Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
11-77532226-C-T c.-19C>T splice_region AAMDC 2 3250 6.15385E-4 1625 0 NA
11-77532287-G-GTTCTGGAGGCT c.-61_-61+1insTTCTGGAGGCT splice_donor AAMDC 1 2988 3.34672E-4 1494 0 NA
11-77552250-T-G p.Trp7Gly missense AAMDC 1 10454 9.56572E-5 5227 0 9.55657E-5
11-77553517-A-G c.-18-8A>G splice_region AAMDC 1 82964 1.20534E-5 41482 0 1.70838E-4
11-77553548-T-G p.Thr2Thr synonymous AAMDC 1 83086 1.20357E-5 41543 0 3.1839E-5
11-77553548-T-C p.Thr2Thr synonymous AAMDC 2 83086 2.40714E-5 41543 0 NA
11-77553552-C-T p.Pro4Ser missense AAMDC 1 83080 1.20366E-5 41540 0 NA
11-77553561-G-A p.Ala7Thr missense AAMDC 1 83090 1.20351E-5 41545 0 NA
11-77553571-C-T p.Ser10Leu missense AAMDC 2 83094 2.40691E-5 41547 0 3.1872E-5
11-77553572-A-G p.Ser10Ser synonymous AAMDC 1 83094 1.20346E-5 41547 0 NA
11-77553572-A-T p.Ser10Ser synonymous AAMDC 1 83094 1.20346E-5 41547 0 NA
11-77553577-G-A p.Gly12Glu missense AAMDC 1 83080 1.20366E-5 41540 0 1.19482E-5
11-77553582-A-T p.Met14Leu missense AAMDC 1 83092 1.20349E-5 41546 0 3.98238E-6
11-77553591-A-G p.Lys17Glu missense AAMDC 4 83104 4.81325E-5 41552 0 8.26078E-6
11-77553595-G-C p.Gly18Ala missense AAMDC 41 83088 4.93453E-4 41544 0 3.38465E-4
11-77553611-T-C p.Tyr23Tyr synonymous AAMDC 1 83078 1.20369E-5 41539 0 NA
11-77553613-A-G p.Lys24Arg missense AAMDC 3 83062 3.61176E-5 41531 0 NA
11-77553624-G-A p.Val28Ile missense AAMDC 1 83082 1.20363E-5 41541 0 NA
11-77553631-CA-C p.Gly32fs frameshift AAMDC 1 83082 1.20363E-5 41541 0 NA
11-77553632-A-AG p.Ser33fs frameshift AAMDC 2 83078 2.40738E-5 41539 0 NA
11-77553634-G-C p.Gly31Ala missense AAMDC 2 83066 2.40772E-5 41533 0 6.3678E-5
11-77553634-G-T p.Gly31Val missense AAMDC 1 83066 1.20386E-5 41533 0 3.1839E-5
11-77553638-T-C p.Gly32Gly synonymous AAMDC 32977 82792 0.398311 41396 6698 0.445619
11-77553642-C-T p.Arg34Trp missense AAMDC 1 83084 1.2036E-5 41542 0 9.55657E-5
11-77553643-G-A p.Arg34Gln missense AAMDC 1 83090 1.20351E-5 41545 0 NA
11-77553644-G-A p.Arg34Arg synonymous AAMDC 1 83104 1.20331E-5 41552 0 8.24525E-6
11-77553646-C-T p.Thr35Ile missense AAMDC 1 83138 1.20282E-5 41569 0 1.99198E-5
11-77553648-TG-T p.Asp37fs frameshift AAMDC 9 83144 1.08246E-4 41572 0 5.03525E-4
11-77553652-A-T p.Asp37Val missense AAMDC 8 83160 9.62001E-5 41580 0 0.001875
11-77553674-G-GCATTCTCCTGGTGTGCAGCCTGCAGATGT c.132_132+1insCATTCTCCTGGTGTGCAGCCTGCAGATGT splice_donor AAMDC 1 83194 1.20201E-5 41597 0 NA
11-77553675-G-A c.132+1G>A splice_donor AAMDC 1 83178 1.20224E-5 41589 0 NA
11-77553675-G-T c.132+1G>T splice_donor AAMDC 2 83178 2.40448E-5 41589 0 3.98613E-6
11-77566489-C-A p.Ser77Ser synonymous AAMDC 1 540 0.00185185 270 0 NA
11-77566503-C-T p.Thr82Ile missense AAMDC 1 820 0.00121951 410 0 NA
11-77566515-G-A p.Cys86Tyr missense AAMDC 7 946 0.00739958 473 0 0.0135135
11-77566524-C-A p.Thr89Asn missense AAMDC 1 1068 9.3633E-4 534 0 4.80184E-4
11-77580767-G-A c.133-1G>A splice_acceptor AAMDC 1 83350 1.19976E-5 41675 0 1.64796E-5
11-77580772-C-T p.Ser46Phe missense AAMDC 1 83370 1.19947E-5 41685 0 NA
11-77580777-G-C p.Gly48Arg missense AAMDC 7 83372 8.3961E-5 41686 0 5.76663E-5
11-77580781-T-C p.Val49Ala missense AAMDC 23 83368 2.75885E-4 41684 0 0.00100705
11-77580783-C-G p.Gln50Glu missense AAMDC 1 83380 1.19933E-5 41690 0 NA
11-77580807-G-A p.Val58Ile missense AAMDC 1 83392 1.19916E-5 41696 0 NA
11-77580817-G-T p.Gly61Val missense AAMDC 3 83390 3.59755E-5 41695 0 2.47105E-5
11-77580817-G-A p.Gly61Asp missense AAMDC 1 83390 1.19918E-5 41695 0 NA
11-77580829-T-C p.Leu65Pro missense AAMDC 2 83394 2.39825E-5 41697 0 3.97693E-6
11-77580835-T-C p.Ile67Thr missense AAMDC 2 83386 2.39848E-5 41693 0 2.78385E-5
11-77580840-C-T p.Arg69* stop_gained AAMDC 4 83392 4.79662E-5 41696 0 5.03525E-4
11-77580848-G-A p.Met71Ile missense AAMDC 1 83378 1.19936E-5 41689 0 NA
11-77580855-G-A p.Ala74Thr missense AAMDC 3 83370 3.59842E-5 41685 0 1.9887E-5
11-77580863-G-A p.Lys76Lys splice_region+synonymous AAMDC 9 83326 1.0801E-4 41663 0 6.25E-4
11-77580865-T-TGCCTTCATCAACTGTGG c.228+2_228+3insGCCTTCATCAACTGTGG splice_region AAMDC 1 83320 1.20019E-5 41660 0 NA
11-77580867-G-GTACCTCAAGAAACATGGCATTGAT c.228+4_228+5insTACCTCAAGAAACATGGCATTGAT splice_region AAMDC 1 83318 1.20022E-5 41659 0 NA
11-77580870-G-A c.228+7G>A splice_region AAMDC 1 83322 1.20016E-5 41661 0 NA
11-77580871-T-C c.228+8T>C splice_region AAMDC 6 83324 7.20081E-5 41662 0 NA
11-77583217-C-T c.229-4C>T splice_region AAMDC 1 82962 1.20537E-5 41481 0 8.60674E-6
11-77583232-A-C p.Ser80Ser synonymous AAMDC 1 83118 1.20311E-5 41559 0 3.18613E-5
11-77583240-A-G p.Glu83Gly missense AAMDC 1 83152 1.20262E-5 41576 0 2.51282E-5
11-77583261-T-C p.Ile90Thr missense AAMDC 1 83212 1.20175E-5 41606 0 3.18431E-5
11-77583266-G-A p.Val92Met missense AAMDC 8891 82952 0.107182 41476 529 0.139134
11-77583269-C-T p.Arg93Trp missense AAMDC 2 83224 2.40315E-5 41612 0 5.58272E-5
11-77583313-G-T p.Leu107Phe missense AAMDC 4 83212 4.807E-5 41606 0 3.30524E-5
11-77583326-G-T p.Val112Phe missense AAMDC 1 83202 1.20189E-5 41601 0 NA
11-77583366-GCCTTAAGAGGAGAATAAATCACTAAGTGCCTATGCCTGTGACTGTCACTCACCATTCTCCAAACCAGCCTCCCCTAAACATTTTTGGACACCTA-G c.*6_*99delCCTTAAGAGGAGAATAAATCACTAAGTGCCTATGCCTGTGACTGTCACTCACCATTCTCCAAACCAGCCTCCCCTAAACATTTTTGGACACCTA splice_region AAMDC 2 83144 2.40547E-5 41572 0 NA
11-77587992-CT-C c.229-3delT splice_region AAMDC 4 59796 6.68941E-5 29898 0 2.17055E-5
11-77587999-C-G p.Pro78Ala missense AAMDC 1 59792 1.67246E-5 29896 0 3.1841E-5
11-77588004-C-G p.Pro4Arg missense AAMDC 1 59796 1.67235E-5 29898 0 2.16801E-5
11-77588008-C-G p.Gln81Glu missense AAMDC 1 59804 1.67213E-5 29902 0 NA
11-77588014-C-T p.Pro83Ser missense AAMDC 4 59796 6.68941E-5 29898 0 NA
11-77588042-T-C p.Val92Ala missense AAMDC 5 59790 8.3626E-5 29895 0 7.23474E-5
11-77588044-C-T p.Gln93* stop_gained AAMDC 1 59790 1.67252E-5 29895 0 NA
11-77588064-T-A p.Leu24His missense AAMDC 7 59780 1.17096E-4 29890 0 1.2738E-4
11-77588076-C-T p.Ser28Phe missense AAMDC 1 59754 1.67353E-5 29877 0 NA
11-77588079-T-C p.Leu29Ser missense AAMDC 3 59754 5.02058E-5 29877 0 NA
11-77588100-G-C c.328+5G>C splice_region AAMDC 1 59722 1.67442E-5 29861 0 NA
11-77588102-A-C c.328+7A>C splice_region AAMDC 263 59712 0.00440447 29856 1 0.00371897
11-77588103-C-T c.328+8C>T splice_region AAMDC 10 59712 1.67471E-4 29856 0 6.25E-4
11-77589750-C-T p.Gln111* stop_gained AAMDC 2 51466 3.88606E-5 25733 0 6.25E-4
11-77589756-C-G p.Leu113Val missense AAMDC 1 52916 1.88979E-5 26458 0 6.36862E-5
11-77589757-T-C p.Leu113Pro missense AAMDC 1 53366 1.87385E-5 26683 0 NA
11-77589759-G-C p.Glu114Gln missense AAMDC 1 53846 1.85715E-5 26923 0 NA
11-77589773-T-C p.Val118Val synonymous AAMDC 1 57240 1.74703E-5 28620 0 2.37503E-5
11-77589788-G-T p.Leu123Phe missense AAMDC 3 60618 4.94902E-5 30309 0 NA
11-77589795-G-A p.Gly126Arg missense AAMDC 3 62448 4.804E-5 31224 0 NA
11-77589796-G-C p.Gly126Ala missense AAMDC 1 62722 1.59434E-5 31361 0 8.88731E-5
11-77595833-C-T p.Thr79Ile missense AAMDC 1 8000 1.25E-4 4000 0 8.6075E-4
11-77595853-T-C p.Cys86Arg missense AAMDC 1 8072 1.23885E-4 4036 0 8.79569E-6
11-77595863-C-T p.Thr89Met missense AAMDC 1 7950 1.25786E-4 3975 0 3.48159E-5
11-77595865-A-G p.Ile90Val missense AAMDC 1 8014 1.24782E-4 4007 0 NA
11-77595867-CAT-C p.Ile91fs frameshift AAMDC 1 7986 1.25219E-4 3993 0 NA
11-77595871-A-G p.Thr92Ala missense AAMDC 1 8090 1.23609E-4 4045 0 NA
11-77611616-G-A c.329-1G>A splice_acceptor AAMDC 47 55570 8.4578E-4 27785 0 0.0017335
11-77611640-G-A p.Val118Ile missense AAMDC 2 55814 3.58333E-5 27907 0 3.21916E-5
11-77611655-A-G p.Met123Val missense AAMDC 1 55876 1.78968E-5 27938 0 NA
11-77611657-G-A p.Met123Ile missense AAMDC 1 55884 1.78942E-5 27942 0 NA
11-77611672-T-G p.Thr128Thr synonymous AAMDC 1 55968 1.78674E-5 27984 0 NA
11-77611676-T-C p.Leu130Leu synonymous AAMDC 1 55976 1.78648E-5 27988 0 NA
11-77611710-T-C p.Met141Thr missense AAMDC 4 55640 7.18907E-5 27820 0 9.06618E-5
11-77611710-T-G p.Met141Arg missense AAMDC 1 55640 1.79727E-5 27820 0 NA
11-77611711-G-A p.Met141Ile missense AAMDC 1 55626 1.79772E-5 27813 0 NA
11-77611729-A-G p.Lys147Lys synonymous AAMDC 3 55256 5.42927E-5 27628 0 1.595E-4
11-77611732-G-A p.Ter148Ter stop_retained AAMDC 54 55086 9.80285E-4 27543 0 0.00449833
11-77629100-C-G c.229-7C>G splice_region AAMDC 1 52130 1.91828E-5 26065 0 NA
11-77629101-C-T c.229-6C>T splice_region AAMDC 2 52126 3.83686E-5 26063 0 NA
11-77629119-G-T p.Gly81Trp missense AAMDC 1 52160 1.91718E-5 26080 0 NA
11-77629132-A-AT p.Leu86fs frameshift AAMDC 36581 49646 0.736837 24823 13819 0.756952