Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
12-125549953-G-T c.-178G>T 5_prime_UTR_premature_start_codon_gain AACS 1 50214 1.99148E-5 25107 0 NA
12-125549960-A-T c.-171A>T 5_prime_UTR_premature_start_codon_gain AACS 2 52888 3.78158E-5 26444 0 3.21192E-5
12-125549976-C-T c.-155C>T 5_prime_UTR_premature_start_codon_gain AACS 2 57434 3.48226E-5 28717 0 3.21254E-5
12-125549992-C-G c.-139C>G 5_prime_UTR_premature_start_codon_gain AACS 1 63790 1.56764E-5 31895 0 3.21316E-5
12-125550032-C-T c.-99C>T 5_prime_UTR_premature_start_codon_gain AACS 1 70324 1.42199E-5 35162 0 NA
12-125550037-C-T c.-94C>T 5_prime_UTR_premature_start_codon_gain AACS 2 70792 2.82518E-5 35396 0 NA
12-125550114-G-T c.-17G>T 5_prime_UTR_premature_start_codon_gain AACS 2 77470 2.58164E-5 38735 0 NA
12-125550119-C-CCCG c.-3_-1dupGCC start_lost AACS 3 77534 3.86927E-5 38767 0 1.85E-5
12-125550131-A-G p.Met1? start_lost AACS 1 77780 1.28568E-5 38890 0 1.59663E-4
12-125550133-G-T p.Met1? start_lost AACS 1 77840 1.28469E-5 38920 0 6.26881E-5
12-125550147-G-GC p.Gly8fs frameshift AACS 2 77950 2.56575E-5 38975 0 NA
12-125550164-A-G p.Ile12Val missense AACS 1 78102 1.28038E-5 39051 0 3.19407E-5
12-125550166-C-T p.Ile12Ile synonymous AACS 5 78156 6.39746E-5 39078 0 2.55265E-4
12-125550167-C-T p.Leu13Leu synonymous AACS 1 78166 1.27933E-5 39083 0 NA
12-125550171-A-T p.Glu14Val missense AACS 2 78160 2.55885E-5 39080 0 1.59653E-4
12-125550174-G-A p.Cys15Tyr missense AACS 1 78168 1.2793E-5 39084 0 NA
12-125550178-G-C p.Gln16His missense AACS 2 78192 2.55781E-5 39096 0 NA
12-125550181-G-T p.Val17Val synonymous AACS 1 78208 1.27864E-5 39104 0 NA
12-125550184-G-GT p.Trp19fs frameshift AACS 5 78220 6.39223E-5 39110 0 5.20562E-5
12-125550190-G-A p.Glu20Glu synonymous AACS 9 78236 1.15037E-4 39118 0 3.1904E-5
12-125550196-CAGTA-C p.Ser23fs frameshift AACS 1 78274 1.27756E-5 39137 0 NA
12-125550199-TAAG-T p.Lys25del disruptive_inframe_deletion AACS 2 78286 2.55474E-5 39143 0 7.33275E-5
12-125550207-A-G p.Asn26Ser missense AACS 23 78284 2.93802E-4 39142 0 7.02113E-4
12-125550210-C-A p.Thr27Lys missense AACS 1 78258 1.27782E-5 39129 0 NA
12-125550219-AC-A p.Arg31fs frameshift AACS 6 78240 7.66871E-5 39120 0 1.34372E-5
12-125550228-G-A p.Arg33Gln missense AACS 1 78212 1.27858E-5 39106 0 6.89237E-6
12-125550232-G-A p.Ala34Ala synonymous AACS 12 78176 1.535E-4 39088 0 2.5531E-4
12-125550233-G-T p.Ala35Ser missense AACS 2 78166 2.55866E-5 39083 0 NA
12-125550236-G-A p.Val36Met missense AACS 2 78162 2.55879E-5 39081 0 NA
12-125550238-G-A p.Val36Val synonymous AACS 2 78150 2.55918E-5 39075 0 5.55309E-5
12-125550246-C-T p.Ala39Val missense AACS 2 78082 2.56141E-5 39041 0 NA
12-125550263-G-A p.Glu45Lys missense+splice_region AACS 1 77960 1.28271E-5 38980 0 7.55424E-6
12-125558450-C-T p.Ser54Ser synonymous AACS 3 82966 3.61594E-5 41483 0 7.9571E-6
12-125558451-G-A p.Val55Ile missense AACS 2 82978 2.41028E-5 41489 0 6.59055E-5
12-125558478-G-A p.Glu64Lys missense AACS 6 83074 7.22248E-5 41537 0 3.97747E-6
12-125558486-G-T p.Trp66Cys missense AACS 1 83054 1.20404E-5 41527 0 3.29511E-5
12-125558509-C-T p.Ser74Leu missense AACS 1 82968 1.20528E-5 41484 0 NA
12-125558511-C-A p.Arg75Ser missense AACS 2 82922 2.41191E-5 41461 0 8.2409E-6
12-125558512-G-A p.Arg75His missense AACS 3 82950 3.61664E-5 41475 0 3.18471E-5
12-125558528-A-G c.237+3A>G splice_region AACS 1 82750 1.20846E-5 41375 0 NA
12-125558531-T-G c.237+6T>G splice_region AACS 1 82668 1.20966E-5 41334 0 4.0516E-6
12-125561033-A-G c.238-4A>G splice_region AACS 2 83340 2.39981E-5 41670 0 3.18471E-5
12-125561037-G-C p.Val80Leu missense+splice_region AACS 1 83364 1.19956E-5 41682 0 NA
12-125561050-C-T p.Ser84Leu missense AACS 10 83384 1.19927E-4 41692 0 0.00125
12-125561051-G-A p.Ser84Ser synonymous AACS 4 83390 4.79674E-5 41695 0 8.23791E-6
12-125561054-A-C p.Lys85Asn missense AACS 2 83388 2.39843E-5 41694 0 7.95305E-6
12-125561060-C-T p.Ile87Ile synonymous AACS 9 83392 1.07924E-4 41696 0 6.25E-4
12-125561061-G-A p.Ala88Thr missense AACS 1 83380 1.19933E-5 41690 0 4.11834E-5
12-125561072-C-T p.Pro91Pro synonymous AACS 6 83400 7.19424E-5 41700 0 0.00100705
12-125561073-G-A p.Glu92Lys missense AACS 1 83398 1.19907E-5 41699 0 3.29457E-5
12-125561080-TCAAAGGCAGTCGGCTCAACTATGCA-T p.Phe94fs frameshift AACS 1 83404 1.19898E-5 41702 0 NA
12-125561085-G-T p.Gly96Cys missense AACS 1 83406 1.19895E-5 41703 0 1.74957E-4
12-125561088-A-G p.Ser97Gly missense AACS 2 83400 2.39808E-5 41700 0 3.18451E-5
12-125561091-C-T p.Arg98Trp missense AACS 9 83394 1.07921E-4 41697 0 6.25E-4
12-125561092-G-A p.Arg98Gln missense AACS 2 83396 2.3982E-5 41698 0 NA
12-125561095-T-C p.Leu99Pro missense AACS 1 83396 1.1991E-5 41698 0 NA
12-125561098-A-G p.Asn100Ser missense AACS 4 83396 4.79639E-5 41698 0 7.95273E-6
12-125561102-T-C p.Tyr101Tyr synonymous AACS 1 83398 1.19907E-5 41699 0 8.23642E-6
12-125561118-C-A p.Arg107Arg synonymous AACS 1135 83372 0.0136137 41686 42 0.0242978
12-125561118-C-T p.Arg107Trp missense AACS 1 83384 1.19927E-5 41692 0 3.18451E-5
12-125561128-A-G p.Glu110Gly missense AACS 1 83388 1.19921E-5 41694 0 3.97633E-6
12-125561149-A-T p.Tyr117Phe missense AACS 1 83344 1.19985E-5 41672 0 8.23791E-6
12-125561151-A-G p.Ile118Val missense AACS 14856 83114 0.178742 41557 1450 0.238143
12-125561155-C-G p.Ala119Gly missense+splice_region AACS 2 83342 2.39975E-5 41671 0 3.97712E-6
12-125561156-A-G p.Ala119Ala splice_region+synonymous AACS 1 83334 1.19999E-5 41667 0 NA
12-125561157-A-AG c.358_358+1insG splice_donor AACS 2 83332 2.40004E-5 41666 1 NA
12-125561158-G-GGGAAGGCAAAGAGGAAATTGTGAAGGTGACTTT c.358+1_358+2insGGAAGGCAAAGAGGAAATTGTGAAGGTGACTTT splice_donor AACS 4 83336 4.79985E-5 41668 2 NA
12-125561158-G-GGGAAGGCAAAGAGGAAATTGTGAAGGTGACTTTTGAAGAGC c.358+1_358+2insGGAAGGCAAAGAGGAAATTGTGAAGGTGACTTTTGAAGAGC splice_donor AACS 4 83336 4.79985E-5 41668 2 NA
12-125561158-G-A c.358+1G>A splice_donor AACS 2 83336 2.39992E-5 41668 0 3.97706E-6
12-125562664-C-T p.His127His synonymous AACS 2 9568 2.0903E-4 4784 0 3.1841E-5
12-125562784-C-T p.Thr167Thr synonymous AACS 1213 9564 0.12683 4782 100 0.176404
12-125562788-A-T p.Thr169Ser missense AACS 3 9574 3.13349E-4 4787 0 1.27421E-4
12-125562809-G-A p.Gly176Arg missense AACS 9519 9560 0.995711 4780 4740 1.0
12-125562844-C-T p.Ser187Ser synonymous AACS 9 9570 9.40439E-4 4785 0 5.41539E-4
12-125562892-C-T p.Asn203Asn synonymous AACS 1169 9276 0.126024 4638 14 0.206118
12-125562897-C-T p.Ser205Leu missense AACS 1 9528 1.04954E-4 4764 0 2.86569E-4
12-125570872-C-T c.359-4C>T splice_region AACS 1 83336 1.19996E-5 41668 0 NA
12-125570884-A-G p.Lys123Glu missense AACS 2 83380 2.39866E-5 41690 0 NA
12-125570893-A-G p.Ile126Val missense AACS 1 83390 1.19918E-5 41695 0 3.18492E-5
12-125570905-A-G p.Thr130Ala missense AACS 3 83404 3.59695E-5 41702 0 NA
12-125570921-G-A p.Arg135Lys missense AACS 5 83408 5.99463E-5 41704 0 9.8837E-5
12-125570923-C-T p.Gln136* stop_gained AACS 1 83408 1.19893E-5 41704 0 NA
12-125570932-G-C p.Ala139Pro missense AACS 1 83424 1.1987E-5 41712 0 7.95292E-6
12-125570940-T-G p.Phe141Leu missense AACS 2 83422 2.39745E-5 41711 0 8.23642E-6
12-125570957-A-G p.Lys147Arg missense AACS 1 83422 1.19872E-5 41711 0 NA
12-125570962-G-T p.Gly149Cys missense AACS 1 83420 1.19875E-5 41710 0 1.64728E-5
12-125570973-A-C p.Lys152Asn missense AACS 4 83406 4.79582E-5 41703 0 1.91095E-4
12-125570983-G-A p.Val156Ile missense AACS 3 83400 3.59712E-5 41700 0 NA
12-125570993-A-G c.472+4A>G splice_region AACS 1 83352 1.19973E-5 41676 0 NA
12-125575975-A-C p.Tyr159Ser missense AACS 2 83146 2.40541E-5 41573 0 9.55962E-5
12-125575981-C-G p.Pro161Arg missense AACS 2 83178 2.40448E-5 41589 0 NA
12-125575986-A-G p.Ser163Gly missense AACS 1 83204 1.20187E-5 41602 0 2.38681E-5
12-125575988-T-A p.Ser163Arg missense AACS 15 83200 1.80288E-4 41600 0 1.31274E-4
12-125575994-C-T c.-13C>T 5_prime_UTR_premature_start_codon_gain AACS 1 83206 1.20184E-5 41603 0 6.36821E-5
12-125576000-C-T c.-7C>T 5_prime_UTR_premature_start_codon_gain AACS 7 83228 8.41063E-5 41614 0 1.98878E-5
12-125576000-C-G p.Val167Val synonymous AACS 1 83228 1.20152E-5 41614 0 3.18471E-5
12-125576005-C-T p.Ala169Val missense AACS 6 83232 7.20877E-5 41616 0 6.36902E-5
12-125576006-G-A p.Ala169Ala synonymous AACS 2 83232 2.40292E-5 41616 0 1.65109E-5
12-125576007-A-C p.Met170Leu missense AACS 1 83240 1.20135E-5 41620 0 1.65082E-5
12-125576017-C-T p.Ala173Val missense AACS 3 83224 3.60473E-5 41612 0 6.36862E-5
12-125576018-G-A p.Ala173Ala synonymous AACS 1 83224 1.20158E-5 41612 0 8.25382E-6
12-125576019-G-A p.Ala174Thr missense AACS 1 83218 1.20166E-5 41609 0 3.18451E-5
12-125576025-A-G p.Ile176Val missense AACS 2 83218 2.40333E-5 41609 1 7.95463E-6
12-125576047-C-T p.Thr183Met missense AACS 5 83100 6.01685E-5 41550 0 6.3678E-5
12-125576048-G-A p.Thr183Thr synonymous AACS 4 83072 4.8151E-5 41536 0 6.61266E-5
12-125576053-C-T p.Pro185Leu missense AACS 2 83058 2.40796E-5 41529 0 9.55414E-5
12-125576054-G-A p.Pro185Pro synonymous AACS 2 83018 2.40912E-5 41509 0 1.98915E-5
12-125576060-C-T p.Phe187Phe synonymous AACS 2 82928 2.41173E-5 41464 0 5.03525E-4
12-125576061-G-A p.Gly188Ser missense AACS 1 82926 1.20589E-5 41463 0 3.97864E-6
12-125576064-G-A p.Val189Met missense AACS 1 82914 1.20607E-5 41457 0 NA
12-125576065-T-G p.Val189Gly missense AACS 1 82888 1.20645E-5 41444 0 NA
12-125576070-G-GGTGTGCTGGACCGGTTTTCTCAAATTCAGCCAAAGCTCA c.570+1_570+2insGTGTGCTGGACCGGTTTTCTCAAATTCAGCCAAAGCTCA splice_donor AACS 2 82864 2.41359E-5 41432 1 NA
12-125576070-G-A c.570+1G>A splice_donor AACS 2 82864 2.41359E-5 41432 0 8.75657E-5
12-125586054-C-T c.-1144C>T 5_prime_UTR_premature_start_codon_gain AACS 1 154 0.00649351 77 0 8.28289E-4
12-125586605-T-C c.-593T>C 5_prime_UTR_premature_start_codon_gain AACS 13 110 0.118182 55 3 0.527492
12-125586900-C-T c.-298C>T 5_prime_UTR_premature_start_codon_gain AACS 1 4382 2.28206E-4 2191 0 6.37146E-5
12-125586919-C-T c.-279C>T 5_prime_UTR_premature_start_codon_gain AACS 1 5928 1.68691E-4 2964 0 1.27486E-4
12-125586987-G-A c.-211G>A 5_prime_UTR_premature_start_codon_gain AACS 3 21636 1.38658E-4 10818 0 6.38978E-5
12-125587003-C-A c.-195C>A 5_prime_UTR_premature_start_codon_gain AACS 19 27800 6.83453E-4 13900 0 NA
12-125587024-T-G c.-174T>G 5_prime_UTR_premature_start_codon_gain AACS 14 36794 3.80497E-4 18397 0 6.39959E-4
12-125587047-C-T c.-151C>T 5_prime_UTR_premature_start_codon_gain AACS 3 48326 6.20784E-5 24163 0 6.44828E-5
12-125587048-G-A c.-150G>A 5_prime_UTR_premature_start_codon_gain AACS 1 47800 2.09205E-5 23900 0 6.56082E-5
12-125587048-G-T c.-150G>T 5_prime_UTR_premature_start_codon_gain AACS 1 47800 2.09205E-5 23900 0 NA
12-125587109-C-G c.-89C>G 5_prime_UTR_premature_start_codon_gain AACS 1 69382 1.4413E-5 34691 0 3.1904E-5
12-125587218-C-T c.571-7C>T splice_region AACS 2 83162 2.40494E-5 41581 0 3.19122E-5
12-125587220-T-C p.Phe8Ser missense AACS 2 83184 2.40431E-5 41592 0 NA
12-125587225-G-C p.Gly191Arg missense+splice_region AACS 1 83244 1.20129E-5 41622 0 NA
12-125587228-G-A p.Val192Met missense AACS 1 83272 1.20088E-5 41636 0 7.95317E-6
12-125587232-T-C p.Leu193Pro missense AACS 1 83290 1.20062E-5 41645 0 NA
12-125587236-C-T p.Asp194Asp synonymous AACS 8 83300 9.60384E-5 41650 0 0.00251762
12-125587237-C-T p.Arg195Trp missense AACS 4 83304 4.80169E-5 41652 0 4.11855E-5
12-125587238-G-A p.Arg195Gln missense AACS 3 83302 3.60135E-5 41651 0 8.3505E-5
12-125587254-G-T p.Gln200His missense AACS 1 83346 1.19982E-5 41673 0 NA
12-125587258-A-G p.Lys202Glu missense AACS 3 83354 3.59911E-5 41677 0 3.18959E-5
12-125587264-A-G p.Ile204Val missense AACS 1 83362 1.19959E-5 41681 0 NA
12-125587273-G-A p.Val207Met missense AACS 16 83362 1.91934E-4 41681 0 1.1929E-4
12-125587275-G-A p.Val207Val synonymous AACS 2 83358 2.39929E-5 41679 0 NA
12-125587277-A-G p.Glu208Gly missense AACS 2 83362 2.39917E-5 41681 0 NA
12-125587278-G-A p.Glu208Glu synonymous AACS 2069 83326 0.0248302 41663 55 0.0745217
12-125587285-G-A p.Val211Ile missense AACS 10 83354 1.1997E-4 41677 0 5.03525E-4
12-125587290-T-A p.Tyr212* stop_gained AACS 2 83352 2.39946E-5 41676 0 3.19101E-5
12-125587298-A-G p.Lys215Arg missense AACS 24 83352 2.87936E-4 41676 0 9.58466E-5
12-125587303-C-T p.His217Tyr missense AACS 2 83352 2.39946E-5 41676 0 3.19163E-5
12-125587322-T-C p.Leu223Pro missense AACS 1 83316 1.20025E-5 41658 0 NA
12-125587324-C-T p.Gln224* stop_gained AACS 6 83308 7.20219E-5 41654 0 6.3804E-5
12-125587326-G-T p.Gln224His missense AACS 1 83314 1.20028E-5 41657 0 NA
12-125587336-A-G p.Lys228Glu missense AACS 1 83270 1.20091E-5 41635 0 NA
12-125587339-G-T p.Gly229Cys missense+splice_region AACS 1 83262 1.20103E-5 41631 0 3.19244E-5
12-125587340-G-GCCTACCAGACT c.685+1_685+2insCCTACCAGACT splice_donor AACS 2 83242 2.40263E-5 41621 1 NA
12-125587340-G-GCCTACCAGACTTGAAGAAAGTGGTGGTGATTCCTTA c.685+1_685+2insCCTACCAGACTTGAAGAAAGTGGTGGTGATTCCTTA splice_donor AACS 1 83242 1.20132E-5 41621 0 NA
12-125587344-G-A c.685+5G>A splice_region AACS 3 83210 3.60534E-5 41605 0 4.94617E-5
12-125587347-G-A c.685+8G>A splice_region AACS 1 83190 1.20207E-5 41595 0 NA
12-125587538-C-T c.686-8C>T splice_region AACS 1 83240 1.20135E-5 41620 0 NA
12-125587544-A-G c.686-2A>G splice_acceptor AACS 2 83270 2.40183E-5 41635 0 6.42137E-5
12-125587553-A-G p.Pro231Pro synonymous AACS 1 83312 1.20031E-5 41656 0 8.23995E-6
12-125587561-A-C p.Lys234Thr missense AACS 1 83334 1.19999E-5 41667 0 6.59131E-5
12-125587566-G-T p.Val236Leu missense AACS 78 83346 9.35858E-4 41673 1 5.24989E-4
12-125587568-G-A p.Val236Val synonymous AACS 1 83348 1.19979E-5 41674 0 NA
12-125587573-T-C p.Val238Ala missense AACS 1 83348 1.19979E-5 41674 0 3.97722E-6
12-125587593-A-G p.Arg245Gly missense AACS 2 83336 2.39992E-5 41668 0 2.47133E-5
12-125587601-C-T p.Asn247Asn synonymous AACS 2 83312 2.40061E-5 41656 0 3.97741E-6
12-125587603-T-C p.Ile248Thr missense AACS 1 83292 1.2006E-5 41646 0 8.23845E-6
12-125587605-G-A p.Asp249Asn missense AACS 4 83292 4.80238E-5 41646 0 3.97772E-6
12-125587627-GG-TT p.Ser256Ile splice_donor AACS 2 83166 2.40483E-5 41583 0 NA
12-125587632-T-C c.767+5T>C splice_region AACS 1 83106 1.20328E-5 41553 0 1.65049E-5
12-125590262-C-T c.-650C>T 5_prime_UTR_premature_start_codon_gain AACS 4 10 0.4 5 1 0.312947
12-125591662-C-T c.768-5C>T splice_region AACS 8 83042 9.63368E-5 41521 0 3.38166E-4
12-125591668-G-A p.Val257Met missense+splice_region AACS 8 83084 9.62881E-5 41542 0 2.38658E-5
12-125591674-C-G p.Leu259Val missense AACS 2 83088 2.40709E-5 41544 0 4.12052E-5
12-125591678-A-G p.Asp260Gly missense AACS 1 83102 1.20334E-5 41551 0 3.97738E-6
12-125591688-T-A p.Leu263Leu synonymous AACS 1 83144 1.20273E-5 41572 0 NA
12-125591694-C-T c.-544C>T 5_prime_UTR_premature_start_codon_gain AACS 4 83160 4.81E-5 41580 0 6.25E-4
12-125591695-G-A p.Gly266Ser missense AACS 5 83150 6.01323E-5 41575 0 7.15928E-5
12-125591696-G-A p.Gly266Asp missense AACS 1 83138 1.20282E-5 41569 0 3.97728E-6
12-125591698-A-T p.Thr98Ser missense+splice_region AACS 1 83138 1.20282E-5 41569 0 3.977E-6
12-125591710-G-C p.Ala271Pro missense AACS 1 83148 1.20267E-5 41574 0 1.56556E-4
12-125591713-C-T p.Pro272Ser missense AACS 2 83152 2.40523E-5 41576 0 1.19324E-5
12-125591715-G-A p.Pro272Pro synonymous AACS 16 83134 1.9246E-4 41567 0 2.86606E-4
12-125591718-G-C p.Gln273His missense AACS 1 83150 1.20265E-5 41575 0 3.97788E-6
12-125591722-G-A p.Glu275Lys missense AACS 1 83154 1.20259E-5 41577 0 NA
12-125591727-C-T c.-511C>T 5_prime_UTR_premature_start_codon_gain AACS 262 83116 0.00315222 41558 10 0.00527844
12-125591734-C-G p.Leu279Val missense AACS 55 83166 6.61328E-4 41583 0 9.87135E-4
12-125591734-C-T c.-504C>T 5_prime_UTR_premature_start_codon_gain AACS 1 83166 1.20241E-5 41583 0 8.75106E-5
12-125591743-A-G p.Ser282Gly missense AACS 5 83164 6.01222E-5 41582 0 1.64804E-5
12-125591757-C-T p.Phe286Phe synonymous AACS 1 83160 1.2025E-5 41580 0 NA
12-125591758-A-G p.Ile287Val missense AACS 1 83156 1.20256E-5 41578 0 6.25E-4
12-125591772-G-A p.Ser291Ser synonymous AACS 17 83128 2.04504E-4 41564 0 6.6896E-4
12-125591780-C-T p.Thr294Met missense AACS 3 83120 3.60924E-5 41560 0 1.59227E-4
12-125591784-C-T p.Gly295Gly synonymous AACS 20 83082 2.40726E-4 41541 0 7.50218E-4
12-125591784-C-G p.Gly295Gly synonymous AACS 1 83084 1.2036E-5 41542 0 3.98149E-6
12-125591785-G-A p.Ala296Thr missense AACS 1 83070 1.2038E-5 41535 0 3.98248E-6
12-125591797-A-C p.Met300Leu missense AACS 2 83094 2.40691E-5 41547 0 3.18471E-5
12-125591798-T-G p.Met300Arg missense AACS 2 83088 2.40709E-5 41544 0 3.29913E-5
12-125591808-C-T c.-430C>T 5_prime_UTR_premature_start_codon_gain AACS 10 82978 1.20514E-4 41489 1 0.00151057
12-125591809-G-A p.Ala304Thr missense AACS 1 82978 1.20514E-5 41489 0 NA
12-125591815-G-T c.915+1G>T splice_donor AACS 1 82908 1.20616E-5 41454 0 3.99367E-6
12-125598986-A-G c.-174A>G 5_prime_UTR_premature_start_codon_gain AACS 3 77972 3.84754E-5 38986 0 1.75334E-5
12-125598999-C-T c.-161C>T 5_prime_UTR_premature_start_codon_gain AACS 1 80008 1.24988E-5 40004 0 8.10104E-6
12-125599007-C-T c.-153C>T 5_prime_UTR_premature_start_codon_gain AACS 36 81166 4.43535E-4 40583 0 0.00125
12-125599008-G-A c.-152G>A 5_prime_UTR_premature_start_codon_gain AACS 1 81210 1.23138E-5 40605 0 9.38535E-5
12-125599019-G-T c.916-4G>T splice_region AACS 2 81924 2.44129E-5 40962 0 NA
12-125599039-A-C p.His311Pro missense AACS 1 82660 1.20978E-5 41330 0 NA
12-125599040-T-C p.His311His synonymous AACS 1 82664 1.20972E-5 41332 0 NA
12-125599043-G-A p.Leu312Leu synonymous AACS 2 82720 2.41779E-5 41360 0 3.18857E-5
12-125599060-A-C p.His318Pro missense AACS 3 82950 3.61664E-5 41475 0 NA
12-125599061-C-T c.-385C>T 5_prime_UTR_premature_start_codon_gain AACS 7 82962 8.4376E-5 41481 0 9.56694E-5
12-125599062-G-A p.Gly319Ser missense AACS 9 82964 1.08481E-4 41482 0 2.8699E-4
12-125599066-A-G p.Asn320Ser missense AACS 3 83008 3.61411E-5 41504 0 3.18837E-5
12-125599071-A-G p.Thr322Ala missense AACS 21 83010 2.52982E-4 41505 0 6.38081E-4
12-125599102-C-T p.Thr332Met missense+splice_region AACS 1 82924 1.20592E-5 41462 0 4.40384E-5
12-125599103-G-A p.Thr332Thr splice_region+synonymous AACS 1 82904 1.20621E-5 41452 0 8.40675E-6
12-125599111-C-T c.996+8C>T splice_region AACS 2 82800 2.41546E-5 41400 0 6.38121E-5
12-125602832-C-T c.-364C>T 5_prime_UTR_premature_start_codon_gain AACS 1 4952 2.01939E-4 2476 0 NA
12-125602842-C-T c.-354C>T 5_prime_UTR_premature_start_codon_gain AACS 1 6016 1.66223E-4 3008 0 6.37308E-5
12-125602911-G-A c.-285G>A 5_prime_UTR_premature_start_codon_gain AACS 1 20974 4.76781E-5 10487 0 NA
12-125602940-C-T c.-256C>T 5_prime_UTR_premature_start_codon_gain AACS 5 35374 1.41347E-4 17687 0 8.59818E-4
12-125603035-C-T c.-161C>T 5_prime_UTR_premature_start_codon_gain AACS 2 76058 2.62957E-5 38029 0 3.18512E-5
12-125603079-C-A c.-117C>A 5_prime_UTR_premature_start_codon_gain AACS 2 80250 2.49221E-5 40125 0 NA
12-125603081-G-A c.-115G>A 5_prime_UTR_premature_start_codon_gain AACS 1 80326 1.24493E-5 40163 0 NA
12-125603136-G-T c.-60G>T 5_prime_UTR_premature_start_codon_gain AACS 7 82074 8.52889E-5 41037 0 4.30493E-5
12-125603175-C-T c.-21C>T 5_prime_UTR_premature_start_codon_gain AACS 1 82734 1.20869E-5 41367 0 NA
12-125603183-G-T c.997-4G>T splice_region AACS 1 82758 1.20834E-5 41379 0 3.99444E-6
12-125603193-T-C p.Trp335Arg missense AACS 1 82860 1.20685E-5 41430 0 NA
12-125603218-C-A p.Ser343Tyr missense AACS 8 82854 9.65554E-5 41427 0 6.38401E-5
12-125603219-C-T p.Ser343Ser synonymous AACS 10 82858 1.20688E-4 41429 5 NA
12-125603223-C-T c.-306C>T 5_prime_UTR_premature_start_codon_gain AACS 101 82874 0.00121872 41437 1 0.00273885
12-125603236-C-T p.Ala349Val missense AACS 1 82910 1.20613E-5 41455 0 1.67479E-5
12-125603249-G-A p.Leu353Leu synonymous AACS 2 82910 2.41225E-5 41455 0 8.36778E-6
12-125603252-C-T c.-277C>T 5_prime_UTR_premature_start_codon_gain AACS 5 82910 6.03064E-5 41455 0 9.55718E-5
12-125603253-G-A p.Asp355Asn missense AACS 1 82928 1.20587E-5 41464 0 3.98899E-6
12-125603259-T-TC p.Leu359fs frameshift AACS 1 82908 1.20616E-5 41454 0 NA
12-125603263-C-T p.Pro358Leu missense AACS 2 82938 2.41144E-5 41469 0 3.98829E-6
12-125603264-C-T p.Pro358Pro synonymous AACS 6 82902 7.23746E-5 41451 0 2.51143E-5
12-125603264-C-G p.Pro358Pro synonymous AACS 5 82902 6.03122E-5 41451 0 3.98816E-6
12-125603265-C-G p.Leu359Val missense AACS 1 82904 1.20621E-5 41452 0 8.37437E-6
12-125603273-C-T p.Pro361Pro synonymous AACS 1 82928 1.20587E-5 41464 0 NA
12-125603274-A-C p.Thr362Pro missense AACS 10 82920 1.20598E-4 41460 0 0.00352467
12-125603275-C-T p.Thr362Met missense AACS 1 82918 1.20601E-5 41459 0 3.18532E-5
12-125603276-G-A p.Thr362Thr synonymous AACS 3 82918 3.61803E-5 41459 0 9.55475E-5
12-125603277-C-A p.Pro363Thr missense AACS 1 82932 1.20581E-5 41466 0 NA
12-125603279-C-T p.Pro363Pro synonymous AACS 12 82934 1.44693E-4 41467 0 5.03525E-4
12-125603281-A-G p.Asn364Ser missense AACS 3 82932 3.61742E-5 41466 0 1.27389E-4
12-125603281-A-T p.Asn364Ile missense AACS 1 82932 1.20581E-5 41466 0 NA
12-125603285-G-A p.Val365Val synonymous AACS 1 82954 1.20549E-5 41477 0 NA
12-125603310-G-A p.Gly374Ser missense+splice_region AACS 2 82982 2.41016E-5 41491 0 3.1841E-5
12-125603317-T-C c.1121+6T>C splice_region AACS 1 82934 1.20578E-5 41467 0 NA
12-125605791-T-G c.-3600T>G 5_prime_UTR_premature_start_codon_gain AACS 3 58 0.0517241 29 0 0.0905786
12-125606824-C-T c.-2567C>T 5_prime_UTR_premature_start_codon_gain AACS 1 68 0.0147059 34 0 0.0492255
12-125607384-C-T c.-2007C>T 5_prime_UTR_premature_start_codon_gain AACS 1 8 0.125 4 0 0.0240268
12-125608795-T-G c.-596T>G 5_prime_UTR_premature_start_codon_gain AACS 1 168 0.00595238 84 0 0.00200663
12-125608983-C-T c.-408C>T 5_prime_UTR_premature_start_codon_gain AACS 137 22636 0.00605231 11318 0 0.00484323
12-125609001-A-G c.-390A>G 5_prime_UTR_premature_start_codon_gain AACS 1 31820 3.14268E-5 15910 0 NA
12-125609007-C-T c.-384C>T 5_prime_UTR_premature_start_codon_gain AACS 1 34096 2.9329E-5 17048 0 1.27437E-4
12-125609012-C-T c.-379C>T 5_prime_UTR_premature_start_codon_gain AACS 2 37008 5.40424E-5 18504 0 6.37186E-5
12-125609036-G-A c.-355G>A 5_prime_UTR_premature_start_codon_gain AACS 1 47994 2.08359E-5 23997 0 3.18573E-5
12-125609036-G-C c.-355G>C 5_prime_UTR_premature_start_codon_gain AACS 1 47994 2.08359E-5 23997 0 NA
12-125609090-C-T c.-301C>T 5_prime_UTR_premature_start_codon_gain AACS 2 65928 3.03361E-5 32964 0 9.55718E-5
12-125609091-G-C c.-300G>C 5_prime_UTR_premature_start_codon_gain AACS 1 66198 1.51062E-5 33099 0 NA
12-125609103-C-T c.-288C>T 5_prime_UTR_premature_start_codon_gain AACS 2 69698 2.86952E-5 34849 0 NA
12-125609237-C-T c.-154C>T 5_prime_UTR_premature_start_codon_gain AACS 40 83106 4.81313E-4 41553 1 2.22969E-4
12-125609245-C-T c.1122-6C>T splice_region AACS 863 83236 0.0103681 41618 2 0.01309
12-125609252-A-G p.Ile375Val missense+splice_region AACS 2 83320 2.40038E-5 41660 0 4.94234E-5
12-125609255-A-G p.Thr376Ala missense AACS 1 83328 1.20008E-5 41664 0 3.97684E-5
12-125609262-T-G p.Leu378Arg missense AACS 1 83354 1.1997E-5 41677 0 NA
12-125609273-G-T p.Ala382Ser missense AACS 1 83370 1.19947E-5 41685 0 NA
12-125609287-A-G p.Ser386Ser synonymous AACS 1 83384 1.19927E-5 41692 0 NA
12-125609293-G-A p.Leu388Leu synonymous AACS 1 83396 1.1991E-5 41698 0 NA
12-125609299-G-A p.Glu390Glu synonymous AACS 2 83386 2.39848E-5 41693 0 NA
12-125609303-G-T p.Ala392Ser missense AACS 2 83392 2.39831E-5 41696 0 NA
12-125609311-G-T p.Lys394Asn missense AACS 1 83390 1.19918E-5 41695 0 NA
12-125609314-GGGTGAGTGTGCCTCTTCAGTACTCATTCCCTGTACTGCCAATCAAGGAAATTAAATCCATCCTATTTCCTGCTTGCGAGTGAGGCTTCAGGCACTGGGTTTAGTTTTAATCTTTTGGTGACTCTGCACCCCA-G c.1186+1_1187-1del splice_acceptor AACS 4 83388 4.79685E-5 41694 0 NA
12-125609314-G-A p.Pro395Pro splice_region+synonymous AACS 1 83388 1.19921E-5 41694 0 2.47129E-5
12-125609366-T-G c.-102T>G 5_prime_UTR_premature_start_codon_gain AACS 1 83336 1.19996E-5 41668 0 8.35621E-5
12-125609378-A-G c.-90A>G 5_prime_UTR_premature_start_codon_gain AACS 2 83324 2.40027E-5 41662 0 NA
12-125609380-T-G c.-88T>G 5_prime_UTR_premature_start_codon_gain AACS 9 83316 1.08022E-4 41658 0 6.37146E-5
12-125609408-C-T c.-60C>T 5_prime_UTR_premature_start_codon_gain AACS 1 83280 1.20077E-5 41640 0 NA
12-125609416-A-G c.-52A>G 5_prime_UTR_premature_start_codon_gain AACS 3 83282 3.60222E-5 41641 0 3.97988E-6
12-125609440-C-T c.1187-8C>T splice_region AACS 6 83308 7.20219E-5 41654 0 5.76711E-5
12-125609455-C-T p.Thr398Thr synonymous AACS 32 83348 3.83932E-4 41674 0 0.00100705
12-125609458-C-G p.His399Gln missense AACS 1 83356 1.19967E-5 41678 0 9.88549E-5
12-125609459-A-T p.Ser400Cys missense AACS 1 83362 1.19959E-5 41681 0 1.31804E-4
12-125609462-C-T p.Leu401Phe missense AACS 1 83356 1.19967E-5 41678 0 NA
12-125609467-G-C p.Gln402His missense AACS 8 83354 9.59762E-5 41677 0 5.76616E-5
12-125609468-A-G p.Met1? start_lost AACS 1 83354 1.1997E-5 41677 0 3.295E-5
12-125609478-C-T p.Thr406Met missense AACS 4 83364 4.79823E-5 41682 0 3.18132E-5
12-125609479-G-T p.Thr406Thr synonymous AACS 1 83368 1.1995E-5 41684 0 2.47125E-5
12-125609479-G-A p.Thr406Thr synonymous AACS 1 83368 1.1995E-5 41684 0 6.37024E-5
12-125609480-ATCCTG-A p.Leu408fs frameshift AACS 1 83370 1.19947E-5 41685 0 NA
12-125609487-C-A p.Ser409Tyr missense AACS 2 83378 2.39871E-5 41689 0 4.11848E-5
12-125609487-C-T p.Ser409Phe missense AACS 1 83378 1.19936E-5 41689 0 3.97636E-6
12-125609493-G-T p.Gly411Val missense AACS 1 83376 1.19939E-5 41688 0 3.97646E-6
12-125609503-G-A p.Leu414Leu synonymous AACS 1 83372 1.19944E-5 41686 0 3.18471E-5
12-125609529-A-G p.Tyr423Cys missense AACS 1 83370 1.19947E-5 41685 0 3.1841E-5
12-125609534-T-C p.Cys425Arg missense AACS 18 83370 2.15905E-4 41685 0 9.55962E-5
12-125609551-C-T p.Ser10Phe missense AACS 310 83334 0.00371997 41667 1 0.0181269
12-125609557-G-C p.Trp12Ser missense AACS 1 83322 1.20016E-5 41661 0 NA
12-125609560-C-T p.Ala13Val missense AACS 1 83312 1.20031E-5 41656 0 NA
12-125609569-A-C p.Gln16Pro missense+splice_region AACS 10 83248 1.20123E-4 41624 0 0.00126105
12-125609571-G-GAGGCACCGACA p.Met257fs frameshift AACS 1 83230 1.20149E-5 41615 0 NA
12-125609576-G-A p.Ala258Thr missense AACS 11 83078 1.32406E-4 41539 0 1.91217E-4
12-125609581-G-A p.Pro259Pro splice_region+synonymous AACS 7 82990 8.43475E-5 41495 0 1.43426E-4
12-125610765-C-T c.-1968C>T 5_prime_UTR_premature_start_codon_gain AACS 9 132 0.0681818 66 3 0.00736372
12-125611271-G-T c.-1462G>T 5_prime_UTR_premature_start_codon_gain AACS 8 30 0.266667 15 2 0.357358
12-125611723-C-T c.-1010C>T 5_prime_UTR_premature_start_codon_gain AACS 2 146 0.0136986 73 1 0.00187617
12-125611759-G-T c.-974G>T 5_prime_UTR_premature_start_codon_gain AACS 2 152 0.0131579 76 0 0.00317491
12-125612484-C-T c.-249C>T 5_prime_UTR_premature_start_codon_gain AACS 2 21522 9.29282E-5 10761 0 NA
12-125612510-G-T c.-223G>T 5_prime_UTR_premature_start_codon_gain AACS 1 34502 2.89838E-5 17251 0 NA
12-125612628-T-G c.-105T>G 5_prime_UTR_premature_start_codon_gain AACS 1 78668 1.27116E-5 39334 0 NA
12-125612697-T-C c.-36T>C 5_prime_UTR_premature_start_codon_gain AACS 14 82872 1.68935E-4 41436 0 8.59927E-4
12-125612714-C-T p.Pro19Leu missense AACS 12 83028 1.4453E-4 41514 0 6.87947E-5
12-125612715-G-A p.Asp440Asn missense AACS 2 83050 2.40819E-5 41525 0 3.18552E-5
12-125612718-A-G p.Ile441Val missense AACS 1 83098 1.2034E-5 41549 0 8.50919E-6
12-125612721-A-G p.Ile442Val missense AACS 1 83120 1.20308E-5 41560 0 3.99326E-6
12-125612723-C-T p.Ser22Phe missense AACS 3 83128 3.60889E-5 41564 0 1.59226E-4
12-125612734-T-C p.Met1? start_lost AACS 1 83182 1.20218E-5 41591 0 NA
12-125612743-A-T p.Asn449Ile missense AACS 1 83198 1.20195E-5 41599 0 1.66884E-5
12-125612751-C-T p.Leu452Phe missense AACS 1 83220 1.20163E-5 41610 0 3.1872E-5
12-125612758-T-C p.Val454Ala missense AACS 1 83218 1.20166E-5 41609 0 NA
12-125612762-T-C p.Ile35Thr missense AACS 82 83226 9.85269E-4 41613 0 0.00453629
12-125612765-AG-A p.Glu458fs frameshift AACS 1 83236 1.2014E-5 41618 0 3.98241E-6
12-125612781-C-T p.Arg462Trp missense AACS 3 83202 3.60568E-5 41601 0 8.29683E-6
12-125612782-G-A p.Arg462Gln missense AACS 10 83194 1.20201E-4 41597 0 1.27372E-4
12-125612785-A-G p.Asn463Ser missense AACS 1 83202 1.20189E-5 41601 0 8.2949E-5
12-125612797-C-T p.Ala467Val missense AACS 1 83142 1.20276E-5 41571 0 NA
12-125612798-C-T p.Pro47Leu missense AACS 6 83140 7.21674E-5 41570 0 0.0015121
12-125612799-G-T p.Val468Leu missense AACS 4 83146 4.81081E-5 41573 0 7.19539E-5
12-125612806-C-T p.Ala470Val missense AACS 3 83100 3.61011E-5 41550 0 4.99634E-5
12-125612807-G-A p.Arg50His missense AACS 7 83108 8.42278E-5 41554 0 5.99429E-5
12-125612813-C-T p.Thr52Met missense AACS 2 83038 2.40854E-5 41519 0 6.36983E-5
12-125612814-G-A p.Glu473Lys missense AACS 4 83040 4.81696E-5 41520 0 6.36821E-5
12-125612819-A-AGGAAAGGC p.Ala467fs frameshift AACS 1 82950 1.20555E-5 41475 0 NA
12-125612819-A-T p.Glu474Asp missense+splice_region AACS 1 82950 1.20555E-5 41475 0 NA
12-125612821-G-GAAAGGCGGTCTGGGGAGAGAGCGGCGAGC c.1423+1_1423+2insAAAGGCGGTCTGGGGAGAGAGCGGCGAGC splice_donor AACS 1 82946 1.2056E-5 41473 0 NA
12-125613610-G-C c.-349G>C 5_prime_UTR_premature_start_codon_gain AACS 1 29250 3.4188E-5 14625 0 9.55536E-5
12-125613659-C-T c.-300C>T 5_prime_UTR_premature_start_codon_gain AACS 5 49046 1.01945E-4 24523 0 3.18593E-5
12-125613739-G-T c.-220G>T 5_prime_UTR_premature_start_codon_gain AACS 1 73018 1.36953E-5 36509 0 NA
12-125613741-G-A c.-218G>A 5_prime_UTR_premature_start_codon_gain AACS 1 73282 1.36459E-5 36641 0 NA
12-125613749-G-A c.-210G>A 5_prime_UTR_premature_start_codon_gain AACS 1 74740 1.33797E-5 37370 0 NA
12-125613807-A-G c.-152A>G 5_prime_UTR_premature_start_codon_gain AACS 53 81812 6.47827E-4 40906 0 0.00162472
12-125613874-A-G c.1424-7A>G splice_region AACS 4 83114 4.81267E-5 41557 0 8.3932E-6
12-125613877-C-T c.1424-4C>T splice_region AACS 2 83160 2.405E-5 41580 0 NA
12-125613880-G-C c.1424-1G>C splice_acceptor AACS 1 83232 1.20146E-5 41616 0 2.50192E-5
12-125613888-G-A p.Arg57Gln missense AACS 1 83324 1.20013E-5 41662 0 4.14704E-5
12-125613900-G-C p.Glu481Asp missense AACS 1 83356 1.19967E-5 41678 0 3.30382E-5
12-125613902-G-A p.Ser482Asn missense AACS 1 83350 1.19976E-5 41675 0 NA
12-125613903-C-T p.Ala62Val missense AACS 18 83354 2.15946E-4 41677 0 3.11497E-4
12-125613904-G-A p.Gly483Ser missense AACS 4 83356 4.79869E-5 41678 0 3.30136E-5
12-125613906-C-T p.Ala63Val missense AACS 16 83352 1.91957E-4 41676 0 6.60055E-5
12-125613907-G-A p.Glu484Lys missense AACS 6 83372 7.19666E-5 41686 0 4.12432E-5
12-125613913-G-A p.Trp65* stop_gained AACS 1 83378 1.19936E-5 41689 0 7.96819E-6
12-125613917-G-C p.Cys487Ser missense AACS 1 83382 1.1993E-5 41691 0 3.97959E-6
12-125613926-C-T p.Arg70* stop_gained AACS 1 83390 1.19918E-5 41695 0 2.78538E-5
12-125613927-G-A p.Arg70Gln missense AACS 1 83390 1.19918E-5 41695 0 4.77525E-5
12-125613935-G-T p.Cys493Phe missense AACS 1 83402 1.19901E-5 41701 0 NA
12-125613943-A-G p.Thr496Ala missense AACS 2 83404 2.39797E-5 41702 0 NA
12-125613947-A-G p.His497Arg missense AACS 1 83412 1.19887E-5 41706 0 6.37349E-5
12-125613967-G-A p.Gly504Ser missense AACS 4 83394 4.79651E-5 41697 0 8.24103E-6
12-125613974-A-G p.Lys506Arg missense AACS 5 83390 5.99592E-5 41695 0 7.56002E-5
12-125613987-G-A p.Arg10His missense AACS 5 83360 5.99808E-5 41680 0 2.56364E-4
12-125613994-T-C p.Ser513Pro missense AACS 1 83330 1.20005E-5 41665 0 NA
12-125614008-T-TATCTGGGCTCATGGCGACTACTGCAGAATCAACCCCAAGAC c.1549+2_1549+3insATCTGGGCTCATGGCGACTACTGCAGAATCAACCCCAAGAC splice_region AACS 3 83240 3.60404E-5 41620 1 NA
12-125614009-C-T c.1549+3C>T splice_region AACS 6 83214 7.21032E-5 41607 0 7.99994E-6
12-125614014-G-A c.1549+8G>A splice_region AACS 1 83214 1.20172E-5 41607 0 NA
12-125618551-A-G p.Ile518Val missense+splice_region AACS 2 82872 2.41336E-5 41436 0 NA
12-125618565-C-T p.Ala22Val missense AACS 3 82954 3.61646E-5 41477 0 1.2747E-4
12-125618569-T-G p.Tyr524Asp missense AACS 1 82972 1.20523E-5 41486 0 8.28926E-6
12-125618573-G-A p.Cys525Tyr missense AACS 1 82976 1.20517E-5 41488 0 NA
12-125618588-A-C p.Lys530Thr missense AACS 1 82962 1.20537E-5 41481 0 NA
12-125618592-C-T p.Pro31Leu missense AACS 6 82968 7.2317E-5 41484 0 3.18593E-5
12-125618593-G-A p.Gly532Arg missense AACS 1 82958 1.20543E-5 41479 0 3.1854E-5
12-125618614-C-T p.Arg539Trp missense AACS 6 82808 7.24568E-5 41404 0 2.23129E-4
12-125618617-A-AGTGACGGCACCCTCAACCCCAACGG c.1619_1619+1insTGACGGCACCCTCAACCCCAACGGG splice_donor AACS 7 82752 8.45901E-5 41376 2 NA
12-125618618-G-A p.Ser540Asn missense+splice_region AACS 6 82762 7.2497E-5 41381 0 2.79287E-5
12-125619335-T-C c.1620-5T>C splice_region AACS 1 82866 1.20677E-5 41433 0 NA
12-125619336-C-T c.1620-4C>T splice_region AACS 1 82884 1.20651E-5 41442 0 NA
12-125619343-C-T p.Thr41Met missense AACS 23 82920 2.77376E-4 41460 0 1.91339E-4
12-125619346-C-T p.Ala42Val missense AACS 1 82930 1.20584E-5 41465 0 NA
12-125619360-A-G p.Asn547Ser missense AACS 1 83000 1.20482E-5 41500 0 6.3804E-5
12-125619361-C-T p.Thr47Met missense AACS 28 82986 3.37406E-4 41493 0 6.25E-4
12-125619361-C-A p.Asn547Lys missense AACS 6 82986 7.23014E-5 41493 0 4.95311E-5
12-125619362-G-A p.Gly548Arg missense AACS 4 83000 4.81928E-5 41500 0 5.77911E-5
12-125619369-G-A p.Arg550Gln missense AACS 1 83044 1.20418E-5 41522 0 8.25873E-6
12-125619373-C-T p.Ser51Leu missense AACS 1 83046 1.20415E-5 41523 0 3.18857E-5
12-125619382-G-A p.Arg54Gln missense AACS 68 83000 8.19277E-4 41500 0 0.00258291
12-125619395-A-G p.Ile559Val missense AACS 2 82926 2.41179E-5 41463 0 3.19387E-5
12-125619402-C-A c.1678+4C>A splice_region AACS 1 82848 1.20703E-5 41424 0 NA
12-125619403-G-T c.1678+5G>T splice_region AACS 3 82828 3.62196E-5 41414 0 8.30234E-6
12-125621218-C-T p.Phe563Phe synonymous AACS 1 82812 1.20755E-5 41406 0 4.13914E-5
12-125621219-G-A p.Glu564Lys missense AACS 161 82878 0.00194261 41439 3 0.00438322
12-125621219-G-C p.Glu564Gln missense AACS 472 82876 0.00569526 41438 7 0.0110955
12-125621219-G-GGA p.Glu564fs frameshift AACS 1 82884 1.20651E-5 41442 0 NA
12-125621238-T-C p.Leu570Pro missense AACS 1 83166 1.20241E-5 41583 0 3.18613E-5
12-125621245-C-T p.Val572Val synonymous AACS 1 83194 1.20201E-5 41597 0 3.97687E-6
12-125621248-C-G p.Pro573Pro synonymous AACS 2 83202 2.40379E-5 41601 0 3.18654E-5
12-125621249-C-G p.Gln574Glu missense AACS 10 83206 1.20184E-4 41603 0 0.001875
12-125621251-G-C p.Gln574His missense AACS 1 83222 1.20161E-5 41611 0 NA
12-125621254-T-A p.Tyr575* stop_gained AACS 1 83230 1.20149E-5 41615 0 NA
12-125621263-CA-C p.Arg579fs frameshift AACS 1 83252 1.20117E-5 41626 0 NA
12-125621280-T-G p.Ile584Ser missense AACS 3 83238 3.60412E-5 41619 0 2.47268E-5
12-125621281-C-T p.Ile584Ile synonymous AACS 1 83244 1.20129E-5 41622 0 NA
12-125621283-T-A p.Leu585His missense AACS 2 83242 2.40263E-5 41621 0 NA
12-125621284-C-T n.480C>T splice_region AACS 2 83236 2.40281E-5 41618 0 1.97804E-4
12-125621284-C-A n.480C>A splice_region AACS 1 83234 1.20143E-5 41617 0 8.24185E-6
12-125621291-A-G p.Lys588Glu missense AACS 1 83244 1.20129E-5 41622 0 NA
12-125621299-C-T p.Ala590Ala synonymous AACS 1 83252 1.20117E-5 41626 0 3.18573E-5
12-125621302-C-T p.Ser591Ser synonymous AACS 2 83242 2.40263E-5 41621 0 8.24348E-5
12-125621303-G-A p.Gly592Arg missense AACS 3 83244 3.60386E-5 41622 0 2.47292E-5
12-125621308-C-T p.His593His synonymous AACS 9 83254 1.08103E-4 41627 0 3.18451E-4
12-125621317-G-T p.Gln596His missense AACS 1 83254 1.20114E-5 41627 0 NA
12-125621319-C-T p.Pro597Leu missense AACS 2 83246 2.40252E-5 41623 0 8.24525E-6
12-125621339-C-T p.Arg159Cys missense+splice_region AACS 1 83188 1.2021E-5 41594 0 1.65019E-5
12-125621341-T-C p.Arg159Arg splice_region+synonymous AACS 1 83184 1.20215E-5 41592 0 9.55657E-5
12-125621344-C-T p.Asp605Asp synonymous AACS 4 83140 4.81116E-5 41570 0 1.15544E-4
12-125621352-G-A p.Arg608His missense AACS 1 83054 1.20404E-5 41527 0 1.6512E-5
12-125621358-G-A p.Gly610Asp missense AACS 14 82942 1.68793E-4 41471 0 5.03525E-4
12-125621364-C-T p.Ser612Phe missense AACS 8 82874 9.65321E-5 41437 0 5.03525E-4
12-125621368-G-A p.Ala613Ala synonymous AACS 7 82666 8.46781E-5 41333 0 6.37227E-5
12-125621370-G-A p.Arg614Gln missense AACS 1 82606 1.21057E-5 41303 0 8.26993E-6
12-125621373-A-G p.His615Arg missense AACS 2 82516 2.42377E-5 41258 0 NA
12-125621374-C-T p.His615His synonymous AACS 56 82490 6.7887E-4 41245 1 0.00105129
12-125621375-G-A p.Val616Met missense AACS 6 82434 7.27855E-5 41217 0 6.37227E-5
12-125621378-C-T p.Pro617Ser missense AACS 1 82398 1.21362E-5 41199 0 NA
12-125621386-C-T p.Leu619Leu synonymous AACS 1 82054 1.21871E-5 41027 0 8.2813E-6
12-125621397-C-T p.Thr623Ile missense AACS 2 81514 2.45357E-5 40757 0 6.64077E-5
12-125621400-A-G p.Lys624Arg missense AACS 1 81358 1.22914E-5 40679 0 3.18634E-5
12-125621401-G-A p.Lys624Lys synonymous AACS 2 81392 2.45724E-5 40696 0 4.01323E-6
12-125621408-C-T p.Pro627Ser missense+splice_region AACS 4 80884 4.94535E-5 40442 0 4.43488E-5
12-125621409-C-A p.Pro627Gln missense+splice_region AACS 2 80654 2.47973E-5 40327 0 NA
12-125621410-G-A p.Pro627Pro splice_region+synonymous AACS 3 80632 3.72061E-5 40316 0 4.03418E-6
12-125621415-G-C c.1881+5G>C splice_region AACS 3 80254 3.73813E-5 40127 0 3.18634E-5
12-125621417-CCA-TCG c.1881+7_1881+9delCCAinsTCG splice_region AACS 1 80032 1.2495E-5 40016 0 NA
12-125621418-CA-GG c.1881+8_1881+9delCAinsGG splice_region AACS 476 79946 0.00595402 39973 5 NA
12-125621418-C-G c.1881+8C>G splice_region AACS 271 79932 0.00339038 39966 11 0.013125
12-125626633-C-T c.1679-5C>T splice_region AACS 5 83202 6.00947E-5 41601 0 2.38827E-5
12-125626634-G-A c.1679-4G>A splice_region AACS 1 83220 1.20163E-5 41610 0 8.24334E-6
12-125626642-C-T p.Thr629Met missense AACS 4 83304 4.80169E-5 41652 0 6.37592E-5
12-125626649-C-T p.Arg564Trp missense AACS 3 83322 3.60049E-5 41661 0 4.37424E-5
12-125626650-G-A p.Arg564Gln missense AACS 2 83324 2.40027E-5 41662 0 0.00151057
12-125626656-A-G p.Glu566Gly missense AACS 1 83350 1.19976E-5 41675 0 3.97652E-6
12-125626658-A-G p.Ser567Gly missense AACS 1 83354 1.1997E-5 41677 0 NA
12-125626658-A-C p.Ser567Arg missense AACS 3 83354 3.59911E-5 41677 0 NA
12-125626670-C-T p.Arg571Cys missense AACS 20 83378 2.39871E-4 41689 0 5.03525E-4
12-125626682-C-A p.His575Asn missense AACS 1 83388 1.19921E-5 41694 0 6.25E-4
12-125626685-C-T p.Arg576Cys missense AACS 3355 83338 0.0402577 41669 130 0.0901309
12-125626709-A-G p.Arg584Gly missense AACS 1 83378 1.19936E-5 41689 0 NA
12-125626720-C-T p.Ser655Leu missense AACS 27 83374 3.23842E-4 41687 0 9.23685E-4
12-125626721-G-A p.Glu588Lys missense AACS 49 83372 5.87727E-4 41686 0 0.00100705
12-125626725-C-T p.Pro589Leu missense AACS 5 83366 5.99765E-5 41683 0 6.37186E-5
12-125626728-G-A p.Arg590Gln missense AACS 7 83368 8.39651E-5 41684 0 1.07079E-4
12-125626746-C-T p.Pro596Leu missense AACS 1 83352 1.19973E-5 41676 0 1.15329E-4
12-125626747-G-A p.Arg664Gln missense AACS 5 83352 5.99866E-5 41676 0 9.55779E-5
12-125626749-G-A p.Gly597Glu missense AACS 4 83358 4.79858E-5 41679 0 NA
12-125626763-G-T p.Leu669Leu synonymous AACS 1 83344 1.19985E-5 41672 0 8.2409E-6
12-125626774-G-C p.Ter673Serext*? stop_lost AACS 7 83334 8.39993E-5 41667 0 1.19456E-5
12-125627861-C-T c.*1102C>T splice_region AACS 1 3078 3.24886E-4 1539 0 1.27413E-4