys missense AARS2 1 82638 1.2101E-5 41319 0 1.19716E-5
6-44269837-C-T p.Arg853Gln missense AARS2 1 82666 1.20969E-5 41333 0 9.55597E-5
6-44269838-G-A p.Arg853Trp missense AARS2 2 82626 2.42055E-5 41313 0 6.37227E-5
6-44269839-C-T p.Gln852Gln synonymous AARS2 7 82648 8.46965E-5 41324 0 2.54842E-4
6-44269844-G-C p.Leu851Val missense AARS2 7 82582 8.47642E-5 41291 0 8.38089E-5
6-44269847-T-C p.Met850Val missense AARS2 622 82526 0.00753702 41263 13 0.0166667
6-44269856-T-C p.Thr847Ala missense AARS2 1 82278 1.21539E-5 41139 0 3.18613E-5
6-44269870-C-T p.Arg842Gln missense AARS2 2 82630 2.42043E-5 41315 0 1.9995E-5
6-44269871-G-A p.Arg842Trp missense AARS2 1 82596 1.21071E-5 41298 0 8.39095E-6
6-44269873-C-T p.Arg841Gln missense AARS2 3 82602 3.63187E-5 41301 0 2.15608E-4
6-44269874-G-A p.Arg841Trp missense AARS2 2 82552 2.42272E-5 41276 0 1.20065E-5
6-44269889-T-C p.Met836Val missense AARS2 1 82538 1.21156E-5 41269 0 NA
6-44270132-A-G p.Ile828Thr missense AARS2 2 83106 2.40657E-5 41553 0 1.27584E-4
6-44270144-A-G p.Ile824Thr missense AARS2 8 83102 9.62672E-5 41551 0 2.552E-4
6-44270152-G-C p.Ser821Ser synonymous AARS2 1 83120 1.20308E-5 41560 0 3.9788E-6
6-44270170-C-T p.Ala815Ala synonymous AARS2 2 83036 2.40859E-5 41518 0 4.77544E-5
6-44270171-G-A p.Ala815Val missense AARS2 1 83006 1.20473E-5 41503 0 9.56633E-5
6-44270175-C-T p.Val814Met missense AARS2 580 83002 0.00698778 41501 10 0.0150105
6-44270180-C-T p.Arg812Gln missense AARS2 6 82988 7.22996E-5 41494 0 4.95655E-5
6-44270189-A-T p.Leu809Gln missense AARS2 648 82890 0.00781759 41445 10 0.0169578
6-44270198-C-T p.Arg806Gln missense AARS2 3 82938 3.61716E-5 41469 0 2.78609E-5
6-44270199-G-A p.Arg806Trp missense AARS2 19 82904 2.29181E-4 41452 0 7.1902E-4
6-44270205-T-C p.Thr804Ala missense AARS2 1 82918 1.20601E-5 41459 0 NA
6-44270207-G-A p.Ala803Val missense AARS2 1 82920 1.20598E-5 41460 0 1.65341E-5
6-44270209-C-G p.Ala802Ala synonymous AARS2 1 82924 1.20592E-5 41462 0 NA
6-44270210-G-A p.Ala802Val missense AARS2 2 82922 2.41191E-5 41461 0 1.6541E-5
6-44270224-G-C p.Ala797Ala synonymous AARS2 1 82896 1.20633E-5 41448 0 3.18695E-5
6-44270231-C-T p.Ser795Asn missense AARS2 1 82924 1.20592E-5 41462 0 NA
6-44270246-C-T p.Arg790Gln missense AARS2 3 82902 3.61873E-5 41451 0 5.03525E-4
6-44270249-G-A p.Ala789Val missense+splice_region AARS2 1 82896 1.20633E-5 41448 0 1.19479E-5
6-44270250-C-A p.Ala789Ser missense+splice_region AARS2 3 82904 3.61864E-5 41452 0 6.25E-4
6-44270254-C-T c.2365-4G>A splice_region AARS2 2 82912 2.4122E-5 41456 0 2.49033E-5
6-44270256-G-A c.2365-6C>T splice_region AARS2 1 82884 1.20651E-5 41442 0 3.18735E-5
6-44270543-T-C p.Gln787Arg missense AARS2 1 82266 1.21557E-5 41133 0 NA
6-44270557-A-C p.Thr782Thr synonymous AARS2 2 82438 2.42607E-5 41219 0 9.05092E-6
6-44270558-G-A p.Thr782Ile missense AARS2 1 82436 1.21306E-5 41218 0 4.0102E-6
6-44270562-C-T p.Val781Ile missense AARS2 2 82486 2.42465E-5 41243 0 3.18613E-5
6-44270563-G-A p.Ala780Ala synonymous AARS2 2 82490 2.42454E-5 41245 0 8.83611E-6
6-44270573-C-T p.Arg777His missense AARS2 1 82652 1.20989E-5 41326 0 8.64409E-6
6-44270574-G-A p.Arg777Cys missense AARS2 6 82684 7.25654E-5 41342 0 1.47812E-4
6-44270581-G-A p.Gly774Gly synonymous AARS2 2 82740 2.41721E-5 41370 0 3.18512E-5
6-44270586-T-C p.Lys773Glu missense AARS2 1 82826 1.20735E-5 41413 0 NA
6-44270597-C-T p.Arg769His missense AARS2 1 82870 1.20671E-5 41435 0 1.69411E-5
6-44270598-G-A p.Arg769Cys missense AARS2 4 82864 4.82719E-5 41432 0 2.79025E-5
6-44270606-A-C p.Ile766Ser missense AARS2 4 82922 4.82381E-5 41461 0 6.36983E-5
6-44270610-T-C p.Ile765Val missense AARS2 8 82962 9.64297E-5 41481 0 8.4093E-6
6-44270633-G-A p.Thr757Ile missense AARS2 1 82938 1.20572E-5 41469 0 6.25E-4
6-44270636-C-T p.Arg756His missense AARS2 2 82920 2.41196E-5 41460 0 6.25E-4
6-44270637-G-A p.Arg756Cys missense AARS2 8 82924 9.64739E-5 41462 0 9.29117E-5
6-44270644-G-A p.His753His synonymous AARS2 2 82890 2.41284E-5 41445 0 NA
6-44270646-GCCTGTGGGAGGAAGGAGTGAACAGAAAGTCGGGGCATGACAGTAGAGAAGGGAGAAGCCAGCGTGCATCTCCCATTAAGGGCTGATGGCTCCAAAGACCAAGGGAAGGGCAAGGATCCGGGGCCCCTGGGCCAGGCAGCACAAAGGAGTGACTCA-G p.His753fs frameshift AARS2 1 82874 1.20665E-5 41437 0 NA
6-44270647-C-CGTCCCACAGCATAG c.2256-1_2256insCTATGCTGTGGGAC splice_acceptor AARS2 2 82854 2.41388E-5 41427 0 NA
6-44270647-C-CGTCCCACAGCATAGCTCCACAGAGGT c.2256-1_2256insACCTCTGTGGAGCTATGCTGTGGGAC splice_acceptor AARS2 1 82856 1.20691E-5 41428 0 NA
6-44270649-T-TCCACAGAGGTCTGCA c.2256-3_2256-2insTGCAGACCTCTGTGG splice_region AARS2 2 82840 2.41429E-5 41420 0 NA
6-44270649-T-C c.2256-2A>G splice_acceptor AARS2 2 82840 2.41429E-5 41420 0 NA
6-44270651-T-C c.2256-4A>G splice_region AARS2 2 82822 2.41482E-5 41411 0 NA
6-44270655-A-G c.2256-8T>C splice_region AARS2 2 82798 2.41552E-5 41399 0 NA
6-44270802-C-T c.2255+1G>A splice_donor AARS2 1 82748 1.20849E-5 41374 0 7.96438E-6
6-44270805-C-T p.Gly751Gly splice_region+synonymous AARS2 346 82802 0.00417864 41401 1 0.00302115
6-44270807-C-T p.Gly751Arg missense AARS2 1 82830 1.20729E-5 41415 0 NA
6-44270823-A-G p.Ser745Ser synonymous AARS2 1 82920 1.20598E-5 41460 0 NA
6-44270833-A-C p.Leu742Arg missense AARS2 1 82940 1.20569E-5 41470 0 NA
6-44270835-T-G p.Ala741Ala synonymous AARS2 1 82940 1.20569E-5 41470 0 0.00100705
6-44270837-C-T p.Ala741Thr missense AARS2 5 82910 6.03064E-5 41455 0 3.18512E-5
6-44270838-G-A p.Ala740Ala synonymous AARS2 1 82922 1.20595E-5 41461 0 1.71174E-4
6-44270845-G-T p.Ser738Tyr missense AARS2 1 82922 1.20595E-5 41461 0 7.96178E-6
6-44270848-G-C p.Ala737Gly missense AARS2 2 82916 2.41208E-5 41458 0 3.18593E-5
6-44270851-G-A p.Pro736Leu missense AARS2 1 82948 1.20557E-5 41474 0 NA
6-44270856-C-T p.Leu734Leu synonymous AARS2 1 82974 1.2052E-5 41487 0 NA
6-44270868-C-T p.Val730Val synonymous AARS2 1 83032 1.20435E-5 41516 0 NA
6-44270870-C-T p.Val730Met missense AARS2 2537 82984 0.0305722 41492 47 0.0334247
6-44270871-G-A p.Pro729Pro synonymous AARS2 1 83032 1.20435E-5 41516 0 1.91192E-4
6-44270890-A-G p.Val723Ala missense AARS2 1 83072 1.20378E-5 41536 0 8.2713E-6
6-44270893-C-T p.Arg722Gln missense AARS2 2 83092 2.40697E-5 41546 0 7.44614E-5
6-44270894-G-A p.Arg722Trp missense AARS2 16 83082 1.92581E-4 41541 0 6.05327E-4
6-44270894-G-T p.Arg722Arg synonymous AARS2 2 83082 2.40726E-5 41541 0 6.25E-4
6-44270899-G-A p.Pro720Leu missense AARS2 2 83116 2.40628E-5 41558 0 1.65442E-5
6-44270910-AACCTGAGGTCAAGAGGGGACAGGCCCGTTAACTGCCAAAGGAGAAGGATAAAGCCTCCAGGTATGCCTGAAGGAGGCCCCCGATCTCCAGCAAAAGGGCTTCCCCAACTC-A p.Val716fs frameshift AARS2 6 83086 7.22143E-5 41543 0 NA
6-44271017-A-T c.2145+6T>A splice_region AARS2 1 82476 1.21247E-5 41238 0 2.48789E-5
6-44271027-T-C p.Asp714Gly missense AARS2 1 82482 1.21239E-5 41241 0 8.29573E-6
6-44271032-A-G p.Ser712Ser synonymous AARS2 6 82486 7.27396E-5 41243 0 9.55536E-5
6-44271036-C-T p.Arg711His missense AARS2 3 82408 3.64042E-5 41204 0 6.25E-4
6-44271037-G-A p.Arg711Cys missense AARS2 4 82374 4.8559E-5 41187 0 6.37146E-5
6-44271046-G-T p.Pro708Thr missense AARS2 2 82338 2.42901E-5 41169 0 4.01594E-6
6-44271055-C-T p.Ala705Thr missense AARS2 1 82260 1.21566E-5 41130 0 NA
6-44271062-C-T p.Ala702Ala synonymous AARS2 1 82188 1.21672E-5 41094 0 6.37186E-5
6-44271063-G-A p.Ala702Val missense AARS2 1 82166 1.21705E-5 41083 0 2.48992E-5
6-44271071-C-A p.Val699Val synonymous AARS2 6 82154 7.30336E-5 41077 0 3.18715E-5
6-44271075-T-G p.Glu698Ala missense AARS2 1 82140 1.21743E-5 41070 0 8.30013E-6
6-44271088-C-T p.Val694Met missense AARS2 1 82112 1.21785E-5 41056 0 9.55657E-5
6-44271106-C-T p.Val688Met missense AARS2 2 81752 2.44642E-5 40876 0 1.60799E-5
6-44271114-T-A p.Gln685Leu missense AARS2 1 81628 1.22507E-5 40814 0 NA
6-44271118-C-G p.Val684Leu missense AARS2 1 81522 1.22666E-5 40761 0 3.18573E-5
6-44271120-G-A p.Thr683Ile missense AARS2 4 81520 4.90677E-5 40760 0 1.66229E-5
6-44271121-T-C p.Thr683Ala missense AARS2 2 81510 2.45369E-5 40755 1 NA
6-44271135-C-T p.Arg678Gln missense AARS2 111 80934 0.00137149 40467 0 0.00283656
6-44271136-G-A p.Arg678Trp missense AARS2 2 80990 2.46944E-5 40495 0 1.60857E-5
6-44271145-C-T p.Glu675Lys missense AARS2 2 80780 2.47586E-5 40390 0 NA
6-44271159-G-T p.Thr670Asn missense+splice_region AARS2 2 80318 2.4901E-5 40159 0 1.67001E-5
6-44271163-G-A c.2008-3C>T splice_region AARS2 1 80140 1.24782E-5 40070 0 NA
6-44271164-G-C c.2008-4C>G splice_region AARS2 1 80062 1.24903E-5 40031 0 8.05192E-6
6-44271167-G-C c.2008-7C>G splice_region AARS2 13 79776 1.62956E-4 39888 0 1.2529E-4
6-44271910-G-A c.2007+8C>T splice_region AARS2 178 78830 0.00225802 39415 1 0.00510139
6-44271915-C-T c.2007+3G>A splice_region AARS2 1 79546 1.25713E-5 39773 0 8.26214E-6
6-44271920-G-T p.Gln669Lys missense+splice_region AARS2 2 80008 2.49975E-5 40004 0 6.25E-4
6-44271922-G-A p.Thr668Ile missense AARS2 2 80124 2.49613E-5 40062 0 3.98524E-6
6-44271937-C-T p.Arg663His missense AARS2 3 80920 3.70737E-5 40460 0 3.18613E-5
6-44271950-G-T p.Pro659Thr missense AARS2 2 81536 2.4529E-5 40768 0 8.25123E-6
6-44271958-T-C p.His656Arg missense AARS2 5 81902 6.10486E-5 40951 0 3.9813E-6
6-44271958-TG-T p.His656fs frameshift AARS2 1 81902 1.22097E-5 40951 0 8.2511E-6
6-44271962-A-C p.Ser655Ala missense AARS2 1 81924 1.22064E-5 40962 0 NA
6-44271965-C-A p.Gly654Cys missense AARS2 1 81960 1.22011E-5 40980 0 NA
6-44271997-C-T p.Arg643Lys missense AARS2 1 82522 1.2118E-5 41261 0 1.19374E-5
6-44272016-G-C p.Leu637Val missense AARS2 1 82630 1.21021E-5 41315 0 3.97826E-6
6-44272025-C-T p.Ala634Thr missense AARS2 2 82620 2.42072E-5 41310 0 NA
6-44272026-C-T p.Thr633Thr synonymous AARS2 4 82628 4.84097E-5 41314 0 3.29777E-5
6-44272035-C-T p.Ala630Ala synonymous AARS2 9 82684 1.08848E-4 41342 0 1.59134E-5
6-44272041-G-A p.Cys628Cys synonymous AARS2 1 82720 1.2089E-5 41360 0 NA
6-44272052-G-A p.Arg625Cys missense AARS2 2 82696 2.4185E-5 41348 0 3.18756E-5
6-44272057-GCCTGAAATACTTTTGTCACCCAGCGTCCTGGGTGAGGGCAGGGGGTTGGGAGAGTGAAGGGGCTGCAGGGTATTGGGAACAGTTAGGGAGGATCCTTA-G p.Ala623fs frameshift AARS2 8 82734 9.66954E-5 41367 1 NA
6-44272064-A-C c.1867-6T>G splice_region AARS2 16 82752 1.93349E-4 41376 0 1.31878E-4
6-44272065-T-C c.1867-7A>G splice_region AARS2 1 82744 1.20855E-5 41372 0 NA
6-44272156-C-T c.1866+1G>A splice_donor AARS2 1 82682 1.20945E-5 41341 0 NA
6-44272175-C-T p.Val616Val synonymous AARS2 1 82636 1.21013E-5 41318 0 NA
6-44272187-T-C p.Leu612Leu synonymous AARS2 1 82518 1.21186E-5 41259 0 8.24307E-6
6-44272191-C-T p.Arg611Gln missense AARS2 5 82432 6.06561E-5 41216 0 1.91302E-4
6-44272192-G-A p.Arg611Trp missense AARS2 1 82390 1.21374E-5 41195 0 3.98076E-6
6-44272199-C-T p.Glu608Glu synonymous AARS2 1 82346 1.21439E-5 41173 0 NA
6-44272204-G-A p.Pro607Ser missense AARS2 3 82312 3.64467E-5 41156 0 3.98159E-6
6-44272219-G-T p.His602Asn missense AARS2 1 82034 1.21901E-5 41017 0 NA
6-44272221-A-G p.Leu601Pro missense AARS2 1 81952 1.22023E-5 40976 0 8.24674E-6
6-44272225-T-C p.Ile600Val missense AARS2 1 81886 1.22121E-5 40943 0 NA
6-44272231-C-T p.Gly598Ser missense AARS2 2 81758 2.44624E-5 40879 0 3.18857E-5
6-44272232-T-G p.Gly597Gly synonymous AARS2 3 81724 3.67089E-5 40862 0 5.03525E-4
6-44272248-C-T p.Arg592Gln missense AARS2 5 81402 6.14236E-5 40701 0 1.65076E-5
6-44272249-G-A p.Arg592Trp missense AARS2 11 81350 1.35218E-4 40675 0 3.50676E-4
6-44272256-T-G p.Pro589Pro synonymous AARS2 1 81536 1.22645E-5 40768 0 NA
6-44272259-G-A p.Phe588Phe synonymous AARS2 1 81534 1.22648E-5 40767 0 3.18837E-5
6-44272267-C-T p.Val586Met missense AARS2 6 81540 7.35835E-5 40770 0 1.27494E-4
6-44272268-G-A p.Asp585Asp splice_region+synonymous AARS2 5 81540 6.13196E-5 40770 0 6.37592E-5
6-44272269-TCCTGAGGGAGGGTAGTGGTCAAGGTGCCTGTAGCCTTTCCCTCCCCTTGGCTCCCACTCAGGCTTGGGTCTGCCGCCCACAGAAATCAGCCTGGGTTGTGATGGAGACTCA-T p.Asp585fs frameshift AARS2 5 81580 6.12895E-5 40790 0 NA
6-44272372-GGA-G c.1752+8_1752+9delTC splice_region AARS2 2 82896 2.41266E-5 41448 0 4.1248E-5
6-44272382-C-T p.Glu584Glu splice_region+synonymous AARS2 1035 82922 0.0124816 41461 20 0.0397784
6-44272396-G-A p.Arg580Trp missense AARS2 1 83026 1.20444E-5 41513 0 3.58024E-5
6-44272426-C-A p.Gly570Cys missense AARS2 2 83120 2.40616E-5 41560 0 1.19328E-5
6-44272430-C-G p.Gln568His missense AARS2 1 83110 1.20322E-5 41555 0 NA
6-44272431-T-C p.Gln568Arg missense AARS2 1 83118 1.20311E-5 41559 0 3.97738E-6
6-44272432-G-GT p.Gln568fs frameshift AARS2 1 83106 1.20328E-5 41553 0 1.59099E-5
6-44272439-G-A p.Tyr565Tyr synonymous AARS2 1 83108 1.20325E-5 41554 0 6.3743E-5
6-44272447-T-A p.Asn563Tyr missense AARS2 1 83112 1.2032E-5 41556 0 NA
6-44272448-G-A p.Thr562Thr synonymous AARS2 1 83106 1.20328E-5 41553 0 8.24661E-6
6-44272463-G-A p.Leu557Leu synonymous AARS2 1 83074 1.20375E-5 41537 0 NA
6-44272467-C-A p.Gly556Val missense AARS2 3 83042 3.61263E-5 41521 0 3.18654E-5
6-44272473-C-T p.Arg554His missense AARS2 41 83018 4.93869E-4 41509 0 0.00375
6-44272474-G-A p.Arg554Cys missense AARS2 61 82996 7.34975E-4 41498 0 8.08608E-4
6-44272476-T-A p.Gln553Leu missense AARS2 1 83030 1.20438E-5 41515 0 NA
6-44272479-C-T p.Gly552Asp missense AARS2 1 83000 1.20482E-5 41500 0 1.65052E-5
6-44272479-C-G p.Gly552Ala missense AARS2 2 83000 2.40964E-5 41500 0 NA
6-44272480-C-T p.Gly552Ser missense AARS2 1 83002 1.20479E-5 41501 0 2.78481E-5
6-44272485-C-G p.Gly550Ala missense AARS2 83 82962 0.00100046 41481 0 0.00125
6-44272489-C-T p.Val549Met missense AARS2 12 82948 1.44669E-4 41474 0 3.50385E-4
6-44272490-G-A p.Ser548Ser synonymous AARS2 2 82940 2.41138E-5 41470 0 8.25668E-6
6-44272493-G-A p.Ala547Ala synonymous AARS2 1 82946 1.2056E-5 41473 0 NA
6-44272500-G-A p.Ala545Val missense AARS2 9 82898 1.08567E-4 41449 0 1.19359E-5
6-44272502-T-C p.Thr544Thr synonymous AARS2 2 82902 2.41249E-5 41451 0 NA
6-44272507-C-T p.Gly543Arg missense AARS2 2 82838 2.41435E-5 41419 0 9.55718E-5
6-44272508-G-A p.Asp542Asp synonymous AARS2 11 82838 1.32789E-4 41419 0 1.07399E-4
6-44272510-C-A p.Asp542Tyr missense AARS2 1 82866 1.20677E-5 41433 0 7.95729E-6
6-44272513-C-T p.Glu541Lys missense AARS2 83 82850 0.00100181 41425 0 0.00125
6-44272531-C-G p.Val535Leu missense AARS2 1 82706 1.2091E-5 41353 0 NA
6-44272539-T-C p.Glu532Gly missense AARS2 2 82588 2.42166E-5 41294 0 4.38086E-5
6-44272544-G-A p.Thr530Thr synonymous AARS2 1 82516 1.21189E-5 41258 0 NA
6-44272549-C-T p.Gly529Ser missense AARS2 2 82392 2.42742E-5 41196 0 9.55962E-5
6-44272550-G-A p.Phe528Phe synonymous AARS2 2 82374 2.42795E-5 41187 0 3.3157E-5
6-44272555-C-CATAACTTCCGCTGGGTCGCAGGGAGTAGT c.1580-2_1580-1insACTACTCCCTGCGACCCAGCGGAAGTTAT splice_acceptor AARS2 1 82380 1.21389E-5 41190 0 NA
6-44272555-C-CA c.1580-2_1580-1insT splice_acceptor AARS2 1 82380 1.21389E-5 41190 0 NA
6-44272783-G-T c.1579+8C>A splice_region AARS2 12 82872 1.44802E-4 41436 0 1.27381E-4
6-44272790-C-T c.1579+1G>A splice_donor AARS2 2 82964 2.41068E-5 41482 0 7.95919E-6
6-44272792-A-G p.Tyr526Tyr splice_region+synonymous AARS2 1 82998 1.20485E-5 41499 0 6.25E-4
6-44272800-C-T p.Gly524Arg missense AARS2 1 82972 1.20523E-5 41486 0 0.00125
6-44272801-G-A p.Ser523Ser synonymous AARS2 17 82942 2.04963E-4 41471 0 4.45082E-4
6-44272801-G-T p.Ser523Arg missense AARS2 1 82942 1.20566E-5 41471 0 NA
6-44272805-G-C p.Pro522Arg missense AARS2 1 82994 1.20491E-5 41497 0 NA
6-44272806-G-A p.Pro522Ser missense AARS2 1 83006 1.20473E-5 41503 0 NA
6-44272808-C-T p.Arg521Gln missense AARS2 1 83000 1.20482E-5 41500 0 3.18552E-5
6-44272809-G-A p.Arg521* stop_gained AARS2 1 82986 1.20502E-5 41493 0 8.24171E-6
6-44272812-G-A p.Leu520Leu synonymous AARS2 13 83060 1.56513E-4 41530 0 5.73468E-4
6-44272817-T-C p.Tyr518Cys missense AARS2 4 83010 4.8187E-5 41505 0 1.19376E-5
6-44272827-T-G p.Lys515Gln missense AARS2 1 83030 1.20438E-5 41515 0 NA
6-44272836-C-G p.Asp512His missense AARS2 40 83006 4.81893E-4 41503 1 7.32951E-4
6-44272836-C-T p.Asp512Asn missense AARS2 3 83006 3.6142E-5 41503 0 4.94454E-5
6-44272837-G-A p.Asp511Asp synonymous AARS2 11 83006 1.32521E-4 41503 0 9.54988E-5
6-44272842-T-C p.Thr510Ala missense AARS2 1 83020 1.20453E-5 41510 0 3.18776E-5
6-44272843-TG-T p.Pro509fs frameshift AARS2 1 83008 1.2047E-5 41504 0 NA
6-44272849-C-T p.Val507Val synonymous AARS2 1 82932 1.20581E-5 41466 0 NA
6-44272851-C-G p.Val507Leu missense AARS2 1 82950 1.20555E-5 41475 0 6.25E-4
6-44272859-C-T p.Arg504His missense AARS2 1 82912 1.2061E-5 41456 0 3.18573E-5
6-44272861-C-T p.Gln503Gln synonymous AARS2 2 82926 2.41179E-5 41463 0 NA
6-44272862-T-C p.Gln503Arg missense AARS2 1 82946 1.2056E-5 41473 0 8.24049E-6
6-44272876-C-T p.Ala498Ala synonymous AARS2 3 82874 3.61995E-5 41437 0 5.03525E-4
6-44272881-G-T p.His497Asn missense AARS2 1 82916 1.20604E-5 41458 0 NA
6-44272884-C-A p.Val496Phe missense AARS2 1 82924 1.20592E-5 41462 0 NA
6-44272891-C-T p.Trp493* stop_gained AARS2 1 82958 1.20543E-5 41479 0 NA
6-44272896-A-G p.Leu492Leu synonymous AARS2 14 82944 1.68789E-4 41472 0 5.03525E-4
6-44272911-C-G p.Val487Leu missense AARS2 1 82870 1.20671E-5 41435 0 NA
6-44272923-G-C p.Gln483Glu missense AARS2 1 82730 1.20875E-5 41365 0 NA
6-44272925-C-T p.Arg482Gln missense AARS2 3 82692 3.62792E-5 41346 0 3.18756E-5
6-44272930-C-T p.Arg480Arg synonymous AARS2 4 82658 4.83922E-5 41329 0 NA
6-44272931-C-T p.Arg480Gln missense AARS2 3 82628 3.63073E-5 41314 0 7.98792E-6
6-44272932-G-A p.Arg480Trp missense AARS2 2 82608 2.42107E-5 41304 0 4.04157E-4
6-44272933-G-A p.His479His splice_region+synonymous AARS2 1 82596 1.21071E-5 41298 0 NA
6-44272937-T-C c.1435-2A>G splice_acceptor AARS2 1 82552 1.21136E-5 41276 0 NA
6-44272938-G-GGGCCTCCTCTTGGGCCAACCGCTCCAGTC c.1435-4_1435-3insGACTGGAGCGGTTGGCCCAAGAGGAGGCC splice_region AARS2 2 82542 2.42301E-5 41271 0 NA
6-44272942-G-A c.1435-7C>T splice_region AARS2 1 82436 1.21306E-5 41218 0 3.18552E-5
6-44273383-C-T c.1434+7G>A splice_region AARS2 4 81256 4.92271E-5 40628 0 3.98473E-6
6-44273384-T-C c.1434+6A>G splice_region AARS2 2 81268 2.46099E-5 40634 0 8.35185E-6
6-44273393-G-C p.Ala477Ala synonymous AARS2 1 81626 1.2251E-5 40813 0 NA
6-44273394-G-A p.Ala477Val missense AARS2 2 81658 2.44924E-5 40829 0 NA
6-44273412-C-T p.Arg471Gln missense AARS2 347 82168 0.00422306 41084 6 0.00898719
6-44273416-C-G p.Glu470Gln missense AARS2 1 82314 1.21486E-5 41157 0 NA
6-44273425-C-T p.Ala467Thr missense AARS2 7 82356 8.49968E-5 41178 0 3.58132E-5
6-44273426-G-A p.Ser466Ser synonymous AARS2 91 82370 0.00110477 41185 2 0.00248598
6-44273458-T-C p.Met456Val missense AARS2 1 82602 1.21062E-5 41301 0 8.25887E-6
6-44273467-C-T p.Val453Ile missense AARS2 2 82566 2.4223E-5 41283 1 NA
6-44273470-T-C p.Met452Val missense AARS2 1 82556 1.2113E-5 41278 0 NA
6-44273470-TGTCCAAGGGGA-T p.Leu448fs frameshift AARS2 1 82556 1.2113E-5 41278 0 NA
6-44273475-A-G p.Leu450Ser missense AARS2 1 82546 1.21145E-5 41273 0 NA
6-44273488-G-A p.Leu446Leu synonymous AARS2 1 82530 1.21168E-5 41265 0 NA
6-44273504-C-T p.Leu440Leu synonymous AARS2 1 82420 1.2133E-5 41210 0 7.95653E-6
6-44273524-C-CAGGGAACA c.1301-2_1301-1insTGTTCCCT splice_acceptor AARS2 2 82022 2.43837E-5 41011 1 NA
6-44274012-C-T c.1300+5G>A splice_region AARS2 2 82404 2.42707E-5 41202 0 3.18735E-5
6-44274028-T-C p.Asp430Gly missense AARS2 1 82428 1.21318E-5 41214 0 NA
6-44274035-GC-AA p.GlyPro427GlySer missense AARS2 2 82426 2.42642E-5 41213 0 NA
6-44274036-C-T p.Gly427Gly synonymous AARS2 14 82412 1.69878E-4 41206 0 3.29674E-4
6-44274045-C-T p.Arg424Arg synonymous AARS2 1 82492 1.21224E-5 41246 0 NA
6-44274054-C-T p.Arg421Arg synonymous AARS2 2 82580 2.42189E-5 41290 0 NA
6-44274055-C-A p.Arg421Leu missense AARS2 2 82586 2.42172E-5 41293 0 3.18367E-5
6-44274055-C-T p.Arg421Gln missense AARS2 4 82586 4.84344E-5 41293 0 2.38776E-5
6-44274056-G-A p.Arg421Trp missense AARS2 2 82618 2.42078E-5 41309 0 3.58192E-5
6-44274061-A-C p.Ile419Ser missense AARS2 1 82698 1.20922E-5 41349 0 NA
6-44274062-T-C p.Ile419Val missense AARS2 3 82718 3.62678E-5 41359 0 1.19371E-5
6-44274068-G-T p.Arg417Arg synonymous AARS2 5 82754 6.042E-5 41377 0 3.5081E-4
6-44274073-C-T p.Gly415Asp missense AARS2 1 82860 1.20685E-5 41430 0 3.97839E-6
6-44274073-C-A p.Gly415Val missense AARS2 1 82860 1.20685E-5 41430 0 3.18817E-5
6-44274076-C-T p.Arg414Gln missense AARS2 1 82906 1.20619E-5 41453 0 1.98904E-5
6-44274077-G-A p.Arg414Trp missense AARS2 8 82894 9.65088E-5 41447 0 5.96801E-5
6-44274080-C-T p.Glu413Lys missense AARS2 2 82964 2.41068E-5 41482 0 NA
6-44274080-C-G p.Glu413Gln missense AARS2 1 82964 1.20534E-5 41482 0 NA
6-44274081-C-T p.Leu412Leu synonymous AARS2 1 82960 1.2054E-5 41480 0 8.23886E-6
6-44274086-A-G p.Ser411Pro missense AARS2 1 83014 1.20462E-5 41507 0 6.37471E-5
6-44274104-C-T p.Glu405Lys missense AARS2 1 83120 1.20308E-5 41560 0 1.64753E-5
6-44274105-G-A p.Asp404Asp synonymous AARS2 2 83124 2.40604E-5 41562 0 5.76635E-5
6-44274115-A-G p.Val401Ala missense AARS2 1 83176 1.20227E-5 41588 0 NA
6-44274116-C-G p.Val401Leu missense AARS2 1 83176 1.20227E-5 41588 0 NA
6-44274117-C-G p.Leu400Leu synonymous AARS2 1 83188 1.2021E-5 41594 0 NA
6-44274121-T-C p.Asn399Ser missense AARS2 365 83198 0.00438712 41599 5 0.0097833
6-44274122-T-G p.Asn399His missense AARS2 22 83206 2.64404E-4 41603 0 0.00100705
6-44274125-C-T p.Ala398Thr missense AARS2 2 83198 2.4039E-5 41599 0 3.50653E-4
6-44274126-G-A p.Ile397Ile splice_region+synonymous AARS2 1 83212 1.20175E-5 41606 0 4.11828E-5
6-44274128-TCTGAACCAGGCAGAGAAGAAGTGGAGCTGGGTCTCCTTGGAAGGAGGGTCTCTCTCCACAACTCTCCCATCAACCCCTTTCTCTCCCACTGGAATCCAGTAC-T c.1188+1_1189-1del splice_acceptor AARS2 5 83220 6.00817E-5 41610 0 NA
6-44274246-T-C p.Gln391Gln synonymous AARS2 24 83320 2.88046E-4 41660 0 8.28817E-4
6-44274254-C-G p.Glu389Gln missense AARS2 1 83312 1.20031E-5 41656 0 NA
6-44274257-G-A p.Pro388Ser missense AARS2 83 83304 9.96351E-4 41652 2 0.00197603
6-44274261-A-C p.Ala386Ala synonymous AARS2 1 83300 1.20048E-5 41650 0 NA
6-44274262-G-A p.Ala386Val missense AARS2 11 83290 1.32069E-4 41645 0 1.27486E-4
6-44274268-C-A p.Gly384Val missense+splice_region AARS2 3 83288 3.60196E-5 41644 0 1.64742E-5
6-44274270-C-CAG c.1150-2_1150-1insCT splice_acceptor AARS2 1 83286 1.20068E-5 41643 0 NA
6-44274272-G-A c.1150-3C>T splice_region AARS2 1 83266 1.20097E-5 41633 0 7.95273E-6
6-44274273-G-C c.1150-4C>G splice_region AARS2 13 83260 1.56137E-4 41630 0 5.10139E-4
6-44274275-G-A c.1150-6C>T splice_region AARS2 3 83264 3.603E-5 41632 0 3.97636E-6
6-44274652-G-A c.1149+8C>T splice_region AARS2 2 83150 2.40529E-5 41575 0 8.35143E-5
6-44274662-G-A p.Leu383Leu splice_region+synonymous AARS2 1 83254 1.20114E-5 41627 0 NA
6-44274664-G-A p.Thr382Ile missense AARS2 1 83250 1.2012E-5 41625 0 NA
6-44274666-C-T p.Glu381Glu synonymous AARS2 1 83260 1.20106E-5 41630 0 NA
6-44274667-TCCA-T p.Val380del disruptive_inframe_deletion AARS2 1 83258 1.20109E-5 41629 0 3.97671E-6
6-44274669-CA-GG p.Val380Ala missense AARS2 1 83258 1.20109E-5 41629 0 NA
6-44274669-C-G p.Val380Val synonymous AARS2 1 83258 1.20109E-5 41629 0 NA
6-44274670-A-G p.Val380Ala missense AARS2 1 83252 1.20117E-5 41626 0 NA
6-44274674-C-T p.Val379Met missense AARS2 1 83270 1.20091E-5 41635 0 3.18837E-5
6-44274683-C-A p.Val376Leu missense AARS2 1 83298 1.20051E-5 41649 0 NA
6-44274684-C-A p.Leu375Leu synonymous AARS2 1 83306 1.20039E-5 41653 0 3.97655E-6
6-44274704-G-A p.Pro369Ser missense AARS2 2 83324 2.40027E-5 41662 0 3.97655E-6
6-44274709-G-A p.Ala367Val missense AARS2 1 83330 1.20005E-5 41665 0 NA
6-44274722-C-T p.Glu363Lys missense AARS2 2 83332 2.40004E-5 41666 0 3.1904E-5
6-44274725-T-A p.Met362Leu missense AARS2 67 83324 8.0409E-4 41662 0 0.00204355
6-44274727-G-A p.Ser361Phe missense AARS2 2 83324 2.40027E-5 41662 0 NA
6-44274732-A-G p.Arg359Arg synonymous AARS2 1 83326 1.20011E-5 41663 0 NA
6-44274733-C-T p.Arg359His missense AARS2 8 83314 9.60223E-5 41657 0 9.56816E-5
6-44274734-G-A p.Arg359Cys missense AARS2 6 83312 7.20184E-5 41656 0 3.18898E-5
6-44274742-C-T p.Arg356Gln missense AARS2 6 83290 7.20375E-5 41645 0 9.57304E-5
6-44274745-C-T p.Arg355His missense AARS2 1 83280 1.20077E-5 41640 0 7.95494E-5
6-44274746-G-A p.Arg355Cys missense AARS2 2 83282 2.40148E-5 41641 0 1.64951E-5
6-44274754-C-T p.Arg352Gln missense AARS2 13 83272 1.56115E-4 41636 0 0.00100705
6-44274755-G-A p.Arg352Trp missense AARS2 3 83260 3.60317E-5 41630 0 3.58027E-5
6-44274757-CG-C p.Arg351fs frameshift AARS2 1 83244 1.20129E-5 41622 0 NA
6-44274758-G-A p.Arg351Cys missense AARS2 2 83240 2.40269E-5 41620 0 3.18253E-5
6-44274762-A-C p.Val349Val synonymous AARS2 2 83230 2.40298E-5 41615 0 1.65123E-5
6-44274771-A-C c.1041-3T>G splice_region AARS2 1 83170 1.20236E-5 41585 0 NA
6-44274775-G-C c.1041-7C>G splice_region AARS2 1 83148 1.20267E-5 41574 0 NA
6-44274776-G-A c.1041-8C>T splice_region AARS2 1 83122 1.20305E-5 41561 0 3.3065E-5
6-44274978-A-G c.1040+8T>C splice_region AARS2 1 82980 1.20511E-5 41490 0 3.19428E-5
6-44274989-G-A p.Pro346Leu missense AARS2 2 83036 2.40859E-5 41518 0 7.97022E-6
6-44274990-G-A p.Pro346Ser missense AARS2 2 83042 2.40842E-5 41521 0 NA
6-44274993-C-T p.Gly345Ser missense AARS2 2 83050 2.40819E-5 41525 0 8.32182E-6
6-44275011-T-C p.Ile339Val missense AARS2 76487 82582 0.926195 41291 35671 0.951902
6-44275017-C-CA p.Asp337fs frameshift AARS2 2 83056 2.40801E-5 41528 0 1.19557E-5
6-44275033-G-A p.Leu331Leu synonymous AARS2 2 83018 2.40912E-5 41509 0 NA
6-44275037-G-A p.Thr330Ile missense AARS2 1 83008 1.2047E-5 41504 0 8.73866E-6
6-44275041-G-A p.Arg329Cys missense AARS2 4 82988 4.81997E-5 41494 0 1.99585E-5
6-44275057-C-T p.Val323Val synonymous AARS2 1 82918 1.20601E-5 41459 0 2.82417E-5
6-44275059-C-T p.Val323Met missense AARS2 7 82902 8.4437E-5 41451 0 0.00125
6-44275066-C-T p.Ala320Ala synonymous AARS2 14 82836 1.69009E-4 41418 0 1.88972E-4
6-44275077-T-C p.Thr317Ala missense AARS2 2 82758 2.41668E-5 41379 0 NA
6-44275079-C-T p.Arg316His missense AARS2 23 82724 2.78033E-4 41362 0 7.3476E-5
6-44275080-G-A p.Arg316Cys missense AARS2 1 82704 1.20913E-5 41352 0 3.1904E-5
6-44275082-CCCT-C p.Glu314del disruptive_inframe_deletion AARS2 3 82708 3.62722E-5 41354 0 3.19163E-5
6-44275086-C-T p.Glu314Lys missense AARS2 2 82636 2.42025E-5 41318 0 1.20659E-4
6-44275093-C-T p.Val311Val synonymous AARS2 1 82592 1.21077E-5 41296 0 NA
6-44275099-T-G p.Val309Val synonymous AARS2 1 82550 1.21139E-5 41275 0 NA
6-44275103-C-T p.Arg308Gln missense AARS2 1 82496 1.21218E-5 41248 0 3.1902E-5
6-44275103-CG-AA p.Arg308Leu missense AARS2 1 82496 1.21218E-5 41248 0 NA
6-44275108-C-G p.Leu306Phe missense AARS2 1 82464 1.21265E-5 41232 0 NA
6-44275110-A-G p.Leu306Leu synonymous AARS2 1 82426 1.21321E-5 41213 0 NA
6-44275123-C-A p.Arg301Ser missense AARS2 4 82292 4.86074E-5 41146 0 8.68908E-6
6-44275139-G-A c.895-8C>T splice_region AARS2 3 81970 3.65988E-5 40985 0 1.37292E-5
6-44278043-A-G p.Ile296Thr missense AARS2 2 82634 2.42031E-5 41317 0 2.04733E-5
6-44278044-T-C p.Ile296Val missense AARS2 1 82648 1.20995E-5 41324 0 4.40567E-6
6-44278047-C-A p.Ala295Ser missense AARS2 1 82652 1.20989E-5 41326 0 3.4977E-5
6-44278048-G-A p.Asn294Asn synonymous AARS2 25 82678 3.02378E-4 41339 0 0.00325149
6-44278049-T-C p.Asn294Ser missense AARS2 2 82684 2.41885E-5 41342 0 5.1565E-5
6-44278054-C-A p.Leu292Leu synonymous AARS2 1 82684 1.20942E-5 41342 0 NA
6-44278057-C-A p.Pro291Pro synonymous AARS2 1 82724 1.20884E-5 41362 0 3.3661E-5
6-44278057-C-T p.Pro291Pro synonymous AARS2 1 82724 1.20884E-5 41362 0 4.8605E-5
6-44278058-G-A p.Pro291Leu missense AARS2 3 82742 3.62573E-5 41371 0 6.27845E-5
6-44278069-G-T p.Asp287Glu missense AARS2 446 82802 0.00538634 41401 6 0.01
6-44278073-G-C p.Thr286Ser missense AARS2 1 82818 1.20747E-5 41409 0 NA
6-44278106-G-A p.Ala275Val missense AARS2 19 82918 2.29142E-4 41459 0 5.04541E-4
6-44278141-A-G p.His263His synonymous AARS2 1 82986 1.20502E-5 41493 0 8.3552E-6
6-44278145-C-T p.Arg262Gln missense AARS2 18 82932 2.17045E-4 41466 0 3.1841E-4
6-44278169-C-G p.Gly254Ala missense AARS2 13 82418 1.57733E-4 41209 0 1.91548E-4
6-44278176-CCT-C p.Glu251fs frameshift AARS2 1 82126 1.21764E-5 41063 0 3.99377E-6
6-44278185-C-T c.750-5G>A splice_region AARS2 256 81574 0.00313825 40787 2 0.00671803
6-44278724-C-G c.749+7G>C splice_region AARS2 1 82220 1.21625E-5 41110 0 NA
6-44278734-T-G p.Asn249Thr missense AARS2 1 82436 1.21306E-5 41218 0 NA
6-44278749-A-G p.Val244Ala missense AARS2 2 82606 2.42113E-5 41303 0 NA
6-44278768-C-A p.Val238Leu missense AARS2 1 82680 1.20948E-5 41340 0 1.19713E-5
6-44278773-T-G p.Gln236Pro missense AARS2 1 82714 1.20899E-5 41357 0 3.98979E-6
6-44278773-T-TG p.Gln236fs frameshift AARS2 1 82710 1.20904E-5 41355 0 NA
6-44278801-C-T p.Asp227Asn missense AARS2 2 82834 2.41447E-5 41417 0 6.25E-4
6-44278802-G-A p.Tyr226Tyr synonymous AARS2 20 82834 2.41447E-4 41417 0 6.25E-4
6-44278807-G-A p.His225Tyr missense AARS2 10 82868 1.20674E-4 41434 0 3.18733E-5
6-44278810-T-G p.Ile224Leu missense AARS2 5 82890 6.03209E-5 41445 0 6.25E-4
6-44278820-G-T p.Pro220Pro synonymous AARS2 1 82938 1.20572E-5 41469 0 NA
6-44278821-G-T p.Pro220His missense AARS2 1 82918 1.20601E-5 41459 0 NA
6-44278829-A-G p.Pro217Pro synonymous AARS2 1 82984 1.20505E-5 41492 0 1.6613E-5
6-44278832-G-GC p.Cys218fs frameshift AARS2 2 82992 2.40987E-5 41496 0 8.30537E-5
6-44278840-C-A p.Asp214Tyr missense AARS2 3 83018 3.61367E-5 41509 0 NA
6-44278846-T-A p.Met212Leu missense AARS2 1 83052 1.20406E-5 41526 0 3.18796E-5
6-44278862-T-C p.Gln206Gln synonymous AARS2 1 83098 1.2034E-5 41549 0 7.96058E-6
6-44278876-A-G p.Ser202Pro missense AARS2 1 83080 1.20366E-5 41540 0 3.98061E-6
6-44278884-C-T p.Arg199His missense AARS2 1 83024 1.20447E-5 41512 0 3.31851E-5
6-44278885-G-A p.Arg199Cys missense AARS2 11 83018 1.32501E-4 41509 0 1.2738E-4
6-44278893-G-A p.Pro196Leu missense AARS2 1 82986 1.20502E-5 41493 0 3.98168E-6
6-44278896-A-ACCCCTAAGCTCAGCCAGATGT p.Asp188_Gly194dup conservative_inframe_insertion AARS2 2 82928 2.41173E-5 41464 1 NA
6-44278902-G-C c.582-4C>G splice_region AARS2 1 82838 1.20718E-5 41419 0 NA
6-44279132-G-A p.Ser192Ser synonymous AARS2 1 83278 1.2008E-5 41639 0 NA
6-44279136-A-C p.Leu191Arg missense AARS2 1 83292 1.2006E-5 41646 0 3.18552E-5
6-44279139-C-T p.Trp190* stop_gained AARS2 2 83288 2.40131E-5 41644 0 NA
6-44279175-G-A p.Ala178Val missense AARS2 13 83330 1.56006E-4 41665 0 1.43178E-4
6-44279199-G-A p.Ser170Phe missense AARS2 2 83334 2.39998E-5 41667 0 NA
6-44279201-G-T p.Ile169Ile synonymous AARS2 1 83328 1.20008E-5 41664 0 3.97668E-6
6-44279212-T-A p.Arg166Trp missense AARS2 1 83308 1.20036E-5 41654 0 NA
6-44279221-G-A p.Pro163Ser missense AARS2 1 83296 1.20054E-5 41648 0 1.64821E-5
6-44279222-G-T p.Ile162Ile synonymous AARS2 2 83292 2.40119E-5 41646 0 3.18837E-5
6-44279238-G-A p.Thr157Ile missense AARS2 2 83276 2.40165E-5 41638 0 8.24321E-6
6-44279242-G-C p.Leu156Val missense AARS2 3 83272 3.60265E-5 41636 0 6.25E-4
6-44279262-C-T p.Cys149Tyr missense AARS2 2 83174 2.4046E-5 41587 0 NA
6-44279274-T-TTAAAATATTCACCCCCAAAGGCCCAATTGCCAAGCATTTCAAA c.436-3_436-2insTTTGAAATGCTTGGCAATTGGGCCTTTGGGGGTGAATATTTTA splice_region AARS2 4 83042 4.81684E-5 41521 0 NA
6-44279275-G-A c.436-3C>T splice_region AARS2 3 83052 3.61219E-5 41526 0 1.65369E-5
6-44279276-C-A c.436-4G>T splice_region AARS2 3 83034 3.61298E-5 41517 0 1.59332E-5
6-44279279-C-A c.436-7G>T splice_region AARS2 3 82996 3.61463E-5 41498 0 8.2861E-6
6-44279822-C-T p.Gly141Asp missense AARS2 6 83320 7.20115E-5 41660 0 1.27372E-4
6-44279824-C-T p.Gly140Gly synonymous AARS2 587 83312 0.0070458 41656 10 0.0149335
6-44279830-G-A p.Ala138Ala synonymous AARS2 1 83348 1.19979E-5 41674 0 NA
6-44279837-T-C p.Asn136Ser missense AARS2 6 83346 7.19891E-5 41673 0 6.36943E-5
6-44279851-AAAG-A p.Phe131del disruptive_inframe_deletion AARS2 2 83358 2.39929E-5 41679 0 3.97627E-6
6-44279859-T-G p.Thr129Pro missense AARS2 4 83374 4.79766E-5 41687 0 8.23845E-6
6-44279860-A-G p.His128His synonymous AARS2 6 83372 7.19666E-5 41686 0 9.55231E-5
6-44279876-C-A p.Arg123Leu missense AARS2 3 83388 3.59764E-5 41694 0 4.94315E-5
6-44279876-C-G p.Arg123Pro missense AARS2 1 83388 1.19921E-5 41694 0 NA
6-44279877-G-A p.Arg123* stop_gained AARS2 2 83388 2.39843E-5 41694 0 7.9526E-6
6-44279892-G-C p.Leu118Val missense AARS2 7 83390 8.39429E-5 41695 0 6.3678E-5
6-44279896-G-A p.Asn116Asn synonymous AARS2 2 83386 2.39848E-5 41693 0 6.36902E-5
6-44279900-T-A p.His115Leu missense AARS2 1 83388 1.19921E-5 41694 0 3.97633E-6
6-44279904-G-A p.His114Tyr missense AARS2 1 83394 1.19913E-5 41697 0 3.1839E-5
6-44279908-T-C p.Gly112Gly synonymous AARS2 1 83396 1.1991E-5 41698 0 NA
6-44279921-C-T p.Cys108Tyr missense AARS2 2 83384 2.39854E-5 41692 0 3.9764E-6
6-44279928-G-A p.Gln106* stop_gained AARS2 2 83382 2.3986E-5 41691 0 NA
6-44279930-C-T p.Ser105Asn missense AARS2 1 83380 1.19933E-5 41690 0 NA
6-44279942-C-T p.Arg101His missense AARS2 2 83368 2.399E-5 41684 0 3.18431E-5
6-44279945-C-T p.Arg100Gln missense AARS2 1 83370 1.19947E-5 41685 0 1.19314E-5
6-44279965-T-G p.Arg93Arg synonymous AARS2 1 83354 1.1997E-5 41677 0 NA
6-44279973-C-T p.Asp91Asn missense AARS2 1 83324 1.20013E-5 41662 0 NA
6-44279976-C-T p.Val90Met missense AARS2 3 83316 3.60075E-5 41658 0 7.95602E-6
6-44279977-G-A p.Thr89Thr synonymous AARS2 2 83312 2.40061E-5 41656 0 3.18512E-5
6-44280003-G-A c.244-3C>T splice_region AARS2 1 83142 1.20276E-5 41571 0 6.3678E-5
6-44280004-G-GTTCATGCCCGCATTGACAAA c.244-5_244-4insTTTGTCAATGCGGGCATGAA splice_region AARS2 1 83136 1.20285E-5 41568 0 NA
6-44280007-G-A c.244-7C>T splice_region AARS2 1 83092 1.20349E-5 41546 0 4.18298E-5
6-44280812-C-T c.243+6G>A splice_region AARS2 41350 78326 0.527922 39163 11072 0.565
6-44280827-G-T p.Gly78Gly synonymous AARS2 1 80160 1.2475E-5 40080 0 6.51434E-5
6-44280834-T-C p.Asn76Ser missense AARS2 2 80138 2.49569E-5 40069 0 3.18573E-5
6-44280840-A-T p.Phe74Tyr missense AARS2 10 80178 1.24722E-4 40089 0 6.25E-4
6-44280850-T-C p.Ser71Gly missense AARS2 4 79936 5.004E-5 39968 0 4.13233E-6
6-44280865-G-A p.Pro66Ser missense AARS2 1 79816 1.25288E-5 39908 0 4.1578E-6
6-44280868-G-A p.Arg65Trp missense AARS2 2 79732 2.5084E-5 39866 0 3.18471E-5
6-44280868-G-C p.Arg65Gly missense AARS2 1 79732 1.2542E-5 39866 0 NA
6-44280880-A-C p.Ser61Ala missense AARS2 1 79956 1.25069E-5 39978 0 3.18492E-5
6-44280885-A-C p.Val59Gly missense AARS2 2 79736 2.50828E-5 39868 0 0.114837
6-44280899-A-G p.His54His synonymous AARS2 5 81826 6.11053E-5 40913 0 6.36943E-5
6-44280901-G-A p.His54Tyr missense AARS2 1 81818 1.22222E-5 40909 0 NA
6-44280914-G-A p.Phe49Phe synonymous AARS2 6 81852 7.3303E-5 40926 0 9.55414E-5
6-44280929-G-A p.Ala44Ala synonymous AARS2 3 81444 3.68351E-5 40722 0 8.48875E-6
6-44280933-C-T p.Arg43Lys missense AARS2 1 81328 1.22959E-5 40664 0 NA
6-44280942-G-T p.Ser40* stop_gained AARS2 1 80868 1.23658E-5 40434 0 NA
6-44280942-G-C p.Ser40Trp missense AARS2 1 80868 1.23658E-5 40434 0 1.28929E-4
6-44280944-G-A p.Ala39Ala synonymous AARS2 1 80788 1.23781E-5 40394 0 4.38358E-6
6-44280945-G-GC p.Ala39fs frameshift AARS2 2 80668 2.4793E-5 40334 0 3.18471E-5
6-44280952-C-T p.Ala37Thr missense AARS2 2 80110 2.49657E-5 40055 0 NA
6-44280956-A-AG p.Ala36fs frameshift AARS2 1 79686 1.25493E-5 39843 0 NA
6-44280958-G-C p.Pro35Ala missense AARS2 4 79544 5.02866E-5 39772 0 5.15172E-5
6-44280965-C-A p.Ser32Ser synonymous AARS2 2 78426 2.55017E-5 39213 0 NA
6-44280968-T-A p.Ser31Ser synonymous AARS2 1 77966 1.28261E-5 38983 0 NA
6-44280971-G-C p.Leu30Leu synonymous AARS2 1 77270 1.29416E-5 38635 0 1.00005E-5
6-44280976-G-A p.Pro29Ser missense AARS2 1 75688 1.32121E-5 37844 0 1.70783E-5
6-44280979-G-C p.Arg28Gly missense AARS2 8 74896 1.06815E-4 37448 0 9.02527E-5
6-44280984-C-T p.Ser26Asn missense AARS2 4 73508 5.44158E-5 36754 0 5.59059E-6
6-44280989-G-C p.Gly24Gly synonymous AARS2 1 71604 1.39657E-5 35802 0 0.113566
6-44280997-A-C p.Trp22Gly missense AARS2 2 76388 2.61821E-5 38194 0 NA
6-44281001-G-A p.Pro20Pro synonymous AARS2 3 76456 3.92383E-5 38228 0 1.11383E-4
6-44281005-G-A p.Ser19Leu missense AARS2 1 76294 1.31072E-5 38147 0 3.14663E-5
6-44281015-T-C p.Ile16Val missense AARS2 5 76164 6.56478E-5 38082 0 1.09587E-4
6-44281021-GCCGCAGCCT-G p.Arg11_Arg13del conservative_inframe_deletion AARS2 37 76088 4.86279E-4 38044 0 8.9189E-4
6-44281023-C-T p.Arg13Gln missense AARS2 2 76134 2.62695E-5 38067 0 3.18492E-5
6-44281027-G-A p.Leu12Leu synonymous AARS2 3 75958 3.94955E-5 37979 0 NA
6-44281032-C-T p.Arg10Gln missense AARS2 6 75828 7.91264E-5 37914 0 1.91131E-4
6-44281033-G-C p.Arg10Gly missense AARS2 2 76370 2.61883E-5 38185 0 3.18532E-5
6-44281036-C-A p.Ala9Ser missense AARS2 3 76176 3.93825E-5 38088 0 3.18451E-5
6-44281036-C-T p.Ala9Thr missense AARS2 11 76176 1.44402E-4 38088 0 2.15703E-4
6-44281051-A-T p.Ser4Thr missense AARS2 4 77126 5.18632E-5 38563 0 8.90767E-5
6-44281053-G-A p.Ala3Val missense AARS2 2 77116 2.5935E-5 38558 0 8.87052E-6