Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
12-53701221-GAAAAGACAGACTGGTAACTGAGTGGAA-G c.*25_*51delTTCCACTCAGTTACCAGTCTGTCTTTT splice_region AAAS 1 80682 1.23943E-5 40341 0 NA
12-53701241-G-A c.*32C>T splice_region AAAS 146 81080 0.00180069 40540 0 0.00741254
12-53701244-TGGAAAACAAAA-T c.*18_*28delTTTTGTTTTCC splice_region AAAS 2 81114 2.46567E-5 40557 0 NA
12-53701245-G-A c.*28C>T splice_region AAAS 2 81198 2.46311E-5 40599 0 4.57528E-6
12-53701297-G-A p.Pro351Leu missense AAAS 1 82752 1.20843E-5 41376 0 NA
12-53701298-G-A p.Pro539Leu missense AAAS 3 82770 3.6245E-5 41385 0 1.19948E-5
12-53701317-C-T p.Gly533Arg missense AAAS 299 82900 0.00360676 41450 4 0.00697763
12-53701332-A-C p.Trp528Gly missense AAAS 1 83030 1.20438E-5 41515 0 8.27431E-5
12-53701333-A-G p.Leu339Pro missense AAAS 1 83046 1.20415E-5 41523 0 3.30983E-5
12-53701334-G-A p.Pro527Leu missense AAAS 1 83054 1.20404E-5 41527 0 8.27321E-6
12-53701339-A-C p.Leu337Arg missense AAAS 2 83066 2.40772E-5 41533 0 NA
12-53701348-G-A p.Pro334Leu missense AAAS 2 83144 2.40547E-5 41572 0 NA
12-53701352-G-T p.Thr521Lys missense AAAS 1 83142 1.20276E-5 41571 0 8.26569E-6
12-53701357-A-G p.Leu331Pro missense AAAS 729 83154 0.00876687 41577 22 0.0181337
12-53701368-G-A p.Pro516Ser missense AAAS 1 83206 1.20184E-5 41603 0 NA
12-53701372-G-A p.Thr326Ile missense AAAS 1 83196 1.20198E-5 41598 0 NA
12-53701383-A-G p.Ser511Pro missense AAAS 2 83228 2.40304E-5 41614 0 NA
12-53701384-G-C p.Ala322Gly missense AAAS 1 83222 1.20161E-5 41611 0 8.27308E-6
12-53701385-C-G p.Gly510Ala missense AAAS 1 83218 1.20166E-5 41609 0 NA
12-53701385-C-T p.Gly510Asp missense AAAS 1 83218 1.20166E-5 41609 0 3.98222E-6
12-53701389-C-T p.Gly509Arg missense AAAS 2 83244 2.40258E-5 41622 0 NA
12-53701397-G-C p.Ala506Gly missense AAAS 18 83234 2.16258E-4 41617 1 6.25E-4
12-53701399-A-G p.Leu317Pro missense AAAS 301 83222 0.00361683 41611 4 0.00707006
12-53701403-G-T p.Pro504His missense AAAS 2 83254 2.40229E-5 41627 0 NA
12-53701404-G-T p.Pro504Thr missense AAAS 1 83260 1.20106E-5 41630 0 NA
12-53701406-T-C p.Glu503Gly missense AAAS 1 83258 1.20109E-5 41629 0 NA
12-53701409-T-C p.Gln502Arg missense AAAS 3 83274 3.60256E-5 41637 0 NA
12-53701416-GC-G p.Arg500fs frameshift AAAS 1 83270 1.20091E-5 41635 0 3.18512E-5
12-53701419-C-G p.Gly499Arg missense AAAS 11 83284 1.32078E-4 41642 0 NA
12-53701431-TAAAACGTGGA-T p.Phe491fs frameshift AAAS 2 83298 2.40102E-5 41649 0 3.18654E-5
12-53701436-C-T p.Arg493His missense AAAS 2 83306 2.40079E-5 41653 0 1.66055E-5
12-53701437-G-A p.Arg493Cys missense AAAS 1 83304 1.20042E-5 41652 0 6.36821E-5
12-53701465-C-T p.Arg295His missense AAAS 2 83288 2.40131E-5 41644 0 1.66257E-5
12-53701466-G-A p.Pro483Leu missense AAAS 1 83298 1.20051E-5 41649 0 3.1837E-5
12-53701471-G-A p.Thr293Ile missense AAAS 1 83294 1.20057E-5 41647 0 NA
12-53701481-C-A p.Glu290* stop_gained AAAS 2 83270 2.40183E-5 41635 0 1.19905E-5
12-53701486-T-C p.Gln288Arg missense AAAS 14 83250 1.68168E-4 41625 0 1.39879E-4
12-53701621-G-A c.1416+8C>T splice_region AAAS 22 83206 2.64404E-4 41603 0 3.58178E-4
12-53701634-T-A p.Ser471Cys missense AAAS 1 83258 1.20109E-5 41629 0 8.25205E-6
12-53701641-G-A p.Ala468Ala synonymous AAAS 2 83276 2.40165E-5 41638 0 3.97823E-6
12-53701643-C-G p.Ala468Pro missense AAAS 1 83286 1.20068E-5 41643 0 NA
12-53701653-G-A p.Phe464Phe synonymous AAAS 1 83296 1.20054E-5 41648 0 8.24906E-6
12-53701660-G-A p.Pro462Leu missense AAAS 2 83308 2.40073E-5 41654 0 3.18431E-5
12-53701670-T-C p.Thr459Ala missense AAAS 3 83320 3.60058E-5 41660 0 1.91192E-4
12-53701693-G-A p.Pro451Leu missense AAAS 1 83344 1.19985E-5 41672 0 NA
12-53701695-C-G p.Glu450Asp missense AAAS 1 83340 1.1999E-5 41670 0 2.38631E-5
12-53701713-ACTAGAAGAAAAGGTGAGCAGGCAACCGGAGGCAAGAAGGGAGCTGAATGTAGTGGGATGTGGGTTTGTTTGTGCAGGAAGGCTGGTGAGAAGTCCAGACCTAAGGGCCCACATGGCACTTAC-A c.1331+1_1332-1del splice_acceptor AAAS 5 83332 6.0001E-5 41666 0 NA
12-53701717-G-C c.1332-4C>G splice_region AAAS 1 83338 1.19993E-5 41669 0 8.2409E-6
12-53701835-C-T c.1331+1G>A splice_donor AAAS 9 83304 1.08038E-4 41652 0 5.76663E-5
12-53701835-C-G c.1331+1G>C splice_donor AAAS 1 83304 1.20042E-5 41652 0 8.23805E-6
12-53701836-C-A p.Cys444Phe missense+splice_region AAAS 1 83306 1.20039E-5 41653 0 NA
12-53701840-G-GA p.Pro443fs frameshift AAAS 1 83310 1.20034E-5 41655 0 NA
12-53701848-T-A p.Glu440Val missense AAAS 1 83310 1.20034E-5 41655 0 8.23818E-6
12-53701854-A-G p.Val438Ala missense AAAS 1 83326 1.20011E-5 41663 0 8.23805E-6
12-53701856-A-G p.Pro437Pro synonymous AAAS 7 83326 8.40074E-5 41663 0 1.59286E-4
12-53701857-G-C p.Pro437Arg missense AAAS 1 83322 1.20016E-5 41661 0 2.47141E-5
12-53701858-G-A p.Pro437Ser missense AAAS 3 83322 3.60049E-5 41661 0 8.23805E-6
12-53701865-T-G p.Arg434Arg synonymous AAAS 1 83312 1.20031E-5 41656 0 3.97652E-6
12-53701866-C-T p.Arg434Gln missense AAAS 87 83320 0.00104417 41660 0 7.03872E-4
12-53701871-G-A p.Arg432Arg synonymous AAAS 5 83322 6.00082E-5 41661 0 5.03525E-4
12-53701872-C-T p.Arg432His missense AAAS 5 83316 6.00125E-5 41658 0 4.77202E-5
12-53701873-G-A p.Arg432Cys missense AAAS 1 83334 1.19999E-5 41667 0 1.64769E-5
12-53701891-G-A p.Pro426Ser missense AAAS 1 83344 1.19985E-5 41672 0 NA
12-53701900-C-T p.Asp423Asn missense AAAS 2 83350 2.39952E-5 41675 0 NA
12-53701919-T-TTTCATAAGCACAGCCAGAC c.1250-3_1250-2insGTCTGGCTGTGCTTATGAA splice_region AAAS 1 83338 1.19993E-5 41669 0 NA
12-53701919-T-TTTC c.1250-3_1250-2insGAA splice_region AAAS 2 83336 2.39992E-5 41668 0 NA
12-53701919-T-TTTCATAAGCACAGCCAGACGTTCCCCACTGGGGTCCCAGACCATGGA c.1250-3_1250-2insTCCATGGTCTGGGACCCCAGTGGGGAACGTCTGGCTGTGCTTATGAA splice_region AAAS 2 83338 2.39987E-5 41669 1 NA
12-53702058-C-T c.1249+8G>A splice_region AAAS 63 83348 7.55867E-4 41674 0 0.00143458
12-53702061-CTC-GTT c.1249+3_1249+5delGAGinsAAC splice_region AAAS 2 83356 2.39935E-5 41678 0 NA
12-53702061-C-G c.1249+5G>C splice_region AAAS 1 83356 1.19967E-5 41678 0 NA
12-53702063-C-T c.1249+3G>A splice_region AAAS 1 83354 1.1997E-5 41677 0 NA
12-53702071-A-G p.Met415Thr missense AAAS 13 83364 1.55943E-4 41682 0 1.91266E-4
12-53702081-C-T p.Ala412Thr missense AAAS 6 83386 7.19545E-5 41693 0 1.27478E-4
12-53702087-G-A p.Arg410Cys missense AAAS 1 83386 1.19924E-5 41693 0 5.96497E-5
12-53702098-G-A p.Pro406Leu missense AAAS 1 83380 1.19933E-5 41690 0 3.97662E-6
12-53702112-G-C p.Ser401Ser synonymous AAAS 1 83394 1.19913E-5 41697 0 5.03525E-4
12-53702123-C-CT p.Glu398fs frameshift AAAS 1 83392 1.19916E-5 41696 0 4.37452E-5
12-53702126-C-T p.Gly397Arg missense AAAS 5 83390 5.99592E-5 41695 0 3.29468E-5
12-53702126-C-A p.Gly397* stop_gained AAAS 1 83390 1.19918E-5 41695 0 NA
12-53702128-C-G p.Gly396Ala missense AAAS 1 83384 1.19927E-5 41692 0 3.97703E-6
12-53702129-C-T p.Gly396Arg missense AAAS 1 83392 1.19916E-5 41696 0 3.18715E-5
12-53702131-A-G p.Leu395Pro missense+splice_region AAAS 2 83386 2.39848E-5 41693 0 4.11828E-5
12-53702132-GCCTGTGGGTAAGGACAGGTTAGGAGAGTTTCAGTGTGGTCCCTCCCACCTGCTTTTCACTGCCACTCCCTCAACCACTCAGCTCA-G p.Arg394fs frameshift AAAS 8 83376 9.59509E-5 41688 2 NA
12-53702133-C-T p.Arg394Arg splice_region+synonymous AAAS 1 83384 1.19927E-5 41692 0 NA
12-53702217-ACCTCT-A p.Glu393fs frameshift AAAS 1 83364 1.19956E-5 41682 0 NA
12-53702220-TCTC-T p.Glu393del conservative_inframe_deletion AAAS 1 83384 1.19927E-5 41692 0 3.9764E-6
12-53702241-G-A p.Gln387* stop_gained AAAS 1 83384 1.19927E-5 41692 0 8.23642E-6
12-53702242-T-C p.Ile386Met missense AAAS 1 83382 1.1993E-5 41691 0 3.97627E-6
12-53702243-ATTG-A p.Thr385del disruptive_inframe_deletion AAAS 7 83380 8.3953E-5 41690 0 2.47093E-5
12-53702252-TCAGA-T p.Ser382fs frameshift AAAS 1 83384 1.19927E-5 41692 0 3.18695E-5
12-53702258-A-C p.Leu381Arg missense AAAS 1 83380 1.19933E-5 41690 0 7.95254E-6
12-53702269-A-G p.Ile377Ile synonymous AAAS 1 83372 1.19944E-5 41686 0 3.97627E-6
12-53702278-T-A p.Ser374Ser synonymous AAAS 1 83372 1.19944E-5 41686 0 NA
12-53702286-C-T p.Ala372Thr missense AAAS 3 83362 3.59876E-5 41681 0 NA
12-53702287-A-C p.Gly371Gly synonymous AAAS 2 83364 2.39912E-5 41682 0 1.27248E-4
12-53702295-C-T p.Val369Ile missense AAAS 5 83356 5.99837E-5 41678 0 4.77228E-5
12-53702296-G-A p.Cys368Cys synonymous AAAS 22 83332 2.64004E-4 41666 0 4.46087E-4
12-53702303-T-C p.Lys366Arg missense AAAS 2 83322 2.40033E-5 41661 0 3.97697E-6
12-53702318-G-T c.1088-6C>A splice_region AAAS 4 83218 4.80665E-5 41609 0 6.3743E-5
12-53702505-TCAC-T c.1087+1_1087+3delGTG splice_donor AAAS 1 83362 1.19959E-5 41681 0 NA
12-53702514-C-T p.Arg361His missense AAAS 6 83372 7.19666E-5 41686 0 0.0025
12-53702515-G-A p.Arg361Cys missense AAAS 2 83374 2.39883E-5 41687 0 3.18431E-5
12-53702516-T-G p.Glu360Asp missense AAAS 4 83374 4.79766E-5 41687 0 1.75032E-4
12-53702520-G-T p.Pro359Gln missense AAAS 2 83368 2.399E-5 41684 0 NA
12-53702526-G-A p.Ser357Phe missense AAAS 29 83370 3.47847E-4 41685 0 2.02893E-4
12-53702527-A-G p.Ser357Pro missense AAAS 1 83370 1.19947E-5 41685 0 6.36821E-5
12-53702528-CAG-C p.Leu356fs frameshift AAAS 4 83374 4.79766E-5 41687 0 6.3674E-5
12-53702545-G-A p.Pro351Ser missense AAAS 1 83346 1.19982E-5 41673 0 8.2462E-6
12-53702561-G-A p.Phe345Phe synonymous AAAS 2 83334 2.39998E-5 41667 0 1.2734E-4
12-53702566-G-A p.Leu344Leu synonymous AAAS 2 83334 2.39998E-5 41667 0 NA
12-53702581-C-G p.Asp339His missense AAAS 22 83298 2.64112E-4 41649 0 6.25E-4
12-53702588-C-T p.Trp336* stop_gained AAAS 1 83292 1.2006E-5 41646 0 NA
12-53702599-TCTGGGGTCAGGGAGCAAAAGGCAGGAGAAGGTATGTCTATAGTAGAATGCAGGAGGGAAAGTAGAGGTGGCCAGGTTTGGGAGCATCAGGGGCCCATTGGAATCATCTCCTCCCCAGTGTCTGTGAATCAGAGTCCCCTCTTAC-T c.996+1_997-1del splice_acceptor AAAS 5 83290 6.00312E-5 41645 0 NA
12-53702602-G-A c.997-3C>T splice_region AAAS 1 83284 1.20071E-5 41642 0 NA
12-53702746-G-C p.Gln332Glu missense+splice_region AAAS 1 83370 1.19947E-5 41685 0 3.18573E-5
12-53702751-C-T p.Arg330His missense AAAS 6 83362 7.19752E-5 41681 0 3.18552E-5
12-53702752-G-T p.Arg330Ser missense AAAS 1 83364 1.19956E-5 41682 0 NA
12-53702752-G-A p.Arg330Cys missense AAAS 9 83364 1.0796E-4 41682 1 4.11889E-5
12-53702772-C-T p.Arg323Lys missense AAAS 5 83372 5.99722E-5 41686 0 6.36983E-5
12-53702777-A-G p.Cys321Cys synonymous AAAS 2 83382 2.3986E-5 41691 0 3.18532E-5
12-53702780-A-C p.Thr320Thr synonymous AAAS 2 83376 2.39877E-5 41688 0 NA
12-53702786-C-T p.Met318Ile missense AAAS 1 83380 1.19933E-5 41690 0 8.23737E-6
12-53702788-T-C p.Met318Val missense AAAS 3 83382 3.5979E-5 41691 0 NA
12-53702789-C-G p.Gln317His missense AAAS 1 83382 1.1993E-5 41691 0 NA
12-53702790-T-C p.Gln317Arg missense AAAS 1 83384 1.19927E-5 41692 0 8.23737E-6
12-53702801-G-A p.Val313Val synonymous AAAS 1 83392 1.19916E-5 41696 0 6.25E-4
12-53702802-A-G p.Val313Ala missense+splice_region AAAS 1 83394 1.19913E-5 41697 0 NA
12-53702804-TCTGAGCCAGAGAAAAGCAAATTACAGCTCAGGACCTCTAAGTTCTAAAAGTTGGACCTACCTCCCTTGACAGAGCTTCCAGGAGCTAAGTGCCTTTCTCTAGGTCCTTGCCCTCCCTCCATCCTTGTCCCACTCAC-T c.935+1_936-1del splice_acceptor AAAS 2 83396 2.3982E-5 41698 0 NA
12-53702804-T-TCGAAAGACAG c.936-1_936insCTGTCTTTCG splice_acceptor AAAS 1 83396 1.1991E-5 41698 0 NA
12-53702807-G-A c.936-3C>T splice_region AAAS 1 83376 1.19939E-5 41688 0 NA
12-53702941-C-G p.Arg312Pro missense+splice_region AAAS 1 83386 1.19924E-5 41693 0 3.9764E-6
12-53702941-C-T p.Arg312Gln missense+splice_region AAAS 1 83386 1.19924E-5 41693 0 7.95279E-6
12-53702964-A-G p.Ala304Ala synonymous AAAS 2 83386 2.39848E-5 41693 0 3.9763E-5
12-53702964-A-C p.Ala304Ala synonymous AAAS 4 83386 4.79697E-5 41693 0 7.15734E-5
12-53702973-T-G p.Lys301Asn missense AAAS 1 83382 1.1993E-5 41691 0 8.23818E-6
12-53702981-C-T p.Gly299Ser missense AAAS 2 83370 2.39894E-5 41685 0 2.47145E-5
12-53702982-G-A p.Asp298Asp synonymous AAAS 5 83364 5.99779E-5 41682 0 5.16956E-5
12-53702994-G-A p.Leu294Leu synonymous AAAS 4 83358 4.79858E-5 41679 0 2.96579E-4
12-53703015-T-G p.Gly287Gly synonymous AAAS 1 83288 1.20065E-5 41644 0 NA
12-53703019-C-G p.Arg286Pro missense AAAS 1 83288 1.20065E-5 41644 0 NA
12-53703020-G-A p.Arg286* stop_gained AAAS 1 83280 1.20077E-5 41640 0 4.37473E-5
12-53703021-G-A p.Phe285Phe synonymous AAAS 77115 80216 0.961342 40108 37355 0.994375
12-53703029-G-A p.Pro283Ser missense AAAS 2 83258 2.40217E-5 41629 0 NA
12-53703033-G-C p.Pro281Pro synonymous AAAS 3 83248 3.60369E-5 41624 0 1.32168E-4
12-53703051-T-C p.Ser275Ser synonymous AAAS 1 83144 1.20273E-5 41572 0 6.37389E-5
12-53703057-A-G p.Asp273Asp synonymous AAAS 10 83110 1.20322E-4 41555 0 4.37773E-5
12-53703378-C-T c.810+7G>A splice_region AAAS 2 83062 2.40784E-5 41531 0 8.48536E-6
12-53703382-C-T c.810+3G>A splice_region AAAS 1 83052 1.20406E-5 41526 0 1.20251E-5
12-53703384-C-T c.810+1G>A splice_donor AAAS 3 83084 3.6108E-5 41542 0 4.00872E-6
12-53703387-G-A p.Arg270Trp missense+splice_region AAAS 1 83078 1.20369E-5 41539 0 5.61239E-5
12-53703390-T-C p.Ile269Val missense AAAS 1 83106 1.20328E-5 41553 0 3.18552E-5
12-53703391-A-G p.Ala268Ala synonymous AAAS 1 83110 1.20322E-5 41555 0 4.00885E-6
12-53703403-G-T p.Pro264Pro synonymous AAAS 1 83096 1.20343E-5 41548 0 1.71827E-5
12-53703403-G-A p.Pro264Pro synonymous AAAS 4 83096 4.81371E-5 41548 0 6.87309E-5
12-53703408-A-G p.Ser263Pro missense AAAS 8 83100 9.62696E-5 41550 0 1.59266E-4
12-53703417-G-A p.Leu260Phe missense AAAS 1 83066 1.20386E-5 41533 0 NA
12-53703422-C-T p.Arg258Gln missense AAAS 1 83066 1.20386E-5 41533 0 8.05717E-6
12-53703423-G-A p.Arg258Trp missense AAAS 13 83032 1.56566E-4 41516 0 0.00303644
12-53703426-C-T p.Gly257Arg missense AAAS 1 83064 1.20389E-5 41532 0 NA
12-53703429-C-A p.Gly256Trp missense AAAS 9 83048 1.08371E-4 41524 0 5.06073E-4
12-53703429-C-G p.Gly256Arg missense AAAS 1 83048 1.20412E-5 41524 0 3.18552E-5
12-53703429-C-CA p.Gly256fs frameshift AAAS 1 83048 1.20412E-5 41524 0 NA
12-53703430-A-T p.Ser255Arg missense AAAS 1 83022 1.2045E-5 41511 0 8.74829E-6
12-53703432-T-C p.Ser255Gly missense AAAS 2 83020 2.40906E-5 41510 0 8.76747E-6
12-53703437-G-T p.Ala253Asp missense AAAS 1 83016 1.20459E-5 41508 0 1.20931E-5
12-53703456-C-G p.Val247Leu missense AAAS 2 83070 2.40761E-5 41535 0 NA
12-53703461-G-A p.Thr245Ile missense AAAS 3 83092 3.61046E-5 41546 0 NA
12-53703472-G-A p.His241His synonymous AAAS 2 83104 2.40662E-5 41552 0 6.84678E-5
12-53703474-G-A p.His241Tyr missense AAAS 2 83112 2.40639E-5 41556 0 NA
12-53703478-C-T p.Leu239Leu synonymous AAAS 1 83114 1.20317E-5 41557 0 NA
12-53703480-G-C p.Leu239Val missense AAAS 1 83122 1.20305E-5 41561 0 NA
12-53703509-G-A c.690-4C>T splice_region AAAS 7 83078 8.42582E-5 41539 0 1.45558E-4
12-53703509-G-C c.690-4C>G splice_region AAAS 1 83080 1.20366E-5 41540 0 9.36803E-6
12-53708078-T-C c.689+4A>G splice_region AAAS 10 83262 1.20103E-4 41631 0 0.0025
12-53708079-T-C c.689+3A>G splice_region AAAS 1 83256 1.20111E-5 41628 0 3.18471E-5
12-53708082-C-T p.Arg230Gln missense+splice_region AAAS 2 83270 2.40183E-5 41635 0 8.23873E-6
12-53708083-G-A p.Arg230* stop_gained AAAS 4 83266 4.80388E-5 41633 0 2.47166E-5
12-53708092-A-G p.Leu227Leu synonymous AAAS 378 83254 0.00454032 41627 1 0.01625
12-53708096-G-A p.Thr225Thr synonymous AAAS 1 83268 1.20094E-5 41634 0 8.239E-6
12-53708104-C-G p.Asp223His missense AAAS 1 83264 1.201E-5 41632 0 8.23927E-6
12-53708133-C-G p.Cys213Ser missense AAAS 34 83244 4.08438E-4 41622 0 2.55422E-4
12-53708144-C-T p.Leu209Leu synonymous AAAS 1 83244 1.20129E-5 41622 0 3.97769E-6
12-53708153-G-C p.Ala206Ala synonymous AAAS 1 83222 1.20161E-5 41611 0 NA
12-53708156-A-C p.Ser205Arg missense AAAS 2 83206 2.40367E-5 41603 0 9.88875E-5
12-53708157-C-T p.Ser205Asn missense AAAS 3 83204 3.6056E-5 41602 0 8.24076E-6
12-53708171-G-C p.Ala200Ala synonymous AAAS 1 83184 1.20215E-5 41592 0 3.97766E-6
12-53708172-G-A p.Ala200Val missense AAAS 1 83170 1.20236E-5 41585 0 NA
12-53708180-C-T p.Ala197Ala synonymous AAAS 2 83128 2.40593E-5 41564 0 9.56206E-5
12-53708181-G-A p.Ala197Val missense AAAS 2 83106 2.40657E-5 41553 0 9.55901E-5
12-53708183-C-T p.Val196Val synonymous AAAS 6 83122 7.21831E-5 41561 0 3.29853E-5
12-53708190-C-T p.Arg194Gln missense AAAS 1 83084 1.2036E-5 41542 0 8.24824E-6
12-53708191-G-A p.Arg194* stop_gained AAAS 4 83062 4.81568E-5 41531 0 2.47476E-5
12-53708200-G-A p.Arg191Trp missense AAAS 5 82956 6.02729E-5 41478 0 1.27421E-4
12-53708200-G-C p.Arg191Gly missense AAAS 1 82956 1.20546E-5 41478 0 3.18552E-5
12-53708214-G-C p.Pro186Arg missense AAAS 1 82678 1.20951E-5 41339 0 6.36796E-5
12-53708528-C-A c.545+7G>T splice_region AAAS 1 82740 1.20861E-5 41370 0 3.99581E-6
12-53708535-C-T p.Ser182Asn missense+splice_region AAAS 2 82854 2.41388E-5 41427 0 NA
12-53708553-C-T p.Arg176His missense AAAS 2 82976 2.41034E-5 41488 0 3.18613E-5
12-53708554-G-A p.Arg176Cys missense AAAS 4 82982 4.82032E-5 41491 0 5.03525E-4
12-53708579-T-A n.551A>T splice_region AAAS 1 83082 1.20363E-5 41541 0 NA
12-53708597-G-C p.Pro161Pro synonymous AAAS 3 83054 3.61211E-5 41527 0 8.65531E-6
12-53708616-C-T p.Arg155His missense AAAS 3 83056 3.61202E-5 41528 0 1.99752E-5
12-53708616-C-G p.Arg155Pro missense AAAS 2 83056 2.40801E-5 41528 0 NA
12-53708618-C-T p.Leu154Leu synonymous AAAS 1 83054 1.20404E-5 41527 0 NA
12-53708637-A-ATTT c.447-5_447-4insAAA splice_region AAAS 1 82966 1.20531E-5 41483 0 NA
12-53708638-G-GT c.447-6_447-5insA splice_region AAAS 1 82954 1.20549E-5 41477 0 NA
12-53708886-G-A p.Val146Val synonymous AAAS 1 83208 1.20181E-5 41604 0 NA
12-53708893-G-A p.Ala144Val missense AAAS 2 83208 2.40361E-5 41604 0 1.4717E-4
12-53708903-C-T p.Ala141Thr missense AAAS 2 83148 2.40535E-5 41574 0 1.64826E-5
12-53708904-G-A p.Ile140Ile synonymous AAAS 2 83166 2.40483E-5 41583 0 5.03525E-4
12-53708905-A-T p.Ile140Asn missense AAAS 2 83158 2.40506E-5 41579 0 8.24144E-6
12-53708910-A-G p.Asp138Asp synonymous AAAS 5643 82946 0.0680322 41473 256 0.071638
12-53708915-C-T p.Glu137Lys missense AAAS 3 83080 3.61098E-5 41540 0 1.64853E-5
12-53708916-G-A p.Ser136Ser synonymous AAAS 2 83048 2.40825E-5 41524 0 2.47288E-5
12-53708928-T-C c.400-4A>G splice_region AAAS 2 82968 2.41057E-5 41484 0 NA
12-53709029-A-C n.584T>G splice_region AAAS 3 82320 3.64431E-5 41160 0 1.21108E-5
12-53709120-G-A p.Ser133Phe missense+splice_region AAAS 2 82720 2.41779E-5 41360 0 NA
12-53709121-A-C p.Ser133Ala missense+splice_region AAAS 1 82722 1.20887E-5 41361 0 NA
12-53709122-C-T p.Leu132Leu synonymous AAAS 2 82734 2.41739E-5 41367 0 NA
12-53709131-G-T p.Phe129Leu missense AAAS 3 82788 3.62371E-5 41394 0 3.1837E-5
12-53709141-C-T p.Gly126Glu missense AAAS 1 82842 1.20712E-5 41421 0 NA
12-53709144-T-C p.His125Arg missense AAAS 4 82870 4.82684E-5 41435 0 NA
12-53709153-G-A p.Ser122Phe missense AAAS 1 82922 1.20595E-5 41461 0 3.98632E-6
12-53709156-G-A p.Ala121Val missense AAAS 6 82890 7.23851E-5 41445 0 5.03525E-4
12-53709160-A-G p.Trp120Arg missense AAAS 8 82936 9.64599E-5 41468 0 NA
12-53709162-C-T p.Arg119Gln missense AAAS 1 82922 1.20595E-5 41461 0 0.00101904
12-53709163-G-A p.Arg119* stop_gained AAAS 1 82924 1.20592E-5 41462 0 8.41978E-6
12-53709168-A-G p.Leu117Pro missense AAAS 1 82914 1.20607E-5 41457 0 NA
12-53709175-G-A p.Leu115Leu synonymous AAAS 4 82860 4.82742E-5 41430 0 4.27811E-5
12-53709178-C-T p.Ala114Thr missense AAAS 1 82822 1.20741E-5 41411 0 NA
12-53709184-C-T p.Gly112Ser missense AAAS 2 82748 2.41698E-5 41374 0 2.60647E-5
12-53709185-G-A p.Ser111Ser synonymous AAAS 2 82730 2.4175E-5 41365 0 6.36983E-5
12-53709191-C-T p.Thr109Thr synonymous AAAS 25 82650 3.0248E-4 41325 0 1.08017E-4
12-53709191-C-A p.Thr109Thr synonymous AAAS 4 82650 4.83969E-5 41325 0 0.00100705
12-53709203-C-T p.Glu105Glu synonymous AAAS 1 82434 1.21309E-5 41217 0 NA
12-53709210-A-G p.Val103Ala missense+splice_region AAAS 27 82314 3.28012E-4 41157 0 1.04454E-4
12-53709213-G-T c.308-3C>A splice_region AAAS 1 82262 1.21563E-5 41131 0 NA
12-53709277-G-A n.242-7C>T splice_region AAAS 1 79668 1.25521E-5 39834 0 NA
12-53709336-C-T n.577G>A splice_region AAAS 1 77966 1.28261E-5 38983 0 6.3743E-5
12-53709515-T-C p.Lys8Arg missense AAAS 2 83308 2.40073E-5 41654 0 2.61556E-5
12-53709522-G-A p.Gln6* stop_gained AAAS 1 83308 1.20036E-5 41654 0 3.18961E-5
12-53709540-A-C p.Leu93Arg missense AAAS 1 83306 1.20039E-5 41653 0 3.18532E-5
12-53709544-C-A p.Val92Leu missense AAAS 1 83290 1.20062E-5 41645 0 NA
12-53709548-A-C p.Phe90Leu missense AAAS 22 83274 2.64188E-4 41637 0 4.77737E-4
12-53709553-G-C p.Leu89Val missense AAAS 1 83278 1.2008E-5 41639 0 8.65157E-6
12-53709564-C-T p.Arg85His missense+splice_region AAAS 1 83232 1.20146E-5 41616 0 3.1839E-5
12-53709565-G-A p.Arg85Cys missense+splice_region AAAS 1 83220 1.20163E-5 41610 0 1.59215E-4
12-53709567-C-CAAATGTTGATGCATCTCTTCCACACTTGCTCCCGG c.252-2_252-1insCCGGGAGCAAGTGTGGAAGAGATGCATCAACATTT splice_acceptor AAAS 1 83212 1.20175E-5 41606 0 NA
12-53709568-T-G c.252-2A>C splice_acceptor AAAS 1 83196 1.20198E-5 41598 0 NA
12-53709571-T-C c.252-5A>G splice_region AAAS 1 83188 1.2021E-5 41594 0 2.79651E-5
12-53709574-G-A c.252-8C>T splice_region AAAS 1 83178 1.20224E-5 41589 0 NA
12-53714362-A-C p.Cys80Gly missense AAAS 3 83358 3.59893E-5 41679 0 2.47097E-5
12-53714363-T-A p.Arg79Ser missense AAAS 1 83360 1.19962E-5 41680 0 3.97621E-6
12-53714363-T-C p.Arg79Arg synonymous AAAS 1 83360 1.19962E-5 41680 0 NA
12-53714366-C-T p.Lys78Lys synonymous AAAS 61 83362 7.31748E-4 41681 0 0.00365697
12-53714370-C-G p.Trp77Ser missense AAAS 1 83368 1.1995E-5 41684 0 NA
12-53714383-G-A p.Arg73Trp missense AAAS 1 83396 1.1991E-5 41698 0 3.18532E-5
12-53714388-TG-T p.His71fs frameshift AAAS 2 83404 2.39797E-5 41702 0 9.55779E-5
12-53714400-G-A p.Thr67Ile missense AAAS 2 83404 2.39797E-5 41702 0 NA
12-53714410-C-T p.Gly64Ser missense AAAS 1 83408 1.19893E-5 41704 0 8.23655E-6
12-53714416-C-A p.Asp62Tyr missense AAAS 1 83404 1.19898E-5 41702 0 NA
12-53714430-G-A p.Thr57Ile missense AAAS 1 83406 1.19895E-5 41703 0 8.23669E-6
12-53714431-T-G p.Thr57Pro missense AAAS 1 83402 1.19901E-5 41701 0 NA
12-53714435-TA-T p.Leu55fs frameshift AAAS 1 83400 1.19904E-5 41700 0 NA
12-53714438-G-A p.Pro54Pro synonymous AAAS 1 83398 1.19907E-5 41699 0 7.95254E-6
12-53714444-C-T p.Lys52Lys synonymous AAAS 1 83396 1.1991E-5 41698 0 NA
12-53714456-T-C c.-137A>G 5_prime_UTR_premature_start_codon_gain AAAS 2 83384 2.39854E-5 41692 0 3.18451E-5
12-53714469-T-C p.Asn44Ser missense AAAS 6 83386 7.19545E-5 41693 0 2.86533E-4
12-53714471-G-C p.Ile43Met missense AAAS 6 83372 7.19666E-5 41686 0 3.18471E-5
12-53714480-T-C c.124-4A>G splice_region AAAS 1 83364 1.19956E-5 41682 0 1.19293E-5
12-53715120-T-A c.123+7A>T splice_region AAAS 1 82800 1.20773E-5 41400 0 1.77728E-4
12-53715126-C-A c.123+1G>T splice_donor AAAS 1 82842 1.20712E-5 41421 0 NA
12-53715130-G-A p.Gly40Gly synonymous AAAS 1 82816 1.2075E-5 41408 0 0.00312891
12-53715141-C-CG p.Asp37fs frameshift AAAS 1 82822 1.20741E-5 41411 0 2.52866E-5
12-53715141-C-T p.Asp37Asn missense AAAS 1 82836 1.2072E-5 41418 0 4.21443E-5
12-53715143-G-A p.Pro36Leu missense AAAS 2 82844 2.41418E-5 41422 0 4.00186E-6
12-53715144-G-A p.Pro36Ser missense AAAS 7 82844 8.44962E-5 41422 0 4.3988E-5
12-53715158-T-C p.Tyr31Cys missense AAAS 1 82932 1.20581E-5 41466 0 3.58571E-5
12-53715170-G-A p.Thr27Met missense AAAS 2 83018 2.40912E-5 41509 0 4.98745E-5
12-53715175-C-T p.Leu25Leu synonymous AAAS 1 83056 1.20401E-5 41528 0 1.66044E-5
12-53715180-C-G p.Glu24Gln missense AAAS 1 83102 1.20334E-5 41551 0 NA
12-53715181-G-C p.Asn23Lys missense AAAS 1 83088 1.20354E-5 41544 0 NA
12-53715185-T-C p.Asn22Ser missense AAAS 1 83122 1.20305E-5 41561 0 1.65766E-5
12-53715187-G-C p.His21Gln missense AAAS 27 83130 3.24792E-4 41565 0 0.0025
12-53715191-TCA-T p.Tyr19fs frameshift AAAS 3 83126 3.60898E-5 41563 0 1.59246E-4
12-53715192-C-T p.Glu20Lys missense AAAS 2 83148 2.40535E-5 41574 0 NA
12-53715200-G-A p.Thr17Ile missense AAAS 1 83144 1.20273E-5 41572 0 NA
12-53715207-G-T p.Gln15Lys missense AAAS 11 83152 1.32288E-4 41576 0 2.31704E-4
12-53715222-G-A p.Pro10Ser missense AAAS 1 83128 1.20296E-5 41564 0 NA
12-53715236-C-T p.Gly5Glu missense AAAS 2 83108 2.40651E-5 41554 0 NA
12-53715240-G-C p.Leu4Val missense AAAS 1 83108 1.20325E-5 41554 0 NA
12-53715246-A-C p.Cys2Gly missense AAAS 1 83094 1.20346E-5 41547 0 7.56394E-5
12-53715302-C-G c.-53G>C 5_prime_UTR_premature_start_codon_gain AAAS 1 82460 1.21271E-5 41230 0 NA
12-53715307-C-A c.-58G>T 5_prime_UTR_premature_start_codon_gain AAAS 1 82338 1.21451E-5 41169 0 NA
12-53715315-C-A c.-66G>T 5_prime_UTR_premature_start_codon_gain AAAS 2 82252 2.43155E-5 41126 0 NA
12-53715319-A-G c.-70T>C 5_prime_UTR_premature_start_codon_gain AAAS 136 82198 0.00165454 41099 2 0.00296159
12-53715323-G-A c.-74C>T 5_prime_UTR_premature_start_codon_gain AAAS 1 82178 1.21687E-5 41089 0 NA
12-53715360-A-C c.-111T>G 5_prime_UTR_premature_start_codon_gain AAAS 1 81132 1.23256E-5 40566 0 NA
12-53715379-G-A c.-130C>T 5_prime_UTR_premature_start_codon_gain AAAS 486 80176 0.00606166 40088 1 0.00898604
12-53715380-G-C c.-131C>G 5_prime_UTR_premature_start_codon_gain AAAS 1 80134 1.24791E-5 40067 0 NA
12-53715395-G-C c.-146C>G 5_prime_UTR_premature_start_codon_gain AAAS 1 78996 1.26589E-5 39498 0 NA