Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
16-70286631-T-A p.Lys967Met missense AARS 1114 82502 0.0135027 41251 7 0.0103204
16-70286633-T-C p.Val966Val synonymous AARS 1 82542 1.2115E-5 41271 0 3.97836E-6
16-70286634-A-G p.Val966Ala missense AARS 1 82556 1.2113E-5 41278 0 3.18573E-5
16-70286638-C-G p.Asp965His missense AARS 1 82638 1.2101E-5 41319 0 NA
16-70286642-G-C p.Leu963Leu synonymous AARS 1 82714 1.20899E-5 41357 0 NA
16-70286656-C-G p.Ala959Pro missense AARS 1 82852 1.20697E-5 41426 0 NA
16-70286661-G-C p.Ser957Cys missense AARS 1 82942 1.20566E-5 41471 0 3.97772E-6
16-70286672-C-A p.Gln953His missense AARS 1 82960 1.2054E-5 41480 0 NA
16-70286674-G-A p.Gln953* stop_gained AARS 2 82970 2.41051E-5 41485 0 NA
16-70286687-C-CTGGGTT p.Leu948_Gln949insThrGln disruptive_inframe_insertion AARS 1 83100 1.20337E-5 41550 0 NA
16-70286696-A-G p.Val945Val synonymous AARS 4 83158 4.81012E-5 41579 0 3.18492E-5
16-70286709-G-C p.Thr941Arg missense AARS 3 83192 3.60612E-5 41596 0 NA
16-70286712-G-A p.Ala940Val missense AARS 2 83192 2.40408E-5 41596 0 NA
16-70286713-C-T p.Ala940Thr missense AARS 1 83200 1.20192E-5 41600 0 NA
16-70286714-C-T p.Gln939Gln synonymous AARS 12 83212 1.4421E-4 41606 0 2.5481E-4
16-70286721-G-A p.Ser937Phe missense AARS 2 83230 2.40298E-5 41615 0 3.18431E-5
16-70286725-C-T p.Val936Met missense AARS 1 83228 1.20152E-5 41614 0 NA
16-70286740-C-T p.Gly931Ser missense AARS 1054 83224 0.0126646 41612 6 0.024375
16-70286777-C-T p.Glu918Glu synonymous AARS 1 83016 1.20459E-5 41508 0 1.59253E-5
16-70286779-C-T p.Glu918Lys missense AARS 1 83018 1.20456E-5 41509 0 3.18532E-5
16-70286780-G-A p.Ser917Ser synonymous AARS 1 82978 1.20514E-5 41489 0 2.47162E-5
16-70286789-TA-T p.Leu914fs frameshift AARS 1 82910 1.20613E-5 41455 0 9.8868E-5
16-70286790-A-AAGCCCCGATTGGCTGCATTCTAGAAGACAGGAAGGGAAGGGGGAGTC p.Leu914fs frameshift AARS 1 82894 1.20636E-5 41447 0 6.37186E-5
16-70286792-G-T p.Gly913Gly synonymous AARS 1 82852 1.20697E-5 41426 0 NA
16-70286793-C-T p.Gly913Asp missense AARS 6 82828 7.24393E-5 41414 0 2.4719E-5
16-70286796-C-T p.Arg912Gln missense AARS 1 82768 1.2082E-5 41384 0 1.19626E-5
16-70286799-T-C p.Asn911Ser missense AARS 7 82762 8.45799E-5 41381 0 1.03673E-4
16-70286801-G-A p.Ala910Ala synonymous AARS 1 82714 1.20899E-5 41357 0 9.96866E-5
16-70286811-T-TGGGGGACTTGACACAGGCACGTGATCTTGCCAGCCTCATTGTCCACCGTG c.2722-3_2722-2insCACGGTGGACAATGAGGCTGGCAAGATCACGTGCCTGTGTCAAGTCCCCC splice_region AARS 2 82468 2.42518E-5 41234 1 NA
16-70286813-G-T c.2722-4C>A splice_region AARS 2 82360 2.42836E-5 41180 0 NA
16-70287163-G-A c.2721+8C>T splice_region AARS 1 82926 1.20589E-5 41463 0 2.1558E-4
16-70287177-A-G p.Val905Val synonymous AARS 67500 82168 0.821488 41084 27836 0.862045
16-70287191-A-T p.Cys901Ser missense AARS 1 83076 1.20372E-5 41538 0 3.97845E-6
16-70287192-C-T p.Thr900Thr synonymous AARS 13 83068 1.56498E-4 41534 0 2.14845E-4
16-70287193-G-A p.Thr900Met missense AARS 1 83070 1.2038E-5 41535 0 3.97864E-6
16-70287206-C-T p.Ala896Thr missense AARS 6 83092 7.22091E-5 41546 0 6.25E-4
16-70287211-T-C p.Asn894Ser missense AARS 2 83096 2.40685E-5 41548 0 6.37471E-5
16-70287219-C-T p.Thr891Thr synonymous AARS 2 83056 2.40801E-5 41528 0 0.00100806
16-70287264-C-G p.Lys876Asn missense AARS 2 81716 2.4475E-5 40858 0 3.18776E-5
16-70287271-G-A p.Ala874Val missense AARS 1 81118 1.23277E-5 40559 0 3.98899E-6
16-70287290-G-T c.2608-6C>A splice_region AARS 18 78844 2.28299E-4 39422 0 7.33465E-4
16-70287290-G-A c.2608-6C>T splice_region AARS 2 78844 2.53665E-5 39422 0 NA
16-70287611-G-A c.2607+6C>T splice_region AARS 1 83030 1.20438E-5 41515 0 NA
16-70287628-C-T p.Ala866Thr missense AARS 1 83212 1.20175E-5 41606 0 3.18654E-5
16-70287629-G-A p.Gly865Gly synonymous AARS 1 83216 1.20169E-5 41608 0 3.98004E-6
16-70287631-C-T p.Gly865Ser missense AARS 6 83232 7.20877E-5 41616 0 3.58146E-5
16-70287632-G-A p.Ser864Ser synonymous AARS 17 83226 2.04263E-4 41613 0 1.91017E-4
16-70287644-C-T p.Leu860Leu synonymous AARS 116 83284 0.00139282 41642 1 0.00250627
16-70287647-G-A p.Ile859Ile synonymous AARS 1 83278 1.2008E-5 41639 0 NA
16-70287659-C-T p.Gln855Gln synonymous AARS 1 83308 1.20036E-5 41654 0 7.95558E-6
16-70287672-C-T p.Ser851Asn missense AARS 1 83318 1.20022E-5 41659 0 1.1932E-5
16-70287676-C-T p.Asp850Asn missense AARS 1 83332 1.20002E-5 41666 0 3.57958E-5
16-70287677-G-A p.Ile849Ile synonymous AARS 2 83324 2.40027E-5 41662 0 5.03525E-4
16-70287692-C-T p.Lys844Lys synonymous AARS 6 83356 7.19804E-5 41678 0 2.38618E-5
16-70287700-ACACCTGCAAGAAAAAAGTCCAGAACAGCAGCTCAGACCAAAAGCCCAGGCCCCGAACCCCTGGCTGTTCTGCCAGCCTTTGCCTAGGAAACACTCTGGCCACTGGTGCTGCCAGGACT-A p.Val841_Leu842del splice_acceptor AARS 9 83328 1.08007E-4 41664 3 NA
16-70287703-C-G p.Val841Leu missense+splice_region AARS 1 83332 1.20002E-5 41666 0 NA
16-70287706-G-A c.2521-3C>T splice_region AARS 285 83328 0.00342022 41664 1 0.0025
16-70287708-A-C c.2521-5T>G splice_region AARS 2 83326 2.40021E-5 41663 0 NA
16-70287823-C-T p.Arg840Gln missense+splice_region AARS 1 83282 1.20074E-5 41641 0 8.23696E-6
16-70287824-G-A p.Arg840* stop_gained AARS 1 83270 1.20091E-5 41635 0 NA
16-70287850-C-T p.Arg831Gln missense AARS 1 83154 1.20259E-5 41577 0 8.2371E-6
16-70287857-A-G p.Leu829Leu synonymous AARS 3 83182 3.60655E-5 41591 0 1.07082E-4
16-70287863-C-T p.Asp827Asn missense AARS 1 83134 1.20288E-5 41567 0 NA
16-70287864-C-T p.Met826Ile missense AARS 2 83142 2.40552E-5 41571 0 3.97722E-6
16-70287871-T-C p.Lys824Arg missense AARS 1 83150 1.20265E-5 41575 0 NA
16-70287876-T-C p.Leu822Leu synonymous AARS 1 83150 1.20265E-5 41575 0 NA
16-70287883-T-C p.Lys820Arg missense AARS 187 83168 0.00224846 41584 0 0.00503525
16-70287896-G-A p.Arg816Trp missense AARS 1 83206 1.20184E-5 41603 0 8.23859E-6
16-70287902-C-T p.Glu814Lys missense AARS 1 83252 1.20117E-5 41626 0 3.18654E-5
16-70287918-G-A p.Pro808Pro synonymous AARS 2 83280 2.40154E-5 41640 0 2.47235E-5
16-70287921-G-T p.Ile807Ile synonymous AARS 1 83280 1.20077E-5 41640 0 8.24131E-6
16-70287939-G-C p.Ala801Ala splice_region+synonymous AARS 1 83268 1.20094E-5 41634 0 3.18613E-5
16-70287947-A-G c.2401-6T>C splice_region AARS 1 83244 1.20129E-5 41622 0 NA
16-70288387-C-G c.745-1G>C splice_acceptor AARS 1 39112 2.55676E-5 19556 0 NA
16-70288516-G-A c.2400+8C>T splice_region AARS 1 81984 1.21975E-5 40992 0 1.6567E-5
16-70288519-C-T c.2400+5G>A splice_region AARS 1 82256 1.21572E-5 41128 0 8.27486E-6
16-70288532-G-A p.Leu798Phe missense AARS 1 82708 1.20907E-5 41354 0 NA
16-70288538-C-T p.Ala796Thr missense AARS 3 82774 3.62433E-5 41387 0 3.18593E-5
16-70288539-G-C p.Ile795Met missense AARS 1 82812 1.20755E-5 41406 0 3.97716E-6
16-70288555-T-A p.Asp790Val missense AARS 1 82996 1.20488E-5 41498 0 7.83389E-4
16-70288563-T-G p.Pro787Pro synonymous AARS 7 83004 8.43333E-5 41502 0 5.03525E-4
16-70288596-G-A p.Val776Val synonymous AARS 2 83010 2.40935E-5 41505 0 8.25559E-6
16-70288600-G-A p.Ser775Phe missense AARS 3 83000 3.61446E-5 41500 0 8.25777E-6
16-70288611-C-A p.Lys771Asn missense AARS 2 82932 2.41161E-5 41466 0 3.97757E-6
16-70288618-C-G p.Ser769Thr missense AARS 2 82826 2.4147E-5 41413 0 2.78503E-5
16-70288619-T-C p.Ser769Gly missense AARS 1 82796 1.20779E-5 41398 0 NA
16-70288622-C-T p.Glu768Lys missense AARS 1 82776 1.20808E-5 41388 0 8.38701E-6
16-70288629-C-T p.Arg765Arg synonymous AARS 1 82544 1.21148E-5 41272 0 NA
16-70288636-G-A p.Ala763Val missense+splice_region AARS 1 82176 1.2169E-5 41088 0 1.59444E-5
16-70288643-A-AG c.2287-7_2287-6insC splice_region AARS 2 81736 2.4469E-5 40868 0 NA
16-70289625-G-A c.2286+6C>T splice_region AARS 2 82996 2.40975E-5 41498 0 NA
16-70289632-T-C p.Lys762Arg missense+splice_region AARS 3 83050 3.61228E-5 41525 0 7.95779E-6
16-70289633-T-G p.Lys762Gln missense+splice_region AARS 1 83042 1.20421E-5 41521 0 NA
16-70289642-C-T p.Glu759Lys missense AARS 8 83100 9.62696E-5 41550 0 1.27348E-4
16-70289654-C-G p.Val755Leu missense AARS 1 83180 1.20221E-5 41590 0 7.95577E-6
16-70289662-A-G p.Ile752Thr missense AARS 1 83220 1.20163E-5 41610 0 8.2776E-6
16-70289666-T-C p.Arg751Gly missense AARS 5 83222 6.00803E-5 41611 0 4.96746E-5
16-70289674-CC-TT p.Gly748Asn missense AARS 2 83232 2.40292E-5 41616 0 NA
16-70289680-G-A p.Ala746Val missense AARS 1 83208 1.20181E-5 41604 0 NA
16-70289694-C-T p.Thr741Thr synonymous AARS 1 83188 1.2021E-5 41594 0 6.3674E-5
16-70289695-G-A p.Thr741Met missense AARS 21 83170 2.52495E-4 41585 0 0.001875
16-70289700-G-A p.Ile739Ile synonymous AARS 21 83148 2.52562E-4 41574 0 2.3482E-4
16-70289702-T-C p.Ile739Val missense AARS 1 83146 1.2027E-5 41573 0 NA
16-70289719-T-A p.His733Leu missense AARS 1 83076 1.20372E-5 41538 0 NA
16-70289724-C-G p.Ser731Ser synonymous AARS 1 83014 1.20462E-5 41507 0 3.18451E-5
16-70289725-G-A p.Ser731Leu missense AARS 3 82996 3.61463E-5 41498 0 1.27364E-4
16-70289726-A-G p.Ser731Pro missense AARS 1 82996 1.20488E-5 41498 0 3.99288E-6
16-70289730-C-T p.Arg729Arg synonymous AARS 1 82946 1.2056E-5 41473 0 9.70836E-6
16-70289731-C-T p.Arg729Gln missense AARS 2 82932 2.41161E-5 41466 0 8.75606E-5
16-70289732-G-A p.Arg729Trp missense AARS 57 82920 6.8741E-4 41460 0 6.46519E-4
16-70289735-G-A p.Leu728Leu synonymous AARS 2 82904 2.41243E-5 41452 0 0.00151057
16-70289746-G-A c.2178-7C>T splice_region AARS 2 82748 2.41698E-5 41374 0 NA
16-70291935-C-T c.2177+1G>A splice_donor AARS 1 82900 1.20627E-5 41450 0 1.19483E-5
16-70291947-G-T p.Phe722Leu missense AARS 48 83022 5.7816E-4 41511 0 0.00114642
16-70291947-G-A p.Phe722Phe synonymous AARS 1 83022 1.2045E-5 41511 0 NA
16-70291957-G-C p.Ser719Cys missense AARS 1 83046 1.20415E-5 41523 0 8.31988E-6
16-70291964-G-C p.Leu717Val missense AARS 1 83094 1.20346E-5 41547 0 NA
16-70291984-G-A p.Pro710Leu missense AARS 2 83106 2.40657E-5 41553 0 3.18613E-5
16-70291995-C-A p.Leu706Phe missense AARS 1 83120 1.20308E-5 41560 0 NA
16-70292004-C-G p.Val703Val synonymous AARS 2 83102 2.40668E-5 41551 0 3.18512E-5
16-70292007-C-T p.Pro702Pro synonymous AARS 1 83072 1.20378E-5 41536 0 2.64616E-5
16-70292020-G-C p.Ser698Cys missense AARS 2 83028 2.40883E-5 41514 0 NA
16-70292029-C-T p.Arg695Gln missense AARS 1 82988 1.20499E-5 41494 0 4.9686E-5
16-70292034-A-G p.Pro693Pro synonymous AARS 1 82974 1.2052E-5 41487 0 2.03405E-5
16-70292035-G-A p.Pro693Leu missense AARS 1 82978 1.20514E-5 41489 0 NA
16-70292041-G-C p.Pro691Arg missense AARS 1 82920 1.20598E-5 41460 0 NA
16-70292051-C-A p.Glu688* stop_gained AARS 1 82892 1.20639E-5 41446 0 NA
16-70292060-C-T p.Val685Met missense AARS 1 82832 1.20726E-5 41416 0 4.93488E-4
16-70292065-C-T p.Arg683Gln missense AARS 4 82800 4.83092E-5 41400 0 2.07281E-5
16-70292066-G-A p.Arg683Trp missense AARS 1 82788 1.2079E-5 41394 0 4.16615E-6
16-70292086-G-A p.Ala676Val missense AARS 1 82534 1.21162E-5 41267 0 4.5346E-5
16-70292088-T-C p.Ala675Ala synonymous AARS 3 82508 3.63601E-5 41254 0 4.56066E-5
16-70292103-A-G p.Asp670Asp synonymous AARS 1 82224 1.21619E-5 41112 0 1.76566E-5
16-70292106-C-G p.Gln669His missense AARS 2 82138 2.43493E-5 41069 0 NA
16-70292109-G-A p.Thr668Thr synonymous AARS 1 82002 1.21948E-5 41001 0 NA
16-70292110-G-A p.Thr668Ile missense AARS 6 81968 7.31993E-5 40984 0 1.90752E-5
16-70292116-A-G p.Val666Ala missense AARS 1 81678 1.22432E-5 40839 0 3.18613E-5
16-70292117-C-T p.Val666Ile missense AARS 6 81598 7.35312E-5 40799 0 1.23188E-4
16-70292118-G-A p.Ala665Ala splice_region+synonymous AARS 2 81448 2.45555E-5 40724 0 1.45276E-4
16-70292124-C-T c.1993-4G>A splice_region AARS 1 81078 1.23338E-5 40539 0 1.78444E-4
16-70292906-T-C p.Asn657Asp missense AARS 2 83254 2.40229E-5 41627 0 4.11821E-5
16-70292911-A-G p.Ile655Thr missense AARS 1 83280 1.20077E-5 41640 0 NA
16-70292919-A-C p.Ala652Ala synonymous AARS 1 83302 1.20045E-5 41651 0 3.97627E-6
16-70292922-C-T p.Lys651Lys synonymous AARS 3 83300 3.60144E-5 41650 0 6.36862E-5
16-70292922-C-G p.Lys651Asn missense AARS 1 83300 1.20048E-5 41650 0 NA
16-70292926-T-C p.Lys650Arg missense AARS 2 83314 2.40056E-5 41657 0 1.19288E-5
16-70292927-T-G p.Lys650Gln missense AARS 2 83308 2.40073E-5 41654 0 NA
16-70292931-C-G p.Gln648His missense AARS 1 83320 1.20019E-5 41660 0 NA
16-70292932-T-C p.Gln648Arg missense AARS 3 83330 3.60014E-5 41665 0 2.78337E-5
16-70292935-T-G p.Gln647Pro missense AARS 2 83350 2.39952E-5 41675 0 NA
16-70292937-G-C p.Thr646Thr synonymous AARS 2 83338 2.39987E-5 41669 0 1.91119E-4
16-70292939-T-C p.Thr646Ala missense AARS 2 83336 2.39992E-5 41668 0 6.25E-4
16-70292950-C-T p.Gly642Glu missense AARS 1 83346 1.19982E-5 41673 0 NA
16-70292954-T-C p.Lys641Glu missense AARS 2 83346 2.39964E-5 41673 0 NA
16-70292960-T-A p.Thr639Ser missense AARS 1 83358 1.19964E-5 41679 0 1.19289E-5
16-70292968-A-C p.Phe636Cys missense AARS 1 83362 1.19959E-5 41681 0 3.18552E-5
16-70292975-G-A p.Leu634Phe missense AARS 1 83352 1.19973E-5 41676 0 3.97621E-6
16-70292978-G-A p.Arg633Cys missense AARS 3 83344 3.59954E-5 41672 0 8.23642E-5
16-70292986-G-A p.Ala630Val missense AARS 1 83346 1.19982E-5 41673 0 NA
16-70292993-A-G p.Leu628Leu synonymous AARS 2 83362 2.39917E-5 41681 0 8.23642E-6
16-70292994-T-C p.Ser627Ser synonymous AARS 1 83356 1.19967E-5 41678 0 6.37267E-5
16-70293028-C-T p.Arg616His missense AARS 2 83350 2.39952E-5 41675 0 3.18552E-5
16-70293029-G-A p.Arg616Cys missense AARS 1 83338 1.19993E-5 41669 0 4.11821E-5
16-70293030-C-T p.Leu615Leu synonymous AARS 1 83340 1.1999E-5 41670 0 NA
16-70293032-G-A p.Leu615Leu synonymous AARS 4 83346 4.79927E-5 41673 0 8.23642E-6
16-70293035-C-T p.Ala614Thr missense AARS 3 83336 3.59988E-5 41668 0 3.97643E-6
16-70293036-G-A p.Phe613Phe synonymous AARS 5 83324 6.00067E-5 41662 1 0.00151057
16-70293051-C-T p.Thr608Thr synonymous AARS 2 83284 2.40142E-5 41642 0 1.64728E-5
16-70293064-T-C p.Asn604Ser missense AARS 12 83246 1.44151E-4 41623 0 2.14154E-4
16-70293072-G-C p.Ile601Met missense AARS 2 83212 2.4035E-5 41606 0 3.97703E-6
16-70293076-G-T p.Pro600His missense AARS 1 83200 1.20192E-5 41600 0 NA
16-70293083-G-A p.Arg598* stop_gained AARS 1 83100 1.20337E-5 41550 0 8.2371E-6
16-70293085-C-T p.Arg597Gln missense AARS 2 83060 2.4079E-5 41530 0 3.29489E-5
16-70293086-G-A p.Arg597* stop_gained AARS 1 83034 1.20433E-5 41517 0 1.19355E-5
16-70293091-T-TCATCAATAAACAGCCAGACCTGATCCCCCACTTTCAGGTCACCGTA c.1786-3_1786-2insTACGGTGACCTGAAAGTGGGGGATCAGGTCTGGCTGTTTATTGATG splice_region AARS 2 83032 2.40871E-5 41516 1 NA
16-70293091-T-TCATCAATAAACA c.1786-3_1786-2insTGTTTATTGATG splice_region AARS 1 83034 1.20433E-5 41517 0 NA
16-70293094-A-G c.1786-5T>C splice_region AARS 3 83006 3.6142E-5 41503 0 3.58072E-5
16-70294942-C-A c.1785+5G>T splice_region AARS 1 83384 1.19927E-5 41692 0 9.57365E-5
16-70294968-C-G p.Gln588His missense AARS 1 83414 1.19884E-5 41707 0 1.64756E-5
16-70294995-G-A p.Ile579Ile synonymous AARS 125 83418 0.00149848 41709 0 0.004375
16-70294995-G-C p.Ile579Met missense AARS 12 83422 1.43847E-4 41711 0 1.39168E-4
16-70295023-C-A p.Gly570Val missense AARS 1 83408 1.19893E-5 41704 0 1.64753E-5
16-70295043-C-T p.Val563Val synonymous AARS 1 83396 1.1991E-5 41698 0 6.75982E-5
16-70295047-G-A p.Thr562Ile missense AARS 620 83370 0.00743673 41685 4 0.00703956
16-70295052-C-G p.Glu560Asp missense AARS 1 83370 1.19947E-5 41685 0 NA
16-70295056-G-A p.Thr559Ile missense AARS 1 83358 1.19964E-5 41679 0 NA
16-70295059-T-TTA p.Lys558fs frameshift AARS 1 83348 1.19979E-5 41674 0 NA
16-70295064-A-T c.1672-4T>A splice_region AARS 270 83308 0.00324099 41654 0 0.00237037
16-70296242-G-A c.1671+7C>T splice_region AARS 10 83234 1.20143E-4 41617 0 2.78419E-5
16-70296243-G-A c.1671+6C>T splice_region AARS 3 83244 3.60386E-5 41622 0 3.97738E-6
16-70296256-C-A p.Ser555Ile missense AARS 11 83326 1.32012E-4 41663 0 0.0040282
16-70296264-A-G p.Asp552Asp synonymous AARS 1 83358 1.19964E-5 41679 0 1.15314E-4
16-70296270-C-T p.Lys550Lys synonymous AARS 4 83362 4.79835E-5 41681 0 8.23669E-6
16-70296280-T-C p.Tyr547Cys missense AARS 4 83368 4.798E-5 41684 0 3.9763E-6
16-70296287-C-T p.Glu545Lys missense AARS 6 83364 7.19735E-5 41682 0 8.23669E-6
16-70296288-G-A p.Asp544Asp synonymous AARS 30 83368 3.5985E-4 41684 0 8.28448E-4
16-70296330-G-A p.Asp530Asp synonymous AARS 1 83354 1.1997E-5 41677 0 3.97627E-6
16-70296341-C-T p.Val527Met missense AARS 1 83340 1.1999E-5 41670 0 8.23683E-6
16-70296370-T-C p.Glu517Gly missense AARS 1 83322 1.20016E-5 41661 0 NA
16-70296374-C-G p.Val516Leu missense AARS 2 83314 2.40056E-5 41657 0 6.36983E-5
16-70296374-C-T p.Val516Met missense AARS 2 83314 2.40056E-5 41657 0 1.9895E-5
16-70296375-G-A p.Phe515Phe synonymous AARS 6 83314 7.20167E-5 41657 0 2.47154E-5
16-70296375-G-T p.Phe515Leu missense AARS 1 83314 1.20028E-5 41657 0 2.47154E-5
16-70296379-ATCT-A p.Lys513del disruptive_inframe_deletion AARS 10 83316 1.20025E-4 41658 0 3.58155E-5
16-70296387-C-T n.29G>A splice_region AARS 1 83300 1.20048E-5 41650 0 8.24362E-6
16-70296391-C-T p.Arg510His missense AARS 2 83278 2.40159E-5 41639 0 3.2987E-5
16-70296391-C-A p.Arg510Leu missense AARS 1 83278 1.2008E-5 41639 0 3.98295E-6
16-70296392-G-A p.Arg510Cys missense AARS 4 83274 4.80342E-5 41637 0 9.07246E-5
16-70296401-T-A p.Met507Leu missense AARS 1 83256 1.20111E-5 41628 0 NA
16-70296406-G-A p.Thr505Met missense AARS 1 83230 1.20149E-5 41615 0 8.28844E-6
16-70296411-C-T p.Val503Val synonymous AARS 25 83218 3.00416E-4 41609 0 0.001875
16-70296416-T-C p.Thr502Ala missense AARS 1 83184 1.20215E-5 41592 0 8.3325E-6
16-70296426-T-TACATAGCTACC p.Phe499fs frameshift AARS 6 83116 7.21883E-5 41558 3 NA
16-70296434-A-G c.1493-7T>C splice_region AARS 7 83034 8.43028E-5 41517 0 1.91156E-4
16-70298867-T-G p.Ser496Arg missense AARS 1 83384 1.19927E-5 41692 0 NA
16-70298872-C-A p.Ser494Ile missense AARS 1 83400 1.19904E-5 41700 0 3.57913E-4
16-70298875-G-C p.Ser493Cys missense AARS 1 83406 1.19895E-5 41703 0 3.9769E-6
16-70298882-A-C p.Leu491Val missense AARS 1 83402 1.19901E-5 41701 0 3.18735E-5
16-70298892-G-A p.Tyr487Tyr synonymous AARS 1 83400 1.19904E-5 41700 0 3.9769E-6
16-70298916-C-T p.Glu479Glu synonymous AARS 6 83400 7.19424E-5 41700 0 8.24008E-6
16-70298918-C-T p.Glu479Lys missense AARS 1 83400 1.19904E-5 41700 0 8.23995E-6
16-70298925-C-G p.Arg476Arg synonymous AARS 46 83404 5.51532E-4 41702 0 0.00302115
16-70298926-C-T p.Arg476Gln missense AARS 2 83406 2.39791E-5 41703 0 8.23954E-6
16-70298927-G-A p.Arg476Trp missense AARS 2 83400 2.39808E-5 41700 0 3.57898E-5
16-70298932-C-T p.Arg474Gln missense AARS 1 83396 1.1991E-5 41698 0 3.18654E-5
16-70298933-G-A p.Arg474Trp missense AARS 6 83398 7.19442E-5 41699 0 8.23927E-5
16-70298934-G-C p.Leu473Leu synonymous AARS 9 83396 1.07919E-4 41698 0 0.0020141
16-70298943-G-A p.Ile470Ile synonymous AARS 11 83398 1.31898E-4 41699 0 5.03525E-4
16-70298943-G-C p.Ile470Met missense AARS 2 83398 2.39814E-5 41699 0 NA
16-70298948-C-T p.Ala469Thr missense AARS 3 83398 3.59721E-5 41699 0 6.75998E-5
16-70298949-G-A p.Tyr468Tyr synonymous AARS 690 83388 0.00827457 41694 7 0.025625
16-70298955-G-A p.Asp466Asp synonymous AARS 1 83392 1.19916E-5 41696 0 6.37024E-5
16-70298958-C-T p.Leu465Leu synonymous AARS 4 83396 4.79639E-5 41698 0 3.97636E-6
16-70298969-G-A p.Leu462Phe missense AARS 1 83384 1.19927E-5 41692 0 NA
16-70298976-C-G p.Gly459Gly synonymous AARS 1 83376 1.19939E-5 41688 0 NA
16-70298986-C-A p.Gly456Val missense AARS 2 83368 2.399E-5 41684 0 3.97627E-6
16-70298992-C-A p.Gly454Val missense AARS 1 83368 1.1995E-5 41684 0 1.27364E-4
16-70299007-T-TGGGCCA c.1348-3_1348-2insTGGCCC splice_region AARS 2 83340 2.39981E-5 41670 1 NA
16-70299007-T-A c.1348-2A>T splice_acceptor AARS 2 83342 2.39975E-5 41671 0 3.97636E-6
16-70299008-G-GGGCCAGTTTCCTCTCCTCTTCAAAGCCATCCATGTCTACCACCAGGCCCTTC c.1348-4_1348-3insGAAGGGCCTGGTGGTAGACATGGATGGCTTTGAAGAGGAGAGGAAACTGGCC splice_region AARS 2 83338 2.39987E-5 41669 1 NA
16-70299008-G-A c.1348-3C>T splice_region AARS 1 83338 1.19993E-5 41669 0 NA
16-70299009-T-C c.1348-4A>G splice_region AARS 1 83324 1.20013E-5 41662 0 NA
16-70299441-C-T p.Gln449Gln splice_region+synonymous AARS 6 82750 7.25076E-5 41375 0 6.37227E-5
16-70299444-G-A p.Ala448Ala synonymous AARS 3 82778 3.62415E-5 41389 0 1.19288E-5
16-70299456-C-T p.Glu444Glu synonymous AARS 163 82956 0.0019649 41478 0 0.00503525
16-70299482-C-T p.Val436Ile missense AARS 1 83260 1.20106E-5 41630 0 6.58913E-5
16-70299483-C-A p.Val435Val synonymous AARS 3 83280 3.60231E-5 41640 0 NA
16-70299486-C-T p.Leu434Leu synonymous AARS 1 83288 1.20065E-5 41644 0 3.9764E-6
16-70299493-T-C p.Lys432Arg missense AARS 3 83318 3.60066E-5 41659 0 1.59058E-5
16-70299504-A-T p.Ile428Ile synonymous AARS 1 83330 1.20005E-5 41665 0 3.18593E-5
16-70299513-A-G p.Thr425Thr synonymous AARS 2 83336 2.39992E-5 41668 0 6.37227E-5
16-70299514-G-C p.Thr425Ser missense AARS 1 83330 1.20005E-5 41665 0 NA
16-70299516-C-T p.Leu424Leu synonymous AARS 3 83338 3.5998E-5 41669 0 NA
16-70299527-G-C p.Pro421Ala missense AARS 3 83332 3.60006E-5 41666 0 7.95336E-6
16-70299535-T-C p.Tyr418Cys missense AARS 5 83306 6.00197E-5 41653 0 0.00100705
16-70299544-T-C p.Tyr415Cys missense AARS 1 83278 1.2008E-5 41639 0 5.03525E-4
16-70299561-G-A p.Asp409Asp synonymous AARS 1 83218 1.20166E-5 41609 0 NA
16-70299566-C-CGGGAA c.1223-2_1223-1insTTCCC splice_acceptor AARS 10 83196 1.20198E-4 41598 5 NA
16-70301554-G-GGCAA c.1222+7_1222+8insTTGC splice_region AARS 4 83154 4.81035E-5 41577 0 6.37024E-5
16-70301555-TAC-AAA c.1222+5_1222+7delGTAinsTTT splice_region AARS 3 83156 3.60768E-5 41578 0 NA
16-70301555-T-A c.1222+7A>T splice_region AARS 1 83156 1.20256E-5 41578 0 6.37105E-5
16-70301555-T-C c.1222+7A>G splice_region AARS 2 83156 2.40512E-5 41578 0 NA
16-70301557-C-A c.1222+5G>T splice_region AARS 1 83188 1.2021E-5 41594 0 6.36902E-5
16-70301560-A-T c.1222+2T>A splice_donor AARS 1 83226 1.20155E-5 41613 0 NA
16-70301562-C-A p.Gly408* stop_gained AARS 1 83266 1.20097E-5 41633 0 3.97772E-6
16-70301562-C-T p.Gly408Arg missense+splice_region AARS 2 83266 2.40194E-5 41633 0 0.00125
16-70301563-G-A p.Pro407Pro splice_region+synonymous AARS 1 83280 1.20077E-5 41640 0 8.24606E-5
16-70301564-G-T p.Pro407His missense+splice_region AARS 10 83290 1.20062E-4 41645 0 NA
16-70301565-G-T p.Pro407Thr missense AARS 5 83296 6.00269E-5 41648 0 1.64891E-5
16-70301568-T-A p.Ile406Phe missense AARS 1 83320 1.20019E-5 41660 0 NA
16-70301578-G-C p.Asp402Glu missense AARS 1 83340 1.1999E-5 41670 0 3.9769E-6
16-70301592-G-C p.Gln398Glu missense AARS 2 83360 2.39923E-5 41680 0 3.18552E-5
16-70301604-C-A p.Asp394Tyr missense AARS 1 83370 1.19947E-5 41685 0 NA
16-70301616-G-A p.Arg390Cys missense AARS 1 83376 1.19939E-5 41688 0 1.19296E-5
16-70301621-C-T p.Arg388Lys missense AARS 1 83378 1.19936E-5 41689 0 NA
16-70301644-C-T p.Val380Val synonymous AARS 3 83380 3.59799E-5 41690 0 3.18471E-5
16-70301645-A-G p.Val380Ala missense AARS 1 83378 1.19936E-5 41689 0 NA
16-70301661-T-C p.Ile375Val missense AARS 1 83376 1.19939E-5 41688 0 NA
16-70301664-T-C p.Ile374Val missense AARS 1 83374 1.19941E-5 41687 0 6.25E-4
16-70301674-C-G p.Met370Ile missense AARS 3 83372 3.59833E-5 41686 0 7.9533E-6
16-70301676-T-C p.Met370Val missense AARS 21 83372 2.51883E-4 41686 0 1.90875E-4
16-70301682-G-A p.Pro368Ser missense AARS 1 83374 1.19941E-5 41687 0 6.36902E-5
16-70301683-G-T p.Asp367Glu missense AARS 1 83374 1.19941E-5 41687 0 NA
16-70301694-G-A p.Leu364Leu synonymous AARS 1 83366 1.19953E-5 41683 0 NA
16-70301711-C-A p.Gly358Val missense+splice_region AARS 3 83352 3.59919E-5 41676 0 8.23696E-6
16-70302178-G-A p.Ser356Phe missense AARS 1 83380 1.19933E-5 41690 0 1.19304E-5
16-70302182-GGAC-G p.Val354del conservative_inframe_deletion AARS 1 83394 1.19913E-5 41697 0 NA
16-70302185-C-T p.Val354Ile missense AARS 1 83392 1.19916E-5 41696 0 3.18431E-5
16-70302196-A-G p.Val350Ala missense AARS 1 83396 1.1991E-5 41698 0 8.23778E-6
16-70302201-C-G p.Thr348Thr synonymous AARS 138 83402 0.00165464 41701 0 0.00305399
16-70302201-C-T p.Thr348Thr synonymous AARS 1 83402 1.19901E-5 41701 0 4.11875E-5
16-70302202-G-A p.Thr348Met missense AARS 5 83402 5.99506E-5 41701 0 1.64753E-5
16-70302203-T-C p.Thr348Ala missense AARS 2 83398 2.39814E-5 41699 0 3.97646E-6
16-70302209-A-G p.Phe346Leu missense AARS 1 83400 1.19904E-5 41700 0 3.9764E-6
16-70302226-T-C p.Asn340Ser missense AARS 6 83398 7.19442E-5 41699 0 1.27242E-4
16-70302238-T-C p.His336Arg missense AARS 1 83390 1.19918E-5 41695 0 3.18471E-5
16-70302247-C-T p.Arg333Gln missense AARS 2 83386 2.39848E-5 41693 0 0.00151057
16-70302263-G-A p.Leu328Phe missense AARS 1 83366 1.19953E-5 41683 0 NA
16-70302269-G-A p.Arg326Trp missense AARS 1 83352 1.19973E-5 41676 0 8.24185E-6
16-70302279-A-G p.Tyr322Tyr synonymous AARS 4 83338 4.79973E-5 41669 0 5.41574E-4
16-70302279-A-C p.Tyr322* stop_gained AARS 1 83338 1.19993E-5 41669 0 NA
16-70302283-C-CCACGCCCTGTGTTGTCAGGCCGGCCACCATCAGCCAGTGCCACAG c.963-2_963-1insCTGTGGCACTGGCTGATGGTGGCCGGCCTGACAACACAGGGCGTG splice_acceptor AARS 2 83336 2.39992E-5 41668 1 NA
16-70303517-T-G c.962+4A>C splice_region AARS 3 82778 3.62415E-5 41389 0 1.19441E-5
16-70303524-C-T p.Arg320His missense AARS 2 82858 2.41377E-5 41429 0 9.07157E-5
16-70303525-G-A p.Arg320Cys missense AARS 1 82856 1.20691E-5 41428 0 3.18573E-5
16-70303525-G-C p.Arg320Gly missense AARS 2 82856 2.41383E-5 41428 0 8.24701E-6
16-70303527-CCT-C p.Gly319fs frameshift AARS 1 82982 1.20508E-5 41491 0 NA
16-70303532-G-A p.Asn317Asn synonymous AARS 1 83022 1.2045E-5 41511 0 1.27389E-4
16-70303533-T-A p.Asn317Ile missense AARS 2 83022 2.409E-5 41511 0 8.24457E-6
16-70303542-C-T p.Arg314Gln missense AARS 2 83050 2.40819E-5 41525 0 8.24294E-6
16-70303543-G-A p.Arg314Trp missense AARS 1 83068 1.20383E-5 41534 0 2.38684E-5
16-70303546-C-T p.Gly313Ser missense AARS 1 83078 1.20369E-5 41539 0 3.2969E-5
16-70303548-C-T p.Gly312Asp missense AARS 2 83100 2.40674E-5 41550 0 2.38633E-5
16-70303548-C-A p.Gly312Val missense AARS 2 83100 2.40674E-5 41550 0 NA
16-70303568-G-C p.Ile305Met missense AARS 1 83204 1.20187E-5 41602 0 NA
16-70303579-C-T p.Ala302Thr missense AARS 15 83252 1.80176E-4 41626 0 6.92053E-4
16-70303580-G-A p.His301His synonymous AARS 40190 82990 0.484275 41495 9782 0.504791
16-70303589-C-T p.Leu298Leu synonymous AARS 5 83270 6.00456E-5 41635 0 3.18593E-5
16-70303596-C-T p.Arg296Gln missense AARS 1 83268 1.20094E-5 41634 0 3.18593E-5
16-70303597-G-T p.Arg296Arg synonymous AARS 1 83270 1.20091E-5 41635 0 NA
16-70303598-G-A p.Tyr295Tyr synonymous AARS 1 83288 1.20065E-5 41644 0 NA
16-70303618-C-T p.Asp289Asn missense AARS 6 83296 7.20323E-5 41648 0 6.25E-4
16-70303619-G-A p.Ala288Ala synonymous AARS 2 83292 2.40119E-5 41646 0 1.19299E-5
16-70303633-C-G p.Gly284Arg missense AARS 2 83250 2.4024E-5 41625 0 NA
16-70303634-A-G p.Val283Val synonymous AARS 3 83248 3.60369E-5 41624 0 3.29489E-5
16-70303637-T-C p.Lys282Lys synonymous AARS 2 83240 2.40269E-5 41620 0 1.15323E-4
16-70303648-A-G p.Tyr279His missense AARS 1 83206 1.20184E-5 41603 0 3.18654E-5
16-70303651-G-C p.Pro278Ala missense AARS 1 83168 1.20239E-5 41584 0 NA
16-70303653-CG-C p.Arg277fs frameshift AARS 1 83146 1.2027E-5 41573 0 NA
16-70303653-C-T p.Arg277Gln missense AARS 1 83146 1.2027E-5 41573 0 1.64756E-5
16-70303654-G-A p.Arg277* stop_gained AARS 1 83124 1.20302E-5 41562 0 1.64758E-5
16-70303659-C-T p.Gly275Asp missense AARS 2691 83052 0.0324014 41526 244 0.0698393
16-70303660-C-T p.Gly275Ser missense AARS 10 83100 1.20337E-4 41550 0 9.94328E-5
16-70303665-C-T p.Gly273Asp missense+splice_region AARS 1 83020 1.20453E-5 41510 0 3.29533E-5
16-70303670-T-C c.817-4A>G splice_region AARS 3 82976 3.6155E-5 41488 0 1.64766E-5
16-70303673-A-G c.817-7T>C splice_region AARS 3 82950 3.61664E-5 41475 0 3.18512E-5
16-70304098-C-T c.816+1G>A splice_donor AARS 1 83242 1.20132E-5 41621 0 NA
16-70304106-A-G p.Ile270Thr missense AARS 1 83272 1.20088E-5 41636 0 NA
16-70304132-G-C p.Asp261Glu missense AARS 1 83358 1.19964E-5 41679 0 1.19296E-5
16-70304137-T-C p.Thr260Ala missense AARS 1 83372 1.19944E-5 41686 0 3.97646E-6
16-70304145-T-C p.Asn257Ser missense AARS 2 83378 2.39871E-5 41689 0 NA
16-70304159-C-G p.Gln252His missense AARS 2 83392 2.39831E-5 41696 0 8.23669E-6
16-70304164-G-A p.Leu251Leu synonymous AARS 2 83392 2.39831E-5 41696 0 7.95286E-6
16-70304171-T-C p.Val248Val synonymous AARS 12 83402 1.43881E-4 41701 1 2.50523E-4
16-70304174-C-T p.Leu247Leu synonymous AARS 57 83398 6.8347E-4 41699 0 5.88535E-4
16-70304176-G-T p.Leu247Met missense AARS 1 83394 1.19913E-5 41697 0 8.23655E-6
16-70304178-C-T p.Arg246Gln missense AARS 1 83394 1.19913E-5 41697 0 NA
16-70304178-C-A p.Arg246Leu missense AARS 1 83394 1.19913E-5 41697 0 NA
16-70304179-G-T p.Arg246Arg synonymous AARS 1 83396 1.1991E-5 41698 0 3.97665E-6
16-70304189-C-T p.Met242Ile missense AARS 1 83392 1.19916E-5 41696 0 1.64734E-5
16-70304191-TC-T p.Met242fs frameshift AARS 1 83390 1.19918E-5 41695 0 NA
16-70304198-G-A p.Asp239Asp synonymous AARS 1 83380 1.19933E-5 41690 0 3.97665E-6
16-70304206-T-C p.Ser237Gly missense AARS 1 83368 1.1995E-5 41684 0 NA
16-70304211-T-C p.Lys235Arg missense AARS 3 83364 3.59868E-5 41682 0 6.25E-4
16-70304215-G-A p.Pro234Ser missense AARS 232 83340 0.00278378 41670 0 0.00704935
16-70304231-G-A p.Gly228Gly synonymous AARS 1 83268 1.20094E-5 41634 0 NA
16-70304248-A-T c.672-5T>A splice_region AARS 1 83150 1.20265E-5 41575 0 3.18552E-5
16-70305681-T-C c.671+3A>G splice_region AARS 2724 83010 0.0328153 41505 245 0.0698797
16-70305688-T-C p.Asn223Asp missense AARS 3 83116 3.60941E-5 41558 0 6.40041E-5
16-70305692-C-G p.Gln221His missense AARS 2 83174 2.4046E-5 41587 0 3.97678E-6
16-70305698-G-A p.Phe219Phe synonymous AARS 1 83238 1.20137E-5 41619 0 NA
16-70305712-A-T p.Trp215Arg missense AARS 1 83352 1.19973E-5 41676 0 NA
16-70305721-G-A p.Leu212Leu synonymous AARS 1 83366 1.19953E-5 41683 0 1.19295E-5
16-70305725-A-G p.Asn210Asn synonymous AARS 2 83378 2.39871E-5 41689 0 4.94356E-5
16-70305733-C-T p.Asp208Asn missense AARS 1 83370 1.19947E-5 41685 0 9.62217E-5
16-70305733-C-G p.Asp208His missense AARS 1 83370 1.19947E-5 41685 0 9.62217E-5
16-70305734-G-A p.Asp207Asp synonymous AARS 17 83366 2.0392E-4 41683 0 8.66273E-4
16-70305734-G-T p.Asp207Glu missense AARS 2 83366 2.39906E-5 41683 0 8.23927E-6
16-70305737-C-A p.Gln206His missense AARS 4 83360 4.79846E-5 41680 0 1.64775E-5
16-70305737-C-T p.Gln206Gln synonymous AARS 2 83360 2.39923E-5 41680 0 NA
16-70305739-G-A p.Gln206* stop_gained AARS 1 83362 1.19959E-5 41681 0 3.97633E-6
16-70305754-C-T p.Ala201Thr missense AARS 2 83368 2.399E-5 41684 0 4.1195E-5
16-70305755-G-A p.Ala200Ala synonymous AARS 43 83370 5.15773E-4 41685 0 0.00100705
16-70305758-G-A p.Asp199Asp synonymous AARS 4 83374 4.79766E-5 41687 0 0.00100705
16-70305759-T-A p.Asp199Val missense AARS 1 83374 1.19941E-5 41687 0 NA
16-70305763-G-A p.Arg198Trp missense AARS 2 83376 2.39877E-5 41688 0 5.7672E-5
16-70305774-C-T p.Arg194Gln missense AARS 5 83382 5.9965E-5 41691 0 1.19299E-5
16-70305779-G-A p.Tyr192Tyr synonymous AARS 3 83372 3.59833E-5 41686 0 2.23957E-4
16-70305784-G-A p.His191Tyr missense AARS 3 83366 3.59859E-5 41683 0 NA
16-70305794-G-A p.Cys187Cys synonymous AARS 8 83378 9.59486E-5 41689 0 6.68098E-4
16-70305800-A-T p.Gly185Gly synonymous AARS 1 83368 1.1995E-5 41684 0 NA
16-70305806-G-A p.Pro183Pro synonymous AARS 1 83308 1.20036E-5 41654 0 0.00159939
16-70305809-G-A p.Gly182Gly synonymous AARS 1 83308 1.20036E-5 41654 0 0.00163169
16-70305810-C-G p.Gly182Ala missense AARS 1 83350 1.19976E-5 41675 0 NA
16-70305813-G-A p.Thr181Met missense AARS 3 83342 3.59963E-5 41671 0 8.24226E-6
16-70305822-A-G p.Met178Thr missense AARS 1 83334 1.19999E-5 41667 0 NA
16-70305830-G-C p.Phe175Leu missense AARS 4 83306 4.80158E-5 41653 0 3.18552E-5
16-70305830-G-A p.Phe175Phe synonymous AARS 13 83306 1.56051E-4 41653 0 NA
16-70305834-T-C p.Asn174Ser missense AARS 2 83284 2.40142E-5 41642 0 3.18776E-5
16-70305837-T-C p.Asp173Gly missense AARS 11 83260 1.32116E-4 41630 0 5.96678E-5
16-70305845-G-T p.Asn170Lys missense AARS 4 83180 4.80885E-5 41590 0 1.5916E-5
16-70305849-C-G p.Gly169Ala missense AARS 1 83086 1.20357E-5 41543 0 NA
16-70305852-G-A p.Pro168Leu missense AARS 2 83050 2.40819E-5 41525 0 6.25E-4
16-70305853-G-A p.Pro168Ser missense AARS 1 83026 1.20444E-5 41513 0 NA
16-70305857-G-A p.Ile166Ile synonymous AARS 1 82954 1.20549E-5 41477 0 3.98206E-6
16-70305858-A-C p.Ile166Ser missense AARS 9 82912 1.08549E-4 41456 0 1.82017E-4
16-70305861-T-C p.Lys165Arg missense AARS 1 82874 1.20665E-5 41437 0 8.27678E-6
16-70305865-T-C p.Thr164Ala missense AARS 2 82784 2.41593E-5 41392 0 3.18756E-5
16-70305873-A-G p.Leu161Pro missense+splice_region AARS 2 82638 2.42019E-5 41319 0 NA
16-70305874-G-A p.Leu161Leu splice_region+synonymous AARS 2 82556 2.4226E-5 41278 0 NA
16-70305876-C-CCCAAATTT c.480-2_480-1insAAATTTGG splice_acceptor AARS 3 82524 3.63531E-5 41262 1 NA
16-70305877-T-TGACA c.480-3_480-2insTGTC splice_region AARS 3 82480 3.63725E-5 41240 0 NA
16-70305883-A-G c.480-8T>C splice_region AARS 25 82260 3.03914E-4 41130 0 6.25E-4
16-70310384-CT-C c.479+4delA splice_region AARS 1 83320 1.20019E-5 41660 0 NA
16-70310403-G-C p.Ile155Met missense AARS 1 83346 1.19982E-5 41673 0 3.97858E-6
16-70310427-T-A p.Glu147Asp missense AARS 1 83360 1.19962E-5 41680 0 NA
16-70310432-A-G p.Leu146Leu synonymous AARS 3 83360 3.59885E-5 41680 0 8.23723E-6
16-70310438-C-T p.Ala144Thr missense AARS 6 83372 7.19666E-5 41686 0 0.00125
16-70310439-T-G p.Ala143Ala synonymous AARS 1 83372 1.19944E-5 41686 0 NA
16-70310450-C-T p.Gly140Arg missense AARS 2 83366 2.39906E-5 41683 0 3.18492E-5
16-70310451-G-A p.Gly139Gly synonymous AARS 1 83364 1.19956E-5 41682 0 4.77308E-5
16-70310465-C-T p.Val135Ile missense AARS 1 83362 1.19959E-5 41681 0 NA
16-70310477-C-T p.Glu131Lys missense AARS 1 83362 1.19959E-5 41681 0 3.18532E-5
16-70310483-G-C p.Pro129Ala missense AARS 14 83348 1.6797E-4 41674 0 0.00100705
16-70310486-T-C p.Ile128Val missense AARS 1 83350 1.19976E-5 41675 0 NA
16-70310488-C-A p.Gly127Val missense AARS 3 83354 3.59911E-5 41677 0 NA
16-70310500-G-A p.Thr123Ile missense AARS 1 83348 1.19979E-5 41674 0 1.59117E-5
16-70310502-G-A p.Leu122Leu synonymous AARS 1 83346 1.19982E-5 41673 0 8.24131E-6
16-70310503-A-T p.Leu122His missense AARS 1 83346 1.19982E-5 41673 0 NA
16-70310508-T-C p.Glu120Glu synonymous AARS 2 83342 2.39975E-5 41671 0 3.18979E-5
16-70310519-T-C p.Met117Val missense AARS 2 83332 2.40004E-5 41666 0 3.9789E-6
16-70310525-A-G p.Cys115Arg missense AARS 2 83324 2.40027E-5 41662 0 1.19392E-5
16-70310526-T-G p.Ala114Ala synonymous AARS 5 83324 6.00067E-5 41662 0 3.18573E-5
16-70310526-T-C p.Ala114Ala synonymous AARS 1 83324 1.20013E-5 41662 0 6.37146E-5
16-70310527-G-A p.Ala114Val missense AARS 1 83318 1.20022E-5 41659 0 NA
16-70310532-T-C p.Glu112Glu splice_region+synonymous AARS 1 83310 1.20034E-5 41655 0 8.26392E-6
16-70310535-C-CT c.334-2_334-1insA splice_acceptor AARS 2 83306 2.40079E-5 41653 1 NA
16-70310536-T-C c.334-2A>G splice_acceptor AARS 3 83302 3.60135E-5 41651 0 8.26897E-6
16-70310866-T-G c.333+3A>C splice_region AARS 5 83328 6.00038E-5 41664 0 9.55353E-5
16-70310870-TTAAAG-T p.Tyr109fs frameshift AARS 3 83352 3.59919E-5 41676 0 3.1841E-5
16-70310875-G-A p.Tyr109Tyr synonymous AARS 1 83368 1.1995E-5 41684 0 NA
16-70310892-A-G p.Trp104Arg missense AARS 1 83398 1.19907E-5 41699 0 NA
16-70310917-G-A p.His95His synonymous AARS 1 83414 1.19884E-5 41707 0 NA
16-70310920-A-G p.His94His synonymous AARS 1 83410 1.1989E-5 41705 0 NA
16-70310924-T-C p.Tyr93Cys missense AARS 3 83410 3.59669E-5 41705 0 1.19289E-5
16-70310941-A-G p.Asp87Asp synonymous AARS 1 83406 1.19895E-5 41703 0 NA
16-70310957-T-A p.His82Leu missense AARS 1 83408 1.19893E-5 41704 0 7.9526E-6
16-70310970-C-A p.Ala78Ser missense AARS 1 83408 1.19893E-5 41704 0 3.18471E-5
16-70310973-G-A p.Arg77Trp missense AARS 1 83410 1.1989E-5 41705 0 NA
16-70310976-T-C p.Ile76Val missense AARS 1 83410 1.1989E-5 41705 0 3.18431E-5
16-70310987-G-T p.Thr72Asn missense AARS 1 83406 1.19895E-5 41703 0 NA
16-70311026-G-A p.Pro59Leu missense AARS 1 83390 1.19918E-5 41695 0 NA
16-70311033-T-C p.Ile57Val missense AARS 1 83388 1.19921E-5 41694 0 3.97649E-6
16-70316522-C-A c.144+1G>T splice_donor AARS 2 83382 2.3986E-5 41691 1 NA
16-70316539-T-C p.Asn43Ser missense AARS 2 83412 2.39774E-5 41706 0 1.27421E-4
16-70316540-T-C p.Asn43Asp missense AARS 1 83412 1.19887E-5 41706 0 NA
16-70316549-G-A p.Leu40Phe missense AARS 1 83416 1.19881E-5 41708 0 3.9764E-6
16-70316556-G-A p.Pro37Pro synonymous AARS 1 83420 1.19875E-5 41710 0 NA
16-70316557-G-T p.Pro37His missense AARS 1 83422 1.19872E-5 41711 0 NA
16-70316569-G-T p.Pro33Gln missense AARS 1 83426 1.19867E-5 41713 0 3.1841E-5
16-70316570-G-C p.Pro33Ala missense AARS 1 83420 1.19875E-5 41710 0 1.64731E-5
16-70316572-A-G p.Ile32Thr missense AARS 4 83420 4.79501E-5 41710 0 6.36213E-5
16-70316573-T-C p.Ile32Val missense AARS 1 83420 1.19875E-5 41710 0 NA
16-70316576-T-C p.Thr31Ala missense AARS 1 83430 1.19861E-5 41715 0 3.18329E-5
16-70316583-C-T p.Ser28Ser synonymous AARS 2 83430 2.39722E-5 41715 0 1.64734E-5
16-70316586-G-A p.His27His synonymous AARS 2 83428 2.39728E-5 41714 0 2.47109E-5
16-70316593-T-C p.Tyr25Cys missense AARS 1 83424 1.1987E-5 41712 0 0.00100705
16-70316595-C-T p.Thr24Thr synonymous AARS 3 83420 3.59626E-5 41710 0 5.03525E-4
16-70316597-T-G p.Thr24Pro missense AARS 1 83420 1.19875E-5 41710 0 1.19289E-5
16-70316599-T-A p.His23Leu missense AARS 1 83420 1.19875E-5 41710 0 NA
16-70316603-C-T p.Glu22Lys missense AARS 200 83416 0.00239762 41708 0 0.00573285
16-70316604-G-A p.Asn21Asn synonymous AARS 1 83410 1.1989E-5 41705 0 8.23737E-6
16-70316604-G-T p.Asn21Lys missense AARS 1 83410 1.1989E-5 41705 0 NA
16-70316609-T-C p.Arg20Gly missense AARS 2 83420 2.39751E-5 41710 0 8.2375E-6
16-70316614-A-C p.Phe18Cys missense AARS 1 83410 1.1989E-5 41705 0 NA
16-70316624-T-C p.Ile15Val missense AARS 1 83404 1.19898E-5 41702 0 NA
16-70316625-A-G p.Phe14Phe synonymous AARS 1 83404 1.19898E-5 41702 0 NA
16-70316630-G-A p.Arg13* stop_gained AARS 14 83400 1.67866E-4 41700 0 8.23859E-6
16-70316636-G-A p.Arg11Trp missense AARS 1 83402 1.19901E-5 41701 0 7.95267E-6
16-70316636-G-T p.Arg11Arg synonymous AARS 1 83402 1.19901E-5 41701 0 NA
16-70316642-C-A p.Glu9* stop_gained AARS 1 83402 1.19901E-5 41701 0 NA
16-70316651-TTAGAG-T p.Thr4fs frameshift AARS 4 83390 4.79674E-5 41695 0 NA
16-70316652-T-G p.Leu5Leu synonymous AARS 1 83388 1.19921E-5 41694 0 NA
16-70316658-A-C p.Ser3Ser synonymous AARS 4 83380 4.79731E-5 41690 0 6.25E-4
16-70316662-T-C p.Asp2Gly missense AARS 4 83368 4.798E-5 41684 0 3.97681E-6
16-70316678-C-T c.-12G>A 5_prime_UTR_premature_start_codon_gain AARS 2 83334 2.39998E-5 41667 0 1.6506E-5
16-70316678-C-G c.-12G>C 5_prime_UTR_premature_start_codon_gain AARS 1 83334 1.19999E-5 41667 0 3.18613E-5
16-70316692-TC-AA c.-21-6_-21-5delGAinsTT splice_region AARS 2 83192 2.40408E-5 41596 0 NA
16-70323316-C-T c.-22+8G>A splice_region AARS 3 8524 3.51947E-4 4262 0 9.57243E-5
16-70323339-C-A c.-37G>T 5_prime_UTR_premature_start_codon_gain AARS 1 8960 1.11607E-4 4480 0 NA
16-70323367-C-A c.-65G>T 5_prime_UTR_premature_start_codon_gain AARS 1 9156 1.09218E-4 4578 0 NA
16-70323437-A-G c.-135T>C 5_prime_UTR_premature_start_codon_gain AARS 2 9006 2.22074E-4 4503 0 NA