Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
15-67495186-T-G p.Glu307Asp missense AAGAB 1 80086 1.24866E-5 40043 0 1.65645E-5
15-67495190-A-G p.Ile306Thr missense AAGAB 1 80102 1.24841E-5 40051 0 1.65648E-5
15-67495193-T-C p.Glu305Gly missense AAGAB 1 80108 1.24831E-5 40054 0 1.21408E-5
15-67495196-T-C p.Asp304Gly missense AAGAB 2 80104 2.49675E-5 40052 0 NA
15-67495201-G-T p.Asp302Glu missense AAGAB 1 80122 1.2481E-5 40061 0 1.65645E-5
15-67495210-G-A p.Ile299Ile synonymous AAGAB 23 80120 2.87069E-4 40060 0 1.25472E-4
15-67495212-T-C p.Ile299Val missense AAGAB 1 80116 1.24819E-5 40058 0 2.4846E-5
15-67495220-C-T p.Trp296* stop_gained AAGAB 1 80114 1.24822E-5 40057 0 NA
15-67495223-A-C p.Phe295Cys missense AAGAB 1 80102 1.24841E-5 40051 0 4.0475E-6
15-67495226-G-A p.Ala294Val missense AAGAB 1 80092 1.24856E-5 40046 0 NA
15-67495229-T-C p.Lys293Arg missense AAGAB 1 80088 1.24863E-5 40044 0 NA
15-67495878-T-A c.870+8A>T splice_region AAGAB 2 82738 2.41727E-5 41369 0 8.04784E-6
15-67495878-T-G c.870+8A>C splice_region AAGAB 1 82738 1.20863E-5 41369 0 NA
15-67495890-T-A p.Glu289Val missense AAGAB 2 82810 2.41517E-5 41405 0 NA
15-67495904-T-G p.Arg284Ser missense AAGAB 1 82846 1.20706E-5 41423 0 2.59117E-5
15-67495907-T-C p.Gln283Gln synonymous AAGAB 1 82856 1.20691E-5 41428 0 6.36659E-5
15-67495909-G-T p.Gln283Lys missense AAGAB 3 82846 3.62118E-5 41423 0 1.72117E-5
15-67495911-T-C p.Glu282Gly missense AAGAB 1 82860 1.20685E-5 41430 0 NA
15-67495912-C-T p.Glu282Lys missense AAGAB 3 82874 3.61995E-5 41437 0 1.71718E-5
15-67495914-T-A p.His281Leu missense AAGAB 2 82860 2.41371E-5 41430 0 NA
15-67495923-G-A p.Thr278Met missense AAGAB 8 82796 9.6623E-5 41398 1 6.25E-4
15-67495925-C-A p.Ala277Ala synonymous AAGAB 6 82784 7.24778E-5 41392 0 0.00151515
15-67495926-G-A p.Ala277Val missense AAGAB 12 82756 1.45005E-4 41378 0 0.00100908
15-67495937-TA-T c.821-3delT splice_region AAGAB 2 82684 2.41885E-5 41342 1 NA
15-67495938-A-AG c.821-4_821-3insC splice_region AAGAB 1 82640 1.21007E-5 41320 0 NA
15-67495940-G-T c.821-5C>A splice_region AAGAB 2 82612 2.42096E-5 41306 0 2.55999E-5
15-67495940-G-A c.821-5C>T splice_region AAGAB 2 82612 2.42096E-5 41306 0 NA
15-67496398-C-G p.Lys268Asn missense AAGAB 2 82560 2.42248E-5 41280 0 NA
15-67496404-A-G p.Phe266Phe synonymous AAGAB 1 82636 1.21013E-5 41318 0 5.86225E-5
15-67496408-A-G p.Leu265Pro missense AAGAB 3 82674 3.62871E-5 41337 0 NA
15-67496427-C-A p.Val259Leu missense AAGAB 2 82758 2.41668E-5 41379 0 3.18471E-5
15-67496448-G-T p.Leu252Ile missense AAGAB 3 82738 3.6259E-5 41369 0 8.31559E-6
15-67496454-C-G p.Ala250Pro missense AAGAB 1 82666 1.20969E-5 41333 0 6.36983E-5
15-67496458-T-A p.Glu248Asp missense AAGAB 19 82610 2.29996E-4 41305 0 5.03525E-4
15-67496461-T-C p.Gln247Gln synonymous AAGAB 1 82576 1.21101E-5 41288 0 8.32861E-6
15-67496480-A-G p.Met241Thr missense AAGAB 1 82278 1.21539E-5 41139 0 3.2306E-5
15-67496481-TG-T p.Met241fs frameshift AAGAB 1 82256 1.21572E-5 41128 0 NA
15-67500893-A-C c.715+7T>G splice_region AAGAB 1 83022 1.2045E-5 41511 0 NA
15-67500905-A-G p.Ile237Thr missense AAGAB 1 83162 1.20247E-5 41581 0 4.00895E-6
15-67500908-C-A p.Ser236Ile missense AAGAB 1 83198 1.20195E-5 41599 0 NA
15-67500919-G-A p.Ala232Ala synonymous AAGAB 13 83280 1.561E-4 41640 0 2.40496E-4
15-67500921-C-G p.Ala232Pro missense AAGAB 1 83292 1.2006E-5 41646 0 NA
15-67500922-A-G p.Asp231Asp synonymous AAGAB 1 83294 1.20057E-5 41647 0 NA
15-67500922-A-T p.Asp231Glu missense AAGAB 1 83294 1.20057E-5 41647 0 NA
15-67500933-T-C p.Asn228Asp missense AAGAB 252 83296 0.00302536 41648 1 0.00595503
15-67500941-C-T p.Gly225Asp missense AAGAB 21 83324 2.52028E-4 41662 0 1.16029E-4
15-67500946-C-T p.Arg223Arg synonymous AAGAB 91 83326 0.0010921 41663 1 0.0034582
15-67500946-CC-TT p.Arg223Gln missense AAGAB 1 83324 1.20013E-5 41662 0 NA
15-67500947-C-T p.Arg223Gln missense AAGAB 11 83326 1.32012E-4 41663 0 2.54728E-4
15-67500947-C-G p.Arg223Pro missense AAGAB 4 83326 4.80042E-5 41663 0 2.00361E-5
15-67500957-A-G p.Ser220Pro missense AAGAB 54 83326 6.48057E-4 41663 0 9.87198E-4
15-67500961-G-A p.Ser218Ser synonymous AAGAB 7 83328 8.40054E-5 41664 0 0.00251762
15-67500974-T-C p.Asp214Gly missense AAGAB 1 83326 1.20011E-5 41663 0 3.31565E-5
15-67500977-GC-AG p.Ala213Leu missense AAGAB 36 83314 4.321E-4 41657 0 NA
15-67500977-G-A p.Ala213Val missense AAGAB 2 83314 2.40056E-5 41657 0 4.64253E-4
15-67500978-C-G p.Ala213Pro missense AAGAB 2 83310 2.40067E-5 41655 0 4.64245E-4
15-67500978-C-T p.Ala213Thr missense AAGAB 1 83310 1.20034E-5 41655 0 8.29009E-6
15-67500980-G-T p.Ala212Glu missense AAGAB 1 83300 1.20048E-5 41650 0 NA
15-67500993-G-A p.Pro208Ser missense AAGAB 21 83242 2.52276E-4 41621 0 0.00151057
15-67500996-G-GCT c.619-1_619insAG splice_acceptor AAGAB 2 83242 2.40263E-5 41621 1 NA
15-67500998-T-TCTGG c.619-3_619-2insCCAG splice_region AAGAB 6 83222 7.20963E-5 41611 2 NA
15-67500998-T-TCTGGGTGACAGGGATCTGCTGACCCAATGCTATGGTTTGTTCCA c.619-3_619-2insTGGAACAAACCATAGCATTGGGTCAGCAGATCCCTGTCACCCAG splice_region AAGAB 3 83222 3.60482E-5 41611 1 NA
15-67501815-A-G p.Asp201Asp synonymous AAGAB 1 83064 1.20389E-5 41532 0 NA
15-67501834-T-C p.His195Arg missense AAGAB 1 83102 1.20334E-5 41551 0 3.1839E-5
15-67501853-A-G p.Ser189Pro missense AAGAB 1 83074 1.20375E-5 41537 0 NA
15-67501882-T-C p.Asp179Gly missense+splice_region AAGAB 2 82876 2.41324E-5 41438 0 8.03135E-6
15-67501883-C-CATTCTTCATCACTACATTGGACCACACATTGGCATTCAGGGCT c.536-2_536-1insAGCCCTGAATGCCAATGTGTGGTCCAATGTAGTGATGAAGAAT splice_acceptor AAGAB 1 82866 1.20677E-5 41433 0 NA
15-67519296-G-T n.559-8C>A splice_region AAGAB 6 3860 0.0015544 1930 0 0.00420704
15-67524148-T-C c.535+4A>G splice_region AAGAB 1 82408 1.21347E-5 41204 0 3.1841E-5
15-67524151-C-T c.535+1G>A splice_donor AAGAB 1 82446 1.21292E-5 41223 0 4.00901E-6
15-67524151-C-CCATT p.Asp179fs frameshift AAGAB 4 82446 4.85166E-5 41223 0 NA
15-67524151-C-G c.535+1G>C splice_donor AAGAB 1 82446 1.21292E-5 41223 0 NA
15-67524153-A-G p.Asn178Asn splice_region+synonymous AAGAB 1 82494 1.21221E-5 41247 0 NA
15-67524161-T-C p.Met176Val missense AAGAB 5 82604 6.05298E-5 41302 0 3.18431E-5
15-67524168-A-C p.Asn173Lys missense AAGAB 1 82654 1.20986E-5 41327 0 NA
15-67524169-T-C p.Asn173Ser missense AAGAB 2 82674 2.41914E-5 41337 0 1.20221E-5
15-67524170-T-A p.Asn173Tyr missense AAGAB 1 82714 1.20899E-5 41357 0 2.80514E-5
15-67524180-A-T p.Asn169Lys missense AAGAB 1 82754 1.2084E-5 41377 0 5.20929E-5
15-67524181-T-C p.Asn169Ser missense AAGAB 1 82776 1.20808E-5 41388 0 8.28034E-6
15-67524192-G-T p.Ala165Ala synonymous AAGAB 4 82828 4.82928E-5 41414 0 8.28048E-6
15-67524194-C-T p.Ala165Thr missense AAGAB 1 82830 1.20729E-5 41415 0 1.60294E-5
15-67524196-T-C p.Gln164Arg missense AAGAB 1 82832 1.20726E-5 41416 0 4.00725E-6
15-67524205-C-T p.Arg161Gln missense AAGAB 1 82784 1.20796E-5 41392 0 3.18492E-5
15-67524206-G-A p.Arg161* stop_gained AAGAB 1 82752 1.20843E-5 41376 0 8.28048E-6
15-67524213-TC-T p.Gly158fs frameshift AAGAB 2 82742 2.41715E-5 41371 0 8.28048E-6
15-67524220-G-C p.Ser156Cys missense AAGAB 6 82656 7.259E-5 41328 0 4.40825E-5
15-67524222-T-C p.Glu155Glu synonymous AAGAB 1 82620 1.21036E-5 41310 0 NA
15-67524223-T-C p.Glu155Gly missense AAGAB 2 82630 2.42043E-5 41315 0 NA
15-67524230-A-ATTTTTCATATAC p.Asp152_Phe153insValTyrGluLys conservative_inframe_insertion AAGAB 1 82514 1.21192E-5 41257 0 NA
15-67524235-T-TCATCCTCCTCAGGCAACTCCTCTGGA c.452-1_452insTCCAGAGGAGTTGCCTGAGGAGGATG splice_acceptor AAGAB 5 82446 6.06458E-5 41223 2 NA
15-67524236-C-CA c.452-2_452-1insT splice_acceptor AAGAB 2 82436 2.42612E-5 41218 1 NA
15-67528310-CACTT-C c.451+3_451+6delAAGT splice_region AAGAB 2 82324 2.42943E-5 41162 0 1.65752E-5
15-67528316-C-G c.451+1G>C splice_donor AAGAB 1 82396 1.21365E-5 41198 0 3.18471E-5
15-67528321-C-T p.Glu149Glu synonymous AAGAB 1 82482 1.21239E-5 41241 0 3.18492E-5
15-67528326-C-T p.Glu148Lys missense AAGAB 1 82524 1.21177E-5 41262 0 NA
15-67528351-T-C p.Val139Val synonymous AAGAB 1 82700 1.20919E-5 41350 0 4.01188E-6
15-67528353-C-T p.Val139Ile missense AAGAB 76 82686 9.1914E-4 41343 0 0.0075
15-67528360-A-G p.Phe136Phe synonymous AAGAB 248 82708 0.0029985 41354 1 0.00592394
15-67528363-G-A p.Gly135Gly synonymous AAGAB 2 82708 2.41815E-5 41354 0 2.00581E-5
15-67528365-C-G p.Gly135Arg missense AAGAB 1 82702 1.20916E-5 41351 0 NA
15-67528370-T-C p.Lys133Arg missense AAGAB 1 82708 1.20907E-5 41354 0 NA
15-67528374-T-G p.Ile132Leu missense AAGAB 26340 82116 0.320766 41058 4645 0.4675
15-67528384-T-C p.Gln128Gln synonymous AAGAB 3 82726 3.62643E-5 41363 0 3.1835E-5
15-67528384-T-G p.Gln128His missense AAGAB 1 82726 1.20881E-5 41363 0 NA
15-67528397-C-T p.Arg124Gln missense AAGAB 1 82612 1.21048E-5 41306 0 3.31455E-5
15-67528398-G-A p.Arg124* stop_gained AAGAB 3 82606 3.6317E-5 41303 0 6.38284E-5
15-67528403-A-T p.Ile122Lys missense AAGAB 1 82598 1.21068E-5 41299 0 NA
15-67528404-T-C p.Ile122Val missense+splice_region AAGAB 2 82548 2.42283E-5 41274 0 1.40913E-4
15-67528406-C-A p.Gly121Val missense+splice_region AAGAB 1 82524 1.21177E-5 41262 0 5.03525E-4
15-67528407-C-CATCTTCAGACACTCTATCGCAGACCAAGATCATCACCTCAGG c.362-2_362-1insCCTGAGGTGATGATCTTGGTCTGCGATAGAGTGTCTGAAGAT splice_acceptor AAGAB 4 82540 4.84614E-5 41270 2 NA
15-67528748-T-C p.Asp120Gly missense+splice_region AAGAB 2 83258 2.40217E-5 41629 0 8.28528E-6
15-67528764-C-T p.Asp115Asn missense AAGAB 11 83286 1.32075E-4 41643 0 1.73979E-4
15-67528764-C-G p.Asp115His missense AAGAB 4 83286 4.80273E-5 41643 0 NA
15-67528765-G-A p.Cys114Cys synonymous AAGAB 2 83280 2.40154E-5 41640 0 4.00792E-6
15-67528778-A-T p.Met1? start_lost AAGAB 374 83282 0.00449077 41641 1 0.00566843
15-67528778-A-G p.Met1? start_lost AAGAB 2 83288 2.40131E-5 41644 0 4.14209E-5
15-67528782-C-T p.Val109Met missense AAGAB 1 83284 1.20071E-5 41642 0 NA
15-67528794-A-G p.Trp105Arg missense AAGAB 2 83254 2.40229E-5 41627 0 8.28583E-6
15-67528795-T-C p.Ala104Ala synonymous AAGAB 3 83270 3.60274E-5 41635 0 1.32272E-4
15-67528797-C-T p.Ala104Thr missense AAGAB 1 83250 1.2012E-5 41625 0 5.03525E-4
15-67528801-T-C p.Ala102Ala synonymous AAGAB 13 83250 1.56156E-4 41625 0 9.94431E-5
15-67528802-G-T p.Ala102Glu missense AAGAB 1 83242 1.20132E-5 41621 0 NA
15-67528804-C-A c.-25G>T 5_prime_UTR_premature_start_codon_gain AAGAB 4 83248 4.80492E-5 41624 0 8.01873E-6
15-67528807-T-C p.Pro100Pro synonymous AAGAB 1 83226 1.20155E-5 41613 0 NA
15-67528816-T-C p.Ser97Ser synonymous AAGAB 1 83144 1.20273E-5 41572 0 2.00521E-5
15-67528819-G-A p.Ser96Ser synonymous AAGAB 1 83124 1.20302E-5 41562 0 NA
15-67528826-C-T p.Ser94Asn missense AAGAB 1 83068 1.20383E-5 41534 0 NA
15-67528833-G-C p.Leu92Val missense AAGAB 8 83012 9.63716E-5 41506 0 4.97669E-5
15-67528837-C-T p.Ser90Ser synonymous AAGAB 1 82962 1.20537E-5 41481 0 3.61469E-5
15-67528838-G-A p.Ser90Leu missense AAGAB 1 82946 1.2056E-5 41473 0 1.65989E-5
15-67528840-T-C p.Lys89Lys splice_region+synonymous AAGAB 3 82932 3.61742E-5 41466 0 NA
15-67528842-TCTAGAGGGAACAAAAAATATAAACAAACAAAAACAGAAAAGAGATAGTCAGACAAAATGTAATGGGAAAAAAAGAAGGCATGCAATAATTTCTTATTCAAGCCTTCATAGAAAACAAAGTCTTAC-T c.264+1_265-1del splice_acceptor AAGAB 13 82906 1.56804E-4 41453 6 NA
15-67528849-G-C c.265-7C>G splice_region AAGAB 1 82800 1.20773E-5 41400 0 NA
15-67528850-G-A c.265-8C>T splice_region AAGAB 1 82758 1.20834E-5 41379 0 NA
15-67528971-T-G p.Thr87Thr synonymous AAGAB 2 82970 2.41051E-5 41485 0 8.08133E-6
15-67528989-C-T p.Val81Val synonymous AAGAB 2 83082 2.40726E-5 41541 0 NA
15-67528996-G-A p.Ala79Val missense AAGAB 1 83110 1.20322E-5 41555 0 8.02755E-6
15-67529013-A-C p.Ile73Met missense AAGAB 2 83152 2.40523E-5 41576 0 NA
15-67529014-A-G p.Ile73Thr missense AAGAB 1 83156 1.20256E-5 41578 0 NA
15-67529026-A-T p.Val69Asp missense AAGAB 1 83174 1.2023E-5 41587 0 NA
15-67529032-A-T p.Phe67Tyr missense AAGAB 2 83166 2.40483E-5 41583 0 NA
15-67529034-T-C p.Lys66Lys synonymous AAGAB 3 83164 3.60733E-5 41582 0 4.14731E-5
15-67529042-G-A p.Pro64Ser missense AAGAB 3 83170 3.60707E-5 41585 0 NA
15-67529043-C-T p.Val63Val synonymous AAGAB 2 83172 2.40466E-5 41586 0 NA
15-67529050-C-T p.Cys61Tyr missense AAGAB 2 83172 2.40466E-5 41586 0 1.20294E-5
15-67529050-C-A p.Cys61Phe missense AAGAB 1 83172 1.20233E-5 41586 0 NA
15-67529051-A-G p.Cys61Arg missense AAGAB 1 83176 1.20227E-5 41588 0 NA
15-67529052-T-C c.-148A>G 5_prime_UTR_premature_start_codon_gain AAGAB 1 83172 1.20233E-5 41586 0 3.18471E-5
15-67529055-A-AT p.Asn59fs frameshift AAGAB 2 83176 2.40454E-5 41588 0 4.00972E-6
15-67529059-A-C p.Ile58Ser missense AAGAB 1 83172 1.20233E-5 41586 0 8.29036E-6
15-67529060-T-C p.Ile58Val missense AAGAB 1 83174 1.2023E-5 41587 0 8.01976E-6
15-67529071-T-C p.Tyr54Cys missense AAGAB 13 83142 1.56359E-4 41571 0 3.1837E-4
15-67529077-T-G p.Lys52Thr missense AAGAB 1 83158 1.20253E-5 41579 0 4.01468E-6
15-67529082-A-G p.Asp50Asp synonymous AAGAB 3 83150 3.60794E-5 41575 0 NA
15-67529086-A-G p.Ile49Thr missense AAGAB 2 83150 2.40529E-5 41575 0 1.65843E-5
15-67529092-C-T p.Trp47* stop_gained AAGAB 1 83118 1.20311E-5 41559 0 NA
15-67529094-G-C p.Pro46Pro synonymous AAGAB 58 83110 6.9787E-4 41555 0 3.86486E-4
15-67529095-G-T p.Pro46His missense AAGAB 1 83100 1.20337E-5 41550 0 NA
15-67529116-T-C p.Asn39Ser missense AAGAB 25 83062 3.0098E-4 41531 0 5.09619E-4
15-67529118-G-A p.Ser38Ser synonymous AAGAB 150 83054 0.00180605 41527 0 0.00254891
15-67529118-G-T p.Ser38Ser synonymous AAGAB 1 83058 1.20398E-5 41529 0 NA
15-67529121-A-G p.Thr37Thr synonymous AAGAB 1 83042 1.20421E-5 41521 0 8.33361E-6
15-67529122-G-A p.Thr37Ile missense AAGAB 2 83030 2.40877E-5 41515 0 8.33403E-6
15-67529132-C-T p.Val34Met missense AAGAB 35 82962 4.2188E-4 41481 0 3.7324E-4
15-67529142-T-C p.Glu30Glu synonymous AAGAB 1 82928 1.20587E-5 41464 0 1.69225E-5
15-67529154-G-C p.Ile26Met missense AAGAB 3 82762 3.62485E-5 41381 0 3.18695E-5
15-67529156-T-C p.Ile26Val missense+splice_region AAGAB 3 82730 3.62625E-5 41365 0 3.42583E-5
15-67529158-T-TGTTGGACCAGCTGGTCTCCTGAGAAGACGGAGGAGCAGCTGGTGACTAACGCA c.74-1_74insTGCGTTAGTCACCAGCTGCTCCTCCGTCTTCTCAGGAGACCAGCTGGTCCAAC splice_acceptor AAGAB 2 82720 2.41779E-5 41360 1 NA
15-67546753-T-G c.-256A>C splice_region AAGAB 1 44364 2.25408E-5 22182 0 NA
15-67546819-G-C c.-322C>G 5_prime_UTR_premature_start_codon_gain AAGAB 36 63358 5.682E-4 31679 0 0.00178367
15-67546874-G-A c.-377C>T 5_prime_UTR_premature_start_codon_gain AAGAB 3 74620 4.02037E-5 37310 0 8.1493E-5
15-67546898-T-A p.Gln24His missense+splice_region AAGAB 1 77552 1.28946E-5 38776 0 NA
15-67546903-C-T p.Val23Ile missense AAGAB 1 77702 1.28697E-5 38851 0 NA
15-67546905-A-G p.Leu22Pro missense AAGAB 1 77928 1.28324E-5 38964 0 NA
15-67546906-G-A c.-409C>T 5_prime_UTR_premature_start_codon_gain AAGAB 2 77892 2.56766E-5 38946 0 5.09684E-4
15-67546908-T-G p.Gln21Pro missense AAGAB 2 78098 2.56088E-5 39049 0 NA
15-67546916-T-G p.Ser18Ser synonymous AAGAB 1 78310 1.27698E-5 39155 0 NA
15-67546919-G-A p.Phe17Phe synonymous AAGAB 10 78394 1.27561E-4 39197 0 5.41263E-4
15-67546920-A-G p.Phe17Ser missense AAGAB 1 78388 1.27571E-5 39194 0 1.24676E-5
15-67546928-G-A p.Ser14Ser synonymous AAGAB 2 78522 2.54706E-5 39261 0 1.20106E-5
15-67546929-G-A p.Ser14Phe missense AAGAB 1 78380 1.27584E-5 39190 0 3.18532E-5
15-67546934-G-C p.Ser12Arg missense AAGAB 1 78552 1.27304E-5 39276 0 NA
15-67546935-C-T p.Ser12Asn missense AAGAB 6 78540 7.63942E-5 39270 0 3.18471E-5
15-67546937-G-A p.Thr11Thr synonymous AAGAB 2 78660 2.54259E-5 39330 0 3.18532E-5
15-67546946-C-G p.Ala8Ala synonymous AAGAB 1 78668 1.27116E-5 39334 0 NA
15-67546946-C-T p.Ala8Ala synonymous AAGAB 3 78668 3.81349E-5 39334 0 3.18471E-5
15-67546947-G-A p.Ala8Val missense AAGAB 5 78524 6.36748E-5 39262 0 5.10725E-4
15-67546947-G-C p.Ala8Gly missense AAGAB 1 78524 1.2735E-5 39262 0 NA
15-67546952-G-A c.-455C>T 5_prime_UTR_premature_start_codon_gain AAGAB 1 78812 1.26884E-5 39406 0 NA
15-67546953-G-A p.Pro6Leu missense AAGAB 2 78712 2.54091E-5 39356 0 5.09009E-5
15-67546954-G-C p.Pro6Ala missense AAGAB 9 78622 1.14472E-4 39311 0 2.54923E-4
15-67546957-C-G p.Val5Leu missense AAGAB 1 78322 1.27678E-5 39161 0 3.95392E-5
15-67546957-CGCCAGCAGCCATA-C p.Met1fs frameshift AAGAB 1 78322 1.27678E-5 39161 0 NA
15-67546961-A-G p.Ala3Ala synonymous AAGAB 617 78350 0.00787492 39175 21 0.0149097
15-67546961-A-T p.Ala3Ala synonymous AAGAB 1 78396 1.27558E-5 39198 0 NA
15-67546962-G-A p.Ala3Val missense AAGAB 1 78236 1.27818E-5 39118 0 3.18512E-5
15-67546965-G-A p.Ala2Val missense AAGAB 1 78680 1.27097E-5 39340 0 NA
15-67546965-G-C p.Ala2Gly missense AAGAB 1 78680 1.27097E-5 39340 0 2.80907E-5
15-67546966-C-T p.Ala2Thr missense AAGAB 4 78826 5.07447E-5 39413 0 6.37308E-5
15-67546969-T-C p.Met1? start_lost AAGAB 9 78776 1.14248E-4 39388 0 6.37267E-5
15-67546973-T-A c.-4A>T 5_prime_UTR_premature_start_codon_gain AAGAB 2 78354 2.55252E-5 39177 0 2.94023E-5
15-67546993-G-A c.-24C>T 5_prime_UTR_premature_start_codon_gain AAGAB 4 80318 4.9802E-5 40159 0 5.89032E-5
15-67546997-G-A c.-28C>T 5_prime_UTR_premature_start_codon_gain AAGAB 3 80378 3.73236E-5 40189 0 3.68283E-5
15-67547051-G-A c.-82C>T 5_prime_UTR_premature_start_codon_gain AAGAB 1 79000 1.26582E-5 39500 0 NA
15-67547468-G-T c.-255+7C>A splice_region AAGAB 1 58852 1.69918E-5 29426 0 NA
15-67547470-C-T c.-255+5G>A splice_region AAGAB 1 58392 1.71256E-5 29196 0 NA
15-67547475-C-T c.-255G>A splice_region AAGAB 2 57162 3.49883E-5 28581 0 3.18715E-5
15-67547477-T-A c.-257A>T 5_prime_UTR_premature_start_codon_gain AAGAB 1 56652 1.76516E-5 28326 0 NA
15-67547524-T-A c.-304A>T 5_prime_UTR_premature_start_codon_gain AAGAB 2 43878 4.55809E-5 21939 0 NA